Clone Name | bah63f09 |
---|---|
Clone Library Name | barley_pub |
>emb|AJ310426.1|HVU310426 Hordeum vulgare mRNA for cathepsin B (cathB gene) Length = 1277 Score = 920 bits (464), Expect = 0.0 Identities = 470/472 (99%) Strand = Plus / Plus Query: 150 ccccagctcgccagagcggcagggggaggccattccctaggaatcatccagaaaggcatc 209 |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 131 ccccagctcgccggagcggcagggggaggccattccctaggaatcatccagaaaggcatc 190 Query: 210 atacagacggtcaacaaccatcccaacgccggatggacggctggacacaacccctacctc 269 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 191 atacagacggtcaacaaccatcccaacgccggatggacggctggacacaacccctacctc 250 Query: 270 gccaattacactattgagcaatttaagcatatgctgggagtgaaaccaacacctccaggt 329 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 251 gccaattacactattgagcaatttaagcatatgctgggagtgaaaccaacacctccaggt 310 Query: 330 ttactggctggtgttcgaaccaaaactcatccaaggtcagagcagctcccaaaggagttc 389 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 311 ttactggctggtgttcgaaccaaaactcatccaaggtcagagcagctcccaaaggagttc 370 Query: 390 gacgccaggtcgaaatggtccggttgcagcacaattgggaaaatacttgatcaaggtcac 449 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 371 gacgccaggtcgaaatggtccggttgcagcacaattgggaaaatacttgatcaaggtcac 430 Query: 450 tgtggttcctgttgggcttttggagctgtggagtgtctgcaagatcgtttctgcatccat 509 || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 431 tgcggttcctgttgggcttttggagctgtggagtgtctgcaagatcgtttctgcatccat 490 Query: 510 cacaacatgaacatttcactttctgccaatgacctagtggcttgctgtgggtttatgtgt 569 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 491 cacaacatgaacatttcactttctgccaatgacctagtggcttgctgtgggtttatgtgt 550 Query: 570 ggtgatggttgtgatggaggatatcctatcagcgcatggcaatacttcgtcc 621 |||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 551 ggtgatggttgtgatggaggatatcctatcagcgcatggcaatacttcgtcc 602 Score = 165 bits (83), Expect = 2e-37 Identities = 86/87 (98%) Strand = Plus / Plus Query: 42 gcttgcttcctcctccctcccaccgcgcgtcgccgatcgaggacgaagatggggagcggc 101 ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Sbjct: 23 gcttgcttcctcctccctcccaccgtgcgtcgccgatcgaggacgaagatggggagcggc 82 Query: 102 ctgctcccgctggcgctgctcgtcgtc 128 ||||||||||||||||||||||||||| Sbjct: 83 ctgctcccgctggcgctgctcgtcgtc 109
>emb|X66012.1|TACATHBA T.aestivum mRNA 1 for cathepsin B (2529) Length = 1065 Score = 664 bits (335), Expect = 0.0 Identities = 395/415 (95%) Strand = Plus / Plus Query: 207 atcatacagacggtcaacaaccatcccaacgccggatggacggctggacacaacccctac 266 |||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| Sbjct: 1 atcatacaaacggtcaacaaccaccccaacgccggatggacggctggacacaacccctac 60 Query: 267 ctcgccaattacactattgagcaatttaagcatatgctgggagtgaaaccaacacctcca 326 ||||| ||||||||||||||||||||||||||||||||||||||||| ||||| |||||| Sbjct: 61 ctcgcgaattacactattgagcaatttaagcatatgctgggagtgaagccaacgcctcca 120 Query: 327 ggtttactggctggtgttcgaaccaaaactcatccaaggtcagagcagctcccaaaggag 386 ||||||| ||||| |||||| |||||||||||| |||| || |||||||||||||||| | Sbjct: 121 ggtttacgggctgctgttcgcaccaaaactcattcaagatcggagcagctcccaaaggtg 180 Query: 387 ttcgacgccaggtcgaaatggtccggttgcagcacaattgggaaaatacttgatcaaggt 446 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 181 ttcgacgccaggtcgaaatggtccggttgcagcacaattgggaaaatacttgatcaaggt 240 Query: 447 cactgtggttcctgttgggcttttggagctgtggagtgtctgcaagatcgtttctgcatc 506 |||||||||||||| ||||||||||| || |||||||| ||||||||||||||||||||| Sbjct: 241 cactgtggttcctgctgggcttttggtgccgtggagtgcctgcaagatcgtttctgcatc 300 Query: 507 catcacaacatgaacatttcactttctgccaatgacctagtggcttgctgtgggtttatg 566 |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct: 301 catcacaacatgaacattacactttctgccaatgacctagtggcttgctgtgggtttatg 360 Query: 567 tgtggtgatggttgtgatggaggatatcctatcagcgcatggcaatacttcgtcc 621 ||||| ||||||||||||||||||||||||||||| || |||||||||||||||| Sbjct: 361 tgtggcgatggttgtgatggaggatatcctatcagtgcgtggcaatacttcgtcc 415
>emb|X66015.1|TACATHBC T.aestivum mRNA 3 for cathepsin B (2557) Length = 491 Score = 466 bits (235), Expect = e-128 Identities = 286/303 (94%) Strand = Plus / Plus Query: 179 ccattccctaggaatcatccagaaaggcatcatacagacggtcaacaaccatcccaacgc 238 |||||||||||||||||||||||||| |||||||| |||||||||||||| |||||||| Sbjct: 189 ccattccctaggaatcatccagaaagatatcatacaaacggtcaacaaccaccccaacgc 248 Query: 239 cggatggacggctggacacaacccctacctcgccaattacactattgagcaatttaagca 298 ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| Sbjct: 249 cggatggacggctggacacaacccctacctcgcgaattacactattgagcaatttaagca 308 Query: 299 tatgctgggagtgaaaccaacacctccaggtttactggctggtgttcgaaccaaaactca 358 ||||||||||||||| ||||| ||||||||||||| ||||| |||||| ||||||||||| Sbjct: 309 tatgctgggagtgaagccaacgcctccaggtttacgggctgctgttcgcaccaaaactca 368 Query: 359 tccaaggtcagagcagctcccaaaggagttcgacgccaggtcgaaatggtccggttgcag 418 | |||| || |||||||||||||||| ||||||||||||||||||||||||||||||||| Sbjct: 369 ttcaagatcggagcagctcccaaaggtgttcgacgccaggtcgaaatggtccggttgcag 428 Query: 419 cacaattgggaaaatacttgatcaaggtcactgtggttcctgttgggcttttggagctgt 478 |||||||||||||||||||||||||||||||||||||||||| ||||||||||| || || Sbjct: 429 cacaattgggaaaatacttgatcaaggtcactgtggttcctgctgggcttttggtgccgt 488 Query: 479 gga 481 ||| Sbjct: 489 gga 491
>emb|X66014.1|TACATHBB T.aestivum mRNA 2 for cathepsin B (2077) Length = 1216 Score = 196 bits (99), Expect = 6e-47 Identities = 162/183 (88%) Strand = Plus / Plus Query: 180 cattccctaggaatcatccagaaaggcatcatacagacggtcaacaaccatcccaacgcc 239 ||||||||||||||||||||||| | |||||| |||||||||||||| |||||||| ||| Sbjct: 152 cattccctaggaatcatccagaaggacatcattcagacggtcaacaagcatcccaatgcc 211 Query: 240 ggatggacggctggacacaacccctacctcgccaattacactattgagcaatttaagcat 299 || |||||||||||||||||||||||| | || || ||||||||||||||||| |||||| Sbjct: 212 gggtggacggctggacacaacccctactttgcaaactacactattgagcaattcaagcat 271 Query: 300 atgctgggagtgaaaccaacacctccaggtttactggctggtgttcgaaccaaaactcat 359 || ||||||||||| ||||| ||||| ||||| || |||||||||| | ||||| |||| Sbjct: 272 atcctgggagtgaagccaacgcctccgggtttgctcgctggtgttccgatcaaaattcat 331 Query: 360 cca 362 ||| Sbjct: 332 cca 334 Score = 188 bits (95), Expect = 1e-44 Identities = 179/207 (86%) Strand = Plus / Plus Query: 403 aatggtccggttgcagcacaattgggaaaatacttgatcaaggtcactgtggttcctgtt 462 |||||||| ||||||||||||||||||| |||||||||||||||||||||||| |||||| Sbjct: 372 aatggtccagttgcagcacaattgggaacatacttgatcaaggtcactgtggtgcctgtt 431 Query: 463 gggcttttggagctgtggagtgtctgcaagatcgtttctgcatccatcacaacatgaaca 522 |||| |||| || ||||| ||| || ||||||||||| || |||| |||||||| | Sbjct: 432 gggcctttgctgccgtggaagctctccaggatcgtttctgtattcatctcaacatgagcg 491 Query: 523 tttcactttctgccaatgacctagtggcttgctgtgggtttatgtgtggtgatggttgtg 582 | || ||||| | |||||||||| ||||||||||||| ||| |||||||| |||||| Sbjct: 492 tctccctttcggtcaatgacctactggcttgctgtggttttctgtgtggtagcggttgta 551 Query: 583 atggaggatatcctatcagcgcatggc 609 ||||||||||||||||||||||||||| Sbjct: 552 atggaggatatcctatcagcgcatggc 578
>gb|BT016464.1| Zea mays clone Contig297 mRNA sequence Length = 1136 Score = 188 bits (95), Expect = 1e-44 Identities = 170/195 (87%) Strand = Plus / Plus Query: 404 atggtccggttgcagcacaattgggaaaatacttgatcaaggtcactgtggttcctgttg 463 ||||||| ||||||||||||||||||| ||||||||||||||||||||||| || ||||| Sbjct: 164 atggtcccgttgcagcacaattgggaacatacttgatcaaggtcactgtggctcttgttg 223 Query: 464 ggcttttggagctgtggagtgtctgcaagatcgtttctgcatccatcacaacatgaacat 523 ||||||||| ||||||||||| || || || ||||| ||||| || | |||||||| ||| Sbjct: 224 ggcttttggtgctgtggagtgcctccaggaccgtttttgcattcacctcaacatgagcat 283 Query: 524 ttcactttctgccaatgacctagtggcttgctgtgggtttatgtgtggtgatggttgtga 583 || |||||| | |||||||||| |||| ||||| || |||||||| || ||||| ||||| Sbjct: 284 tttactttcagtcaatgacctactggcatgctgcggttttatgtgcggcgatgggtgtga 343 Query: 584 tggaggatatcctat 598 |||||| |||||||| Sbjct: 344 tggaggctatcctat 358 Score = 40.1 bits (20), Expect = 8.5 Identities = 32/36 (88%) Strand = Plus / Plus Query: 287 gcaatttaagcatatgctgggagtgaaaccaacacc 322 |||||||||||| || || |||||||||||| |||| Sbjct: 47 gcaatttaagcacatacttggagtgaaaccagcacc 82
>dbj|AK101093.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033024N03, full insert sequence Length = 1437 Score = 188 bits (95), Expect = 1e-44 Identities = 167/191 (87%) Strand = Plus / Plus Query: 419 cacaattgggaaaatacttgatcaaggtcactgtggttcctgttgggcttttggagctgt 478 ||||||||||| ||||||||||| ||||||||||| || |||||||| ||||| ||||| Sbjct: 540 cacaattgggaccatacttgatcagggtcactgtggctcgtgttgggcatttggtgctgt 599 Query: 479 ggagtgtctgcaagatcgtttctgcatccatcacaacatgaacatttcactttctgccaa 538 ||||||||| || |||||||||||||| ||| ||||||||||||||| || |||| ||| Sbjct: 600 ggagtgtctccaggatcgtttctgcattcatttcaacatgaacatttcgctatctgtcaa 659 Query: 539 tgacctagtggcttgctgtgggtttatgtgtggtgatggttgtgatggaggatatcctat 598 |||||||||||| ||||| || || ||||| || ||||||||||||||||| |||||||| Sbjct: 660 tgacctagtggcatgctgcggtttcatgtgcggcgatggttgtgatggaggctatcctat 719 Query: 599 cagcgcatggc 609 || ||||||| Sbjct: 720 catggcatggc 730 Score = 42.1 bits (21), Expect = 2.1 Identities = 105/133 (78%) Strand = Plus / Plus Query: 190 gaatcatccagaaaggcatcatacagacggtcaacaaccatcccaacgccggatggacgg 249 ||||||||||| | | ||||||| || | ||||||| |||||||| || || ||||||| Sbjct: 311 gaatcatccaggacgacatcataaaggcaatcaacaagcatcccaatgctggctggacgg 370 Query: 250 ctggacacaacccctacctcgccaattacactattgagcaatttaagcatatgctgggag 309 ||| || || || ||| | || || || |||| || |||||| || ||||| || |||| Sbjct: 371 ctgcacggaatccatactttgcaaactatactactgcgcaattcaaacatatccttggag 430 Query: 310 tgaaaccaacacc 322 |||| |||||||| Sbjct: 431 tgaagccaacacc 443
>dbj|AK100225.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023047M19, full insert sequence Length = 1436 Score = 188 bits (95), Expect = 1e-44 Identities = 167/191 (87%) Strand = Plus / Plus Query: 419 cacaattgggaaaatacttgatcaaggtcactgtggttcctgttgggcttttggagctgt 478 ||||||||||| ||||||||||| ||||||||||| || |||||||| ||||| ||||| Sbjct: 538 cacaattgggaccatacttgatcagggtcactgtggctcgtgttgggcatttggtgctgt 597 Query: 479 ggagtgtctgcaagatcgtttctgcatccatcacaacatgaacatttcactttctgccaa 538 ||||||||| || |||||||||||||| ||| ||||||||||||||| || |||| ||| Sbjct: 598 ggagtgtctccaggatcgtttctgcattcatttcaacatgaacatttcgctatctgtcaa 657 Query: 539 tgacctagtggcttgctgtgggtttatgtgtggtgatggttgtgatggaggatatcctat 598 |||||||||||| ||||| || || ||||| || ||||||||||||||||| |||||||| Sbjct: 658 tgacctagtggcatgctgcggtttcatgtgcggcgatggttgtgatggaggctatcctat 717 Query: 599 cagcgcatggc 609 || ||||||| Sbjct: 718 catggcatggc 728 Score = 42.1 bits (21), Expect = 2.1 Identities = 105/133 (78%) Strand = Plus / Plus Query: 190 gaatcatccagaaaggcatcatacagacggtcaacaaccatcccaacgccggatggacgg 249 ||||||||||| | | ||||||| || | ||||||| |||||||| || || ||||||| Sbjct: 309 gaatcatccaggacgacatcataaaggcaatcaacaagcatcccaatgctggctggacgg 368 Query: 250 ctggacacaacccctacctcgccaattacactattgagcaatttaagcatatgctgggag 309 ||| || || || ||| | || || || |||| || |||||| || ||||| || |||| Sbjct: 369 ctgcacggaatccatactttgcaaactatactactgcgcaattcaaacatatccttggag 428 Query: 310 tgaaaccaacacc 322 |||| |||||||| Sbjct: 429 tgaagccaacacc 441
>dbj|AK068459.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013151C17, full insert sequence Length = 3464 Score = 188 bits (95), Expect = 1e-44 Identities = 167/191 (87%) Strand = Plus / Plus Query: 419 cacaattgggaaaatacttgatcaaggtcactgtggttcctgttgggcttttggagctgt 478 ||||||||||| ||||||||||| ||||||||||| || |||||||| ||||| ||||| Sbjct: 669 cacaattgggaccatacttgatcagggtcactgtggctcgtgttgggcatttggtgctgt 728 Query: 479 ggagtgtctgcaagatcgtttctgcatccatcacaacatgaacatttcactttctgccaa 538 ||||||||| || |||||||||||||| ||| ||||||||||||||| || |||| ||| Sbjct: 729 ggagtgtctccaggatcgtttctgcattcatttcaacatgaacatttcgctatctgtcaa 788 Query: 539 tgacctagtggcttgctgtgggtttatgtgtggtgatggttgtgatggaggatatcctat 598 |||||||||||| ||||| || || ||||| || ||||||||||||||||| |||||||| Sbjct: 789 tgacctagtggcatgctgcggtttcatgtgcggcgatggttgtgatggaggctatcctat 848 Query: 599 cagcgcatggc 609 || ||||||| Sbjct: 849 catggcatggc 859
>dbj|AK064820.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000E23, full insert sequence Length = 1369 Score = 188 bits (95), Expect = 1e-44 Identities = 167/191 (87%) Strand = Plus / Plus Query: 419 cacaattgggaaaatacttgatcaaggtcactgtggttcctgttgggcttttggagctgt 478 ||||||||||| ||||||||||| ||||||||||| || |||||||| ||||| ||||| Sbjct: 471 cacaattgggaccatacttgatcagggtcactgtggctcgtgttgggcatttggtgctgt 530 Query: 479 ggagtgtctgcaagatcgtttctgcatccatcacaacatgaacatttcactttctgccaa 538 ||||||||| || |||||||||||||| ||| ||||||||||||||| || |||| ||| Sbjct: 531 ggagtgtctccaggatcgtttctgcattcatttcaacatgaacatttcgctatctgtcaa 590 Query: 539 tgacctagtggcttgctgtgggtttatgtgtggtgatggttgtgatggaggatatcctat 598 |||||||||||| ||||| || || ||||| || ||||||||||||||||| |||||||| Sbjct: 591 tgacctagtggcatgctgcggtttcatgtgcggcgatggttgtgatggaggctatcctat 650 Query: 599 cagcgcatggc 609 || ||||||| Sbjct: 651 catggcatggc 661 Score = 42.1 bits (21), Expect = 2.1 Identities = 105/133 (78%) Strand = Plus / Plus Query: 190 gaatcatccagaaaggcatcatacagacggtcaacaaccatcccaacgccggatggacgg 249 ||||||||||| | | ||||||| || | ||||||| |||||||| || || ||||||| Sbjct: 242 gaatcatccaggacgacatcataaaggcaatcaacaagcatcccaatgctggctggacgg 301 Query: 250 ctggacacaacccctacctcgccaattacactattgagcaatttaagcatatgctgggag 309 ||| || || || ||| | || || || |||| || |||||| || ||||| || |||| Sbjct: 302 ctgcacggaatccatactttgcaaactatactactgcgcaattcaaacatatccttggag 361 Query: 310 tgaaaccaacacc 322 |||| |||||||| Sbjct: 362 tgaagccaacacc 374
>dbj|AK059697.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-032-C04, full insert sequence Length = 1565 Score = 188 bits (95), Expect = 1e-44 Identities = 167/191 (87%) Strand = Plus / Plus Query: 419 cacaattgggaaaatacttgatcaaggtcactgtggttcctgttgggcttttggagctgt 478 ||||||||||| ||||||||||| ||||||||||| || |||||||| ||||| ||||| Sbjct: 470 cacaattgggaccatacttgatcagggtcactgtggctcgtgttgggcatttggtgctgt 529 Query: 479 ggagtgtctgcaagatcgtttctgcatccatcacaacatgaacatttcactttctgccaa 538 ||||||||| || |||||||||||||| ||| ||||||||||||||| || |||| ||| Sbjct: 530 ggagtgtctccaggatcgtttctgcattcatttcaacatgaacatttcgctatctgtcaa 589 Query: 539 tgacctagtggcttgctgtgggtttatgtgtggtgatggttgtgatggaggatatcctat 598 |||||||||||| ||||| || || ||||| || ||||||||||||||||| |||||||| Sbjct: 590 tgacctagtggcatgctgcggtttcatgtgcggcgatggttgtgatggaggctatcctat 649 Query: 599 cagcgcatggc 609 || ||||||| Sbjct: 650 catggcatggc 660 Score = 42.1 bits (21), Expect = 2.1 Identities = 105/133 (78%) Strand = Plus / Plus Query: 190 gaatcatccagaaaggcatcatacagacggtcaacaaccatcccaacgccggatggacgg 249 ||||||||||| | | ||||||| || | ||||||| |||||||| || || ||||||| Sbjct: 241 gaatcatccaggacgacatcataaaggcaatcaacaagcatcccaatgctggctggacgg 300 Query: 250 ctggacacaacccctacctcgccaattacactattgagcaatttaagcatatgctgggag 309 ||| || || || ||| | || || || |||| || |||||| || ||||| || |||| Sbjct: 301 ctgcacggaatccatactttgcaaactatactactgcgcaattcaaacatatccttggag 360 Query: 310 tgaaaccaacacc 322 |||| |||||||| Sbjct: 361 tgaagccaacacc 373
>gb|AY916493.1| Oryza sativa (japonica cultivar-group) cathepsin B-like cysteine protease mRNA, complete cds Length = 1475 Score = 188 bits (95), Expect = 1e-44 Identities = 167/191 (87%) Strand = Plus / Plus Query: 419 cacaattgggaaaatacttgatcaaggtcactgtggttcctgttgggcttttggagctgt 478 ||||||||||| ||||||||||| ||||||||||| || |||||||| ||||| ||||| Sbjct: 492 cacaattgggaccatacttgatcagggtcactgtggctcgtgttgggcatttggtgctgt 551 Query: 479 ggagtgtctgcaagatcgtttctgcatccatcacaacatgaacatttcactttctgccaa 538 ||||||||| || |||||||||||||| ||| ||||||||||||||| || |||| ||| Sbjct: 552 ggagtgtctccaggatcgtttctgcattcatttcaacatgaacatttcgctatctgtcaa 611 Query: 539 tgacctagtggcttgctgtgggtttatgtgtggtgatggttgtgatggaggatatcctat 598 |||||||||||| ||||| || || ||||| || ||||||||||||||||| |||||||| Sbjct: 612 tgacctagtggcatgctgcggtttcatgtgcggcgatggttgtgatggaggctatcctat 671 Query: 599 cagcgcatggc 609 || ||||||| Sbjct: 672 catggcatggc 682 Score = 42.1 bits (21), Expect = 2.1 Identities = 105/133 (78%) Strand = Plus / Plus Query: 190 gaatcatccagaaaggcatcatacagacggtcaacaaccatcccaacgccggatggacgg 249 ||||||||||| | | ||||||| || | ||||||| |||||||| || || ||||||| Sbjct: 263 gaatcatccaggacgacatcataaaggcaatcaacaagcatcccaatgctggctggacgg 322 Query: 250 ctggacacaacccctacctcgccaattacactattgagcaatttaagcatatgctgggag 309 ||| || || || ||| | || || || |||| || |||||| || ||||| || |||| Sbjct: 323 ctgcacggaatccatactttgcaaactatactactgcgcaattcaaacatatccttggag 382 Query: 310 tgaaaccaacacc 322 |||| |||||||| Sbjct: 383 tgaagccaacacc 395
>emb|X66013.1|TACATHBG T.aestivum gene for cathepsin B (Al16) Length = 4792 Score = 91.7 bits (46), Expect = 3e-15 Identities = 67/74 (90%) Strand = Plus / Plus Query: 536 caatgacctagtggcttgctgtgggtttatgtgtggtgatggttgtgatggaggatatcc 595 |||||||||| ||||||||||||| ||| |||||||| |||||| ||||||||||||| Sbjct: 2484 caatgacctactggcttgctgtggttttctgtgtggtagcggttgtaatggaggatatcc 2543 Query: 596 tatcagcgcatggc 609 |||||||||||||| Sbjct: 2544 tatcagcgcatggc 2557 Score = 89.7 bits (45), Expect = 1e-14 Identities = 57/61 (93%) Strand = Plus / Plus Query: 206 catcatacagacggtcaacaaccatcccaacgccggatggacggctggacacaaccccta 265 |||||| |||||||||||||| |||||||| ||||| ||||||||||||||||||||||| Sbjct: 1709 catcattcagacggtcaacaagcatcccaatgccgggtggacggctggacacaaccccta 1768 Query: 266 c 266 | Sbjct: 1769 c 1769 Score = 73.8 bits (37), Expect = 6e-10 Identities = 70/81 (86%) Strand = Plus / Plus Query: 282 attgagcaatttaagcatatgctgggagtgaaaccaacacctccaggtttactggctggt 341 ||||||||||| |||||||| ||||||||||| ||||| ||||| ||||| || |||||| Sbjct: 1885 attgagcaattcaagcatatcctgggagtgaagccaacgcctccgggtttgctcgctggt 1944 Query: 342 gttcgaaccaaaactcatcca 362 |||| | ||||| ||||||| Sbjct: 1945 gttccgatcaaaattcatcca 1965 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 403 aatggtccggttgcagcacaattgggaaaatacttg 438 |||||||| ||||||||||||||||||| ||||||| Sbjct: 2003 aatggtccagttgcagcacaattgggaacatacttg 2038 Score = 46.1 bits (23), Expect = 0.14 Identities = 62/75 (82%) Strand = Plus / Plus Query: 444 ggtcactgtggttcctgttgggcttttggagctgtggagtgtctgcaagatcgtttctgc 503 |||||||||||| |||||||||| |||| || ||||| ||| || ||||||||||| Sbjct: 2290 ggtcactgtggtgcctgttgggcctttgctgccgtggaagctctccaggatcgtttctgt 2349 Query: 504 atccatcacaacatg 518 || |||| ||||||| Sbjct: 2350 attcatctcaacatg 2364 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 180 cattccctaggaatcatccag 200 ||||||||||||||||||||| Sbjct: 1592 cattccctaggaatcatccag 1612
>gb|AC132490.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0570A02, complete sequence Length = 146541 Score = 87.7 bits (44), Expect = 4e-14 Identities = 80/92 (86%) Strand = Plus / Plus Query: 518 gaacatttcactttctgccaatgacctagtggcttgctgtgggtttatgtgtggtgatgg 577 ||||||||| || |||| ||||||||||||||| ||||| || || ||||| || ||||| Sbjct: 110408 gaacatttcgctatctgtcaatgacctagtggcatgctgcggtttcatgtgcggcgatgg 110467 Query: 578 ttgtgatggaggatatcctatcagcgcatggc 609 |||||||||||| |||||||||| ||||||| Sbjct: 110468 ttgtgatggaggctatcctatcatggcatggc 110499 Score = 77.8 bits (39), Expect = 4e-11 Identities = 66/75 (88%) Strand = Plus / Plus Query: 444 ggtcactgtggttcctgttgggcttttggagctgtggagtgtctgcaagatcgtttctgc 503 ||||||||||| || |||||||| ||||| |||||||||||||| || |||||||||||| Sbjct: 110229 ggtcactgtggctcgtgttgggcatttggtgctgtggagtgtctccaggatcgtttctgc 110288 Query: 504 atccatcacaacatg 518 || ||| ||||||| Sbjct: 110289 attcatttcaacatg 110303
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 87.7 bits (44), Expect = 4e-14 Identities = 80/92 (86%) Strand = Plus / Plus Query: 518 gaacatttcactttctgccaatgacctagtggcttgctgtgggtttatgtgtggtgatgg 577 ||||||||| || |||| ||||||||||||||| ||||| || || ||||| || ||||| Sbjct: 14030331 gaacatttcgctatctgtcaatgacctagtggcatgctgcggtttcatgtgcggcgatgg 14030390 Query: 578 ttgtgatggaggatatcctatcagcgcatggc 609 |||||||||||| |||||||||| ||||||| Sbjct: 14030391 ttgtgatggaggctatcctatcatggcatggc 14030422 Score = 77.8 bits (39), Expect = 4e-11 Identities = 66/75 (88%) Strand = Plus / Plus Query: 444 ggtcactgtggttcctgttgggcttttggagctgtggagtgtctgcaagatcgtttctgc 503 ||||||||||| || |||||||| ||||| |||||||||||||| || |||||||||||| Sbjct: 14030152 ggtcactgtggctcgtgttgggcatttggtgctgtggagtgtctccaggatcgtttctgc 14030211 Query: 504 atccatcacaacatg 518 || ||| ||||||| Sbjct: 14030212 attcatttcaacatg 14030226
>gb|AY112465.1| Zea mays CL31697_1 mRNA sequence Length = 1472 Score = 85.7 bits (43), Expect = 2e-13 Identities = 49/51 (96%) Strand = Plus / Minus Query: 404 atggtccggttgcagcacaattgggaaaatacttgatcaaggtcactgtgg 454 ||||||| ||||||||||||||||||| ||||||||||||||||||||||| Sbjct: 925 atggtcccgttgcagcacaattgggaacatacttgatcaaggtcactgtgg 875 Score = 77.8 bits (39), Expect = 4e-11 Identities = 75/87 (86%) Strand = Plus / Minus Query: 512 caacatgaacatttcactttctgccaatgacctagtggcttgctgtgggtttatgtgtgg 571 |||||||| ||||| |||||| | |||||||||| |||| ||||| || |||||||| || Sbjct: 817 caacatgagcattttactttcagtcaatgacctactggcatgctgcggttttatgtgcgg 758 Query: 572 tgatggttgtgatggaggatatcctat 598 ||||| ||||||||||| |||||||| Sbjct: 757 cgatgggtgtgatggaggctatcctat 731 Score = 42.1 bits (21), Expect = 2.1 Identities = 39/45 (86%) Strand = Plus / Minus Query: 190 gaatcatccagaaaggcatcatacagacggtcaacaaccatccca 234 ||||||||||| | | |||||| |||| |||||||||||||||| Sbjct: 1139 gaatcatccaggaggacatcatcgagacagtcaacaaccatccca 1095 Score = 42.1 bits (21), Expect = 2.1 Identities = 36/41 (87%) Strand = Plus / Minus Query: 282 attgagcaatttaagcatatgctgggagtgaaaccaacacc 322 |||| |||||||||||| || || |||||||||||| |||| Sbjct: 1047 attgcgcaatttaagcacatacttggagtgaaaccagcacc 1007
>gb|DQ492287.1| Nicotiana benthamiana cathepsin B (CathB) mRNA, complete cds Length = 1353 Score = 69.9 bits (35), Expect = 9e-09 Identities = 143/179 (79%) Strand = Plus / Plus Query: 417 agcacaattgggaaaatacttgatcaaggtcactgtggttcctgttgggcttttggagct 476 ||||| ||||||| ||| |||||||| || ||||||||||| |||||||||||||| ||| Sbjct: 343 agcactattgggagaattcttgatcagggacactgtggttcttgttgggcttttggtgct 402 Query: 477 gtggagtgtctgcaagatcgtttctgcatccatcacaacatgaacatttcactttctgcc 536 || |||| ||| ||||||||||| || ||| | | |||| || || || || || Sbjct: 403 gttgagtcactgtctgatcgtttctgtattcattatggcttgaatatctctctgtcagca 462 Query: 537 aatgacctagtggcttgctgtgggtttatgtgtggtgatggttgtgatggaggatatcc 595 ||||| || | || |||||||| ||| | ||||| |||||||||||||| |||||||| Sbjct: 463 aatgatctcttagcatgctgtggctttttatgtggagatggttgtgatggtggatatcc 521
>emb|X81995.1|NRCATHB N.rustica mRNA for cathepsin B-like cysteine proteinase Length = 1331 Score = 69.9 bits (35), Expect = 9e-09 Identities = 59/67 (88%) Strand = Plus / Plus Query: 417 agcacaattgggaaaatacttgatcaaggtcactgtggttcctgttgggcttttggagct 476 ||||| ||||||| ||| |||||||| || ||||||||||| |||||||||||||| ||| Sbjct: 355 agcactattgggagaattcttgatcagggacactgtggttcttgttgggcttttggtgct 414 Query: 477 gtggagt 483 || |||| Sbjct: 415 gttgagt 421 Score = 48.1 bits (24), Expect = 0.035 Identities = 39/44 (88%) Strand = Plus / Plus Query: 552 tgctgtgggtttatgtgtggtgatggttgtgatggaggatatcc 595 |||||||| ||| | ||||| |||||||||||||| |||||||| Sbjct: 490 tgctgtggctttttatgtggggatggttgtgatggtggatatcc 533
>gb|AY450641.1| Solanum tuberosum cathepsin B-like cysteine proteinase mRNA, complete cds Length = 1262 Score = 63.9 bits (32), Expect = 6e-07 Identities = 80/96 (83%) Strand = Plus / Plus Query: 414 tgcagcacaattgggaaaatacttgatcaaggtcactgtggttcctgttgggcttttgga 473 |||||||||||||| ||||| || ||||| || || || ||||| |||||||||||||| Sbjct: 337 tgcagcacaattggaaaaattctggatcagggacattgcggttcttgttgggcttttggt 396 Query: 474 gctgtggagtgtctgcaagatcgtttctgcatccat 509 ||||| |||| ||| ||||||||||| |||||| Sbjct: 397 gctgttgagtcgctgtctgatcgtttctgtatccat 432 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 575 tggttgtgatggaggatatcctat 598 |||||||||||| ||||||||||| Sbjct: 498 tggttgtgatggtggatatcctat 521
>gb|AY450638.1| Solanum tuberosum clone plbr2 cathepsin B-like cysteine proteinase mRNA, partial cds Length = 655 Score = 63.9 bits (32), Expect = 6e-07 Identities = 80/96 (83%) Strand = Plus / Plus Query: 414 tgcagcacaattgggaaaatacttgatcaaggtcactgtggttcctgttgggcttttgga 473 |||||||||||||| ||||| || ||||| || || || ||||| |||||||||||||| Sbjct: 332 tgcagcacaattggaaaaattctggatcagggacattgcggttcttgttgggcttttggt 391 Query: 474 gctgtggagtgtctgcaagatcgtttctgcatccat 509 ||||| |||| ||| ||||||||||| |||||| Sbjct: 392 gctgttgagtcgctgtctgatcgtttctgtatccat 427 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 575 tggttgtgatggaggatatcctat 598 |||||||||||| ||||||||||| Sbjct: 493 tggttgtgatggtggatatcctat 516
>gb|BT014624.1| Lycopersicon esculentum clone 134127R, mRNA sequence Length = 1263 Score = 56.0 bits (28), Expect = 1e-04 Identities = 79/96 (82%) Strand = Plus / Plus Query: 414 tgcagcacaattgggaaaatacttgatcaaggtcactgtggttcctgttgggcttttgga 473 |||||||||||||| | ||| || ||||| || || || ||||| |||||||||||||| Sbjct: 376 tgcagcacaattggaagaattctagatcagggacattgcggttcttgttgggcttttggt 435 Query: 474 gctgtggagtgtctgcaagatcgtttctgcatccat 509 ||||| |||| ||| ||||||||||| |||||| Sbjct: 436 gctgttgagtcgctgtctgatcgtttctgtatccat 471 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 575 tggttgtgatggaggatatcctat 598 |||||||||||| ||||||||||| Sbjct: 537 tggttgtgatggtggatatcctat 560
>ref|XM_849967.1| PREDICTED: Canis familiaris similar to Cathepsin L2 precursor (Cathepsin V) (Cathepsin U) (LOC612231), mRNA Length = 870 Score = 56.0 bits (28), Expect = 1e-04 Identities = 31/32 (96%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 ||||||||||||||||||| |||||||||||| Sbjct: 380 atcaaggtcactgtggttcttgttgggctttt 411
>emb|AJ251535.1|PSA251535 Pisum sativum partial mRNA for putative cathepsin B-like protease (cat1-related gene), clone A7 Length = 620 Score = 52.0 bits (26), Expect = 0.002 Identities = 53/62 (85%) Strand = Plus / Plus Query: 417 agcacaattgggaaaatacttgatcaaggtcactgtggttcctgttgggcttttggagct 476 ||||| ||||| | ||| || ||||| |||||||||||||| |||||||| ||||| ||| Sbjct: 347 agcactattggaagaattctagatcagggtcactgtggttcttgttgggcatttggcgct 406 Query: 477 gt 478 || Sbjct: 407 gt 408
>emb|AJ251534.1|PSA251534 Pisum sativum partial mRNA for putative cathepsin B-like protease (cat1-related gene), clone A6 Length = 499 Score = 52.0 bits (26), Expect = 0.002 Identities = 53/62 (85%) Strand = Plus / Plus Query: 417 agcacaattgggaaaatacttgatcaaggtcactgtggttcctgttgggcttttggagct 476 ||||| ||||| | ||| || ||||| |||||||||||||| |||||||| ||||| ||| Sbjct: 226 agcactattggaagaattctagatcagggtcactgtggttcttgttgggcatttggcgct 285 Query: 477 gt 478 || Sbjct: 286 gt 287
>dbj|D16823.1|SPESPCB S.peregrina mRNA for cathepsin B, complete cds Length = 1280 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 450 tgtggttcctgttgggcttttggagctgt 478 |||||||| |||||||||||||||||||| Sbjct: 436 tgtggttcatgttgggcttttggagctgt 464
>ref|XM_513780.1| PREDICTED: Pan troglodytes LOC457278 (LOC457278), mRNA Length = 914 Score = 48.1 bits (24), Expect = 0.035 Identities = 30/32 (93%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| ||||||||||||||||||||| Sbjct: 493 atcagggtcagtgtggttcctgttgggctttt 524
>gb|BC016058.1| Homo sapiens cathepsin K (pycnodysostosis), mRNA (cDNA clone MGC:23107 IMAGE:4860926), complete cds Length = 1699 Score = 48.1 bits (24), Expect = 0.035 Identities = 30/32 (93%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| ||||||||||||||||||||| Sbjct: 506 atcagggtcagtgtggttcctgttgggctttt 537
>ref|NM_000396.2| Homo sapiens cathepsin K (pycnodysostosis) (CTSK), mRNA Length = 1702 Score = 48.1 bits (24), Expect = 0.035 Identities = 30/32 (93%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| ||||||||||||||||||||| Sbjct: 519 atcagggtcagtgtggttcctgttgggctttt 550
>ref|NM_001032812.1| Macaca mulatta cathepsin K (CTSK), mRNA Length = 1029 Score = 48.1 bits (24), Expect = 0.035 Identities = 30/32 (93%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| ||||||||||||||||||||| Sbjct: 411 atcagggtcagtgtggttcctgttgggctttt 442
>ref|XM_969178.1| PREDICTED: Tribolium castaneum similar to cathepsin B preproprotein (LOC663117), mRNA Length = 1008 Score = 48.1 bits (24), Expect = 0.035 Identities = 30/32 (93%) Strand = Plus / Plus Query: 450 tgtggttcctgttgggcttttggagctgtgga 481 ||||| || ||||||||||||||||||||||| Sbjct: 328 tgtgggtcttgttgggcttttggagctgtgga 359
>emb|X82153.1|HSOC2RNA H.sapiens mRNA for cathepsin O Length = 1669 Score = 48.1 bits (24), Expect = 0.035 Identities = 30/32 (93%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| ||||||||||||||||||||| Sbjct: 524 atcagggtcagtgtggttcctgttgggctttt 555
>emb|CR541719.1| Homo sapiens full open reading frame cDNA clone RZPDo834E1237D for gene CTSK, cathepsin K (pycnodysostosis); complete cds, without stopcodon Length = 987 Score = 48.1 bits (24), Expect = 0.035 Identities = 30/32 (93%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| ||||||||||||||||||||| Sbjct: 395 atcagggtcagtgtggttcctgttgggctttt 426
>emb|CR541675.1| Homo sapiens full open reading frame cDNA clone RZPDo834C0328D for gene CTSK, cathepsin K (pycnodysostosis); complete cds, incl. stopcodon Length = 990 Score = 48.1 bits (24), Expect = 0.035 Identities = 30/32 (93%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| ||||||||||||||||||||| Sbjct: 395 atcagggtcagtgtggttcctgttgggctttt 426
>emb|X66116.1|TAPCATHB T.aestivum promoter sequence of cathepsin B-like gene Length = 483 Score = 48.1 bits (24), Expect = 0.035 Identities = 24/24 (100%) Strand = Plus / Plus Query: 69 cgtcgccgatcgaggacgaagatg 92 |||||||||||||||||||||||| Sbjct: 460 cgtcgccgatcgaggacgaagatg 483
>emb|CR626559.1| full-length cDNA clone CS0DI024YJ12 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1658 Score = 48.1 bits (24), Expect = 0.035 Identities = 30/32 (93%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| ||||||||||||||||||||| Sbjct: 490 atcagggtcagtgtggttcctgttgggctttt 521
>emb|CR626142.1| full-length cDNA clone CS0DN002YD24 of Adult brain of Homo sapiens (human) Length = 1619 Score = 48.1 bits (24), Expect = 0.035 Identities = 30/32 (93%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| ||||||||||||||||||||| Sbjct: 500 atcagggtcagtgtggttcctgttgggctttt 531
>emb|CR624019.1| full-length cDNA clone CS0DN002YH21 of Adult brain of Homo sapiens (human) Length = 1563 Score = 48.1 bits (24), Expect = 0.035 Identities = 30/32 (93%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| ||||||||||||||||||||| Sbjct: 422 atcagggtcagtgtggttcctgttgggctttt 453
>emb|CR614321.1| full-length cDNA clone CS0DI069YM12 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1527 Score = 48.1 bits (24), Expect = 0.035 Identities = 30/32 (93%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| ||||||||||||||||||||| Sbjct: 424 atcagggtcagtgtggttcctgttgggctttt 455
>emb|CR612623.1| full-length cDNA clone CS0DI018YG15 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1583 Score = 48.1 bits (24), Expect = 0.035 Identities = 30/32 (93%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| ||||||||||||||||||||| Sbjct: 425 atcagggtcagtgtggttcctgttgggctttt 456
>emb|CR612492.1| full-length cDNA clone CS0DI033YH19 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1577 Score = 48.1 bits (24), Expect = 0.035 Identities = 30/32 (93%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| ||||||||||||||||||||| Sbjct: 425 atcagggtcagtgtggttcctgttgggctttt 456
>emb|CR606929.1| full-length cDNA clone CS0DN002YF20 of Adult brain of Homo sapiens (human) Length = 1626 Score = 48.1 bits (24), Expect = 0.035 Identities = 30/32 (93%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| ||||||||||||||||||||| Sbjct: 492 atcagggtcagtgtggttcctgttgggctttt 523
>emb|CR601270.1| full-length cDNA clone CS0DE008YM10 of Placenta of Homo sapiens (human) Length = 1565 Score = 48.1 bits (24), Expect = 0.035 Identities = 30/32 (93%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| ||||||||||||||||||||| Sbjct: 425 atcagggtcagtgtggttcctgttgggctttt 456
>emb|CR598542.1| full-length cDNA clone CS0DN002YO18 of Adult brain of Homo sapiens (human) Length = 1577 Score = 48.1 bits (24), Expect = 0.035 Identities = 30/32 (93%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| ||||||||||||||||||||| Sbjct: 425 atcagggtcagtgtggttcctgttgggctttt 456
>emb|CR594213.1| full-length cDNA clone CS0DI009YN05 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1579 Score = 48.1 bits (24), Expect = 0.035 Identities = 30/32 (93%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| ||||||||||||||||||||| Sbjct: 433 atcagggtcagtgtggttcctgttgggctttt 464
>gb|AF359422.1| Nicotiana tabacum cathepsin B-like cysteine proteinase gene, partial cds Length = 731 Score = 48.1 bits (24), Expect = 0.035 Identities = 30/32 (93%) Strand = Plus / Plus Query: 447 cactgtggttcctgttgggcttttggagctgt 478 ||||||||||| |||||||||||||| ||||| Sbjct: 520 cactgtggttcttgttgggcttttggtgctgt 551
>gb|S79895.1| OC2=cathepsin O2 [human, spleen, mRNA, 1482 nt] Length = 1482 Score = 48.1 bits (24), Expect = 0.035 Identities = 30/32 (93%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| ||||||||||||||||||||| Sbjct: 536 atcagggtcagtgtggttcctgttgggctttt 567
>gb|AF283476.1|AF283476 Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete cds Length = 3334 Score = 48.1 bits (24), Expect = 0.035 Identities = 57/68 (83%) Strand = Plus / Plus Query: 531 tctgccaatgacctagtggcttgctgtgggtttatgtgtggtgatggttgtgatggagga 590 |||| ||||||||| | || |||||||| ||| |||| ||||| ||||||||||| || Sbjct: 1926 tctgtcaatgacctcttagcgtgctgtggctttttgtgcggtgaaggttgtgatggtggt 1985 Query: 591 tatcctat 598 |||||||| Sbjct: 1986 tatcctat 1993
>gb|AY892942.1| Synthetic construct Homo sapiens clone FLH135296.01L cathepsin K (CTSK) mRNA, partial cds Length = 990 Score = 48.1 bits (24), Expect = 0.035 Identities = 30/32 (93%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| ||||||||||||||||||||| Sbjct: 395 atcagggtcagtgtggttcctgttgggctttt 426
>gb|AY892941.1| Synthetic construct Homo sapiens clone FLH135294.01L cathepsin K (CTSK) mRNA, partial cds Length = 990 Score = 48.1 bits (24), Expect = 0.035 Identities = 30/32 (93%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| ||||||||||||||||||||| Sbjct: 395 atcagggtcagtgtggttcctgttgggctttt 426
>gb|AF101239.1|AF101239 Ipomoea batatas cathepsin B-like cysteine proteinase (CathB) mRNA, complete cds Length = 1248 Score = 48.1 bits (24), Expect = 0.035 Identities = 57/68 (83%) Strand = Plus / Plus Query: 531 tctgccaatgacctagtggcttgctgtgggtttatgtgtggtgatggttgtgatggagga 590 |||| ||||||||| | || |||||||| ||| |||| ||||| ||||||||||| || Sbjct: 470 tctgtcaatgacctcttagcgtgctgtggctttttgtgcggtgaaggttgtgatggtggt 529 Query: 591 tatcctat 598 |||||||| Sbjct: 530 tatcctat 537
>dbj|AK130134.1| Homo sapiens cDNA FLJ26624 fis, clone MPC03724, highly similar to Cathepsin K precursor (EC 3.4.22.38) Length = 1601 Score = 48.1 bits (24), Expect = 0.035 Identities = 30/32 (93%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| ||||||||||||||||||||| Sbjct: 443 atcagggtcagtgtggttcctgttgggctttt 474
>gb|AY893612.1| Synthetic construct Homo sapiens clone FLH131032.01X cathepsin K (CTSK) mRNA, complete cds Length = 990 Score = 48.1 bits (24), Expect = 0.035 Identities = 30/32 (93%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| ||||||||||||||||||||| Sbjct: 395 atcagggtcagtgtggttcctgttgggctttt 426
>gb|AF124092.1|AF124092 Macaca mulatta cathepsin K mRNA, complete cds Length = 1029 Score = 48.1 bits (24), Expect = 0.035 Identities = 30/32 (93%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| ||||||||||||||||||||| Sbjct: 411 atcagggtcagtgtggttcctgttgggctttt 442
>gb|AF070927.1|AF070927 Macaca fascicularis cathepsin K mRNA, complete cds Length = 990 Score = 48.1 bits (24), Expect = 0.035 Identities = 30/32 (93%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| ||||||||||||||||||||| Sbjct: 395 atcagggtcagtgtggttcctgttgggctttt 426
>gb|U20280.1|HSU20280 Human cathepsin X mRNA, complete cds Length = 1597 Score = 48.1 bits (24), Expect = 0.035 Identities = 30/32 (93%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| ||||||||||||||||||||| Sbjct: 413 atcagggtcagtgtggttcctgttgggctttt 444
>gb|U13665.1|HSU13665 Human cathepsin O (CTSO) mRNA, complete cds Length = 1661 Score = 48.1 bits (24), Expect = 0.035 Identities = 30/32 (93%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| ||||||||||||||||||||| Sbjct: 500 atcagggtcagtgtggttcctgttgggctttt 531
>ref|NM_001034435.1| Bos taurus cathepsin K preproprotein (CTSK), mRNA Length = 1699 Score = 46.1 bits (23), Expect = 0.14 Identities = 26/27 (96%) Strand = Plus / Plus Query: 444 ggtcactgtggttcctgttgggctttt 470 ||||| ||||||||||||||||||||| Sbjct: 531 ggtcagtgtggttcctgttgggctttt 557
>ref|NM_001033996.1| Canis familiaris cathepsin K (pycnodysostosis) (CTSK), mRNA Length = 1001 Score = 46.1 bits (23), Expect = 0.14 Identities = 26/27 (96%) Strand = Plus / Plus Query: 444 ggtcactgtggttcctgttgggctttt 470 ||||| ||||||||||||||||||||| Sbjct: 411 ggtcagtgtggttcctgttgggctttt 437
>gb|AY738221.1| Canis familiaris cathepsin K mRNA, complete cds Length = 1001 Score = 46.1 bits (23), Expect = 0.14 Identities = 26/27 (96%) Strand = Plus / Plus Query: 444 ggtcactgtggttcctgttgggctttt 470 ||||| ||||||||||||||||||||| Sbjct: 411 ggtcagtgtggttcctgttgggctttt 437
>emb|AL355860.12| Human DNA sequence from clone RP11-235D19 on chromosome 1 Contains a ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) (UBE2D3) pseudogene, the 5' end of the CTSK gene for cathepsin K (pycnodysostosis), the ARNT gene for aryl hydrocarbon receptor nuclear translocator, a ribosomal protein S27a (RPS27A) pseudogene, a cytochrome c, somatic (CYCS) pseudogene and a CpG island, complete sequence Length = 116451 Score = 46.1 bits (23), Expect = 0.14 Identities = 26/27 (96%) Strand = Plus / Minus Query: 444 ggtcactgtggttcctgttgggctttt 470 ||||| ||||||||||||||||||||| Sbjct: 4883 ggtcagtgtggttcctgttgggctttt 4857
>ref|XM_961570.1| PREDICTED: Tribolium castaneum similar to cathepsin B preproprotein (LOC655077), mRNA Length = 963 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggcttttggagctgtgga 481 |||||||| |||||| ||||| |||||||||||||| ||||| Sbjct: 299 atcaaggttcctgtggctcctgctgggcttttggagccgtgga 341
>gb|BC109853.1| Bos taurus cathepsin K preproprotein, mRNA (cDNA clone MGC:134021 IMAGE:8039598), complete cds Length = 1762 Score = 46.1 bits (23), Expect = 0.14 Identities = 26/27 (96%) Strand = Plus / Plus Query: 444 ggtcactgtggttcctgttgggctttt 470 ||||| ||||||||||||||||||||| Sbjct: 458 ggtcagtgtggttcctgttgggctttt 484
>gb|AC149038.2| Medicago truncatula chromosome 7 BAC clone mth2-29a5, complete sequence Length = 136566 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Minus Query: 444 ggtcactgtggttcctgttgggcttttggagctgt 478 |||||||||||||| |||||||| ||||| ||||| Sbjct: 23462 ggtcactgtggttcttgttgggcatttggtgctgt 23428 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Minus Query: 444 ggtcactgtggttcctgttgggcttttggagctgt 478 |||||||||||||| |||||||| ||||| ||||| Sbjct: 16508 ggtcactgtggttcttgttgggcatttggtgctgt 16474
>gb|AF292030.1|AF292030 Sus scrofa cathepsin K precursor (CTSK) mRNA, complete cds Length = 994 Score = 46.1 bits (23), Expect = 0.14 Identities = 26/27 (96%) Strand = Plus / Plus Query: 444 ggtcactgtggttcctgttgggctttt 470 ||||| ||||||||||||||||||||| Sbjct: 404 ggtcagtgtggttcctgttgggctttt 430
>ref|NM_214302.1| Sus scrofa cathepsin K precursor (CTSK), mRNA Length = 994 Score = 46.1 bits (23), Expect = 0.14 Identities = 26/27 (96%) Strand = Plus / Plus Query: 444 ggtcactgtggttcctgttgggctttt 470 ||||| ||||||||||||||||||||| Sbjct: 404 ggtcagtgtggttcctgttgggctttt 430
>gb|BT021052.1| Bos taurus cathepsin K (pycnodysostosis) (CTSK), mRNA, complete cds Length = 1699 Score = 46.1 bits (23), Expect = 0.14 Identities = 26/27 (96%) Strand = Plus / Plus Query: 444 ggtcactgtggttcctgttgggctttt 470 ||||| ||||||||||||||||||||| Sbjct: 531 ggtcagtgtggttcctgttgggctttt 557
>gb|AY609962.1| Sus scrofa clone Clu_4871.scr.msk.p1.Contig1, mRNA sequence Length = 1756 Score = 46.1 bits (23), Expect = 0.14 Identities = 26/27 (96%) Strand = Plus / Plus Query: 444 ggtcactgtggttcctgttgggctttt 470 ||||| ||||||||||||||||||||| Sbjct: 566 ggtcagtgtggttcctgttgggctttt 592
>gb|AE014825.1| Plasmodium falciparum 3D7 chromosome 14 section 10 of 13 of the complete sequence Length = 250053 Score = 44.1 bits (22), Expect = 0.54 Identities = 31/34 (91%) Strand = Plus / Plus Query: 438 gatcaaggtcactgtggttcctgttgggcttttg 471 |||||||||| |||||||| ||||||||||||| Sbjct: 125022 gatcaaggtctttgtggttcttgttgggcttttg 125055
>ref|XM_782854.1| PREDICTED: Strongylocentrotus purpuratus similar to cathepsin B preproprotein (LOC582922), mRNA Length = 534 Score = 44.1 bits (22), Expect = 0.54 Identities = 28/30 (93%) Strand = Plus / Plus Query: 449 ctgtggttcctgttgggcttttggagctgt 478 |||||| ||||| ||||||||||||||||| Sbjct: 399 ctgtggctcctgctgggcttttggagctgt 428
>gb|AY573569.1| Fasciola hepatica strain Firat cathepsin L1 proteinase mRNA, complete cds Length = 981 Score = 44.1 bits (22), Expect = 0.54 Identities = 22/22 (100%) Strand = Plus / Plus Query: 448 actgtggttcctgttgggcttt 469 |||||||||||||||||||||| Sbjct: 383 actgtggttcctgttgggcttt 404
>gb|AC158233.2| Mus musculus BAC clone RP23-240E15 from chromosome 3, complete sequence Length = 209923 Score = 44.1 bits (22), Expect = 0.54 Identities = 22/22 (100%) Strand = Plus / Plus Query: 26 tcctccgcttgcttctgcttgc 47 |||||||||||||||||||||| Sbjct: 114358 tcctccgcttgcttctgcttgc 114379
>dbj|D14036.1|RABOC2 Oryctolagus cuniculus mRNA for OC-2 protein, complete cds Length = 1599 Score = 44.1 bits (22), Expect = 0.54 Identities = 25/26 (96%) Strand = Plus / Plus Query: 444 ggtcactgtggttcctgttgggcttt 469 ||||| |||||||||||||||||||| Sbjct: 424 ggtcagtgtggttcctgttgggcttt 449
>gb|M81341.1|PFACYPROT Plasmodium falciparum cysteine proteinase gene, complete cds Length = 1801 Score = 44.1 bits (22), Expect = 0.54 Identities = 31/34 (91%) Strand = Plus / Plus Query: 438 gatcaaggtcactgtggttcctgttgggcttttg 471 |||||||||| |||||||| ||||||||||||| Sbjct: 1118 gatcaaggtctttgtggttcttgttgggcttttg 1151
>gb|AY584068.1| Plasmodium vivax vivapain-4 mRNA, complete cds Length = 1455 Score = 42.1 bits (21), Expect = 2.1 Identities = 27/29 (93%) Strand = Plus / Plus Query: 450 tgtggttcctgttgggcttttggagctgt 478 ||||| ||||||||||| ||||||||||| Sbjct: 847 tgtggctcctgttgggcctttggagctgt 875
>ref|NM_100111.1| Arabidopsis thaliana cysteine-type endopeptidase/ cysteine-type peptidase AT1G02305 mRNA, complete cds Length = 1277 Score = 42.1 bits (21), Expect = 2.1 Identities = 36/41 (87%) Strand = Plus / Plus Query: 438 gatcaaggtcactgtggttcctgttgggcttttggagctgt 478 ||||| |||||||||||||| || ||||| ||||| ||||| Sbjct: 417 gatcagggtcactgtggttcttgctgggcctttggtgctgt 457
>gb|AC115865.9| Mus musculus chromosome 3, clone RP24-314I8, complete sequence Length = 200362 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 40 ctgcttgcttcctcctccctc 60 ||||||||||||||||||||| Sbjct: 168611 ctgcttgcttcctcctccctc 168631
>emb|AL135793.13| Human DNA sequence from clone RP11-296H2 on chromosome 10 Contains the 3' end of the TACC2 gene for transforming, acidic coiled-coil containing protein 2 (AZU-1), the gene for a novel protein (FLJ25359) and two CpG islands, complete sequence Length = 213861 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 42 gcttgcttcctcctccctccc 62 ||||||||||||||||||||| Sbjct: 193400 gcttgcttcctcctccctccc 193380
>gb|AC135643.2| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone OSJNBa0023F01, complete sequence Length = 145009 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Plus Query: 156 ctcgccagagcggcagggggaggcc 180 |||||||||||||||| |||||||| Sbjct: 137980 ctcgccagagcggcagtgggaggcc 138004
>ref|XM_961657.1| PREDICTED: Tribolium castaneum similar to CG10992-PA (LOC655148), mRNA Length = 1072 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Plus Query: 448 actgtggttcctgttgggcttttgg 472 |||| |||||||||||||||||||| Sbjct: 324 actgcggttcctgttgggcttttgg 348
>emb|AJ279093.1|FHE279093 Fasciola hepatica partial mRNA for procathepsin L3 (ORF1), clone pFH64 Length = 1008 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 450 tgtggttcctgttgggctttt 470 ||||||||||||||||||||| Sbjct: 325 tgtggttcctgttgggctttt 345
>emb|AJ279091.1|FHE279091 Fasciola hepatica partial mRNA for procathepsin L3 (ORF1), clone pFH22 Length = 936 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 450 tgtggttcctgttgggctttt 470 ||||||||||||||||||||| Sbjct: 340 tgtggttcctgttgggctttt 360
>gb|AF419329.1|AF419329 Fasciola gigantica cathepsin L mRNA, complete cds Length = 1091 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 450 tgtggttcctgttgggctttt 470 ||||||||||||||||||||| Sbjct: 414 tgtggttcctgttgggctttt 434
>gb|AF428337.1|AF428337 Arabidopsis thaliana At1g02300/T6A9_10 mRNA, complete cds Length = 1277 Score = 42.1 bits (21), Expect = 2.1 Identities = 36/41 (87%) Strand = Plus / Plus Query: 438 gatcaaggtcactgtggttcctgttgggcttttggagctgt 478 ||||| |||||||||||||| || ||||| ||||| ||||| Sbjct: 485 gatcagggtcactgtggttcttgctgggcctttggtgctgt 525
>gb|AY039887.1| Arabidopsis thaliana At1g02300/T6A9_10 mRNA, complete cds Length = 1277 Score = 42.1 bits (21), Expect = 2.1 Identities = 36/41 (87%) Strand = Plus / Plus Query: 438 gatcaaggtcactgtggttcctgttgggcttttggagctgt 478 ||||| |||||||||||||| || ||||| ||||| ||||| Sbjct: 417 gatcagggtcactgtggttcttgctgggcctttggtgctgt 457
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Minus Query: 156 ctcgccagagcggcagggggaggcc 180 |||||||||||||||| |||||||| Sbjct: 26451740 ctcgccagagcggcagtgggaggcc 26451716
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 444 ggtcactgtggttcctgttgg 464 ||||||||||||||||||||| Sbjct: 16385943 ggtcactgtggttcctgttgg 16385963
>emb|BX815386.1|CNS0AAL6 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS56ZE10 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1305 Score = 42.1 bits (21), Expect = 2.1 Identities = 36/41 (87%) Strand = Plus / Plus Query: 438 gatcaaggtcactgtggttcctgttgggcttttggagctgt 478 ||||| |||||||||||||| || ||||| ||||| ||||| Sbjct: 439 gatcagggtcactgtggttcttgctgggcctttggtgctgt 479
>dbj|AP005419.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0046G12 Length = 189391 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 444 ggtcactgtggttcctgttgg 464 ||||||||||||||||||||| Sbjct: 74490 ggtcactgtggttcctgttgg 74510
>emb|BX842243.1| Homo sapiens chromosome 10 clone RP11-436O19, partial sequence Length = 38906 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 42 gcttgcttcctcctccctccc 62 ||||||||||||||||||||| Sbjct: 21578 gcttgcttcctcctccctccc 21598
>gb|BT002227.1| Arabidopsis thaliana At1g02300/T6A9_10 mRNA, complete cds Length = 1089 Score = 42.1 bits (21), Expect = 2.1 Identities = 36/41 (87%) Strand = Plus / Plus Query: 438 gatcaaggtcactgtggttcctgttgggcttttggagctgt 478 ||||| |||||||||||||| || ||||| ||||| ||||| Sbjct: 379 gatcagggtcactgtggttcttgctgggcctttggtgctgt 419
>dbj|AK066748.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013074D19, full insert sequence Length = 1486 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 444 ggtcactgtggttcctgttgg 464 ||||||||||||||||||||| Sbjct: 553 ggtcactgtggttcctgttgg 573
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Minus Query: 156 ctcgccagagcggcagggggaggcc 180 |||||||||||||||| |||||||| Sbjct: 26777004 ctcgccagagcggcagtgggaggcc 26776980
>gb|AC102108.12| Mus musculus chromosome 3, clone RP23-100J23, complete sequence Length = 216506 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 40 ctgcttgcttcctcctccctc 60 ||||||||||||||||||||| Sbjct: 31414 ctgcttgcttcctcctccctc 31434
>ref|NM_122435.2| Arabidopsis thaliana unknown protein AT5G25260 mRNA, complete cds Length = 1459 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 27 cctccgcttgcttctgcttg 46 |||||||||||||||||||| Sbjct: 1043 cctccgcttgcttctgcttg 1024
>ref|XM_520110.1| PREDICTED: Pan troglodytes similar to hypothetical protein (LOC464571), mRNA Length = 6888 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 5963 atcagggtcagtgtggttcttgttgggctttt 5994
>ref|NM_001003115.1| Canis familiaris cathepsin L2 (CTSL2), mRNA Length = 1395 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 459 atcagggtcagtgtggttcttgttgggctttt 490
>ref|NM_031560.2| Rattus norvegicus cathepsin K (Ctsk), mRNA Length = 1446 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 450 tgtggttcctgttgggcttt 469 |||||||||||||||||||| Sbjct: 479 tgtggttcctgttgggcttt 498
>gb|AC006259.1| Arabidopsis thaliana BAC F21J6 from chromosome V, containing KNAT3 and mapping near 60.5 cM, complete sequence Length = 110680 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 27 cctccgcttgcttctgcttg 46 |||||||||||||||||||| Sbjct: 90153 cctccgcttgcttctgcttg 90134
>gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome Length = 6438405 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 109 cgctggcgctgctcgtcgtcatct 132 ||||||||||| |||||||||||| Sbjct: 3860717 cgctggcgctgttcgtcgtcatct 3860694
>gb|BC046320.1| Mus musculus cathepsin K, mRNA (cDNA clone MGC:54691 IMAGE:6390854), complete cds Length = 1562 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 450 tgtggttcctgttgggcttt 469 |||||||||||||||||||| Sbjct: 488 tgtggttcctgttgggcttt 507
>gb|BC012612.1| Homo sapiens cathepsin L, transcript variant 1, mRNA (cDNA clone MGC:13635 IMAGE:4295635), complete cds Length = 1517 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 590 atcagggtcagtgtggttcttgttgggctttt 621
>gb|AC140053.4| Mus musculus BAC clone RP23-258J2 from chromosome 19, complete sequence Length = 186595 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 43 cttgcttcctcctccctccc 62 |||||||||||||||||||| Sbjct: 155528 cttgcttcctcctccctccc 155509
>ref|NM_001912.2| Homo sapiens cathepsin L (CTSL), transcript variant 1, mRNA Length = 1632 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 736 atcagggtcagtgtggttcttgttgggctttt 767
>ref|NM_145918.1| Homo sapiens cathepsin L (CTSL), transcript variant 2, mRNA Length = 1487 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 591 atcagggtcagtgtggttcttgttgggctttt 622
>gb|AC112144.4| Mus musculus BAC clone RP23-32B4 from 19, complete sequence Length = 216521 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 43 cttgcttcctcctccctccc 62 |||||||||||||||||||| Sbjct: 142771 cttgcttcctcctccctccc 142790
>emb|AL109919.18|HSDJ258B3 Human DNA sequence from clone RP1-258B3 on chromosome 6q16.1-16.3 Contains part of the GRIK2 gene for glutamate receptor ionotropic kainate 2, complete sequence Length = 147603 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 566 gtgtggtgatggttgtgatg 585 |||||||||||||||||||| Sbjct: 51980 gtgtggtgatggttgtgatg 51961
>emb|AL035446.4|HS460G2 Human DNA sequence from clone RP3-460G2 on chromosome 6q24.1-24.3 Contains a novel gene and part of a 40s ribosomal protein S3a (v-fos transformation effector protein 1) (RPS3A)(FTE1) pseudogene, complete sequence Length = 102552 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 86 gaagatggggagcggcctgc 105 |||||||||||||||||||| Sbjct: 86183 gaagatggggagcggcctgc 86202
>emb|Z22765.1|FHCATHPRC F.hepatica cathepsin L-like protease mRNA, complete CDS Length = 1070 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 450 tgtggttcctgttgggcttt 469 |||||||||||||||||||| Sbjct: 418 tgtggttcctgttgggcttt 437
>emb|Y18462.1|HOS18462 Homo sapiens mRNA for cathepsin L, partial Length = 525 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 17 atcagggtcagtgtggttcttgttgggctttt 48
>emb|X94444.1|MMPPCATHK M.musculus mRNA for preprocathepsin K Length = 990 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 450 tgtggttcctgttgggcttt 469 |||||||||||||||||||| Sbjct: 406 tgtggttcctgttgggcttt 425
>emb|X12451.1|HSCATHL Human mRNA for pro-cathepsin L (major excreted protein MEP) Length = 1575 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 680 atcagggtcagtgtggttcttgttgggctttt 711
>emb|CR457053.1| Homo sapiens full open reading frame cDNA clone RZPDo834B0418D for gene CTSL, cathepsin L; complete cds, incl. stopcodon Length = 1002 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 392 atcagggtcagtgtggttcttgttgggctttt 423
>emb|BX537395.1|HSM805692 Homo sapiens mRNA; cDNA DKFZp686A18159 (from clone DKFZp686A18159) Length = 1441 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 533 atcagggtcagtgtggttcttgttgggctttt 564
>ref|NM_007802.2| Mus musculus cathepsin K (Ctsk), mRNA Length = 1483 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 450 tgtggttcctgttgggcttt 469 |||||||||||||||||||| Sbjct: 459 tgtggttcctgttgggcttt 478
>emb|AJ279008.1|CFA279008 Canis familiaris mRNA for cathepsin L (ccL gene) Length = 1395 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 459 atcagggtcagtgtggttcttgttgggctttt 490
>emb|AJ006033.1|MMU6033 Mus musculus ctsk gene Length = 11934 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 450 tgtggttcctgttgggcttt 469 |||||||||||||||||||| Sbjct: 5003 tgtggttcctgttgggcttt 5022
>gb|AC009320.7| Homo sapiens 12 BAC RP11-310I24 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 57166 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 514 acatgaacatttcactttct 533 |||||||||||||||||||| Sbjct: 44278 acatgaacatttcactttct 44259
>emb|BX470140.10| Zebrafish DNA sequence from clone CH211-238E6 in linkage group 4 Contains the gene for a novel protein similar to vertebrate microphthalmia-associated transcription factor (MITF), six novel genes and two CpG islands, complete sequence Length = 148136 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 555 tgtgggtttatgtgtggtgatggt 578 ||||||||||| |||||||||||| Sbjct: 6032 tgtgggtttatatgtggtgatggt 6055 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 555 tgtgggtttatgtgtggtgatggt 578 ||||||||||| |||||||||||| Sbjct: 1589 tgtgggtttatatgtggtgatggt 1612
>emb|X05256.1|HSCATLR1 Human mRNA fragment for cathepsin L N-terminal/fragment Length = 126 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 56 atcagggtcagtgtggttcttgttgggctttt 87
>gb|AF453501.1| Actinosynnema pretiosum subsp. auranticum maytansinoid antitumor agent ansamitocin biosynthetic gene cluster I, partial sequence Length = 82746 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 106 tcccgctggcgctgctcgtc 125 |||||||||||||||||||| Sbjct: 43968 tcccgctggcgctgctcgtc 43949
>emb|CR626403.1| full-length cDNA clone CS0DI043YP08 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1405 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 540 atcagggtcagtgtggttcttgttgggctttt 571
>emb|CR625678.1| full-length cDNA clone CS0DI021YB15 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1507 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 663 atcagggtcagtgtggttcttgttgggctttt 694
>emb|CR624043.1| full-length cDNA clone CS0DI056YK03 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1464 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 600 atcagggtcagtgtggttcttgttgggctttt 631
>emb|CR624025.1| full-length cDNA clone CS0DI004YP08 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1434 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 571 atcagggtcagtgtggttcttgttgggctttt 602
>emb|CR623879.1| full-length cDNA clone CS0DI003YI03 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1378 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 511 atcagggtcagtgtggttcttgttgggctttt 542
>emb|CR620973.1| full-length cDNA clone CS0DC027YD18 of Neuroblastoma Cot 25-normalized of Homo sapiens (human) Length = 1552 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 687 atcagggtcagtgtggttcttgttgggctttt 718
>emb|CR620883.1| full-length cDNA clone CS0DI079YJ10 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1408 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 516 atcagggtcagtgtggttcttgttgggctttt 547
>emb|CR620702.1| full-length cDNA clone CS0DI064YL15 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1523 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 656 atcagggtcagtgtggttcttgttgggctttt 687
>emb|CR620611.1| full-length cDNA clone CL0BA007ZC09 of Placenta of Homo sapiens (human) Length = 1549 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 656 atcagggtcagtgtggttcttgttgggctttt 687
>emb|CR619793.1| full-length cDNA clone CS0DC004YH11 of Neuroblastoma Cot 25-normalized of Homo sapiens (human) Length = 1288 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 408 atcagggtcagtgtggttcttgttgggctttt 439
>emb|CR618895.1| full-length cDNA clone CS0DI028YJ02 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1549 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 690 atcagggtcagtgtggttcttgttgggctttt 721
>emb|CR619050.1| full-length cDNA clone CS0DE013YN08 of Placenta of Homo sapiens (human) Length = 1521 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 652 atcagggtcagtgtggttcttgttgggctttt 683
>emb|CR618528.1| full-length cDNA clone CS0DE010YH08 of Placenta of Homo sapiens (human) Length = 1383 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 511 atcagggtcagtgtggttcttgttgggctttt 542
>emb|CR617897.1| full-length cDNA clone CS0DI062YC17 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1406 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 543 atcagggtcagtgtggttcttgttgggctttt 574
>emb|CR616495.1| full-length cDNA clone CS0DI023YP04 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1438 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 571 atcagggtcagtgtggttcttgttgggctttt 602
>emb|CR616359.1| full-length cDNA clone CS0DE012YE21 of Placenta of Homo sapiens (human) Length = 1590 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 716 atcagggtcagtgtggttcttgttgggctttt 747
>emb|CR615255.1| full-length cDNA clone CS0DI007YE22 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1329 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 457 atcagggtcagtgtggttcttgttgggctttt 488
>emb|CR614675.1| full-length cDNA clone CS0DE004YN19 of Placenta of Homo sapiens (human) Length = 1444 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 571 atcagggtcagtgtggttcttgttgggctttt 602
>emb|CR613528.1| full-length cDNA clone CS0DI053YI24 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1506 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 626 atcagggtcagtgtggttcttgttgggctttt 657
>emb|CR613254.1| full-length cDNA clone CS0DI024YL17 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1467 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 600 atcagggtcagtgtggttcttgttgggctttt 631
>emb|CR612596.1| full-length cDNA clone CS0DI027YN17 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1431 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 567 atcagggtcagtgtggttcttgttgggctttt 598
>emb|CR612043.1| full-length cDNA clone CS0DI083YN04 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1436 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 571 atcagggtcagtgtggttcttgttgggctttt 602
>emb|CR611865.1| full-length cDNA clone CS0DI044YM22 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1390 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 552 atcagggtcagtgtggttcttgttgggctttt 583
>emb|CR610633.1| full-length cDNA clone CS0DI052YG23 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1465 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 606 atcagggtcagtgtggttcttgttgggctttt 637
>emb|CR609955.1| full-length cDNA clone CS0DI043YK10 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1419 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 539 atcagggtcagtgtggttcttgttgggctttt 570
>emb|CR608495.1| full-length cDNA clone CS0DI044YA21 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1403 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 511 atcagggtcagtgtggttcttgttgggctttt 542
>emb|CR608477.1| full-length cDNA clone CS0DI073YL22 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1443 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 584 atcagggtcagtgtggttcttgttgggctttt 615
>emb|CR607586.1| full-length cDNA clone CS0DI052YO05 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1496 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 636 atcagggtcagtgtggttcttgttgggctttt 667
>emb|CR607547.1| full-length cDNA clone CS0DI031YE16 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1378 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 511 atcagggtcagtgtggttcttgttgggctttt 542
>emb|CR607374.1| full-length cDNA clone CS0DI014YJ10 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1572 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 716 atcagggtcagtgtggttcttgttgggctttt 747
>emb|CR607254.1| full-length cDNA clone CS0DM005YG24 of Fetal liver of Homo sapiens (human) Length = 1364 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 487 atcagggtcagtgtggttcttgttgggctttt 518
>emb|CR606843.1| full-length cDNA clone CS0DI026YP02 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1583 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 716 atcagggtcagtgtggttcttgttgggctttt 747
>emb|CR606674.1| full-length cDNA clone CS0DM013YH08 of Fetal liver of Homo sapiens (human) Length = 1591 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 716 atcagggtcagtgtggttcttgttgggctttt 747
>emb|CR606260.1| full-length cDNA clone CS0DI076YM01 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1447 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 571 atcagggtcagtgtggttcttgttgggctttt 602
>emb|CR605661.1| full-length cDNA clone CS0DI007YM22 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1336 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 457 atcagggtcagtgtggttcttgttgggctttt 488
>emb|CR605581.1| full-length cDNA clone CS0DM005YE21 of Fetal liver of Homo sapiens (human) Length = 1340 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 487 atcagggtcagtgtggttcttgttgggctttt 518
>emb|CR604305.1| full-length cDNA clone CS0DI087YM03 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1430 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 571 atcagggtcagtgtggttcttgttgggctttt 602
>emb|CR603807.1| full-length cDNA clone CS0DE006YL09 of Placenta of Homo sapiens (human) Length = 1510 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 648 atcagggtcagtgtggttcttgttgggctttt 679
>emb|CR603622.1| full-length cDNA clone CS0DI062YA13 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1498 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 626 atcagggtcagtgtggttcttgttgggctttt 657
>emb|CR602859.1| full-length cDNA clone CS0DE013YG13 of Placenta of Homo sapiens (human) Length = 1584 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 716 atcagggtcagtgtggttcttgttgggctttt 747
>emb|CR601498.1| full-length cDNA clone CS0DI063YH21 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1574 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 707 atcagggtcagtgtggttcttgttgggctttt 738
>emb|CR601495.1| full-length cDNA clone CS0DI062YF03 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1557 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 690 atcagggtcagtgtggttcttgttgggctttt 721
>emb|CR601598.1| full-length cDNA clone CS0DI051YJ12 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1515 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 657 atcagggtcagtgtggttcttgttgggctttt 688
>emb|CR600244.1| full-length cDNA clone CS0DI006YE14 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1443 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 571 atcagggtcagtgtggttcttgttgggctttt 602
>dbj|AK075100.1| Homo sapiens cDNA FLJ90619 fis, clone PLACE1002374, highly similar to Human mRNA for pro-cathepsin L Length = 1437 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 548 atcagggtcagtgtggttcttgttgggctttt 579
>emb|CR599034.1| full-length cDNA clone CS0DK006YK20 of HeLa cells Cot 25-normalized of Homo sapiens (human) Length = 1354 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 487 atcagggtcagtgtggttcttgttgggctttt 518
>emb|CR596740.1| full-length cDNA clone CS0DI022YG23 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1475 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 545 atcagggtcagtgtggttcttgttgggctttt 576
>emb|CR595891.1| full-length cDNA clone CS0DI012YI01 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1433 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 571 atcagggtcagtgtggttcttgttgggctttt 602
>dbj|AK055599.1| Homo sapiens cDNA FLJ31037 fis, clone HSYRA2000137, highly similar to CATHEPSIN L PRECURSOR (EC 3.4.22.15) Length = 2175 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 1280 atcagggtcagtgtggttcttgttgggctttt 1311
>emb|CR595268.1| full-length cDNA clone CS0DI069YC18 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1437 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 571 atcagggtcagtgtggttcttgttgggctttt 602
>emb|CR595008.1| full-length cDNA clone CS0DM001YJ02 of Fetal liver of Homo sapiens (human) Length = 1411 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 545 atcagggtcagtgtggttcttgttgggctttt 576
>emb|CR594363.1| full-length cDNA clone CS0DI077YM18 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1554 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 687 atcagggtcagtgtggttcttgttgggctttt 718
>emb|CR593015.1| full-length cDNA clone CS0DI026YP10 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1397 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 522 atcagggtcagtgtggttcttgttgggctttt 553
>emb|CR592569.1| full-length cDNA clone CS0DI055YF16 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1439 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 566 atcagggtcagtgtggttcttgttgggctttt 597
>emb|CR591819.1| full-length cDNA clone CS0DI002YE08 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1592 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 716 atcagggtcagtgtggttcttgttgggctttt 747
>emb|CR590723.1| full-length cDNA clone CS0DI025YI04 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1529 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 648 atcagggtcagtgtggttcttgttgggctttt 679
>emb|CR590618.1| full-length cDNA clone CS0DE006YA20 of Placenta of Homo sapiens (human) Length = 1431 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 571 atcagggtcagtgtggttcttgttgggctttt 602
>emb|CR590181.1| full-length cDNA clone CS0DI002YD23 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1557 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 690 atcagggtcagtgtggttcttgttgggctttt 721
>emb|CR590033.1| full-length cDNA clone CS0DI014YA03 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1437 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 545 atcagggtcagtgtggttcttgttgggctttt 576
>dbj|AK132648.1| Mus musculus 0 day neonate head cDNA, RIKEN full-length enriched library, clone:4833447E19 product:cathepsin K, full insert sequence Length = 1507 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 450 tgtggttcctgttgggcttt 469 |||||||||||||||||||| Sbjct: 464 tgtggttcctgttgggcttt 483
>gb|AE003849.1| Xylella fastidiosa 9a5c, complete genome Length = 2679306 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 411 ggttgcagcacaattgggaa 430 |||||||||||||||||||| Sbjct: 546761 ggttgcagcacaattgggaa 546742
>gb|AF239266.1|AF239266 Fasciola gigantica cathepsin L (cat-L1D) mRNA, complete cds Length = 981 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 450 tgtggttcctgttgggcttt 469 |||||||||||||||||||| Sbjct: 385 tgtggttcctgttgggcttt 404
>dbj|AK003425.1| Mus musculus 18-day embryo whole body cDNA, RIKEN full-length enriched library, clone:1110004H19 product:cathepsin K, full insert sequence Length = 1483 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 450 tgtggttcctgttgggcttt 469 |||||||||||||||||||| Sbjct: 459 tgtggttcctgttgggcttt 478
>gb|BT023420.1| Arabidopsis thaliana At5g25260 gene, complete cds Length = 1451 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 27 cctccgcttgcttctgcttg 46 |||||||||||||||||||| Sbjct: 983 cctccgcttgcttctgcttg 964
>gb|AC108049.5| Homo sapiens BAC clone RP11-325P16 from 2, complete sequence Length = 89604 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 435 cttgatcaaggtcactgtgg 454 |||||||||||||||||||| Sbjct: 66984 cttgatcaaggtcactgtgg 66965
>gb|AF201700.1|AF201700 Cercopithecus aethiops cysteine protease mRNA, complete cds Length = 1452 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 574 atcagggtcaatgtggttcttgttgggctttt 605
>ref|NM_213892.1| Sus scrofa cathepsin L (CTSL2), mRNA Length = 1378 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 469 atcagggtcagtgtggttcttgttgggctttt 500
>gb|AY890446.1| Synthetic construct Homo sapiens clone FLH140202.01X cathepsin L (CTSL) mRNA, complete cds Length = 1002 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 392 atcagggtcagtgtggttcttgttgggctttt 423
>dbj|BS000063.1| Pan troglodytes chromosome 22 clone:PTB-428P03, map 22, complete sequences Length = 136131 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 563 tatgtgtggtgatggttgtg 582 |||||||||||||||||||| Sbjct: 74570 tatgtgtggtgatggttgtg 74589
>emb|BX647435.1|HSM807580 Homo sapiens mRNA; cDNA DKFZp686J08158 (from clone DKFZp686J08158) Length = 1513 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 592 atcagggtcagtgtggttcttgttgggctttt 623
>emb|BX647434.1|HSM807579 Homo sapiens mRNA; cDNA DKFZp686B07158 (from clone DKFZp686B07158) Length = 1516 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 595 atcagggtcagtgtggttcttgttgggctttt 626
>emb|BX647413.1|HSM807558 Homo sapiens mRNA; cDNA DKFZp686B10158 (from clone DKFZp686B10158) Length = 1448 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 537 atcagggtcagtgtggttcttgttgggctttt 568
>gb|AF240629.1|AF240629 Homo sapiens chromosome 21 map 21q21 clone B47C12, complete sequence Length = 151696 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 563 tatgtgtggtgatggttgtg 582 |||||||||||||||||||| Sbjct: 73704 tatgtgtggtgatggttgtg 73723
>emb|BX649140.1|HSM809292 Homo sapiens mRNA; cDNA DKFZp686L20157 (from clone DKFZp686L20157) Length = 1499 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 593 atcagggtcagtgtggttcttgttgggctttt 624
>emb|BX648849.1|HSM809000 Homo sapiens mRNA; cDNA DKFZp686A04157 (from clone DKFZp686A04157) Length = 1453 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 537 atcagggtcagtgtggttcttgttgggctttt 568
>emb|BX648848.1|HSM808999 Homo sapiens mRNA; cDNA DKFZp686A03157 (from clone DKFZp686A03157) Length = 1459 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 547 atcagggtcagtgtggttcttgttgggctttt 578
>emb|BX647102.1|HSM807246 Homo sapiens mRNA; cDNA DKFZp686F10158 (from clone DKFZp686F10158) Length = 1449 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 536 atcagggtcagtgtggttcttgttgggctttt 567
>emb|BX647101.1|HSM807245 Homo sapiens mRNA; cDNA DKFZp686D14158 (from clone DKFZp686D14158) Length = 1471 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 537 atcagggtcagtgtggttcttgttgggctttt 568
>emb|AJ303304.1|HEC303304 Hepatitis C virus type 1b partial mRNA for p7/NS2 protein (e2(p7)-NS2 gene), clone B236b12 Length = 212 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 101 cctgctcccgctggcgctgc 120 |||||||||||||||||||| Sbjct: 74 cctgctcccgctggcgctgc 93
>ref|XM_560519.1| Anopheles gambiae str. PEST ENSANGP00000028370 (ENSANGG00000022283), partial mRNA Length = 297 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 acactattgagcaatttaag 296 |||||||||||||||||||| Sbjct: 167 acactattgagcaatttaag 186
>gb|AY893779.1| Synthetic construct Homo sapiens clone FLH053856.01L cathepsin L (CTSL) mRNA, partial cds Length = 1002 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 392 atcagggtcagtgtggttcttgttgggctttt 423
>gb|BC078793.1| Rattus norvegicus cathepsin K, mRNA (cDNA clone MGC:93359 IMAGE:7134253), complete cds Length = 1446 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 450 tgtggttcctgttgggcttt 469 |||||||||||||||||||| Sbjct: 479 tgtggttcctgttgggcttt 498
>gb|U62289.1|FHU62289 Fasciola hepatica secreted cathepsin L 2 (FheCL2) mRNA, complete cds Length = 1053 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 450 tgtggttcctgttgggcttt 469 |||||||||||||||||||| Sbjct: 400 tgtggttcctgttgggcttt 419
>dbj|AP001679.1| Homo sapiens genomic DNA, chromosome 21q, section 23/105 Length = 340000 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 563 tatgtgtggtgatggttgtg 582 |||||||||||||||||||| Sbjct: 259595 tatgtgtggtgatggttgtg 259614
>dbj|AP006199.1| Homo sapiens genomic DNA, chromosome 6, clone:RP11-482B5, complete sequence Length = 188161 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 566 gtgtggtgatggttgtgatg 585 |||||||||||||||||||| Sbjct: 134332 gtgtggtgatggttgtgatg 134351
>dbj|AP006196.1| Homo sapiens genomic DNA, chromosome 6, clone:RP11-347H8, complete sequence Length = 181660 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 566 gtgtggtgatggttgtgatg 585 |||||||||||||||||||| Sbjct: 8674 gtgtggtgatggttgtgatg 8693
>gb|AC092203.16| Mus musculus strain C57BL/6J chromosome 3 clone rp23-422n18, complete sequence Length = 188880 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 450 tgtggttcctgttgggcttt 469 |||||||||||||||||||| Sbjct: 113194 tgtggttcctgttgggcttt 113175
>gb|AY609853.1| Sus scrofa clone Clu_3550.scr.msk.p1.Contig6, mRNA sequence Length = 1456 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 468 atcagggtcagtgtggttcttgttgggctttt 499
>emb|AL832167.1|HSM803474 Homo sapiens mRNA; cDNA DKFZp686K15158 (from clone DKFZp686K15158) Length = 1454 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 540 atcagggtcagtgtggttcttgttgggctttt 571
>gb|AF010306.1|AF010306 Rattus norvegicus cathepsin K mRNA, complete cds Length = 1248 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 450 tgtggttcctgttgggcttt 469 |||||||||||||||||||| Sbjct: 448 tgtggttcctgttgggcttt 467
>emb|AL672267.10| Mouse DNA sequence from clone RP23-377K9 on chromosome X, complete sequence Length = 169331 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 551 ttgctgtgggtttatgtgtg 570 |||||||||||||||||||| Sbjct: 79928 ttgctgtgggtttatgtgtg 79947
>emb|AL844881.5| Mouse DNA sequence from clone RP23-244B19 on chromosome 2, complete sequence Length = 219340 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 449 ctgtggttcctgttgggctt 468 |||||||||||||||||||| Sbjct: 138909 ctgtggttcctgttgggctt 138928
>gb|M20496.1|HUMPROLA Human cathepsin L gene, complete cds Length = 1404 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 525 atcagggtcagtgtggttcttgttgggctttt 556
>emb|AL929125.1| Mouse DNA sequence from clone RP23-262O4 on chromosome 2, complete sequence Length = 183595 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 569 tggtgatggttgtgatggag 588 |||||||||||||||||||| Sbjct: 75985 tggtgatggttgtgatggag 75966
>dbj|AP000957.2| Homo sapiens genomic DNA, chromosome 21q21.1-q21.2 clone:B781M3, LL56-APP region, complete sequence Length = 190937 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 563 tatgtgtggtgatggttgtg 582 |||||||||||||||||||| Sbjct: 31684 tatgtgtggtgatggttgtg 31703
>dbj|AP002529.1| Homo sapiens genomic DNA, chromosome 6q21, anti-oncogene region, section 2/4 Length = 300000 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 566 gtgtggtgatggttgtgatg 585 |||||||||||||||||||| Sbjct: 44075 gtgtggtgatggttgtgatg 44094
>dbj|AB041731.1| Homo sapiens genomic DNA, chromosome 6q21, BAC clone:706L14, complete sequence Length = 156242 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 566 gtgtggtgatggttgtgatg 585 |||||||||||||||||||| Sbjct: 137302 gtgtggtgatggttgtgatg 137321
>dbj|AB042031.1| Homo sapiens genomic DNA, chromosome 6q21, BAC clone:515A4, complete sequence Length = 194732 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 566 gtgtggtgatggttgtgatg 585 |||||||||||||||||||| Sbjct: 33999 gtgtggtgatggttgtgatg 34018
>dbj|D37917.1|PIGPCL Boar mRNA for porcine cathepsin L, complete cds Length = 1378 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 439 atcaaggtcactgtggttcctgttgggctttt 470 |||| ||||| |||||||| |||||||||||| Sbjct: 469 atcagggtcagtgtggttcttgttgggctttt 500 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,132,900 Number of Sequences: 3902068 Number of extensions: 5132900 Number of successful extensions: 111973 Number of sequences better than 10.0: 218 Number of HSP's better than 10.0 without gapping: 218 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 111517 Number of HSP's gapped (non-prelim): 451 length of query: 621 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 598 effective length of database: 17,143,297,704 effective search space: 10251692026992 effective search space used: 10251692026992 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)