ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bah63f09
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AJ310426.1|HVU310426 Hordeum vulgare mRNA for cathepsin B (c... 920 0.0
2emb|X66012.1|TACATHBA T.aestivum mRNA 1 for cathepsin B (2529) 664 0.0
3emb|X66015.1|TACATHBC T.aestivum mRNA 3 for cathepsin B (2557) 466 e-128
4emb|X66014.1|TACATHBB T.aestivum mRNA 2 for cathepsin B (2077) 196 6e-47
5gb|BT016464.1| Zea mays clone Contig297 mRNA sequence 188 1e-44
6dbj|AK101093.1| Oryza sativa (japonica cultivar-group) cDNA clon... 188 1e-44
7dbj|AK100225.1| Oryza sativa (japonica cultivar-group) cDNA clon... 188 1e-44
8dbj|AK068459.1| Oryza sativa (japonica cultivar-group) cDNA clon... 188 1e-44
9dbj|AK064820.1| Oryza sativa (japonica cultivar-group) cDNA clon... 188 1e-44
10dbj|AK059697.1| Oryza sativa (japonica cultivar-group) cDNA clon... 188 1e-44
11gb|AY916493.1| Oryza sativa (japonica cultivar-group) cathepsin ... 188 1e-44
12emb|X66013.1|TACATHBG T.aestivum gene for cathepsin B (Al16) 92 3e-15
13gb|AC132490.2| Oryza sativa (japonica cultivar-group) chromosome... 88 4e-14
14dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 88 4e-14
15gb|AY112465.1| Zea mays CL31697_1 mRNA sequence 86 2e-13
16gb|DQ492287.1| Nicotiana benthamiana cathepsin B (CathB) mRNA, c... 70 9e-09
17emb|X81995.1|NRCATHB N.rustica mRNA for cathepsin B-like cystein... 70 9e-09
18gb|AY450641.1| Solanum tuberosum cathepsin B-like cysteine prote... 64 6e-07
19gb|AY450638.1| Solanum tuberosum clone plbr2 cathepsin B-like cy... 64 6e-07
20gb|BT014624.1| Lycopersicon esculentum clone 134127R, mRNA sequence 56 1e-04
21ref|XM_849967.1| PREDICTED: Canis familiaris similar to Cathepsi... 56 1e-04
22emb|AJ251535.1|PSA251535 Pisum sativum partial mRNA for putative... 52 0.002
23emb|AJ251534.1|PSA251534 Pisum sativum partial mRNA for putative... 52 0.002
24dbj|D16823.1|SPESPCB S.peregrina mRNA for cathepsin B, complete cds 50 0.009
25ref|XM_513780.1| PREDICTED: Pan troglodytes LOC457278 (LOC457278... 48 0.035
26gb|BC016058.1| Homo sapiens cathepsin K (pycnodysostosis), mRNA ... 48 0.035
27ref|NM_000396.2| Homo sapiens cathepsin K (pycnodysostosis) (CTS... 48 0.035
28ref|NM_001032812.1| Macaca mulatta cathepsin K (CTSK), mRNA 48 0.035
29ref|XM_969178.1| PREDICTED: Tribolium castaneum similar to cathe... 48 0.035
30emb|X82153.1|HSOC2RNA H.sapiens mRNA for cathepsin O 48 0.035
31emb|CR541719.1| Homo sapiens full open reading frame cDNA clone ... 48 0.035
32emb|CR541675.1| Homo sapiens full open reading frame cDNA clone ... 48 0.035
33emb|X66116.1|TAPCATHB T.aestivum promoter sequence of cathepsin ... 48 0.035
34emb|CR626559.1| full-length cDNA clone CS0DI024YJ12 of Placenta ... 48 0.035
35emb|CR626142.1| full-length cDNA clone CS0DN002YD24 of Adult bra... 48 0.035
36emb|CR624019.1| full-length cDNA clone CS0DN002YH21 of Adult bra... 48 0.035
37emb|CR614321.1| full-length cDNA clone CS0DI069YM12 of Placenta ... 48 0.035
38emb|CR612623.1| full-length cDNA clone CS0DI018YG15 of Placenta ... 48 0.035
39emb|CR612492.1| full-length cDNA clone CS0DI033YH19 of Placenta ... 48 0.035
40emb|CR606929.1| full-length cDNA clone CS0DN002YF20 of Adult bra... 48 0.035
41emb|CR601270.1| full-length cDNA clone CS0DE008YM10 of Placenta ... 48 0.035
42emb|CR598542.1| full-length cDNA clone CS0DN002YO18 of Adult bra... 48 0.035
43emb|CR594213.1| full-length cDNA clone CS0DI009YN05 of Placenta ... 48 0.035
44gb|AF359422.1| Nicotiana tabacum cathepsin B-like cysteine prote... 48 0.035
45gb|S79895.1| OC2=cathepsin O2 [human, spleen, mRNA, 1482 nt] 48 0.035
46gb|AF283476.1|AF283476 Ipomoea batatas cathepsin B-like cysteine... 48 0.035
47gb|AY892942.1| Synthetic construct Homo sapiens clone FLH135296.... 48 0.035
48gb|AY892941.1| Synthetic construct Homo sapiens clone FLH135294.... 48 0.035
49gb|AF101239.1|AF101239 Ipomoea batatas cathepsin B-like cysteine... 48 0.035
50dbj|AK130134.1| Homo sapiens cDNA FLJ26624 fis, clone MPC03724, ... 48 0.035
51gb|AY893612.1| Synthetic construct Homo sapiens clone FLH131032.... 48 0.035
52gb|AF124092.1|AF124092 Macaca mulatta cathepsin K mRNA, complete... 48 0.035
53gb|AF070927.1|AF070927 Macaca fascicularis cathepsin K mRNA, com... 48 0.035
54gb|U20280.1|HSU20280 Human cathepsin X mRNA, complete cds 48 0.035
55gb|U13665.1|HSU13665 Human cathepsin O (CTSO) mRNA, complete cds 48 0.035
56ref|NM_001034435.1| Bos taurus cathepsin K preproprotein (CTSK),... 46 0.14
57ref|NM_001033996.1| Canis familiaris cathepsin K (pycnodysostosi... 46 0.14
58gb|AY738221.1| Canis familiaris cathepsin K mRNA, complete cds 46 0.14
59emb|AL355860.12| Human DNA sequence from clone RP11-235D19 on ch... 46 0.14
60ref|XM_961570.1| PREDICTED: Tribolium castaneum similar to cathe... 46 0.14
61gb|BC109853.1| Bos taurus cathepsin K preproprotein, mRNA (cDNA ... 46 0.14
62gb|AC149038.2| Medicago truncatula chromosome 7 BAC clone mth2-2... 46 0.14
63gb|AF292030.1|AF292030 Sus scrofa cathepsin K precursor (CTSK) m... 46 0.14
64ref|NM_214302.1| Sus scrofa cathepsin K precursor (CTSK), mRNA 46 0.14
65gb|BT021052.1| Bos taurus cathepsin K (pycnodysostosis) (CTSK), ... 46 0.14
66gb|AY609962.1| Sus scrofa clone Clu_4871.scr.msk.p1.Contig1, mRN... 46 0.14
67gb|AE014825.1| Plasmodium falciparum 3D7 chromosome 14 section 1... 44 0.54
68ref|XM_782854.1| PREDICTED: Strongylocentrotus purpuratus simila... 44 0.54
69gb|AY573569.1| Fasciola hepatica strain Firat cathepsin L1 prote... 44 0.54
70gb|AC158233.2| Mus musculus BAC clone RP23-240E15 from chromosom... 44 0.54
71dbj|D14036.1|RABOC2 Oryctolagus cuniculus mRNA for OC-2 protein,... 44 0.54
72gb|M81341.1|PFACYPROT Plasmodium falciparum cysteine proteinase ... 44 0.54
73gb|AY584068.1| Plasmodium vivax vivapain-4 mRNA, complete cds 42 2.1
74ref|NM_100111.1| Arabidopsis thaliana cysteine-type endopeptidas... 42 2.1
75gb|AC115865.9| Mus musculus chromosome 3, clone RP24-314I8, comp... 42 2.1
76emb|AL135793.13| Human DNA sequence from clone RP11-296H2 on chr... 42 2.1
77gb|AC135643.2| Oryza sativa (japonica cultivar-group) chromosome... 42 2.1
78ref|XM_961657.1| PREDICTED: Tribolium castaneum similar to CG109... 42 2.1
79emb|AJ279093.1|FHE279093 Fasciola hepatica partial mRNA for proc... 42 2.1
80emb|AJ279091.1|FHE279091 Fasciola hepatica partial mRNA for proc... 42 2.1
81gb|AF419329.1|AF419329 Fasciola gigantica cathepsin L mRNA, comp... 42 2.1
82gb|AF428337.1|AF428337 Arabidopsis thaliana At1g02300/T6A9_10 mR... 42 2.1
83gb|AY039887.1| Arabidopsis thaliana At1g02300/T6A9_10 mRNA, comp... 42 2.1
84dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 42 2.1
85dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 42 2.1
86emb|BX815386.1|CNS0AAL6 Arabidopsis thaliana Full-length cDNA Co... 42 2.1
87dbj|AP005419.3| Oryza sativa (japonica cultivar-group) genomic D... 42 2.1
88emb|BX842243.1| Homo sapiens chromosome 10 clone RP11-436O19, pa... 42 2.1
89gb|BT002227.1| Arabidopsis thaliana At1g02300/T6A9_10 mRNA, comp... 42 2.1
90dbj|AK066748.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.1
91gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 42 2.1
92gb|AC102108.12| Mus musculus chromosome 3, clone RP23-100J23, co... 42 2.1
93ref|NM_122435.2| Arabidopsis thaliana unknown protein AT5G25260 ... 40 8.5
94ref|XM_520110.1| PREDICTED: Pan troglodytes similar to hypotheti... 40 8.5
95ref|NM_001003115.1| Canis familiaris cathepsin L2 (CTSL2), mRNA 40 8.5
96ref|NM_031560.2| Rattus norvegicus cathepsin K (Ctsk), mRNA 40 8.5
97gb|AC006259.1| Arabidopsis thaliana BAC F21J6 from chromosome V,... 40 8.5
98gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome 40 8.5
99gb|BC046320.1| Mus musculus cathepsin K, mRNA (cDNA clone MGC:54... 40 8.5
100gb|BC012612.1| Homo sapiens cathepsin L, transcript variant 1, m... 40 8.5
101gb|AC140053.4| Mus musculus BAC clone RP23-258J2 from chromosome... 40 8.5
102ref|NM_001912.2| Homo sapiens cathepsin L (CTSL), transcript var... 40 8.5
103ref|NM_145918.1| Homo sapiens cathepsin L (CTSL), transcript var... 40 8.5
104gb|AC112144.4| Mus musculus BAC clone RP23-32B4 from 19, complet... 40 8.5
105emb|AL109919.18|HSDJ258B3 Human DNA sequence from clone RP1-258B... 40 8.5
106emb|AL035446.4|HS460G2 Human DNA sequence from clone RP3-460G2 o... 40 8.5
107emb|Z22765.1|FHCATHPRC F.hepatica cathepsin L-like protease mRNA... 40 8.5
108emb|Y18462.1|HOS18462 Homo sapiens mRNA for cathepsin L, partial 40 8.5
109emb|X94444.1|MMPPCATHK M.musculus mRNA for preprocathepsin K 40 8.5
110emb|X12451.1|HSCATHL Human mRNA for pro-cathepsin L (major excre... 40 8.5
111emb|CR457053.1| Homo sapiens full open reading frame cDNA clone ... 40 8.5
112emb|BX537395.1|HSM805692 Homo sapiens mRNA; cDNA DKFZp686A18159 ... 40 8.5
113ref|NM_007802.2| Mus musculus cathepsin K (Ctsk), mRNA 40 8.5
114emb|AJ279008.1|CFA279008 Canis familiaris mRNA for cathepsin L (... 40 8.5
115emb|AJ006033.1|MMU6033 Mus musculus ctsk gene 40 8.5
116gb|AC009320.7| Homo sapiens 12 BAC RP11-310I24 (Roswell Park Can... 40 8.5
117emb|BX470140.10| Zebrafish DNA sequence from clone CH211-238E6 i... 40 8.5
118emb|X05256.1|HSCATLR1 Human mRNA fragment for cathepsin L N-term... 40 8.5
119gb|AF453501.1| Actinosynnema pretiosum subsp. auranticum maytans... 40 8.5
120emb|CR626403.1| full-length cDNA clone CS0DI043YP08 of Placenta ... 40 8.5
121emb|CR625678.1| full-length cDNA clone CS0DI021YB15 of Placenta ... 40 8.5
122emb|CR624043.1| full-length cDNA clone CS0DI056YK03 of Placenta ... 40 8.5
123emb|CR624025.1| full-length cDNA clone CS0DI004YP08 of Placenta ... 40 8.5
124emb|CR623879.1| full-length cDNA clone CS0DI003YI03 of Placenta ... 40 8.5
125emb|CR620973.1| full-length cDNA clone CS0DC027YD18 of Neuroblas... 40 8.5
126emb|CR620883.1| full-length cDNA clone CS0DI079YJ10 of Placenta ... 40 8.5
127emb|CR620702.1| full-length cDNA clone CS0DI064YL15 of Placenta ... 40 8.5
128emb|CR620611.1| full-length cDNA clone CL0BA007ZC09 of Placenta ... 40 8.5
129emb|CR619793.1| full-length cDNA clone CS0DC004YH11 of Neuroblas... 40 8.5
130emb|CR618895.1| full-length cDNA clone CS0DI028YJ02 of Placenta ... 40 8.5
131emb|CR619050.1| full-length cDNA clone CS0DE013YN08 of Placenta ... 40 8.5
132emb|CR618528.1| full-length cDNA clone CS0DE010YH08 of Placenta ... 40 8.5
133emb|CR617897.1| full-length cDNA clone CS0DI062YC17 of Placenta ... 40 8.5
134emb|CR616495.1| full-length cDNA clone CS0DI023YP04 of Placenta ... 40 8.5
135emb|CR616359.1| full-length cDNA clone CS0DE012YE21 of Placenta ... 40 8.5
136emb|CR615255.1| full-length cDNA clone CS0DI007YE22 of Placenta ... 40 8.5
137emb|CR614675.1| full-length cDNA clone CS0DE004YN19 of Placenta ... 40 8.5
138emb|CR613528.1| full-length cDNA clone CS0DI053YI24 of Placenta ... 40 8.5
139emb|CR613254.1| full-length cDNA clone CS0DI024YL17 of Placenta ... 40 8.5
140emb|CR612596.1| full-length cDNA clone CS0DI027YN17 of Placenta ... 40 8.5
141emb|CR612043.1| full-length cDNA clone CS0DI083YN04 of Placenta ... 40 8.5
142emb|CR611865.1| full-length cDNA clone CS0DI044YM22 of Placenta ... 40 8.5
143emb|CR610633.1| full-length cDNA clone CS0DI052YG23 of Placenta ... 40 8.5
144emb|CR609955.1| full-length cDNA clone CS0DI043YK10 of Placenta ... 40 8.5
145emb|CR608495.1| full-length cDNA clone CS0DI044YA21 of Placenta ... 40 8.5
146emb|CR608477.1| full-length cDNA clone CS0DI073YL22 of Placenta ... 40 8.5
147emb|CR607586.1| full-length cDNA clone CS0DI052YO05 of Placenta ... 40 8.5
148emb|CR607547.1| full-length cDNA clone CS0DI031YE16 of Placenta ... 40 8.5
149emb|CR607374.1| full-length cDNA clone CS0DI014YJ10 of Placenta ... 40 8.5
150emb|CR607254.1| full-length cDNA clone CS0DM005YG24 of Fetal liv... 40 8.5
151emb|CR606843.1| full-length cDNA clone CS0DI026YP02 of Placenta ... 40 8.5
152emb|CR606674.1| full-length cDNA clone CS0DM013YH08 of Fetal liv... 40 8.5
153emb|CR606260.1| full-length cDNA clone CS0DI076YM01 of Placenta ... 40 8.5
154emb|CR605661.1| full-length cDNA clone CS0DI007YM22 of Placenta ... 40 8.5
155emb|CR605581.1| full-length cDNA clone CS0DM005YE21 of Fetal liv... 40 8.5
156emb|CR604305.1| full-length cDNA clone CS0DI087YM03 of Placenta ... 40 8.5
157emb|CR603807.1| full-length cDNA clone CS0DE006YL09 of Placenta ... 40 8.5
158emb|CR603622.1| full-length cDNA clone CS0DI062YA13 of Placenta ... 40 8.5
159emb|CR602859.1| full-length cDNA clone CS0DE013YG13 of Placenta ... 40 8.5
160emb|CR601498.1| full-length cDNA clone CS0DI063YH21 of Placenta ... 40 8.5
161emb|CR601495.1| full-length cDNA clone CS0DI062YF03 of Placenta ... 40 8.5
162emb|CR601598.1| full-length cDNA clone CS0DI051YJ12 of Placenta ... 40 8.5
163emb|CR600244.1| full-length cDNA clone CS0DI006YE14 of Placenta ... 40 8.5
164dbj|AK075100.1| Homo sapiens cDNA FLJ90619 fis, clone PLACE10023... 40 8.5
165emb|CR599034.1| full-length cDNA clone CS0DK006YK20 of HeLa cell... 40 8.5
166emb|CR596740.1| full-length cDNA clone CS0DI022YG23 of Placenta ... 40 8.5
167emb|CR595891.1| full-length cDNA clone CS0DI012YI01 of Placenta ... 40 8.5
168dbj|AK055599.1| Homo sapiens cDNA FLJ31037 fis, clone HSYRA20001... 40 8.5
169emb|CR595268.1| full-length cDNA clone CS0DI069YC18 of Placenta ... 40 8.5
170emb|CR595008.1| full-length cDNA clone CS0DM001YJ02 of Fetal liv... 40 8.5
171emb|CR594363.1| full-length cDNA clone CS0DI077YM18 of Placenta ... 40 8.5
172emb|CR593015.1| full-length cDNA clone CS0DI026YP10 of Placenta ... 40 8.5
173emb|CR592569.1| full-length cDNA clone CS0DI055YF16 of Placenta ... 40 8.5
174emb|CR591819.1| full-length cDNA clone CS0DI002YE08 of Placenta ... 40 8.5
175emb|CR590723.1| full-length cDNA clone CS0DI025YI04 of Placenta ... 40 8.5
176emb|CR590618.1| full-length cDNA clone CS0DE006YA20 of Placenta ... 40 8.5
177emb|CR590181.1| full-length cDNA clone CS0DI002YD23 of Placenta ... 40 8.5
178emb|CR590033.1| full-length cDNA clone CS0DI014YA03 of Placenta ... 40 8.5
179dbj|AK132648.1| Mus musculus 0 day neonate head cDNA, RIKEN full... 40 8.5
180gb|AE003849.1| Xylella fastidiosa 9a5c, complete genome 40 8.5
181gb|AF239266.1|AF239266 Fasciola gigantica cathepsin L (cat-L1D) ... 40 8.5
182dbj|AK003425.1| Mus musculus 18-day embryo whole body cDNA, RIKE... 40 8.5
183gb|BT023420.1| Arabidopsis thaliana At5g25260 gene, complete cds 40 8.5
184gb|AC108049.5| Homo sapiens BAC clone RP11-325P16 from 2, comple... 40 8.5
185gb|AF201700.1|AF201700 Cercopithecus aethiops cysteine protease ... 40 8.5
186ref|NM_213892.1| Sus scrofa cathepsin L (CTSL2), mRNA 40 8.5
187gb|AY890446.1| Synthetic construct Homo sapiens clone FLH140202.... 40 8.5
188dbj|BS000063.1| Pan troglodytes chromosome 22 clone:PTB-428P03, ... 40 8.5
189emb|BX647435.1|HSM807580 Homo sapiens mRNA; cDNA DKFZp686J08158 ... 40 8.5
190emb|BX647434.1|HSM807579 Homo sapiens mRNA; cDNA DKFZp686B07158 ... 40 8.5
191emb|BX647413.1|HSM807558 Homo sapiens mRNA; cDNA DKFZp686B10158 ... 40 8.5
192gb|AF240629.1|AF240629 Homo sapiens chromosome 21 map 21q21 clon... 40 8.5
193emb|BX649140.1|HSM809292 Homo sapiens mRNA; cDNA DKFZp686L20157 ... 40 8.5
194emb|BX648849.1|HSM809000 Homo sapiens mRNA; cDNA DKFZp686A04157 ... 40 8.5
195emb|BX648848.1|HSM808999 Homo sapiens mRNA; cDNA DKFZp686A03157 ... 40 8.5
196emb|BX647102.1|HSM807246 Homo sapiens mRNA; cDNA DKFZp686F10158 ... 40 8.5
197emb|BX647101.1|HSM807245 Homo sapiens mRNA; cDNA DKFZp686D14158 ... 40 8.5
198emb|AJ303304.1|HEC303304 Hepatitis C virus type 1b partial mRNA ... 40 8.5
199ref|XM_560519.1| Anopheles gambiae str. PEST ENSANGP00000028370 ... 40 8.5
200gb|AY893779.1| Synthetic construct Homo sapiens clone FLH053856.... 40 8.5
201gb|BC078793.1| Rattus norvegicus cathepsin K, mRNA (cDNA clone M... 40 8.5
202gb|U62289.1|FHU62289 Fasciola hepatica secreted cathepsin L 2 (F... 40 8.5
203dbj|AP001679.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 40 8.5
204dbj|AP006199.1| Homo sapiens genomic DNA, chromosome 6, clone:RP... 40 8.5
205dbj|AP006196.1| Homo sapiens genomic DNA, chromosome 6, clone:RP... 40 8.5
206gb|AC092203.16| Mus musculus strain C57BL/6J chromosome 3 clone ... 40 8.5
207gb|AY609853.1| Sus scrofa clone Clu_3550.scr.msk.p1.Contig6, mRN... 40 8.5
208emb|AL832167.1|HSM803474 Homo sapiens mRNA; cDNA DKFZp686K15158 ... 40 8.5
209gb|AF010306.1|AF010306 Rattus norvegicus cathepsin K mRNA, compl... 40 8.5
210emb|AL672267.10| Mouse DNA sequence from clone RP23-377K9 on chr... 40 8.5
211emb|AL844881.5| Mouse DNA sequence from clone RP23-244B19 on chr... 40 8.5
212gb|M20496.1|HUMPROLA Human cathepsin L gene, complete cds 40 8.5
213emb|AL929125.1| Mouse DNA sequence from clone RP23-262O4 on chro... 40 8.5
214dbj|AP000957.2| Homo sapiens genomic DNA, chromosome 21q21.1-q21... 40 8.5
215dbj|AP002529.1| Homo sapiens genomic DNA, chromosome 6q21, anti-... 40 8.5
216dbj|AB041731.1| Homo sapiens genomic DNA, chromosome 6q21, BAC c... 40 8.5
217dbj|AB042031.1| Homo sapiens genomic DNA, chromosome 6q21, BAC c... 40 8.5
218dbj|D37917.1|PIGPCL Boar mRNA for porcine cathepsin L, complete cds 40 8.5

>emb|AJ310426.1|HVU310426 Hordeum vulgare mRNA for cathepsin B (cathB gene)
          Length = 1277

 Score =  920 bits (464), Expect = 0.0
 Identities = 470/472 (99%)
 Strand = Plus / Plus

                                                                       
Query: 150 ccccagctcgccagagcggcagggggaggccattccctaggaatcatccagaaaggcatc 209
           |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 131 ccccagctcgccggagcggcagggggaggccattccctaggaatcatccagaaaggcatc 190

                                                                       
Query: 210 atacagacggtcaacaaccatcccaacgccggatggacggctggacacaacccctacctc 269
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 191 atacagacggtcaacaaccatcccaacgccggatggacggctggacacaacccctacctc 250

                                                                       
Query: 270 gccaattacactattgagcaatttaagcatatgctgggagtgaaaccaacacctccaggt 329
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 251 gccaattacactattgagcaatttaagcatatgctgggagtgaaaccaacacctccaggt 310

                                                                       
Query: 330 ttactggctggtgttcgaaccaaaactcatccaaggtcagagcagctcccaaaggagttc 389
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 311 ttactggctggtgttcgaaccaaaactcatccaaggtcagagcagctcccaaaggagttc 370

                                                                       
Query: 390 gacgccaggtcgaaatggtccggttgcagcacaattgggaaaatacttgatcaaggtcac 449
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 371 gacgccaggtcgaaatggtccggttgcagcacaattgggaaaatacttgatcaaggtcac 430

                                                                       
Query: 450 tgtggttcctgttgggcttttggagctgtggagtgtctgcaagatcgtttctgcatccat 509
           || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 431 tgcggttcctgttgggcttttggagctgtggagtgtctgcaagatcgtttctgcatccat 490

                                                                       
Query: 510 cacaacatgaacatttcactttctgccaatgacctagtggcttgctgtgggtttatgtgt 569
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 491 cacaacatgaacatttcactttctgccaatgacctagtggcttgctgtgggtttatgtgt 550

                                                               
Query: 570 ggtgatggttgtgatggaggatatcctatcagcgcatggcaatacttcgtcc 621
           ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 551 ggtgatggttgtgatggaggatatcctatcagcgcatggcaatacttcgtcc 602



 Score =  165 bits (83), Expect = 2e-37
 Identities = 86/87 (98%)
 Strand = Plus / Plus

                                                                       
Query: 42  gcttgcttcctcctccctcccaccgcgcgtcgccgatcgaggacgaagatggggagcggc 101
           ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 23  gcttgcttcctcctccctcccaccgtgcgtcgccgatcgaggacgaagatggggagcggc 82

                                      
Query: 102 ctgctcccgctggcgctgctcgtcgtc 128
           |||||||||||||||||||||||||||
Sbjct: 83  ctgctcccgctggcgctgctcgtcgtc 109



to top

>emb|X66012.1|TACATHBA T.aestivum mRNA 1 for cathepsin B (2529)
          Length = 1065

 Score =  664 bits (335), Expect = 0.0
 Identities = 395/415 (95%)
 Strand = Plus / Plus

                                                                       
Query: 207 atcatacagacggtcaacaaccatcccaacgccggatggacggctggacacaacccctac 266
           |||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 1   atcatacaaacggtcaacaaccaccccaacgccggatggacggctggacacaacccctac 60

                                                                       
Query: 267 ctcgccaattacactattgagcaatttaagcatatgctgggagtgaaaccaacacctcca 326
           ||||| ||||||||||||||||||||||||||||||||||||||||| ||||| ||||||
Sbjct: 61  ctcgcgaattacactattgagcaatttaagcatatgctgggagtgaagccaacgcctcca 120

                                                                       
Query: 327 ggtttactggctggtgttcgaaccaaaactcatccaaggtcagagcagctcccaaaggag 386
           ||||||| ||||| |||||| |||||||||||| |||| || |||||||||||||||| |
Sbjct: 121 ggtttacgggctgctgttcgcaccaaaactcattcaagatcggagcagctcccaaaggtg 180

                                                                       
Query: 387 ttcgacgccaggtcgaaatggtccggttgcagcacaattgggaaaatacttgatcaaggt 446
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 181 ttcgacgccaggtcgaaatggtccggttgcagcacaattgggaaaatacttgatcaaggt 240

                                                                       
Query: 447 cactgtggttcctgttgggcttttggagctgtggagtgtctgcaagatcgtttctgcatc 506
           |||||||||||||| ||||||||||| || |||||||| |||||||||||||||||||||
Sbjct: 241 cactgtggttcctgctgggcttttggtgccgtggagtgcctgcaagatcgtttctgcatc 300

                                                                       
Query: 507 catcacaacatgaacatttcactttctgccaatgacctagtggcttgctgtgggtttatg 566
           |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 301 catcacaacatgaacattacactttctgccaatgacctagtggcttgctgtgggtttatg 360

                                                                  
Query: 567 tgtggtgatggttgtgatggaggatatcctatcagcgcatggcaatacttcgtcc 621
           ||||| ||||||||||||||||||||||||||||| || ||||||||||||||||
Sbjct: 361 tgtggcgatggttgtgatggaggatatcctatcagtgcgtggcaatacttcgtcc 415



to top

>emb|X66015.1|TACATHBC T.aestivum mRNA 3 for cathepsin B (2557)
          Length = 491

 Score =  466 bits (235), Expect = e-128
 Identities = 286/303 (94%)
 Strand = Plus / Plus

                                                                       
Query: 179 ccattccctaggaatcatccagaaaggcatcatacagacggtcaacaaccatcccaacgc 238
           ||||||||||||||||||||||||||  |||||||| |||||||||||||| ||||||||
Sbjct: 189 ccattccctaggaatcatccagaaagatatcatacaaacggtcaacaaccaccccaacgc 248

                                                                       
Query: 239 cggatggacggctggacacaacccctacctcgccaattacactattgagcaatttaagca 298
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 249 cggatggacggctggacacaacccctacctcgcgaattacactattgagcaatttaagca 308

                                                                       
Query: 299 tatgctgggagtgaaaccaacacctccaggtttactggctggtgttcgaaccaaaactca 358
           ||||||||||||||| ||||| ||||||||||||| ||||| |||||| |||||||||||
Sbjct: 309 tatgctgggagtgaagccaacgcctccaggtttacgggctgctgttcgcaccaaaactca 368

                                                                       
Query: 359 tccaaggtcagagcagctcccaaaggagttcgacgccaggtcgaaatggtccggttgcag 418
           | |||| || |||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 369 ttcaagatcggagcagctcccaaaggtgttcgacgccaggtcgaaatggtccggttgcag 428

                                                                       
Query: 419 cacaattgggaaaatacttgatcaaggtcactgtggttcctgttgggcttttggagctgt 478
           |||||||||||||||||||||||||||||||||||||||||| ||||||||||| || ||
Sbjct: 429 cacaattgggaaaatacttgatcaaggtcactgtggttcctgctgggcttttggtgccgt 488

              
Query: 479 gga 481
           |||
Sbjct: 489 gga 491



to top

>emb|X66014.1|TACATHBB T.aestivum mRNA 2 for cathepsin B (2077)
          Length = 1216

 Score =  196 bits (99), Expect = 6e-47
 Identities = 162/183 (88%)
 Strand = Plus / Plus

                                                                       
Query: 180 cattccctaggaatcatccagaaaggcatcatacagacggtcaacaaccatcccaacgcc 239
           ||||||||||||||||||||||| | |||||| |||||||||||||| |||||||| |||
Sbjct: 152 cattccctaggaatcatccagaaggacatcattcagacggtcaacaagcatcccaatgcc 211

                                                                       
Query: 240 ggatggacggctggacacaacccctacctcgccaattacactattgagcaatttaagcat 299
           || |||||||||||||||||||||||| | || || ||||||||||||||||| ||||||
Sbjct: 212 gggtggacggctggacacaacccctactttgcaaactacactattgagcaattcaagcat 271

                                                                       
Query: 300 atgctgggagtgaaaccaacacctccaggtttactggctggtgttcgaaccaaaactcat 359
           || ||||||||||| ||||| ||||| ||||| || ||||||||||  | ||||| ||||
Sbjct: 272 atcctgggagtgaagccaacgcctccgggtttgctcgctggtgttccgatcaaaattcat 331

              
Query: 360 cca 362
           |||
Sbjct: 332 cca 334



 Score =  188 bits (95), Expect = 1e-44
 Identities = 179/207 (86%)
 Strand = Plus / Plus

                                                                       
Query: 403 aatggtccggttgcagcacaattgggaaaatacttgatcaaggtcactgtggttcctgtt 462
           |||||||| ||||||||||||||||||| |||||||||||||||||||||||| ||||||
Sbjct: 372 aatggtccagttgcagcacaattgggaacatacttgatcaaggtcactgtggtgcctgtt 431

                                                                       
Query: 463 gggcttttggagctgtggagtgtctgcaagatcgtttctgcatccatcacaacatgaaca 522
           |||| ||||  || |||||   ||| || ||||||||||| || |||| |||||||| | 
Sbjct: 432 gggcctttgctgccgtggaagctctccaggatcgtttctgtattcatctcaacatgagcg 491

                                                                       
Query: 523 tttcactttctgccaatgacctagtggcttgctgtgggtttatgtgtggtgatggttgtg 582
           | || ||||| | |||||||||| ||||||||||||| ||| ||||||||   |||||| 
Sbjct: 492 tctccctttcggtcaatgacctactggcttgctgtggttttctgtgtggtagcggttgta 551

                                      
Query: 583 atggaggatatcctatcagcgcatggc 609
           |||||||||||||||||||||||||||
Sbjct: 552 atggaggatatcctatcagcgcatggc 578



to top

>gb|BT016464.1| Zea mays clone Contig297 mRNA sequence
          Length = 1136

 Score =  188 bits (95), Expect = 1e-44
 Identities = 170/195 (87%)
 Strand = Plus / Plus

                                                                       
Query: 404 atggtccggttgcagcacaattgggaaaatacttgatcaaggtcactgtggttcctgttg 463
           ||||||| ||||||||||||||||||| ||||||||||||||||||||||| || |||||
Sbjct: 164 atggtcccgttgcagcacaattgggaacatacttgatcaaggtcactgtggctcttgttg 223

                                                                       
Query: 464 ggcttttggagctgtggagtgtctgcaagatcgtttctgcatccatcacaacatgaacat 523
           ||||||||| ||||||||||| || || || ||||| ||||| || | |||||||| |||
Sbjct: 224 ggcttttggtgctgtggagtgcctccaggaccgtttttgcattcacctcaacatgagcat 283

                                                                       
Query: 524 ttcactttctgccaatgacctagtggcttgctgtgggtttatgtgtggtgatggttgtga 583
           || |||||| | |||||||||| |||| ||||| || |||||||| || ||||| |||||
Sbjct: 284 tttactttcagtcaatgacctactggcatgctgcggttttatgtgcggcgatgggtgtga 343

                          
Query: 584 tggaggatatcctat 598
           |||||| ||||||||
Sbjct: 344 tggaggctatcctat 358



 Score = 40.1 bits (20), Expect = 8.5
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 287 gcaatttaagcatatgctgggagtgaaaccaacacc 322
           |||||||||||| || || |||||||||||| ||||
Sbjct: 47  gcaatttaagcacatacttggagtgaaaccagcacc 82



to top

>dbj|AK101093.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033024N03, full
           insert sequence
          Length = 1437

 Score =  188 bits (95), Expect = 1e-44
 Identities = 167/191 (87%)
 Strand = Plus / Plus

                                                                       
Query: 419 cacaattgggaaaatacttgatcaaggtcactgtggttcctgttgggcttttggagctgt 478
           |||||||||||  ||||||||||| ||||||||||| || |||||||| ||||| |||||
Sbjct: 540 cacaattgggaccatacttgatcagggtcactgtggctcgtgttgggcatttggtgctgt 599

                                                                       
Query: 479 ggagtgtctgcaagatcgtttctgcatccatcacaacatgaacatttcactttctgccaa 538
           ||||||||| || |||||||||||||| |||  ||||||||||||||| || |||| |||
Sbjct: 600 ggagtgtctccaggatcgtttctgcattcatttcaacatgaacatttcgctatctgtcaa 659

                                                                       
Query: 539 tgacctagtggcttgctgtgggtttatgtgtggtgatggttgtgatggaggatatcctat 598
           |||||||||||| ||||| || || ||||| || ||||||||||||||||| ||||||||
Sbjct: 660 tgacctagtggcatgctgcggtttcatgtgcggcgatggttgtgatggaggctatcctat 719

                      
Query: 599 cagcgcatggc 609
           ||  |||||||
Sbjct: 720 catggcatggc 730



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 105/133 (78%)
 Strand = Plus / Plus

                                                                       
Query: 190 gaatcatccagaaaggcatcatacagacggtcaacaaccatcccaacgccggatggacgg 249
           ||||||||||| | | ||||||| || |  ||||||| |||||||| || || |||||||
Sbjct: 311 gaatcatccaggacgacatcataaaggcaatcaacaagcatcccaatgctggctggacgg 370

                                                                       
Query: 250 ctggacacaacccctacctcgccaattacactattgagcaatttaagcatatgctgggag 309
           ||| ||  || || ||| | || || || |||| || |||||| || ||||| || ||||
Sbjct: 371 ctgcacggaatccatactttgcaaactatactactgcgcaattcaaacatatccttggag 430

                        
Query: 310 tgaaaccaacacc 322
           |||| ||||||||
Sbjct: 431 tgaagccaacacc 443



to top

>dbj|AK100225.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023047M19, full
           insert sequence
          Length = 1436

 Score =  188 bits (95), Expect = 1e-44
 Identities = 167/191 (87%)
 Strand = Plus / Plus

                                                                       
Query: 419 cacaattgggaaaatacttgatcaaggtcactgtggttcctgttgggcttttggagctgt 478
           |||||||||||  ||||||||||| ||||||||||| || |||||||| ||||| |||||
Sbjct: 538 cacaattgggaccatacttgatcagggtcactgtggctcgtgttgggcatttggtgctgt 597

                                                                       
Query: 479 ggagtgtctgcaagatcgtttctgcatccatcacaacatgaacatttcactttctgccaa 538
           ||||||||| || |||||||||||||| |||  ||||||||||||||| || |||| |||
Sbjct: 598 ggagtgtctccaggatcgtttctgcattcatttcaacatgaacatttcgctatctgtcaa 657

                                                                       
Query: 539 tgacctagtggcttgctgtgggtttatgtgtggtgatggttgtgatggaggatatcctat 598
           |||||||||||| ||||| || || ||||| || ||||||||||||||||| ||||||||
Sbjct: 658 tgacctagtggcatgctgcggtttcatgtgcggcgatggttgtgatggaggctatcctat 717

                      
Query: 599 cagcgcatggc 609
           ||  |||||||
Sbjct: 718 catggcatggc 728



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 105/133 (78%)
 Strand = Plus / Plus

                                                                       
Query: 190 gaatcatccagaaaggcatcatacagacggtcaacaaccatcccaacgccggatggacgg 249
           ||||||||||| | | ||||||| || |  ||||||| |||||||| || || |||||||
Sbjct: 309 gaatcatccaggacgacatcataaaggcaatcaacaagcatcccaatgctggctggacgg 368

                                                                       
Query: 250 ctggacacaacccctacctcgccaattacactattgagcaatttaagcatatgctgggag 309
           ||| ||  || || ||| | || || || |||| || |||||| || ||||| || ||||
Sbjct: 369 ctgcacggaatccatactttgcaaactatactactgcgcaattcaaacatatccttggag 428

                        
Query: 310 tgaaaccaacacc 322
           |||| ||||||||
Sbjct: 429 tgaagccaacacc 441



to top

>dbj|AK068459.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013151C17, full
           insert sequence
          Length = 3464

 Score =  188 bits (95), Expect = 1e-44
 Identities = 167/191 (87%)
 Strand = Plus / Plus

                                                                       
Query: 419 cacaattgggaaaatacttgatcaaggtcactgtggttcctgttgggcttttggagctgt 478
           |||||||||||  ||||||||||| ||||||||||| || |||||||| ||||| |||||
Sbjct: 669 cacaattgggaccatacttgatcagggtcactgtggctcgtgttgggcatttggtgctgt 728

                                                                       
Query: 479 ggagtgtctgcaagatcgtttctgcatccatcacaacatgaacatttcactttctgccaa 538
           ||||||||| || |||||||||||||| |||  ||||||||||||||| || |||| |||
Sbjct: 729 ggagtgtctccaggatcgtttctgcattcatttcaacatgaacatttcgctatctgtcaa 788

                                                                       
Query: 539 tgacctagtggcttgctgtgggtttatgtgtggtgatggttgtgatggaggatatcctat 598
           |||||||||||| ||||| || || ||||| || ||||||||||||||||| ||||||||
Sbjct: 789 tgacctagtggcatgctgcggtttcatgtgcggcgatggttgtgatggaggctatcctat 848

                      
Query: 599 cagcgcatggc 609
           ||  |||||||
Sbjct: 849 catggcatggc 859



to top

>dbj|AK064820.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000E23, full
           insert sequence
          Length = 1369

 Score =  188 bits (95), Expect = 1e-44
 Identities = 167/191 (87%)
 Strand = Plus / Plus

                                                                       
Query: 419 cacaattgggaaaatacttgatcaaggtcactgtggttcctgttgggcttttggagctgt 478
           |||||||||||  ||||||||||| ||||||||||| || |||||||| ||||| |||||
Sbjct: 471 cacaattgggaccatacttgatcagggtcactgtggctcgtgttgggcatttggtgctgt 530

                                                                       
Query: 479 ggagtgtctgcaagatcgtttctgcatccatcacaacatgaacatttcactttctgccaa 538
           ||||||||| || |||||||||||||| |||  ||||||||||||||| || |||| |||
Sbjct: 531 ggagtgtctccaggatcgtttctgcattcatttcaacatgaacatttcgctatctgtcaa 590

                                                                       
Query: 539 tgacctagtggcttgctgtgggtttatgtgtggtgatggttgtgatggaggatatcctat 598
           |||||||||||| ||||| || || ||||| || ||||||||||||||||| ||||||||
Sbjct: 591 tgacctagtggcatgctgcggtttcatgtgcggcgatggttgtgatggaggctatcctat 650

                      
Query: 599 cagcgcatggc 609
           ||  |||||||
Sbjct: 651 catggcatggc 661



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 105/133 (78%)
 Strand = Plus / Plus

                                                                       
Query: 190 gaatcatccagaaaggcatcatacagacggtcaacaaccatcccaacgccggatggacgg 249
           ||||||||||| | | ||||||| || |  ||||||| |||||||| || || |||||||
Sbjct: 242 gaatcatccaggacgacatcataaaggcaatcaacaagcatcccaatgctggctggacgg 301

                                                                       
Query: 250 ctggacacaacccctacctcgccaattacactattgagcaatttaagcatatgctgggag 309
           ||| ||  || || ||| | || || || |||| || |||||| || ||||| || ||||
Sbjct: 302 ctgcacggaatccatactttgcaaactatactactgcgcaattcaaacatatccttggag 361

                        
Query: 310 tgaaaccaacacc 322
           |||| ||||||||
Sbjct: 362 tgaagccaacacc 374



to top

>dbj|AK059697.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-032-C04, full
           insert sequence
          Length = 1565

 Score =  188 bits (95), Expect = 1e-44
 Identities = 167/191 (87%)
 Strand = Plus / Plus

                                                                       
Query: 419 cacaattgggaaaatacttgatcaaggtcactgtggttcctgttgggcttttggagctgt 478
           |||||||||||  ||||||||||| ||||||||||| || |||||||| ||||| |||||
Sbjct: 470 cacaattgggaccatacttgatcagggtcactgtggctcgtgttgggcatttggtgctgt 529

                                                                       
Query: 479 ggagtgtctgcaagatcgtttctgcatccatcacaacatgaacatttcactttctgccaa 538
           ||||||||| || |||||||||||||| |||  ||||||||||||||| || |||| |||
Sbjct: 530 ggagtgtctccaggatcgtttctgcattcatttcaacatgaacatttcgctatctgtcaa 589

                                                                       
Query: 539 tgacctagtggcttgctgtgggtttatgtgtggtgatggttgtgatggaggatatcctat 598
           |||||||||||| ||||| || || ||||| || ||||||||||||||||| ||||||||
Sbjct: 590 tgacctagtggcatgctgcggtttcatgtgcggcgatggttgtgatggaggctatcctat 649

                      
Query: 599 cagcgcatggc 609
           ||  |||||||
Sbjct: 650 catggcatggc 660



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 105/133 (78%)
 Strand = Plus / Plus

                                                                       
Query: 190 gaatcatccagaaaggcatcatacagacggtcaacaaccatcccaacgccggatggacgg 249
           ||||||||||| | | ||||||| || |  ||||||| |||||||| || || |||||||
Sbjct: 241 gaatcatccaggacgacatcataaaggcaatcaacaagcatcccaatgctggctggacgg 300

                                                                       
Query: 250 ctggacacaacccctacctcgccaattacactattgagcaatttaagcatatgctgggag 309
           ||| ||  || || ||| | || || || |||| || |||||| || ||||| || ||||
Sbjct: 301 ctgcacggaatccatactttgcaaactatactactgcgcaattcaaacatatccttggag 360

                        
Query: 310 tgaaaccaacacc 322
           |||| ||||||||
Sbjct: 361 tgaagccaacacc 373



to top

>gb|AY916493.1| Oryza sativa (japonica cultivar-group) cathepsin B-like cysteine
           protease mRNA, complete cds
          Length = 1475

 Score =  188 bits (95), Expect = 1e-44
 Identities = 167/191 (87%)
 Strand = Plus / Plus

                                                                       
Query: 419 cacaattgggaaaatacttgatcaaggtcactgtggttcctgttgggcttttggagctgt 478
           |||||||||||  ||||||||||| ||||||||||| || |||||||| ||||| |||||
Sbjct: 492 cacaattgggaccatacttgatcagggtcactgtggctcgtgttgggcatttggtgctgt 551

                                                                       
Query: 479 ggagtgtctgcaagatcgtttctgcatccatcacaacatgaacatttcactttctgccaa 538
           ||||||||| || |||||||||||||| |||  ||||||||||||||| || |||| |||
Sbjct: 552 ggagtgtctccaggatcgtttctgcattcatttcaacatgaacatttcgctatctgtcaa 611

                                                                       
Query: 539 tgacctagtggcttgctgtgggtttatgtgtggtgatggttgtgatggaggatatcctat 598
           |||||||||||| ||||| || || ||||| || ||||||||||||||||| ||||||||
Sbjct: 612 tgacctagtggcatgctgcggtttcatgtgcggcgatggttgtgatggaggctatcctat 671

                      
Query: 599 cagcgcatggc 609
           ||  |||||||
Sbjct: 672 catggcatggc 682



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 105/133 (78%)
 Strand = Plus / Plus

                                                                       
Query: 190 gaatcatccagaaaggcatcatacagacggtcaacaaccatcccaacgccggatggacgg 249
           ||||||||||| | | ||||||| || |  ||||||| |||||||| || || |||||||
Sbjct: 263 gaatcatccaggacgacatcataaaggcaatcaacaagcatcccaatgctggctggacgg 322

                                                                       
Query: 250 ctggacacaacccctacctcgccaattacactattgagcaatttaagcatatgctgggag 309
           ||| ||  || || ||| | || || || |||| || |||||| || ||||| || ||||
Sbjct: 323 ctgcacggaatccatactttgcaaactatactactgcgcaattcaaacatatccttggag 382

                        
Query: 310 tgaaaccaacacc 322
           |||| ||||||||
Sbjct: 383 tgaagccaacacc 395



to top

>emb|X66013.1|TACATHBG T.aestivum gene for cathepsin B (Al16)
          Length = 4792

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 67/74 (90%)
 Strand = Plus / Plus

                                                                        
Query: 536  caatgacctagtggcttgctgtgggtttatgtgtggtgatggttgtgatggaggatatcc 595
            |||||||||| ||||||||||||| ||| ||||||||   |||||| |||||||||||||
Sbjct: 2484 caatgacctactggcttgctgtggttttctgtgtggtagcggttgtaatggaggatatcc 2543

                          
Query: 596  tatcagcgcatggc 609
            ||||||||||||||
Sbjct: 2544 tatcagcgcatggc 2557



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 57/61 (93%)
 Strand = Plus / Plus

                                                                        
Query: 206  catcatacagacggtcaacaaccatcccaacgccggatggacggctggacacaaccccta 265
            |||||| |||||||||||||| |||||||| ||||| |||||||||||||||||||||||
Sbjct: 1709 catcattcagacggtcaacaagcatcccaatgccgggtggacggctggacacaaccccta 1768

             
Query: 266  c 266
            |
Sbjct: 1769 c 1769



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 70/81 (86%)
 Strand = Plus / Plus

                                                                        
Query: 282  attgagcaatttaagcatatgctgggagtgaaaccaacacctccaggtttactggctggt 341
            ||||||||||| |||||||| ||||||||||| ||||| ||||| ||||| || ||||||
Sbjct: 1885 attgagcaattcaagcatatcctgggagtgaagccaacgcctccgggtttgctcgctggt 1944

                                 
Query: 342  gttcgaaccaaaactcatcca 362
            ||||  | ||||| |||||||
Sbjct: 1945 gttccgatcaaaattcatcca 1965



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                                
Query: 403  aatggtccggttgcagcacaattgggaaaatacttg 438
            |||||||| ||||||||||||||||||| |||||||
Sbjct: 2003 aatggtccagttgcagcacaattgggaacatacttg 2038



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 62/75 (82%)
 Strand = Plus / Plus

                                                                        
Query: 444  ggtcactgtggttcctgttgggcttttggagctgtggagtgtctgcaagatcgtttctgc 503
            |||||||||||| |||||||||| ||||  || |||||   ||| || ||||||||||| 
Sbjct: 2290 ggtcactgtggtgcctgttgggcctttgctgccgtggaagctctccaggatcgtttctgt 2349

                           
Query: 504  atccatcacaacatg 518
            || |||| |||||||
Sbjct: 2350 attcatctcaacatg 2364



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 180  cattccctaggaatcatccag 200
            |||||||||||||||||||||
Sbjct: 1592 cattccctaggaatcatccag 1612



to top

>gb|AC132490.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0570A02,
              complete sequence
          Length = 146541

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 80/92 (86%)
 Strand = Plus / Plus

                                                                          
Query: 518    gaacatttcactttctgccaatgacctagtggcttgctgtgggtttatgtgtggtgatgg 577
              ||||||||| || |||| ||||||||||||||| ||||| || || ||||| || |||||
Sbjct: 110408 gaacatttcgctatctgtcaatgacctagtggcatgctgcggtttcatgtgcggcgatgg 110467

                                              
Query: 578    ttgtgatggaggatatcctatcagcgcatggc 609
              |||||||||||| ||||||||||  |||||||
Sbjct: 110468 ttgtgatggaggctatcctatcatggcatggc 110499



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 66/75 (88%)
 Strand = Plus / Plus

                                                                          
Query: 444    ggtcactgtggttcctgttgggcttttggagctgtggagtgtctgcaagatcgtttctgc 503
              ||||||||||| || |||||||| ||||| |||||||||||||| || ||||||||||||
Sbjct: 110229 ggtcactgtggctcgtgttgggcatttggtgctgtggagtgtctccaggatcgtttctgc 110288

                             
Query: 504    atccatcacaacatg 518
              || |||  |||||||
Sbjct: 110289 attcatttcaacatg 110303



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 80/92 (86%)
 Strand = Plus / Plus

                                                                            
Query: 518      gaacatttcactttctgccaatgacctagtggcttgctgtgggtttatgtgtggtgatgg 577
                ||||||||| || |||| ||||||||||||||| ||||| || || ||||| || |||||
Sbjct: 14030331 gaacatttcgctatctgtcaatgacctagtggcatgctgcggtttcatgtgcggcgatgg 14030390

                                                
Query: 578      ttgtgatggaggatatcctatcagcgcatggc 609
                |||||||||||| ||||||||||  |||||||
Sbjct: 14030391 ttgtgatggaggctatcctatcatggcatggc 14030422



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 66/75 (88%)
 Strand = Plus / Plus

                                                                            
Query: 444      ggtcactgtggttcctgttgggcttttggagctgtggagtgtctgcaagatcgtttctgc 503
                ||||||||||| || |||||||| ||||| |||||||||||||| || ||||||||||||
Sbjct: 14030152 ggtcactgtggctcgtgttgggcatttggtgctgtggagtgtctccaggatcgtttctgc 14030211

                               
Query: 504      atccatcacaacatg 518
                || |||  |||||||
Sbjct: 14030212 attcatttcaacatg 14030226



to top

>gb|AY112465.1| Zea mays CL31697_1 mRNA sequence
          Length = 1472

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 49/51 (96%)
 Strand = Plus / Minus

                                                              
Query: 404 atggtccggttgcagcacaattgggaaaatacttgatcaaggtcactgtgg 454
           ||||||| ||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 925 atggtcccgttgcagcacaattgggaacatacttgatcaaggtcactgtgg 875



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 75/87 (86%)
 Strand = Plus / Minus

                                                                       
Query: 512 caacatgaacatttcactttctgccaatgacctagtggcttgctgtgggtttatgtgtgg 571
           |||||||| ||||| |||||| | |||||||||| |||| ||||| || |||||||| ||
Sbjct: 817 caacatgagcattttactttcagtcaatgacctactggcatgctgcggttttatgtgcgg 758

                                      
Query: 572 tgatggttgtgatggaggatatcctat 598
            ||||| ||||||||||| ||||||||
Sbjct: 757 cgatgggtgtgatggaggctatcctat 731



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                         
Query: 190  gaatcatccagaaaggcatcatacagacggtcaacaaccatccca 234
            ||||||||||| | | ||||||  |||| ||||||||||||||||
Sbjct: 1139 gaatcatccaggaggacatcatcgagacagtcaacaaccatccca 1095



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 282  attgagcaatttaagcatatgctgggagtgaaaccaacacc 322
            |||| |||||||||||| || || |||||||||||| ||||
Sbjct: 1047 attgcgcaatttaagcacatacttggagtgaaaccagcacc 1007



to top

>gb|DQ492287.1| Nicotiana benthamiana cathepsin B (CathB) mRNA, complete cds
          Length = 1353

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 143/179 (79%)
 Strand = Plus / Plus

                                                                       
Query: 417 agcacaattgggaaaatacttgatcaaggtcactgtggttcctgttgggcttttggagct 476
           ||||| ||||||| ||| |||||||| || ||||||||||| |||||||||||||| |||
Sbjct: 343 agcactattgggagaattcttgatcagggacactgtggttcttgttgggcttttggtgct 402

                                                                       
Query: 477 gtggagtgtctgcaagatcgtttctgcatccatcacaacatgaacatttcactttctgcc 536
           || ||||  |||   ||||||||||| || ||| |   | |||| || || || || || 
Sbjct: 403 gttgagtcactgtctgatcgtttctgtattcattatggcttgaatatctctctgtcagca 462

                                                                      
Query: 537 aatgacctagtggcttgctgtgggtttatgtgtggtgatggttgtgatggaggatatcc 595
           ||||| ||  | || |||||||| ||| | ||||| |||||||||||||| ||||||||
Sbjct: 463 aatgatctcttagcatgctgtggctttttatgtggagatggttgtgatggtggatatcc 521



to top

>emb|X81995.1|NRCATHB N.rustica mRNA for cathepsin B-like cysteine proteinase
          Length = 1331

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 59/67 (88%)
 Strand = Plus / Plus

                                                                       
Query: 417 agcacaattgggaaaatacttgatcaaggtcactgtggttcctgttgggcttttggagct 476
           ||||| ||||||| ||| |||||||| || ||||||||||| |||||||||||||| |||
Sbjct: 355 agcactattgggagaattcttgatcagggacactgtggttcttgttgggcttttggtgct 414

                  
Query: 477 gtggagt 483
           || ||||
Sbjct: 415 gttgagt 421



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 552 tgctgtgggtttatgtgtggtgatggttgtgatggaggatatcc 595
           |||||||| ||| | ||||| |||||||||||||| ||||||||
Sbjct: 490 tgctgtggctttttatgtggggatggttgtgatggtggatatcc 533



to top

>gb|AY450641.1| Solanum tuberosum cathepsin B-like cysteine proteinase mRNA,
           complete cds
          Length = 1262

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 80/96 (83%)
 Strand = Plus / Plus

                                                                       
Query: 414 tgcagcacaattgggaaaatacttgatcaaggtcactgtggttcctgttgggcttttgga 473
           |||||||||||||| ||||| || ||||| || || || ||||| |||||||||||||| 
Sbjct: 337 tgcagcacaattggaaaaattctggatcagggacattgcggttcttgttgggcttttggt 396

                                               
Query: 474 gctgtggagtgtctgcaagatcgtttctgcatccat 509
           ||||| ||||  |||   ||||||||||| ||||||
Sbjct: 397 gctgttgagtcgctgtctgatcgtttctgtatccat 432



 Score = 40.1 bits (20), Expect = 8.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 575 tggttgtgatggaggatatcctat 598
           |||||||||||| |||||||||||
Sbjct: 498 tggttgtgatggtggatatcctat 521



to top

>gb|AY450638.1| Solanum tuberosum clone plbr2 cathepsin B-like cysteine proteinase
           mRNA, partial cds
          Length = 655

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 80/96 (83%)
 Strand = Plus / Plus

                                                                       
Query: 414 tgcagcacaattgggaaaatacttgatcaaggtcactgtggttcctgttgggcttttgga 473
           |||||||||||||| ||||| || ||||| || || || ||||| |||||||||||||| 
Sbjct: 332 tgcagcacaattggaaaaattctggatcagggacattgcggttcttgttgggcttttggt 391

                                               
Query: 474 gctgtggagtgtctgcaagatcgtttctgcatccat 509
           ||||| ||||  |||   ||||||||||| ||||||
Sbjct: 392 gctgttgagtcgctgtctgatcgtttctgtatccat 427



 Score = 40.1 bits (20), Expect = 8.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 575 tggttgtgatggaggatatcctat 598
           |||||||||||| |||||||||||
Sbjct: 493 tggttgtgatggtggatatcctat 516



to top

>gb|BT014624.1| Lycopersicon esculentum clone 134127R, mRNA sequence
          Length = 1263

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 79/96 (82%)
 Strand = Plus / Plus

                                                                       
Query: 414 tgcagcacaattgggaaaatacttgatcaaggtcactgtggttcctgttgggcttttgga 473
           |||||||||||||| | ||| || ||||| || || || ||||| |||||||||||||| 
Sbjct: 376 tgcagcacaattggaagaattctagatcagggacattgcggttcttgttgggcttttggt 435

                                               
Query: 474 gctgtggagtgtctgcaagatcgtttctgcatccat 509
           ||||| ||||  |||   ||||||||||| ||||||
Sbjct: 436 gctgttgagtcgctgtctgatcgtttctgtatccat 471



 Score = 40.1 bits (20), Expect = 8.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 575 tggttgtgatggaggatatcctat 598
           |||||||||||| |||||||||||
Sbjct: 537 tggttgtgatggtggatatcctat 560



to top

>ref|XM_849967.1| PREDICTED: Canis familiaris similar to Cathepsin L2 precursor
           (Cathepsin V) (Cathepsin U) (LOC612231), mRNA
          Length = 870

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           ||||||||||||||||||| ||||||||||||
Sbjct: 380 atcaaggtcactgtggttcttgttgggctttt 411



to top

>emb|AJ251535.1|PSA251535 Pisum sativum partial mRNA for putative cathepsin B-like protease
           (cat1-related gene), clone A7
          Length = 620

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                       
Query: 417 agcacaattgggaaaatacttgatcaaggtcactgtggttcctgttgggcttttggagct 476
           ||||| ||||| | ||| || ||||| |||||||||||||| |||||||| ||||| |||
Sbjct: 347 agcactattggaagaattctagatcagggtcactgtggttcttgttgggcatttggcgct 406

             
Query: 477 gt 478
           ||
Sbjct: 407 gt 408



to top

>emb|AJ251534.1|PSA251534 Pisum sativum partial mRNA for putative cathepsin B-like protease
           (cat1-related gene), clone A6
          Length = 499

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                       
Query: 417 agcacaattgggaaaatacttgatcaaggtcactgtggttcctgttgggcttttggagct 476
           ||||| ||||| | ||| || ||||| |||||||||||||| |||||||| ||||| |||
Sbjct: 226 agcactattggaagaattctagatcagggtcactgtggttcttgttgggcatttggcgct 285

             
Query: 477 gt 478
           ||
Sbjct: 286 gt 287



to top

>dbj|D16823.1|SPESPCB S.peregrina mRNA for cathepsin B, complete cds
          Length = 1280

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 450 tgtggttcctgttgggcttttggagctgt 478
           |||||||| ||||||||||||||||||||
Sbjct: 436 tgtggttcatgttgggcttttggagctgt 464



to top

>ref|XM_513780.1| PREDICTED: Pan troglodytes LOC457278 (LOC457278), mRNA
          Length = 914

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||||||||||||||||
Sbjct: 493 atcagggtcagtgtggttcctgttgggctttt 524



to top

>gb|BC016058.1| Homo sapiens cathepsin K (pycnodysostosis), mRNA (cDNA clone
           MGC:23107 IMAGE:4860926), complete cds
          Length = 1699

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||||||||||||||||
Sbjct: 506 atcagggtcagtgtggttcctgttgggctttt 537



to top

>ref|NM_000396.2| Homo sapiens cathepsin K (pycnodysostosis) (CTSK), mRNA
          Length = 1702

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||||||||||||||||
Sbjct: 519 atcagggtcagtgtggttcctgttgggctttt 550



to top

>ref|NM_001032812.1| Macaca mulatta cathepsin K (CTSK), mRNA
          Length = 1029

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||||||||||||||||
Sbjct: 411 atcagggtcagtgtggttcctgttgggctttt 442



to top

>ref|XM_969178.1| PREDICTED: Tribolium castaneum similar to cathepsin B preproprotein
           (LOC663117), mRNA
          Length = 1008

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 450 tgtggttcctgttgggcttttggagctgtgga 481
           ||||| || |||||||||||||||||||||||
Sbjct: 328 tgtgggtcttgttgggcttttggagctgtgga 359



to top

>emb|X82153.1|HSOC2RNA H.sapiens mRNA for cathepsin O
          Length = 1669

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||||||||||||||||
Sbjct: 524 atcagggtcagtgtggttcctgttgggctttt 555



to top

>emb|CR541719.1| Homo sapiens full open reading frame cDNA clone RZPDo834E1237D for
           gene CTSK, cathepsin K (pycnodysostosis); complete cds,
           without stopcodon
          Length = 987

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||||||||||||||||
Sbjct: 395 atcagggtcagtgtggttcctgttgggctttt 426



to top

>emb|CR541675.1| Homo sapiens full open reading frame cDNA clone RZPDo834C0328D for
           gene CTSK, cathepsin K (pycnodysostosis); complete cds,
           incl. stopcodon
          Length = 990

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||||||||||||||||
Sbjct: 395 atcagggtcagtgtggttcctgttgggctttt 426



to top

>emb|X66116.1|TAPCATHB T.aestivum promoter sequence of cathepsin B-like gene
          Length = 483

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 69  cgtcgccgatcgaggacgaagatg 92
           ||||||||||||||||||||||||
Sbjct: 460 cgtcgccgatcgaggacgaagatg 483



to top

>emb|CR626559.1| full-length cDNA clone CS0DI024YJ12 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1658

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||||||||||||||||
Sbjct: 490 atcagggtcagtgtggttcctgttgggctttt 521



to top

>emb|CR626142.1| full-length cDNA clone CS0DN002YD24 of Adult brain of Homo sapiens
           (human)
          Length = 1619

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||||||||||||||||
Sbjct: 500 atcagggtcagtgtggttcctgttgggctttt 531



to top

>emb|CR624019.1| full-length cDNA clone CS0DN002YH21 of Adult brain of Homo sapiens
           (human)
          Length = 1563

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||||||||||||||||
Sbjct: 422 atcagggtcagtgtggttcctgttgggctttt 453



to top

>emb|CR614321.1| full-length cDNA clone CS0DI069YM12 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1527

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||||||||||||||||
Sbjct: 424 atcagggtcagtgtggttcctgttgggctttt 455



to top

>emb|CR612623.1| full-length cDNA clone CS0DI018YG15 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1583

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||||||||||||||||
Sbjct: 425 atcagggtcagtgtggttcctgttgggctttt 456



to top

>emb|CR612492.1| full-length cDNA clone CS0DI033YH19 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1577

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||||||||||||||||
Sbjct: 425 atcagggtcagtgtggttcctgttgggctttt 456



to top

>emb|CR606929.1| full-length cDNA clone CS0DN002YF20 of Adult brain of Homo sapiens
           (human)
          Length = 1626

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||||||||||||||||
Sbjct: 492 atcagggtcagtgtggttcctgttgggctttt 523



to top

>emb|CR601270.1| full-length cDNA clone CS0DE008YM10 of Placenta of Homo sapiens
           (human)
          Length = 1565

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||||||||||||||||
Sbjct: 425 atcagggtcagtgtggttcctgttgggctttt 456



to top

>emb|CR598542.1| full-length cDNA clone CS0DN002YO18 of Adult brain of Homo sapiens
           (human)
          Length = 1577

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||||||||||||||||
Sbjct: 425 atcagggtcagtgtggttcctgttgggctttt 456



to top

>emb|CR594213.1| full-length cDNA clone CS0DI009YN05 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1579

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||||||||||||||||
Sbjct: 433 atcagggtcagtgtggttcctgttgggctttt 464



to top

>gb|AF359422.1| Nicotiana tabacum cathepsin B-like cysteine proteinase gene,
           partial cds
          Length = 731

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 447 cactgtggttcctgttgggcttttggagctgt 478
           ||||||||||| |||||||||||||| |||||
Sbjct: 520 cactgtggttcttgttgggcttttggtgctgt 551



to top

>gb|S79895.1| OC2=cathepsin O2 [human, spleen, mRNA, 1482 nt]
          Length = 1482

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||||||||||||||||
Sbjct: 536 atcagggtcagtgtggttcctgttgggctttt 567



to top

>gb|AF283476.1|AF283476 Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete
            cds
          Length = 3334

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                        
Query: 531  tctgccaatgacctagtggcttgctgtgggtttatgtgtggtgatggttgtgatggagga 590
            |||| |||||||||  | || |||||||| ||| |||| ||||| ||||||||||| || 
Sbjct: 1926 tctgtcaatgacctcttagcgtgctgtggctttttgtgcggtgaaggttgtgatggtggt 1985

                    
Query: 591  tatcctat 598
            ||||||||
Sbjct: 1986 tatcctat 1993



to top

>gb|AY892942.1| Synthetic construct Homo sapiens clone FLH135296.01L cathepsin K
           (CTSK) mRNA, partial cds
          Length = 990

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||||||||||||||||
Sbjct: 395 atcagggtcagtgtggttcctgttgggctttt 426



to top

>gb|AY892941.1| Synthetic construct Homo sapiens clone FLH135294.01L cathepsin K
           (CTSK) mRNA, partial cds
          Length = 990

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||||||||||||||||
Sbjct: 395 atcagggtcagtgtggttcctgttgggctttt 426



to top

>gb|AF101239.1|AF101239 Ipomoea batatas cathepsin B-like cysteine proteinase (CathB) mRNA,
           complete cds
          Length = 1248

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                       
Query: 531 tctgccaatgacctagtggcttgctgtgggtttatgtgtggtgatggttgtgatggagga 590
           |||| |||||||||  | || |||||||| ||| |||| ||||| ||||||||||| || 
Sbjct: 470 tctgtcaatgacctcttagcgtgctgtggctttttgtgcggtgaaggttgtgatggtggt 529

                   
Query: 591 tatcctat 598
           ||||||||
Sbjct: 530 tatcctat 537



to top

>dbj|AK130134.1| Homo sapiens cDNA FLJ26624 fis, clone MPC03724, highly similar to
           Cathepsin K precursor (EC 3.4.22.38)
          Length = 1601

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||||||||||||||||
Sbjct: 443 atcagggtcagtgtggttcctgttgggctttt 474



to top

>gb|AY893612.1| Synthetic construct Homo sapiens clone FLH131032.01X cathepsin K
           (CTSK) mRNA, complete cds
          Length = 990

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||||||||||||||||
Sbjct: 395 atcagggtcagtgtggttcctgttgggctttt 426



to top

>gb|AF124092.1|AF124092 Macaca mulatta cathepsin K mRNA, complete cds
          Length = 1029

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||||||||||||||||
Sbjct: 411 atcagggtcagtgtggttcctgttgggctttt 442



to top

>gb|AF070927.1|AF070927 Macaca fascicularis cathepsin K mRNA, complete cds
          Length = 990

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||||||||||||||||
Sbjct: 395 atcagggtcagtgtggttcctgttgggctttt 426



to top

>gb|U20280.1|HSU20280 Human cathepsin X mRNA, complete cds
          Length = 1597

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||||||||||||||||
Sbjct: 413 atcagggtcagtgtggttcctgttgggctttt 444



to top

>gb|U13665.1|HSU13665 Human cathepsin O (CTSO) mRNA, complete cds
          Length = 1661

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||||||||||||||||
Sbjct: 500 atcagggtcagtgtggttcctgttgggctttt 531



to top

>ref|NM_001034435.1| Bos taurus cathepsin K preproprotein (CTSK), mRNA
          Length = 1699

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 444 ggtcactgtggttcctgttgggctttt 470
           ||||| |||||||||||||||||||||
Sbjct: 531 ggtcagtgtggttcctgttgggctttt 557



to top

>ref|NM_001033996.1| Canis familiaris cathepsin K (pycnodysostosis) (CTSK), mRNA
          Length = 1001

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 444 ggtcactgtggttcctgttgggctttt 470
           ||||| |||||||||||||||||||||
Sbjct: 411 ggtcagtgtggttcctgttgggctttt 437



to top

>gb|AY738221.1| Canis familiaris cathepsin K mRNA, complete cds
          Length = 1001

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 444 ggtcactgtggttcctgttgggctttt 470
           ||||| |||||||||||||||||||||
Sbjct: 411 ggtcagtgtggttcctgttgggctttt 437



to top

>emb|AL355860.12| Human DNA sequence from clone RP11-235D19 on chromosome 1 Contains a
            ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog,
            yeast) (UBE2D3) pseudogene, the 5' end of the CTSK gene
            for cathepsin K (pycnodysostosis), the ARNT gene for aryl
            hydrocarbon receptor nuclear translocator, a ribosomal
            protein S27a (RPS27A) pseudogene, a cytochrome c, somatic
            (CYCS) pseudogene and a CpG island, complete sequence
          Length = 116451

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 444  ggtcactgtggttcctgttgggctttt 470
            ||||| |||||||||||||||||||||
Sbjct: 4883 ggtcagtgtggttcctgttgggctttt 4857



to top

>ref|XM_961570.1| PREDICTED: Tribolium castaneum similar to cathepsin B preproprotein
           (LOC655077), mRNA
          Length = 963

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 439 atcaaggtcactgtggttcctgttgggcttttggagctgtgga 481
           ||||||||  |||||| ||||| |||||||||||||| |||||
Sbjct: 299 atcaaggttcctgtggctcctgctgggcttttggagccgtgga 341



to top

>gb|BC109853.1| Bos taurus cathepsin K preproprotein, mRNA (cDNA clone MGC:134021
           IMAGE:8039598), complete cds
          Length = 1762

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 444 ggtcactgtggttcctgttgggctttt 470
           ||||| |||||||||||||||||||||
Sbjct: 458 ggtcagtgtggttcctgttgggctttt 484



to top

>gb|AC149038.2| Medicago truncatula chromosome 7 BAC clone mth2-29a5, complete sequence
          Length = 136566

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                
Query: 444   ggtcactgtggttcctgttgggcttttggagctgt 478
             |||||||||||||| |||||||| ||||| |||||
Sbjct: 23462 ggtcactgtggttcttgttgggcatttggtgctgt 23428



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                
Query: 444   ggtcactgtggttcctgttgggcttttggagctgt 478
             |||||||||||||| |||||||| ||||| |||||
Sbjct: 16508 ggtcactgtggttcttgttgggcatttggtgctgt 16474



to top

>gb|AF292030.1|AF292030 Sus scrofa cathepsin K precursor (CTSK) mRNA, complete cds
          Length = 994

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 444 ggtcactgtggttcctgttgggctttt 470
           ||||| |||||||||||||||||||||
Sbjct: 404 ggtcagtgtggttcctgttgggctttt 430



to top

>ref|NM_214302.1| Sus scrofa cathepsin K precursor (CTSK), mRNA
          Length = 994

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 444 ggtcactgtggttcctgttgggctttt 470
           ||||| |||||||||||||||||||||
Sbjct: 404 ggtcagtgtggttcctgttgggctttt 430



to top

>gb|BT021052.1| Bos taurus cathepsin K (pycnodysostosis) (CTSK), mRNA, complete cds
          Length = 1699

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 444 ggtcactgtggttcctgttgggctttt 470
           ||||| |||||||||||||||||||||
Sbjct: 531 ggtcagtgtggttcctgttgggctttt 557



to top

>gb|AY609962.1| Sus scrofa clone Clu_4871.scr.msk.p1.Contig1, mRNA sequence
          Length = 1756

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 444 ggtcactgtggttcctgttgggctttt 470
           ||||| |||||||||||||||||||||
Sbjct: 566 ggtcagtgtggttcctgttgggctttt 592



to top

>gb|AE014825.1| Plasmodium falciparum 3D7 chromosome 14 section 10 of 13 of the complete
              sequence
          Length = 250053

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                                
Query: 438    gatcaaggtcactgtggttcctgttgggcttttg 471
              ||||||||||  |||||||| |||||||||||||
Sbjct: 125022 gatcaaggtctttgtggttcttgttgggcttttg 125055



to top

>ref|XM_782854.1| PREDICTED: Strongylocentrotus purpuratus similar to cathepsin B
           preproprotein (LOC582922), mRNA
          Length = 534

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 449 ctgtggttcctgttgggcttttggagctgt 478
           |||||| ||||| |||||||||||||||||
Sbjct: 399 ctgtggctcctgctgggcttttggagctgt 428



to top

>gb|AY573569.1| Fasciola hepatica strain Firat cathepsin L1 proteinase mRNA,
           complete cds
          Length = 981

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 448 actgtggttcctgttgggcttt 469
           ||||||||||||||||||||||
Sbjct: 383 actgtggttcctgttgggcttt 404



to top

>gb|AC158233.2| Mus musculus BAC clone RP23-240E15 from chromosome 3, complete sequence
          Length = 209923

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 26     tcctccgcttgcttctgcttgc 47
              ||||||||||||||||||||||
Sbjct: 114358 tcctccgcttgcttctgcttgc 114379



to top

>dbj|D14036.1|RABOC2 Oryctolagus cuniculus mRNA for OC-2 protein, complete cds
          Length = 1599

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 444 ggtcactgtggttcctgttgggcttt 469
           ||||| ||||||||||||||||||||
Sbjct: 424 ggtcagtgtggttcctgttgggcttt 449



to top

>gb|M81341.1|PFACYPROT Plasmodium falciparum cysteine proteinase gene, complete cds
          Length = 1801

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                              
Query: 438  gatcaaggtcactgtggttcctgttgggcttttg 471
            ||||||||||  |||||||| |||||||||||||
Sbjct: 1118 gatcaaggtctttgtggttcttgttgggcttttg 1151



to top

>gb|AY584068.1| Plasmodium vivax vivapain-4 mRNA, complete cds
          Length = 1455

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 450 tgtggttcctgttgggcttttggagctgt 478
           ||||| ||||||||||| |||||||||||
Sbjct: 847 tgtggctcctgttgggcctttggagctgt 875



to top

>ref|NM_100111.1| Arabidopsis thaliana cysteine-type endopeptidase/ cysteine-type
           peptidase AT1G02305 mRNA, complete cds
          Length = 1277

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 438 gatcaaggtcactgtggttcctgttgggcttttggagctgt 478
           ||||| |||||||||||||| || ||||| ||||| |||||
Sbjct: 417 gatcagggtcactgtggttcttgctgggcctttggtgctgt 457



to top

>gb|AC115865.9| Mus musculus chromosome 3, clone RP24-314I8, complete sequence
          Length = 200362

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 40     ctgcttgcttcctcctccctc 60
              |||||||||||||||||||||
Sbjct: 168611 ctgcttgcttcctcctccctc 168631



to top

>emb|AL135793.13| Human DNA sequence from clone RP11-296H2 on chromosome 10 Contains the 3'
              end of the TACC2 gene for transforming, acidic coiled-coil
              containing protein 2 (AZU-1), the gene for a novel protein
              (FLJ25359) and two CpG islands, complete sequence
          Length = 213861

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 42     gcttgcttcctcctccctccc 62
              |||||||||||||||||||||
Sbjct: 193400 gcttgcttcctcctccctccc 193380



to top

>gb|AC135643.2| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone
              OSJNBa0023F01, complete sequence
          Length = 145009

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 156    ctcgccagagcggcagggggaggcc 180
              |||||||||||||||| ||||||||
Sbjct: 137980 ctcgccagagcggcagtgggaggcc 138004



to top

>ref|XM_961657.1| PREDICTED: Tribolium castaneum similar to CG10992-PA (LOC655148),
           mRNA
          Length = 1072

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 448 actgtggttcctgttgggcttttgg 472
           |||| ||||||||||||||||||||
Sbjct: 324 actgcggttcctgttgggcttttgg 348



to top

>emb|AJ279093.1|FHE279093 Fasciola hepatica partial mRNA for procathepsin L3 (ORF1), clone
           pFH64
          Length = 1008

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 450 tgtggttcctgttgggctttt 470
           |||||||||||||||||||||
Sbjct: 325 tgtggttcctgttgggctttt 345



to top

>emb|AJ279091.1|FHE279091 Fasciola hepatica partial mRNA for procathepsin L3 (ORF1), clone
           pFH22
          Length = 936

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 450 tgtggttcctgttgggctttt 470
           |||||||||||||||||||||
Sbjct: 340 tgtggttcctgttgggctttt 360



to top

>gb|AF419329.1|AF419329 Fasciola gigantica cathepsin L mRNA, complete cds
          Length = 1091

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 450 tgtggttcctgttgggctttt 470
           |||||||||||||||||||||
Sbjct: 414 tgtggttcctgttgggctttt 434



to top

>gb|AF428337.1|AF428337 Arabidopsis thaliana At1g02300/T6A9_10 mRNA, complete cds
          Length = 1277

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 438 gatcaaggtcactgtggttcctgttgggcttttggagctgt 478
           ||||| |||||||||||||| || ||||| ||||| |||||
Sbjct: 485 gatcagggtcactgtggttcttgctgggcctttggtgctgt 525



to top

>gb|AY039887.1| Arabidopsis thaliana At1g02300/T6A9_10 mRNA, complete cds
          Length = 1277

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 438 gatcaaggtcactgtggttcctgttgggcttttggagctgt 478
           ||||| |||||||||||||| || ||||| ||||| |||||
Sbjct: 417 gatcagggtcactgtggttcttgctgggcctttggtgctgt 457



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 156      ctcgccagagcggcagggggaggcc 180
                |||||||||||||||| ||||||||
Sbjct: 26451740 ctcgccagagcggcagtgggaggcc 26451716



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 444      ggtcactgtggttcctgttgg 464
                |||||||||||||||||||||
Sbjct: 16385943 ggtcactgtggttcctgttgg 16385963



to top

>emb|BX815386.1|CNS0AAL6 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS56ZE10 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1305

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 438 gatcaaggtcactgtggttcctgttgggcttttggagctgt 478
           ||||| |||||||||||||| || ||||| ||||| |||||
Sbjct: 439 gatcagggtcactgtggttcttgctgggcctttggtgctgt 479



to top

>dbj|AP005419.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0046G12
          Length = 189391

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 444   ggtcactgtggttcctgttgg 464
             |||||||||||||||||||||
Sbjct: 74490 ggtcactgtggttcctgttgg 74510



to top

>emb|BX842243.1| Homo sapiens chromosome 10 clone RP11-436O19, partial sequence
          Length = 38906

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 42    gcttgcttcctcctccctccc 62
             |||||||||||||||||||||
Sbjct: 21578 gcttgcttcctcctccctccc 21598



to top

>gb|BT002227.1| Arabidopsis thaliana At1g02300/T6A9_10 mRNA, complete cds
          Length = 1089

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 438 gatcaaggtcactgtggttcctgttgggcttttggagctgt 478
           ||||| |||||||||||||| || ||||| ||||| |||||
Sbjct: 379 gatcagggtcactgtggttcttgctgggcctttggtgctgt 419



to top

>dbj|AK066748.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013074D19, full
           insert sequence
          Length = 1486

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 444 ggtcactgtggttcctgttgg 464
           |||||||||||||||||||||
Sbjct: 553 ggtcactgtggttcctgttgg 573



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 156      ctcgccagagcggcagggggaggcc 180
                |||||||||||||||| ||||||||
Sbjct: 26777004 ctcgccagagcggcagtgggaggcc 26776980



to top

>gb|AC102108.12| Mus musculus chromosome 3, clone RP23-100J23, complete sequence
          Length = 216506

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 40    ctgcttgcttcctcctccctc 60
             |||||||||||||||||||||
Sbjct: 31414 ctgcttgcttcctcctccctc 31434



to top

>ref|NM_122435.2| Arabidopsis thaliana unknown protein AT5G25260 mRNA, complete cds
          Length = 1459

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 27   cctccgcttgcttctgcttg 46
            ||||||||||||||||||||
Sbjct: 1043 cctccgcttgcttctgcttg 1024



to top

>ref|XM_520110.1| PREDICTED: Pan troglodytes similar to hypothetical protein
            (LOC464571), mRNA
          Length = 6888

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 439  atcaaggtcactgtggttcctgttgggctttt 470
            |||| ||||| |||||||| ||||||||||||
Sbjct: 5963 atcagggtcagtgtggttcttgttgggctttt 5994



to top

>ref|NM_001003115.1| Canis familiaris cathepsin L2 (CTSL2), mRNA
          Length = 1395

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 459 atcagggtcagtgtggttcttgttgggctttt 490



to top

>ref|NM_031560.2| Rattus norvegicus cathepsin K (Ctsk), mRNA
          Length = 1446

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 450 tgtggttcctgttgggcttt 469
           ||||||||||||||||||||
Sbjct: 479 tgtggttcctgttgggcttt 498



to top

>gb|AC006259.1| Arabidopsis thaliana BAC F21J6 from chromosome V, containing KNAT3 and
             mapping near 60.5 cM, complete sequence
          Length = 110680

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 27    cctccgcttgcttctgcttg 46
             ||||||||||||||||||||
Sbjct: 90153 cctccgcttgcttctgcttg 90134



to top

>gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome
          Length = 6438405

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 109     cgctggcgctgctcgtcgtcatct 132
               ||||||||||| ||||||||||||
Sbjct: 3860717 cgctggcgctgttcgtcgtcatct 3860694



to top

>gb|BC046320.1| Mus musculus cathepsin K, mRNA (cDNA clone MGC:54691
           IMAGE:6390854), complete cds
          Length = 1562

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 450 tgtggttcctgttgggcttt 469
           ||||||||||||||||||||
Sbjct: 488 tgtggttcctgttgggcttt 507



to top

>gb|BC012612.1| Homo sapiens cathepsin L, transcript variant 1, mRNA (cDNA clone
           MGC:13635 IMAGE:4295635), complete cds
          Length = 1517

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 590 atcagggtcagtgtggttcttgttgggctttt 621



to top

>gb|AC140053.4| Mus musculus BAC clone RP23-258J2 from chromosome 19, complete sequence
          Length = 186595

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 43     cttgcttcctcctccctccc 62
              ||||||||||||||||||||
Sbjct: 155528 cttgcttcctcctccctccc 155509



to top

>ref|NM_001912.2| Homo sapiens cathepsin L (CTSL), transcript variant 1, mRNA
          Length = 1632

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 736 atcagggtcagtgtggttcttgttgggctttt 767



to top

>ref|NM_145918.1| Homo sapiens cathepsin L (CTSL), transcript variant 2, mRNA
          Length = 1487

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 591 atcagggtcagtgtggttcttgttgggctttt 622



to top

>gb|AC112144.4| Mus musculus BAC clone RP23-32B4 from 19, complete sequence
          Length = 216521

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 43     cttgcttcctcctccctccc 62
              ||||||||||||||||||||
Sbjct: 142771 cttgcttcctcctccctccc 142790



to top

>emb|AL109919.18|HSDJ258B3 Human DNA sequence from clone RP1-258B3 on chromosome 6q16.1-16.3
             Contains part of the GRIK2 gene for glutamate receptor
             ionotropic kainate 2, complete sequence
          Length = 147603

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 566   gtgtggtgatggttgtgatg 585
             ||||||||||||||||||||
Sbjct: 51980 gtgtggtgatggttgtgatg 51961



to top

>emb|AL035446.4|HS460G2 Human DNA sequence from clone RP3-460G2 on chromosome 6q24.1-24.3
             Contains a novel gene and part of a 40s ribosomal protein
             S3a (v-fos transformation effector protein 1)
             (RPS3A)(FTE1) pseudogene, complete sequence
          Length = 102552

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 86    gaagatggggagcggcctgc 105
             ||||||||||||||||||||
Sbjct: 86183 gaagatggggagcggcctgc 86202



to top

>emb|Z22765.1|FHCATHPRC F.hepatica cathepsin L-like protease mRNA, complete CDS
          Length = 1070

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 450 tgtggttcctgttgggcttt 469
           ||||||||||||||||||||
Sbjct: 418 tgtggttcctgttgggcttt 437



to top

>emb|Y18462.1|HOS18462 Homo sapiens mRNA for cathepsin L, partial
          Length = 525

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 17  atcagggtcagtgtggttcttgttgggctttt 48



to top

>emb|X94444.1|MMPPCATHK M.musculus mRNA for preprocathepsin K
          Length = 990

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 450 tgtggttcctgttgggcttt 469
           ||||||||||||||||||||
Sbjct: 406 tgtggttcctgttgggcttt 425



to top

>emb|X12451.1|HSCATHL Human mRNA for pro-cathepsin L (major excreted protein MEP)
          Length = 1575

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 680 atcagggtcagtgtggttcttgttgggctttt 711



to top

>emb|CR457053.1| Homo sapiens full open reading frame cDNA clone RZPDo834B0418D for
           gene CTSL, cathepsin L; complete cds, incl. stopcodon
          Length = 1002

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 392 atcagggtcagtgtggttcttgttgggctttt 423



to top

>emb|BX537395.1|HSM805692 Homo sapiens mRNA; cDNA DKFZp686A18159 (from clone DKFZp686A18159)
          Length = 1441

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 533 atcagggtcagtgtggttcttgttgggctttt 564



to top

>ref|NM_007802.2| Mus musculus cathepsin K (Ctsk), mRNA
          Length = 1483

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 450 tgtggttcctgttgggcttt 469
           ||||||||||||||||||||
Sbjct: 459 tgtggttcctgttgggcttt 478



to top

>emb|AJ279008.1|CFA279008 Canis familiaris mRNA for cathepsin L (ccL gene)
          Length = 1395

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 459 atcagggtcagtgtggttcttgttgggctttt 490



to top

>emb|AJ006033.1|MMU6033 Mus musculus ctsk gene
          Length = 11934

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 450  tgtggttcctgttgggcttt 469
            ||||||||||||||||||||
Sbjct: 5003 tgtggttcctgttgggcttt 5022



to top

>gb|AC009320.7| Homo sapiens 12 BAC RP11-310I24 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 57166

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 514   acatgaacatttcactttct 533
             ||||||||||||||||||||
Sbjct: 44278 acatgaacatttcactttct 44259



to top

>emb|BX470140.10| Zebrafish DNA sequence from clone CH211-238E6 in linkage group 4
            Contains the gene for a novel protein similar to
            vertebrate microphthalmia-associated transcription factor
            (MITF), six novel genes and two CpG islands, complete
            sequence
          Length = 148136

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 555  tgtgggtttatgtgtggtgatggt 578
            ||||||||||| ||||||||||||
Sbjct: 6032 tgtgggtttatatgtggtgatggt 6055



 Score = 40.1 bits (20), Expect = 8.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 555  tgtgggtttatgtgtggtgatggt 578
            ||||||||||| ||||||||||||
Sbjct: 1589 tgtgggtttatatgtggtgatggt 1612



to top

>emb|X05256.1|HSCATLR1 Human mRNA fragment for cathepsin L N-terminal/fragment
          Length = 126

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 56  atcagggtcagtgtggttcttgttgggctttt 87



to top

>gb|AF453501.1| Actinosynnema pretiosum subsp. auranticum maytansinoid antitumor agent
             ansamitocin biosynthetic gene cluster I, partial sequence
          Length = 82746

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 106   tcccgctggcgctgctcgtc 125
             ||||||||||||||||||||
Sbjct: 43968 tcccgctggcgctgctcgtc 43949



to top

>emb|CR626403.1| full-length cDNA clone CS0DI043YP08 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1405

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 540 atcagggtcagtgtggttcttgttgggctttt 571



to top

>emb|CR625678.1| full-length cDNA clone CS0DI021YB15 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1507

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 663 atcagggtcagtgtggttcttgttgggctttt 694



to top

>emb|CR624043.1| full-length cDNA clone CS0DI056YK03 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1464

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 600 atcagggtcagtgtggttcttgttgggctttt 631



to top

>emb|CR624025.1| full-length cDNA clone CS0DI004YP08 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1434

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 571 atcagggtcagtgtggttcttgttgggctttt 602



to top

>emb|CR623879.1| full-length cDNA clone CS0DI003YI03 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1378

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 511 atcagggtcagtgtggttcttgttgggctttt 542



to top

>emb|CR620973.1| full-length cDNA clone CS0DC027YD18 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1552

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 687 atcagggtcagtgtggttcttgttgggctttt 718



to top

>emb|CR620883.1| full-length cDNA clone CS0DI079YJ10 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1408

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 516 atcagggtcagtgtggttcttgttgggctttt 547



to top

>emb|CR620702.1| full-length cDNA clone CS0DI064YL15 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1523

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 656 atcagggtcagtgtggttcttgttgggctttt 687



to top

>emb|CR620611.1| full-length cDNA clone CL0BA007ZC09 of Placenta of Homo sapiens
           (human)
          Length = 1549

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 656 atcagggtcagtgtggttcttgttgggctttt 687



to top

>emb|CR619793.1| full-length cDNA clone CS0DC004YH11 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1288

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 408 atcagggtcagtgtggttcttgttgggctttt 439



to top

>emb|CR618895.1| full-length cDNA clone CS0DI028YJ02 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1549

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 690 atcagggtcagtgtggttcttgttgggctttt 721



to top

>emb|CR619050.1| full-length cDNA clone CS0DE013YN08 of Placenta of Homo sapiens
           (human)
          Length = 1521

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 652 atcagggtcagtgtggttcttgttgggctttt 683



to top

>emb|CR618528.1| full-length cDNA clone CS0DE010YH08 of Placenta of Homo sapiens
           (human)
          Length = 1383

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 511 atcagggtcagtgtggttcttgttgggctttt 542



to top

>emb|CR617897.1| full-length cDNA clone CS0DI062YC17 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1406

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 543 atcagggtcagtgtggttcttgttgggctttt 574



to top

>emb|CR616495.1| full-length cDNA clone CS0DI023YP04 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1438

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 571 atcagggtcagtgtggttcttgttgggctttt 602



to top

>emb|CR616359.1| full-length cDNA clone CS0DE012YE21 of Placenta of Homo sapiens
           (human)
          Length = 1590

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 716 atcagggtcagtgtggttcttgttgggctttt 747



to top

>emb|CR615255.1| full-length cDNA clone CS0DI007YE22 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1329

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 457 atcagggtcagtgtggttcttgttgggctttt 488



to top

>emb|CR614675.1| full-length cDNA clone CS0DE004YN19 of Placenta of Homo sapiens
           (human)
          Length = 1444

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 571 atcagggtcagtgtggttcttgttgggctttt 602



to top

>emb|CR613528.1| full-length cDNA clone CS0DI053YI24 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1506

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 626 atcagggtcagtgtggttcttgttgggctttt 657



to top

>emb|CR613254.1| full-length cDNA clone CS0DI024YL17 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1467

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 600 atcagggtcagtgtggttcttgttgggctttt 631



to top

>emb|CR612596.1| full-length cDNA clone CS0DI027YN17 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1431

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 567 atcagggtcagtgtggttcttgttgggctttt 598



to top

>emb|CR612043.1| full-length cDNA clone CS0DI083YN04 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1436

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 571 atcagggtcagtgtggttcttgttgggctttt 602



to top

>emb|CR611865.1| full-length cDNA clone CS0DI044YM22 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1390

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 552 atcagggtcagtgtggttcttgttgggctttt 583



to top

>emb|CR610633.1| full-length cDNA clone CS0DI052YG23 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1465

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 606 atcagggtcagtgtggttcttgttgggctttt 637



to top

>emb|CR609955.1| full-length cDNA clone CS0DI043YK10 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1419

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 539 atcagggtcagtgtggttcttgttgggctttt 570



to top

>emb|CR608495.1| full-length cDNA clone CS0DI044YA21 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1403

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 511 atcagggtcagtgtggttcttgttgggctttt 542



to top

>emb|CR608477.1| full-length cDNA clone CS0DI073YL22 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1443

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 584 atcagggtcagtgtggttcttgttgggctttt 615



to top

>emb|CR607586.1| full-length cDNA clone CS0DI052YO05 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1496

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 636 atcagggtcagtgtggttcttgttgggctttt 667



to top

>emb|CR607547.1| full-length cDNA clone CS0DI031YE16 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1378

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 511 atcagggtcagtgtggttcttgttgggctttt 542



to top

>emb|CR607374.1| full-length cDNA clone CS0DI014YJ10 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1572

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 716 atcagggtcagtgtggttcttgttgggctttt 747



to top

>emb|CR607254.1| full-length cDNA clone CS0DM005YG24 of Fetal liver of Homo sapiens
           (human)
          Length = 1364

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 487 atcagggtcagtgtggttcttgttgggctttt 518



to top

>emb|CR606843.1| full-length cDNA clone CS0DI026YP02 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1583

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 716 atcagggtcagtgtggttcttgttgggctttt 747



to top

>emb|CR606674.1| full-length cDNA clone CS0DM013YH08 of Fetal liver of Homo sapiens
           (human)
          Length = 1591

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 716 atcagggtcagtgtggttcttgttgggctttt 747



to top

>emb|CR606260.1| full-length cDNA clone CS0DI076YM01 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1447

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 571 atcagggtcagtgtggttcttgttgggctttt 602



to top

>emb|CR605661.1| full-length cDNA clone CS0DI007YM22 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1336

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 457 atcagggtcagtgtggttcttgttgggctttt 488



to top

>emb|CR605581.1| full-length cDNA clone CS0DM005YE21 of Fetal liver of Homo sapiens
           (human)
          Length = 1340

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 487 atcagggtcagtgtggttcttgttgggctttt 518



to top

>emb|CR604305.1| full-length cDNA clone CS0DI087YM03 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1430

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 571 atcagggtcagtgtggttcttgttgggctttt 602



to top

>emb|CR603807.1| full-length cDNA clone CS0DE006YL09 of Placenta of Homo sapiens
           (human)
          Length = 1510

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 648 atcagggtcagtgtggttcttgttgggctttt 679



to top

>emb|CR603622.1| full-length cDNA clone CS0DI062YA13 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1498

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 626 atcagggtcagtgtggttcttgttgggctttt 657



to top

>emb|CR602859.1| full-length cDNA clone CS0DE013YG13 of Placenta of Homo sapiens
           (human)
          Length = 1584

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 716 atcagggtcagtgtggttcttgttgggctttt 747



to top

>emb|CR601498.1| full-length cDNA clone CS0DI063YH21 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1574

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 707 atcagggtcagtgtggttcttgttgggctttt 738



to top

>emb|CR601495.1| full-length cDNA clone CS0DI062YF03 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1557

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 690 atcagggtcagtgtggttcttgttgggctttt 721



to top

>emb|CR601598.1| full-length cDNA clone CS0DI051YJ12 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1515

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 657 atcagggtcagtgtggttcttgttgggctttt 688



to top

>emb|CR600244.1| full-length cDNA clone CS0DI006YE14 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1443

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 571 atcagggtcagtgtggttcttgttgggctttt 602



to top

>dbj|AK075100.1| Homo sapiens cDNA FLJ90619 fis, clone PLACE1002374, highly similar
           to Human mRNA for pro-cathepsin L
          Length = 1437

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 548 atcagggtcagtgtggttcttgttgggctttt 579



to top

>emb|CR599034.1| full-length cDNA clone CS0DK006YK20 of HeLa cells Cot 25-normalized
           of Homo sapiens (human)
          Length = 1354

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 487 atcagggtcagtgtggttcttgttgggctttt 518



to top

>emb|CR596740.1| full-length cDNA clone CS0DI022YG23 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1475

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 545 atcagggtcagtgtggttcttgttgggctttt 576



to top

>emb|CR595891.1| full-length cDNA clone CS0DI012YI01 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1433

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 571 atcagggtcagtgtggttcttgttgggctttt 602



to top

>dbj|AK055599.1| Homo sapiens cDNA FLJ31037 fis, clone HSYRA2000137, highly similar to
            CATHEPSIN L PRECURSOR (EC 3.4.22.15)
          Length = 2175

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 439  atcaaggtcactgtggttcctgttgggctttt 470
            |||| ||||| |||||||| ||||||||||||
Sbjct: 1280 atcagggtcagtgtggttcttgttgggctttt 1311



to top

>emb|CR595268.1| full-length cDNA clone CS0DI069YC18 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1437

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 571 atcagggtcagtgtggttcttgttgggctttt 602



to top

>emb|CR595008.1| full-length cDNA clone CS0DM001YJ02 of Fetal liver of Homo sapiens
           (human)
          Length = 1411

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 545 atcagggtcagtgtggttcttgttgggctttt 576



to top

>emb|CR594363.1| full-length cDNA clone CS0DI077YM18 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1554

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 687 atcagggtcagtgtggttcttgttgggctttt 718



to top

>emb|CR593015.1| full-length cDNA clone CS0DI026YP10 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1397

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 522 atcagggtcagtgtggttcttgttgggctttt 553



to top

>emb|CR592569.1| full-length cDNA clone CS0DI055YF16 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1439

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 566 atcagggtcagtgtggttcttgttgggctttt 597



to top

>emb|CR591819.1| full-length cDNA clone CS0DI002YE08 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1592

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 716 atcagggtcagtgtggttcttgttgggctttt 747



to top

>emb|CR590723.1| full-length cDNA clone CS0DI025YI04 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1529

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 648 atcagggtcagtgtggttcttgttgggctttt 679



to top

>emb|CR590618.1| full-length cDNA clone CS0DE006YA20 of Placenta of Homo sapiens
           (human)
          Length = 1431

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 571 atcagggtcagtgtggttcttgttgggctttt 602



to top

>emb|CR590181.1| full-length cDNA clone CS0DI002YD23 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1557

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 690 atcagggtcagtgtggttcttgttgggctttt 721



to top

>emb|CR590033.1| full-length cDNA clone CS0DI014YA03 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1437

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 545 atcagggtcagtgtggttcttgttgggctttt 576



to top

>dbj|AK132648.1| Mus musculus 0 day neonate head cDNA, RIKEN full-length enriched
           library, clone:4833447E19 product:cathepsin K, full
           insert sequence
          Length = 1507

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 450 tgtggttcctgttgggcttt 469
           ||||||||||||||||||||
Sbjct: 464 tgtggttcctgttgggcttt 483



to top

>gb|AE003849.1| Xylella fastidiosa 9a5c, complete genome
          Length = 2679306

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 411    ggttgcagcacaattgggaa 430
              ||||||||||||||||||||
Sbjct: 546761 ggttgcagcacaattgggaa 546742



to top

>gb|AF239266.1|AF239266 Fasciola gigantica cathepsin L (cat-L1D) mRNA, complete cds
          Length = 981

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 450 tgtggttcctgttgggcttt 469
           ||||||||||||||||||||
Sbjct: 385 tgtggttcctgttgggcttt 404



to top

>dbj|AK003425.1| Mus musculus 18-day embryo whole body cDNA, RIKEN full-length
           enriched library, clone:1110004H19 product:cathepsin K,
           full insert sequence
          Length = 1483

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 450 tgtggttcctgttgggcttt 469
           ||||||||||||||||||||
Sbjct: 459 tgtggttcctgttgggcttt 478



to top

>gb|BT023420.1| Arabidopsis thaliana At5g25260 gene, complete cds
          Length = 1451

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 27  cctccgcttgcttctgcttg 46
           ||||||||||||||||||||
Sbjct: 983 cctccgcttgcttctgcttg 964



to top

>gb|AC108049.5| Homo sapiens BAC clone RP11-325P16 from 2, complete sequence
          Length = 89604

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 435   cttgatcaaggtcactgtgg 454
             ||||||||||||||||||||
Sbjct: 66984 cttgatcaaggtcactgtgg 66965



to top

>gb|AF201700.1|AF201700 Cercopithecus aethiops cysteine protease mRNA, complete cds
          Length = 1452

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 574 atcagggtcaatgtggttcttgttgggctttt 605



to top

>ref|NM_213892.1| Sus scrofa cathepsin L (CTSL2), mRNA
          Length = 1378

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 469 atcagggtcagtgtggttcttgttgggctttt 500



to top

>gb|AY890446.1| Synthetic construct Homo sapiens clone FLH140202.01X cathepsin L
           (CTSL) mRNA, complete cds
          Length = 1002

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 392 atcagggtcagtgtggttcttgttgggctttt 423



to top

>dbj|BS000063.1| Pan troglodytes chromosome 22 clone:PTB-428P03, map 22, complete
             sequences
          Length = 136131

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 563   tatgtgtggtgatggttgtg 582
             ||||||||||||||||||||
Sbjct: 74570 tatgtgtggtgatggttgtg 74589



to top

>emb|BX647435.1|HSM807580 Homo sapiens mRNA; cDNA DKFZp686J08158 (from clone DKFZp686J08158)
          Length = 1513

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 592 atcagggtcagtgtggttcttgttgggctttt 623



to top

>emb|BX647434.1|HSM807579 Homo sapiens mRNA; cDNA DKFZp686B07158 (from clone DKFZp686B07158)
          Length = 1516

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 595 atcagggtcagtgtggttcttgttgggctttt 626



to top

>emb|BX647413.1|HSM807558 Homo sapiens mRNA; cDNA DKFZp686B10158 (from clone DKFZp686B10158)
          Length = 1448

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 537 atcagggtcagtgtggttcttgttgggctttt 568



to top

>gb|AF240629.1|AF240629 Homo sapiens chromosome 21 map 21q21 clone B47C12, complete sequence
          Length = 151696

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 563   tatgtgtggtgatggttgtg 582
             ||||||||||||||||||||
Sbjct: 73704 tatgtgtggtgatggttgtg 73723



to top

>emb|BX649140.1|HSM809292 Homo sapiens mRNA; cDNA DKFZp686L20157 (from clone DKFZp686L20157)
          Length = 1499

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 593 atcagggtcagtgtggttcttgttgggctttt 624



to top

>emb|BX648849.1|HSM809000 Homo sapiens mRNA; cDNA DKFZp686A04157 (from clone DKFZp686A04157)
          Length = 1453

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 537 atcagggtcagtgtggttcttgttgggctttt 568



to top

>emb|BX648848.1|HSM808999 Homo sapiens mRNA; cDNA DKFZp686A03157 (from clone DKFZp686A03157)
          Length = 1459

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 547 atcagggtcagtgtggttcttgttgggctttt 578



to top

>emb|BX647102.1|HSM807246 Homo sapiens mRNA; cDNA DKFZp686F10158 (from clone DKFZp686F10158)
          Length = 1449

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 536 atcagggtcagtgtggttcttgttgggctttt 567



to top

>emb|BX647101.1|HSM807245 Homo sapiens mRNA; cDNA DKFZp686D14158 (from clone DKFZp686D14158)
          Length = 1471

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 537 atcagggtcagtgtggttcttgttgggctttt 568



to top

>emb|AJ303304.1|HEC303304 Hepatitis C virus type 1b partial mRNA for p7/NS2 protein
           (e2(p7)-NS2 gene), clone B236b12
          Length = 212

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 101 cctgctcccgctggcgctgc 120
           ||||||||||||||||||||
Sbjct: 74  cctgctcccgctggcgctgc 93



to top

>ref|XM_560519.1| Anopheles gambiae str. PEST ENSANGP00000028370
           (ENSANGG00000022283), partial mRNA
          Length = 297

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 277 acactattgagcaatttaag 296
           ||||||||||||||||||||
Sbjct: 167 acactattgagcaatttaag 186



to top

>gb|AY893779.1| Synthetic construct Homo sapiens clone FLH053856.01L cathepsin L
           (CTSL) mRNA, partial cds
          Length = 1002

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 392 atcagggtcagtgtggttcttgttgggctttt 423



to top

>gb|BC078793.1| Rattus norvegicus cathepsin K, mRNA (cDNA clone MGC:93359
           IMAGE:7134253), complete cds
          Length = 1446

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 450 tgtggttcctgttgggcttt 469
           ||||||||||||||||||||
Sbjct: 479 tgtggttcctgttgggcttt 498



to top

>gb|U62289.1|FHU62289 Fasciola hepatica secreted cathepsin L 2 (FheCL2) mRNA, complete
           cds
          Length = 1053

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 450 tgtggttcctgttgggcttt 469
           ||||||||||||||||||||
Sbjct: 400 tgtggttcctgttgggcttt 419



to top

>dbj|AP001679.1| Homo sapiens genomic DNA, chromosome 21q, section 23/105
          Length = 340000

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 563    tatgtgtggtgatggttgtg 582
              ||||||||||||||||||||
Sbjct: 259595 tatgtgtggtgatggttgtg 259614



to top

>dbj|AP006199.1| Homo sapiens genomic DNA, chromosome 6, clone:RP11-482B5, complete
              sequence
          Length = 188161

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 566    gtgtggtgatggttgtgatg 585
              ||||||||||||||||||||
Sbjct: 134332 gtgtggtgatggttgtgatg 134351



to top

>dbj|AP006196.1| Homo sapiens genomic DNA, chromosome 6, clone:RP11-347H8, complete
            sequence
          Length = 181660

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 566  gtgtggtgatggttgtgatg 585
            ||||||||||||||||||||
Sbjct: 8674 gtgtggtgatggttgtgatg 8693



to top

>gb|AC092203.16| Mus musculus strain C57BL/6J chromosome 3 clone rp23-422n18, complete
              sequence
          Length = 188880

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 450    tgtggttcctgttgggcttt 469
              ||||||||||||||||||||
Sbjct: 113194 tgtggttcctgttgggcttt 113175



to top

>gb|AY609853.1| Sus scrofa clone Clu_3550.scr.msk.p1.Contig6, mRNA sequence
          Length = 1456

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 468 atcagggtcagtgtggttcttgttgggctttt 499



to top

>emb|AL832167.1|HSM803474 Homo sapiens mRNA; cDNA DKFZp686K15158 (from clone DKFZp686K15158)
          Length = 1454

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 540 atcagggtcagtgtggttcttgttgggctttt 571



to top

>gb|AF010306.1|AF010306 Rattus norvegicus cathepsin K mRNA, complete cds
          Length = 1248

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 450 tgtggttcctgttgggcttt 469
           ||||||||||||||||||||
Sbjct: 448 tgtggttcctgttgggcttt 467



to top

>emb|AL672267.10| Mouse DNA sequence from clone RP23-377K9 on chromosome X, complete
             sequence
          Length = 169331

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 551   ttgctgtgggtttatgtgtg 570
             ||||||||||||||||||||
Sbjct: 79928 ttgctgtgggtttatgtgtg 79947



to top

>emb|AL844881.5| Mouse DNA sequence from clone RP23-244B19 on chromosome 2, complete
              sequence
          Length = 219340

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 449    ctgtggttcctgttgggctt 468
              ||||||||||||||||||||
Sbjct: 138909 ctgtggttcctgttgggctt 138928



to top

>gb|M20496.1|HUMPROLA Human cathepsin L gene, complete cds
          Length = 1404

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 525 atcagggtcagtgtggttcttgttgggctttt 556



to top

>emb|AL929125.1| Mouse DNA sequence from clone RP23-262O4 on chromosome 2, complete
             sequence
          Length = 183595

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 569   tggtgatggttgtgatggag 588
             ||||||||||||||||||||
Sbjct: 75985 tggtgatggttgtgatggag 75966



to top

>dbj|AP000957.2| Homo sapiens genomic DNA, chromosome 21q21.1-q21.2 clone:B781M3,
             LL56-APP region, complete sequence
          Length = 190937

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 563   tatgtgtggtgatggttgtg 582
             ||||||||||||||||||||
Sbjct: 31684 tatgtgtggtgatggttgtg 31703



to top

>dbj|AP002529.1| Homo sapiens genomic DNA, chromosome 6q21, anti-oncogene region,
             section 2/4
          Length = 300000

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 566   gtgtggtgatggttgtgatg 585
             ||||||||||||||||||||
Sbjct: 44075 gtgtggtgatggttgtgatg 44094



to top

>dbj|AB041731.1| Homo sapiens genomic DNA, chromosome 6q21, BAC clone:706L14, complete
              sequence
          Length = 156242

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 566    gtgtggtgatggttgtgatg 585
              ||||||||||||||||||||
Sbjct: 137302 gtgtggtgatggttgtgatg 137321



to top

>dbj|AB042031.1| Homo sapiens genomic DNA, chromosome 6q21, BAC clone:515A4, complete
             sequence
          Length = 194732

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 566   gtgtggtgatggttgtgatg 585
             ||||||||||||||||||||
Sbjct: 33999 gtgtggtgatggttgtgatg 34018



to top

>dbj|D37917.1|PIGPCL Boar mRNA for porcine cathepsin L, complete cds
          Length = 1378

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 439 atcaaggtcactgtggttcctgttgggctttt 470
           |||| ||||| |||||||| ||||||||||||
Sbjct: 469 atcagggtcagtgtggttcttgttgggctttt 500


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,132,900
Number of Sequences: 3902068
Number of extensions: 5132900
Number of successful extensions: 111973
Number of sequences better than 10.0: 218
Number of HSP's better than 10.0 without gapping: 218
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 111517
Number of HSP's gapped (non-prelim): 451
length of query: 621
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 598
effective length of database: 17,143,297,704
effective search space: 10251692026992
effective search space used: 10251692026992
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top