>gb|AC102554.7| Mus musculus chromosome 9, clone RP23-159E10, complete sequence
          Length = 197397

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 483   gcaaagttgaatttgaaattc 503
             |||||||||||||||||||||
Sbjct: 54232 gcaaagttgaatttgaaattc 54212

>emb|AL645504.10| Human DNA sequence from clone RP11-90L20 on chromosome 1 Contains the 3'
              end of the NAV1 gene for neuron navigator 1, two novel
              genes and the 5' end of the IPO9 gene for importin 9,
              complete sequence
          Length = 201934

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 169    tttacctgtgtgctgtctgtt 189
              |||||||||||||||||||||
Sbjct: 170715 tttacctgtgtgctgtctgtt 170735

>emb|AJ248288.1|CNSPAX06 Pyrococcus abyssi complete genome; segment 6/6
          Length = 265118

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 481    tggcaaagttgaatttgaaat 501
              |||||||||||||||||||||
Sbjct: 130692 tggcaaagttgaatttgaaat 130672

>gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence
          Length = 3587082

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 113     gacgccggcgcgatctgcgg 132
               ||||||||||||||||||||
Sbjct: 2233704 gacgccggcgcgatctgcgg 2233723

>gb|AC131065.16| Mus musculus chromosome 18, clone RP23-21J21, complete sequence
          Length = 208270

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 453    tttggtgggatgctggggat 472
              ||||||||||||||||||||
Sbjct: 190343 tttggtgggatgctggggat 190362

>gb|AC125735.1| Leishmania major strain Friedlin chromosome 3, complete sequence
          Length = 384518

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 113    gacgccggcgcgatctgcgg 132
              ||||||||||||||||||||
Sbjct: 239500 gacgccggcgcgatctgcgg 239481

>gb|L39096.1|AVIALGEB Azotobacter vinelandii mannuronan C-5-epimerase (algE4), mannuronan
           C-5-epimerase (algE1), mannuronan C-5-epimerase (algE2),
           and mannuronan C-5-epimerase (algE3) genes, complete cds
          Length = 15759

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 369 acgtcaaggatttcggtgca 388
           ||||||||||||||||||||
Sbjct: 300 acgtcaaggatttcggtgca 319

>gb|AY186794.1| Notoplana atomata potassium channel Kv3.2 mRNA, complete cds
          Length = 2261

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 349  ctggatccgcaccttctgtc 368
            ||||||||||||||||||||
Sbjct: 2043 ctggatccgcaccttctgtc 2062

>gb|AC069157.8| Homo sapiens BAC clone RP11-796M18 from 2, complete sequence
          Length = 138029

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 479   gctggcaaagttgaatttga 498
             ||||||||||||||||||||
Sbjct: 53378 gctggcaaagttgaatttga 53359

>gb|AC104607.15| Drosophila melanogaster X BAC RP98-19G9 (Roswell Park Cancer
            Institute Drosophila BAC Library) complete sequence
          Length = 137639

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 486  aagttgaatttgaaattcag 505
            ||||||||||||||||||||
Sbjct: 5291 aagttgaatttgaaattcag 5272

>gb|AC130390.4| Drosophila melanogaster X BAC RP98-21O19 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 184175

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 486    aagttgaatttgaaattcag 505
              ||||||||||||||||||||
Sbjct: 119045 aagttgaatttgaaattcag 119026

>gb|AC151280.3| Mus musculus BAC clone RP24-79H13 from 17, complete sequence
          Length = 214433

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 267   gccacagccacagagaacag 286
             ||||||||||||||||||||
Sbjct: 88688 gccacagccacagagaacag 88669

>gb|AE003448.4| Drosophila melanogaster chromosome X, section 32 of 74 of the complete
              sequence
          Length = 318665

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 486    aagttgaatttgaaattcag 505
              ||||||||||||||||||||
Sbjct: 145934 aagttgaatttgaaattcag 145915

>gb|AC145610.4| Mus musculus BAC clone RP24-281O20 from 18, complete sequence
          Length = 182640

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 453    tttggtgggatgctggggat 472
              ||||||||||||||||||||
Sbjct: 178188 tttggtgggatgctggggat 178169


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,022,717
Number of Sequences: 3902068
Number of extensions: 4022717
Number of successful extensions: 69416
Number of sequences better than 10.0: 14
Number of HSP's better than 10.0 without gapping: 14
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 69348
Number of HSP's gapped (non-prelim): 68
length of query: 567
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 544
effective length of database: 17,143,297,704
effective search space: 9325953950976
effective search space used: 9325953950976
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)