Clone Name	bah62p19
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	ref|XM_469533.1| Oryza sativa (japonica cultivar-group), mRNA	712	0.0
2	dbj|AK071307.1| Oryza sativa (japonica cultivar-group) cDNA clon...	712	0.0
3	gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3	379	e-102
4	dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D...	379	e-102
5	gb|AC090882.10| Oryza sativa chromosome 3 BAC OSJNBa0014G15 geno...	379	e-102
6	emb|X85808.1|ST76CISUB S.tuberosum mRNA for 76 kDa mitochondrial...	252	1e-63
7	ref|NM_123110.2| Arabidopsis thaliana EMB1467; NADH dehydrogenas...	228	2e-56
8	ref|NM_180772.1| Arabidopsis thaliana EMB1467; NADH dehydrogenas...	228	2e-56
9	gb|BT001090.1| Arabidopsis thaliana At4g37510/F6G17_160 mRNA, co...	228	2e-56
10	gb|AY056140.1| Arabidopsis thaliana putative NADH dehydrogenase ...	228	2e-56
11	gb|AY128304.1| Arabidopsis thaliana AT4g37510/F6G17_160 mRNA, co...	228	2e-56
12	emb|BX831070.1|CNS09YQ6 Arabidopsis thaliana Full-length cDNA Co...	204	2e-49
13	emb|CT009535.6| M.truncatula DNA sequence from clone MTH2-68D12 ...	188	1e-44
14	dbj|AB025630.1| Arabidopsis thaliana genomic DNA, chromosome 5, ...	149	1e-32
15	gb|BT011089.1| Drosophila melanogaster RE66734 full insert cDNA	123	7e-25
16	gb|AY075017.1| Drosophila simulans strain HW09 NADH-ubiquinone r...	123	7e-25
17	gb|AY075016.1| Drosophila simulans strain HW00 NADH-ubiquinone r...	123	7e-25
18	gb|AY075015.1| Drosophila simulans strain NC48 NADH-ubiquinone r...	123	7e-25
19	gb|AY075014.1| Drosophila simulans strain NC37 NADH-ubiquinone r...	123	7e-25
20	gb|AY075012.1| Drosophila simulans strain TT00 NADH-ubiquinone r...	123	7e-25
21	gb|AY075011.1| Drosophila simulans strain SCOO NADH-ubiquinone r...	123	7e-25
22	gb|AY075010.1| Drosophila simulans strain RU35 NADH-ubiquinone r...	123	7e-25
23	gb|AY075009.1| Drosophila simulans strain C167 NADH-ubiquinone r...	123	7e-25
24	gb|AY075007.1| Drosophila simulans strain RU07 NADH-ubiquinone r...	123	7e-25
25	gb|AY075006.1| Drosophila simulans strain RU01 NADH-ubiquinone r...	123	7e-25
26	gb|AY075005.1| Drosophila simulans strain RU00 NADH-ubiquinone r...	123	7e-25
27	gb|AY075003.1| Drosophila simulans strain W86 NADH-ubiquinone re...	123	7e-25
28	gb|AY075002.1| Drosophila simulans strain MD221 NADH-ubiquinone ...	123	7e-25
29	gb|AY075001.1| Drosophila simulans strain MD199 NADH-ubiquinone ...	123	7e-25
30	gb|AY074998.1| Drosophila simulans strain MD106 NADH-ubiquinone ...	123	7e-25
31	gb|AY074997.1| Drosophila simulans strain DSW NADH-ubiquinone re...	123	7e-25
32	gb|AY074996.1| Drosophila simulans strain DSR NADH-ubiquinone re...	123	7e-25
33	gb|AY074994.1| Drosophila melanogaster strain Oregon R NADH-ubiq...	123	7e-25
34	gb|AC104609.10| Drosophila melanogaster X BAC RP98-39F18 (Roswel...	123	7e-25
35	ref|NM_167152.1| Drosophila melanogaster NADH:ubiquinone reducta...	123	7e-25
36	ref|NM_078528.1| Drosophila melanogaster NADH:ubiquinone reducta...	123	7e-25
37	gb|AE003443.2| Drosophila melanogaster chromosome X, section 27 ...	123	7e-25
38	emb|Y09063.1|DM75KNADH D.melanogaster mRNA for NADH:ubiquinone r...	123	7e-25
39	gb|AY075008.1| Drosophila simulans strain RU259 NADH-ubiquinone ...	115	2e-22
40	gb|AY075004.1| Drosophila simulans strain MD225 NADH-ubiquinone ...	113	6e-22
41	gb|AY075000.1| Drosophila simulans strain MD112 NADH-ubiquinone ...	113	6e-22
42	gb|AY074995.1| Drosophila melanogaster strain Zimbabwe 53 NADH-u...	109	1e-20
43	gb|AY075013.1| Drosophila simulans strain TTO1 NADH-ubiquinone r...	107	4e-20
44	gb|AY074999.1| Drosophila simulans strain MD111 NADH-ubiquinone ...	107	4e-20
45	gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome	103	6e-19
46	gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome	96	1e-16
47	gb|CP000319.1| Nitrobacter hamburgensis X14, complete genome	92	2e-15
48	emb|BX572602.1| Rhodopseudomonas palustris CGA009 complete genom...	92	2e-15
49	dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome	92	2e-15
50	gb|AE009089.1| Agrobacterium tumefaciens str. C58 circular chrom...	86	1e-13
51	gb|AE007869.1| Agrobacterium tumefaciens str. C58, complete genome	86	1e-13
52	gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome	84	6e-13
53	gb|AY367780.1| Chlamydomonas reinhardtii NADH:ubiquinone oxidore...	80	9e-12
54	gb|CP000264.1| Jannaschia sp. CCS1, complete genome	78	3e-11
55	gb|AF029365.1|AF029365 Rhodobacter capsulatus B10 nuo gene clust...	78	3e-11
56	gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome	76	1e-10
57	emb|CR555306.1| Azoarcus sp. EbN1 complete genome	76	1e-10
58	gb|CP000133.1| Rhizobium etli CFN 42, complete genome	74	5e-10
59	gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, comp...	72	2e-09
60	gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, com...	72	2e-09
61	emb|AL591786.1|SME591786 Sinorhizobium meliloti 1021 complete ch...	72	2e-09
62	emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromos...	72	2e-09
63	emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome comple...	72	2e-09
64	gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, com...	72	2e-09
65	ref|XM_321442.2| Anopheles gambiae str. PEST ENSANGP00000022170 ...	70	8e-09
66	gb|AE014291.4| Brucella suis 1330 chromosome I, complete sequence	68	3e-08
67	gb|AE011910.1| Xanthomonas axonopodis pv. citri str. 306, secti...	68	3e-08
68	gb|AE009555.1| Brucella melitensis 16M chromosome I, section 112...	68	3e-08
69	gb|AE017223.1| Brucella abortus biovar 1 str. 9-941 chromosome I...	68	3e-08
70	emb|AM040264.1| Brucella melitensis biovar Abortus chromosome I,...	68	3e-08
71	gb|DQ167767.1| Drosophila teissieri putative NADH:ubiquinone red...	66	1e-07
72	gb|DQ167766.1| Drosophila simulans putative NADH:ubiquinone redu...	66	1e-07
73	gb|DQ167765.1| Drosophila orena putative NADH:ubiquinone reducta...	66	1e-07
74	gb|CP000352.1| Ralstonia metallidurans CH34, complete genome	64	5e-07
75	gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete ...	64	5e-07
76	emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete ...	60	8e-06
77	gb|DQ167768.1| Drosophila yakuba putative NADH:ubiquinone reduct...	60	8e-06
78	gb|AE012364.1| Xanthomonas campestris pv. campestris str. ATCC 3...	60	8e-06
79	gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, ...	60	8e-06
80	gb|DQ167764.1| Drosophila erecta putative NADH:ubiquinone reduct...	58	3e-05
81	gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome	56	1e-04
82	dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ...	56	1e-04
83	gb|BC049394.1| Xenopus laevis NADH dehydrogenase (ubiquinone) Fe...	54	5e-04
84	ref|XM_796826.1| PREDICTED: Strongylocentrotus purpuratus simila...	54	5e-04
85	ref|XM_775031.1| PREDICTED: Strongylocentrotus purpuratus simila...	54	5e-04
86	dbj|AP007162.1| Aspergillus oryzae RIB40 genomic DNA, SC102	54	5e-04
87	gb|AY972100.1| Rhodothermus marinus strain PRQ 62B putative aden...	52	0.002
88	gb|CP000088.1| Thermobifida fusca YX, complete genome	52	0.002
89	dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, c...	52	0.002
90	gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete...	52	0.002
91	gb|AE017196.1| Wolbachia endosymbiont of Drosophila melanogaster...	52	0.002
92	gb|BC085651.1| Danio rerio zgc:92209, mRNA (cDNA clone MGC:92209...	50	0.008
93	ref|NM_001007765.1| Danio rerio zgc:92209 (zgc:92209), mRNA	50	0.008
94	emb|AL162752.2|NMA1Z2491 Neisseria meningitidis serogroup A stra...	48	0.031
95	gb|CP000249.1| Frankia sp. CcI3, complete genome	48	0.031
96	gb|AE004969.1| Neisseria gonorrhoeae FA 1090, complete genome	48	0.031
97	gb|AE016828.2| Coxiella burnetii RSA 493, complete genome	46	0.12
98	gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence	44	0.49
99	gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome	44	0.49
100	gb|AY809738.1| Schistosoma japonicum SJCHGC05264 protein mRNA, p...	44	0.49
101	gb|AE007270.1| Sinorhizobium meliloti 1021 plasmid pSymA section...	44	0.49
102	ref|XM_568803.1| Cryptococcus neoformans var. neoformans JEC21 N...	44	0.49
103	emb|AJ245399.2|RME245399 Sinorhizobium meliloti ORF-378 (partial...	44	0.49
104	gb|CP000053.1| Rickettsia felis URRWXCal2, complete genome	44	0.49
105	ref|XM_968704.1| PREDICTED: Tribolium castaneum similar to NADH-...	44	0.49
106	emb|BX842582.1| Mycobacterium tuberculosis H37Rv complete genome...	44	0.49
107	emb|BX248345.1| Mycobacterium bovis subsp. bovis AF2122/97 compl...	44	0.49
108	gb|AE017342.1| Cryptococcus neoformans var. neoformans JEC21 chr...	44	0.49
109	gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome	42	1.9
110	gb|BC015300.1| Mus musculus NADH dehydrogenase (ubiquinone) Fe-S...	42	1.9
111	ref|NM_145518.1| Mus musculus NADH dehydrogenase (ubiquinone) Fe...	42	1.9
112	gb|AC141109.13| Medicago truncatula clone mth2-16p3, complete se...	42	1.9
113	emb|AL590393.7| Human DNA sequence from clone RP11-191O13 on chr...	42	1.9
114	emb|AL645950.13| Mouse DNA sequence from clone RP23-13C17 on chr...	42	1.9
115	emb|AL645704.9| Mouse DNA sequence from clone RP23-414F19 on chr...	42	1.9
116	dbj|AK142711.1| Mus musculus 16 days neonate heart cDNA, RIKEN f...	42	1.9
117	dbj|AK146814.1| Mus musculus 16 days embryo heart cDNA, RIKEN fu...	42	1.9
118	dbj|AK167705.1| Mus musculus 12 days pregnant adult female place...	42	1.9
119	dbj|AK166604.1| Mus musculus 4 cells embryo 4 cells cDNA, RIKEN ...	42	1.9
120	dbj|AK034597.1| Mus musculus 12 days embryo embryonic body betwe...	42	1.9
121	dbj|AK036926.1| Mus musculus adult female vagina cDNA, RIKEN ful...	42	1.9
122	dbj|AK078590.1| Mus musculus 11 days embryo gonad cDNA, RIKEN fu...	42	1.9
123	gb|BC006660.1| Mus musculus NADH dehydrogenase (ubiquinone) Fe-S...	42	1.9
124	gb|AC158162.13| Mus musculus chromosome 3, clone RP23-335E20, co...	40	7.6
125	gb|AC149783.2| Bos taurus BAC CH240-3K17 (Children's Hospital O...	40	7.6
126	gb|AE006430.1| Lactococcus lactis subsp. lactis IL1403 section 1...	40	7.6
127	gb|AE009034.1| Agrobacterium tumefaciens str. C58 circular chrom...	40	7.6
128	gb|DQ491003.1| Chlorella virus AR158 ctg_1047243734156 genomic s...	40	7.6
129	gb|DQ491002.1| Paramecium bursaria Chlorella virus NY2A Chlorell...	40	7.6
130	gb|AC126260.3| Mus musculus BAC clone RP23-338J1 from chromosome...	40	7.6
131	gb|AC121885.3| Mus musculus BAC clone RP24-138N20 from chromosom...	40	7.6
132	emb|AL138700.18| Human DNA sequence from clone RP11-401G12 on ch...	40	7.6
133	gb|AC160015.2| Mus musculus BAC clone RP23-433E2 from chromosome...	40	7.6
134	emb|AL772195.4| Mouse DNA sequence from clone RP23-218C5 on chro...	40	7.6
135	gb|AC063953.13| Homo sapiens 3 BAC RP11-317I15 (Roswell Park Can...	40	7.6
136	gb|AC007431.8| Homo sapiens chromosome 17, clone RP11-118E18, co...	40	7.6
137	dbj|AK048234.1| Mus musculus 16 days embryo head cDNA, RIKEN ful...	40	7.6
138	gb|AE002098.2| Neisseria meningitidis MC58, complete genome	40	7.6
139	emb|AL603630.11| Mouse DNA sequence from clone RP23-350M23 on ch...	40	7.6
140	gb|BC084851.1| Xenopus laevis hypothetical LOC495383, mRNA (cDNA...	40	7.6
141	emb|CT025676.10| Mouse DNA sequence from clone RP24-372B7 on chr...	40	7.6
142	emb|AL669921.13| Mouse DNA sequence from clone RP23-67P9 on chro...	40	7.6

---

>ref|XM_469533.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2486

 Score =  712 bits (359), Expect = 0.0
 Identities = 506/555 (91%)
 Strand = Plus / Plus

                                                                       
Query: 1   gcccgtcgcctcctgcgccatgcccgccctcccagggatgaagattaagaccaacacacc 60
           ||||||||||||||||||||||||||| || |||||||||||||||||||| ||||| ||
Sbjct: 393 gcccgtcgcctcctgcgccatgcccgcgcttccagggatgaagattaagacaaacacgcc 452

                                                                       
Query: 61  aattgcgaagaaggcaagggagggtgtcatggagttcttgctgatgaaccatccgctcga 120
           | | || ||||| || ||||||||||||||||||||| || ||||||| |||||||| ||
Sbjct: 453 agtagcaaagaaagccagggagggtgtcatggagttcctgttgatgaatcatccgctgga 512

                                                                       
Query: 121 ttgcccaatctgcgatcagggcggggagtgtgacctccaggatcagtccatggcctttgg 180
            ||||||||||| |||||||| ||||||||||| |||||||||||||| ||||| |||||
Sbjct: 513 ctgcccaatctgtgatcagggtggggagtgtgatctccaggatcagtctatggcatttgg 572

                                                                       
Query: 181 ggctgaccgtggtcgtttcaccgacatgaagcggtcggttgtggataagaatctgggccc 240
           ||||||||||||||| ||||| || ||||||||||| |||||||| |||||| |||||||
Sbjct: 573 ggctgaccgtggtcggttcactgagatgaagcggtccgttgtggacaagaatttgggccc 632

                                                                       
Query: 241 cttggtgaagacggtgatgacccgttgcatccagtgtacaaggtgtgtcaggtttgcatc 300
            ||||||||||| |||||||||||||||||||| ||||||||||| ||||| |||||   
Sbjct: 633 attggtgaagacagtgatgacccgttgcatccaatgtacaaggtgcgtcagatttgctag 692

                                                                       
Query: 301 tgaggttgctggtgttcaagacctgggcatgttaggccgtggcagtggtgaagaaatcgg 360
           ||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| ||
Sbjct: 693 tgaggttgctggtgttcaagacctgggtatgttaggtcgtggcagtggtgaagaaattgg 752

                                                                       
Query: 361 aacatatgtggggaaactcatgacaagtgaactatctggaaatgttattgatatctgccc 420
           ||||||||||| |||||| |||||||||||||| ||||||||||||||||||||||||||
Sbjct: 753 aacatatgtggagaaacttatgacaagtgaactctctggaaatgttattgatatctgccc 812

                                                                       
Query: 421 cgttggagctcttacatccaagccgtttgcatttaaagctaggaactgggagatgaaggg 480
            |||||||| |||||||||||||| ||||||||||||||||||||||||||| |||||||
Sbjct: 813 agttggagcccttacatccaagccatttgcatttaaagctaggaactgggagctgaaggg 872

                                                                       
Query: 481 cactgagactattgatgttactgatgcagtagggtccaacatccgtgttgacagcagagg 540
           |||||| |||||||||||||||||||||||||| || |||||  | ||||||||||||||
Sbjct: 873 cactgaaactattgatgttactgatgcagtaggttcaaacattagagttgacagcagagg 932

                          
Query: 541 tcctgaagttatgcg 555
           |||||||||||||||
Sbjct: 933 tcctgaagttatgcg 947

---

>dbj|AK071307.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023087M21, full
            insert sequence
          Length = 2518

 Score =  712 bits (359), Expect = 0.0
 Identities = 506/555 (91%)
 Strand = Plus / Plus

                                                                        
Query: 1    gcccgtcgcctcctgcgccatgcccgccctcccagggatgaagattaagaccaacacacc 60
            ||||||||||||||||||||||||||| || |||||||||||||||||||| ||||| ||
Sbjct: 481  gcccgtcgcctcctgcgccatgcccgcgcttccagggatgaagattaagacaaacacgcc 540

                                                                        
Query: 61   aattgcgaagaaggcaagggagggtgtcatggagttcttgctgatgaaccatccgctcga 120
            | | || ||||| || ||||||||||||||||||||| || ||||||| |||||||| ||
Sbjct: 541  agtagcaaagaaagccagggagggtgtcatggagttcctgttgatgaatcatccgctgga 600

                                                                        
Query: 121  ttgcccaatctgcgatcagggcggggagtgtgacctccaggatcagtccatggcctttgg 180
             ||||||||||| |||||||| ||||||||||| |||||||||||||| ||||| |||||
Sbjct: 601  ctgcccaatctgtgatcagggtggggagtgtgatctccaggatcagtctatggcatttgg 660

                                                                        
Query: 181  ggctgaccgtggtcgtttcaccgacatgaagcggtcggttgtggataagaatctgggccc 240
            ||||||||||||||| ||||| || ||||||||||| |||||||| |||||| |||||||
Sbjct: 661  ggctgaccgtggtcggttcactgagatgaagcggtccgttgtggacaagaatttgggccc 720

                                                                        
Query: 241  cttggtgaagacggtgatgacccgttgcatccagtgtacaaggtgtgtcaggtttgcatc 300
             ||||||||||| |||||||||||||||||||| ||||||||||| ||||| |||||   
Sbjct: 721  attggtgaagacagtgatgacccgttgcatccaatgtacaaggtgcgtcagatttgctag 780

                                                                        
Query: 301  tgaggttgctggtgttcaagacctgggcatgttaggccgtggcagtggtgaagaaatcgg 360
            ||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| ||
Sbjct: 781  tgaggttgctggtgttcaagacctgggtatgttaggtcgtggcagtggtgaagaaattgg 840

                                                                        
Query: 361  aacatatgtggggaaactcatgacaagtgaactatctggaaatgttattgatatctgccc 420
            ||||||||||| |||||| |||||||||||||| ||||||||||||||||||||||||||
Sbjct: 841  aacatatgtggagaaacttatgacaagtgaactctctggaaatgttattgatatctgccc 900

                                                                        
Query: 421  cgttggagctcttacatccaagccgtttgcatttaaagctaggaactgggagatgaaggg 480
             |||||||| |||||||||||||| ||||||||||||||||||||||||||| |||||||
Sbjct: 901  agttggagcccttacatccaagccatttgcatttaaagctaggaactgggagctgaaggg 960

                                                                        
Query: 481  cactgagactattgatgttactgatgcagtagggtccaacatccgtgttgacagcagagg 540
            |||||| |||||||||||||||||||||||||| || |||||  | ||||||||||||||
Sbjct: 961  cactgaaactattgatgttactgatgcagtaggttcaaacattagagttgacagcagagg 1020

                           
Query: 541  tcctgaagttatgcg 555
            |||||||||||||||
Sbjct: 1021 tcctgaagttatgcg 1035

---

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  379 bits (191), Expect = e-102
 Identities = 239/255 (93%)
 Strand = Plus / Minus

                                                                            
Query: 301      tgaggttgctggtgttcaagacctgggcatgttaggccgtggcagtggtgaagaaatcgg 360
                ||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| ||
Sbjct: 28563868 tgaggttgctggtgttcaagacctgggtatgttaggtcgtggcagtggtgaagaaattgg 28563809

                                                                            
Query: 361      aacatatgtggggaaactcatgacaagtgaactatctggaaatgttattgatatctgccc 420
                ||||||||||| |||||| |||||||||||||| ||||||||||||||||||||||||||
Sbjct: 28563808 aacatatgtggagaaacttatgacaagtgaactctctggaaatgttattgatatctgccc 28563749

                                                                            
Query: 421      cgttggagctcttacatccaagccgtttgcatttaaagctaggaactgggagatgaaggg 480
                 |||||||| |||||||||||||| ||||||||||||||||||||||||||| |||||||
Sbjct: 28563748 agttggagcccttacatccaagccatttgcatttaaagctaggaactgggagctgaaggg 28563689

                                                                            
Query: 481      cactgagactattgatgttactgatgcagtagggtccaacatccgtgttgacagcagagg 540
                |||||| |||||||||||||||||||||||||| || |||||  | ||||||||||||||
Sbjct: 28563688 cactgaaactattgatgttactgatgcagtaggttcaaacattagagttgacagcagagg 28563629

                               
Query: 541      tcctgaagttatgcg 555
                |||||||||||||||
Sbjct: 28563628 tcctgaagttatgcg 28563614



 Score =  291 bits (147), Expect = 1e-75
 Identities = 225/251 (89%)
 Strand = Plus / Minus

                                                                            
Query: 34       agggatgaagattaagaccaacacaccaattgcgaagaaggcaagggagggtgtcatgga 93
                |||||||||||||||||| ||||| ||| | || ||||| || |||||||||||||||||
Sbjct: 28564438 agggatgaagattaagacaaacacgccagtagcaaagaaagccagggagggtgtcatgga 28564379

                                                                            
Query: 94       gttcttgctgatgaaccatccgctcgattgcccaatctgcgatcagggcggggagtgtga 153
                |||| || ||||||| |||||||| || ||||||||||| |||||||| |||||||||||
Sbjct: 28564378 gttcctgttgatgaatcatccgctggactgcccaatctgtgatcagggtggggagtgtga 28564319

                                                                            
Query: 154      cctccaggatcagtccatggcctttggggctgaccgtggtcgtttcaccgacatgaagcg 213
                 |||||||||||||| ||||| |||||||||||||||||||| ||||| || ||||||||
Sbjct: 28564318 tctccaggatcagtctatggcatttggggctgaccgtggtcggttcactgagatgaagcg 28564259

                                                                            
Query: 214      gtcggttgtggataagaatctgggccccttggtgaagacggtgatgacccgttgcatcca 273
                ||| |||||||| |||||| ||||||| ||||||||||| ||||||||||||||||||||
Sbjct: 28564258 gtccgttgtggacaagaatttgggcccattggtgaagacagtgatgacccgttgcatcca 28564199

                           
Query: 274      gtgtacaaggt 284
                 ||||||||||
Sbjct: 28564198 atgtacaaggt 28564188



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                    
Query: 1        gcccgtcgcctcctgcgccatgcccgccctcccagg 36
                ||||||||||||||||||||||||||| || |||||
Sbjct: 28564727 gcccgtcgcctcctgcgccatgcccgcgcttccagg 28564692

---

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  379 bits (191), Expect = e-102
 Identities = 239/255 (93%)
 Strand = Plus / Minus

                                                                            
Query: 301      tgaggttgctggtgttcaagacctgggcatgttaggccgtggcagtggtgaagaaatcgg 360
                ||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| ||
Sbjct: 28655192 tgaggttgctggtgttcaagacctgggtatgttaggtcgtggcagtggtgaagaaattgg 28655133

                                                                            
Query: 361      aacatatgtggggaaactcatgacaagtgaactatctggaaatgttattgatatctgccc 420
                ||||||||||| |||||| |||||||||||||| ||||||||||||||||||||||||||
Sbjct: 28655132 aacatatgtggagaaacttatgacaagtgaactctctggaaatgttattgatatctgccc 28655073

                                                                            
Query: 421      cgttggagctcttacatccaagccgtttgcatttaaagctaggaactgggagatgaaggg 480
                 |||||||| |||||||||||||| ||||||||||||||||||||||||||| |||||||
Sbjct: 28655072 agttggagcccttacatccaagccatttgcatttaaagctaggaactgggagctgaaggg 28655013

                                                                            
Query: 481      cactgagactattgatgttactgatgcagtagggtccaacatccgtgttgacagcagagg 540
                |||||| |||||||||||||||||||||||||| || |||||  | ||||||||||||||
Sbjct: 28655012 cactgaaactattgatgttactgatgcagtaggttcaaacattagagttgacagcagagg 28654953

                               
Query: 541      tcctgaagttatgcg 555
                |||||||||||||||
Sbjct: 28654952 tcctgaagttatgcg 28654938



 Score =  291 bits (147), Expect = 1e-75
 Identities = 225/251 (89%)
 Strand = Plus / Minus

                                                                            
Query: 34       agggatgaagattaagaccaacacaccaattgcgaagaaggcaagggagggtgtcatgga 93
                |||||||||||||||||| ||||| ||| | || ||||| || |||||||||||||||||
Sbjct: 28655762 agggatgaagattaagacaaacacgccagtagcaaagaaagccagggagggtgtcatgga 28655703

                                                                            
Query: 94       gttcttgctgatgaaccatccgctcgattgcccaatctgcgatcagggcggggagtgtga 153
                |||| || ||||||| |||||||| || ||||||||||| |||||||| |||||||||||
Sbjct: 28655702 gttcctgttgatgaatcatccgctggactgcccaatctgtgatcagggtggggagtgtga 28655643

                                                                            
Query: 154      cctccaggatcagtccatggcctttggggctgaccgtggtcgtttcaccgacatgaagcg 213
                 |||||||||||||| ||||| |||||||||||||||||||| ||||| || ||||||||
Sbjct: 28655642 tctccaggatcagtctatggcatttggggctgaccgtggtcggttcactgagatgaagcg 28655583

                                                                            
Query: 214      gtcggttgtggataagaatctgggccccttggtgaagacggtgatgacccgttgcatcca 273
                ||| |||||||| |||||| ||||||| ||||||||||| ||||||||||||||||||||
Sbjct: 28655582 gtccgttgtggacaagaatttgggcccattggtgaagacagtgatgacccgttgcatcca 28655523

                           
Query: 274      gtgtacaaggt 284
                 ||||||||||
Sbjct: 28655522 atgtacaaggt 28655512



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                    
Query: 1        gcccgtcgcctcctgcgccatgcccgccctcccagg 36
                ||||||||||||||||||||||||||| || |||||
Sbjct: 28656051 gcccgtcgcctcctgcgccatgcccgcgcttccagg 28656016

---

>gb|AC090882.10| Oryza sativa chromosome 3 BAC OSJNBa0014G15 genomic sequence, complete
              sequence
          Length = 158839

 Score =  379 bits (191), Expect = e-102
 Identities = 239/255 (93%)
 Strand = Plus / Plus

                                                                          
Query: 301    tgaggttgctggtgttcaagacctgggcatgttaggccgtggcagtggtgaagaaatcgg 360
              ||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| ||
Sbjct: 135028 tgaggttgctggtgttcaagacctgggtatgttaggtcgtggcagtggtgaagaaattgg 135087

                                                                          
Query: 361    aacatatgtggggaaactcatgacaagtgaactatctggaaatgttattgatatctgccc 420
              ||||||||||| |||||| |||||||||||||| ||||||||||||||||||||||||||
Sbjct: 135088 aacatatgtggagaaacttatgacaagtgaactctctggaaatgttattgatatctgccc 135147

                                                                          
Query: 421    cgttggagctcttacatccaagccgtttgcatttaaagctaggaactgggagatgaaggg 480
               |||||||| |||||||||||||| ||||||||||||||||||||||||||| |||||||
Sbjct: 135148 agttggagcccttacatccaagccatttgcatttaaagctaggaactgggagctgaaggg 135207

                                                                          
Query: 481    cactgagactattgatgttactgatgcagtagggtccaacatccgtgttgacagcagagg 540
              |||||| |||||||||||||||||||||||||| || |||||  | ||||||||||||||
Sbjct: 135208 cactgaaactattgatgttactgatgcagtaggttcaaacattagagttgacagcagagg 135267

                             
Query: 541    tcctgaagttatgcg 555
              |||||||||||||||
Sbjct: 135268 tcctgaagttatgcg 135282



 Score =  291 bits (147), Expect = 1e-75
 Identities = 225/251 (89%)
 Strand = Plus / Plus

                                                                          
Query: 34     agggatgaagattaagaccaacacaccaattgcgaagaaggcaagggagggtgtcatgga 93
              |||||||||||||||||| ||||| ||| | || ||||| || |||||||||||||||||
Sbjct: 134458 agggatgaagattaagacaaacacgccagtagcaaagaaagccagggagggtgtcatgga 134517

                                                                          
Query: 94     gttcttgctgatgaaccatccgctcgattgcccaatctgcgatcagggcggggagtgtga 153
              |||| || ||||||| |||||||| || ||||||||||| |||||||| |||||||||||
Sbjct: 134518 gttcctgttgatgaatcatccgctggactgcccaatctgtgatcagggtggggagtgtga 134577

                                                                          
Query: 154    cctccaggatcagtccatggcctttggggctgaccgtggtcgtttcaccgacatgaagcg 213
               |||||||||||||| ||||| |||||||||||||||||||| ||||| || ||||||||
Sbjct: 134578 tctccaggatcagtctatggcatttggggctgaccgtggtcggttcactgagatgaagcg 134637

                                                                          
Query: 214    gtcggttgtggataagaatctgggccccttggtgaagacggtgatgacccgttgcatcca 273
              ||| |||||||| |||||| ||||||| ||||||||||| ||||||||||||||||||||
Sbjct: 134638 gtccgttgtggacaagaatttgggcccattggtgaagacagtgatgacccgttgcatcca 134697

                         
Query: 274    gtgtacaaggt 284
               ||||||||||
Sbjct: 134698 atgtacaaggt 134708



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                                  
Query: 1      gcccgtcgcctcctgcgccatgcccgccctcccagg 36
              ||||||||||||||||||||||||||| || |||||
Sbjct: 134169 gcccgtcgcctcctgcgccatgcccgcgcttccagg 134204

---

>emb|X85808.1|ST76CISUB S.tuberosum mRNA for 76 kDa mitochondrial complex I subunit
          Length = 2599

 Score =  252 bits (127), Expect = 1e-63
 Identities = 427/527 (81%)
 Strand = Plus / Plus

                                                                       
Query: 17  gccatgcccgccctcccagggatgaagattaagaccaacacaccaattgcgaagaaggca 76
           |||||||| || || ||||| |||||||| |||||  | ||||| ||||| || ||||| 
Sbjct: 427 gccatgcctgcacttccaggaatgaagatcaagacagatacacctattgccaaaaaggct 486

                                                                       
Query: 77  agggagggtgtcatggagttcttgctgatgaaccatccgctcgattgcccaatctgcgat 136
            | || || ||||||||||||||||| ||||| |||||  | ||||||||||| || |||
Sbjct: 487 cgtgaaggagtcatggagttcttgcttatgaatcatccattagattgcccaatttgtgat 546

                                                                       
Query: 137 cagggcggggagtgtgacctccaggatcagtccatggcctttggggctgaccgtggtcgt 196
           ||||| || || ||||| ||||||||||| || |||||||||||  | ||||| || |||
Sbjct: 547 cagggaggagaatgtgatctccaggatcaatctatggcctttggatccgaccgcgggcgt 606

                                                                       
Query: 197 ttcaccgacatgaagcggtcggttgtggataagaatctgggccccttggtgaagacggtg 256
           ||||| || |||||| | || || || || |||||| |||| || ||||||||||| |||
Sbjct: 607 ttcactgaaatgaagagatctgtggttgacaagaatttgggtccattggtgaagactgtg 666

                                                                       
Query: 257 atgacccgttgcatccagtgtacaaggtgtgtcaggtttgcatctgaggttgctggtgtt 316
           |||||||| ||||||||||||||||||||||||||||| ||||| || || ||||| || 
Sbjct: 667 atgacccggtgcatccagtgtacaaggtgtgtcaggttcgcatcagaagtagctggagtg 726

                                                                       
Query: 317 caagacctgggcatgttaggccgtggcagtggtgaagaaatcggaacatatgtggggaaa 376
            | ||||| || ||||| || ||||| |||||||||||||| ||||| ||||| |  || 
Sbjct: 727 gaggaccttggaatgttgggtcgtggaagtggtgaagaaattggaacttatgttgaaaag 786

                                                                       
Query: 377 ctcatgacaagtgaactatctggaaatgttattgatatctgccccgttggagctcttaca 436
           || ||||||||||| || || || ||||| |||||||| || || || ||||| ||||||
Sbjct: 787 cttatgacaagtgagctttcagggaatgtgattgatatatgtccagtaggagcccttaca 846

                                                                       
Query: 437 tccaagccgtttgcatttaaagctaggaactgggagatgaagggcactgagactattgat 496
           || || || ||||| || ||||| || || |||||| | |||||||| || |  ||||||
Sbjct: 847 tcaaaaccatttgccttcaaagccagaaattgggagctaaagggcacagaaagcattgat 906

                                                          
Query: 497 gttactgatgcagtagggtccaacatccgtgttgacagcagaggtcc 543
           || |||||||| || || || ||||||||  |||| || ||||||||
Sbjct: 907 gtgactgatgctgttggttctaacatccgaattgatagtagaggtcc 953

---

>ref|NM_123110.2| Arabidopsis thaliana EMB1467; NADH dehydrogenase (ubiquinone)/ NADH
            dehydrogenase/ electron transporter/ iron ion binding /
            oxidoreductase AT5G37510 (EMB1467) transcript variant
            AT5G37510.2 mRNA, complete cds
          Length = 2527

 Score =  228 bits (115), Expect = 2e-56
 Identities = 433/539 (80%)
 Strand = Plus / Plus

                                                                        
Query: 17   gccatgcccgccctcccagggatgaagattaagaccaacacaccaattgcgaagaaggca 76
            |||||||| || || || |||||||||||||||||  | ||||| || || |||||||| 
Sbjct: 483  gccatgcctgcgcttcctgggatgaagattaagactgatacaccgatagctaagaaggcg 542

                                                                        
Query: 77   agggagggtgtcatggagttcttgctgatgaaccatccgctcgattgcccaatctgcgat 136
            |||||||| || |||||||| ||| ||||||| || ||  | ||||| || || || || 
Sbjct: 543  agggagggagtgatggagtttttgttgatgaatcaccctttggattgtcctatttgtgac 602

                                                                        
Query: 137  cagggcggggagtgtgacctccaggatcagtccatggcctttggggctgaccgtggtcgt 196
            || || || |||||||| || ||||||||||| ||||| |||||  ||||  | || |||
Sbjct: 603  caaggaggagagtgtgatcttcaggatcagtctatggcttttggatctgatagaggacgt 662

                                                                        
Query: 197  ttcaccgacatgaagcggtcggttgtggataagaatctgggccccttggtgaagacggtg 256
            || || || |||||  | || ||||| ||||||||||| || ||  | |||||||| || 
Sbjct: 663  tttactgagatgaaaagatctgttgttgataagaatcttggtcctcttgtgaagactgtt 722

                                                                        
Query: 257  atgacccgttgcatccagtgtacaaggtgtgtcaggtttgcatctgaggttgctggtgtt 316
            ||||| || || ||||||||||||||||||||  | ||||| ||||| |||||||| |||
Sbjct: 723  atgactcggtgtatccagtgtacaaggtgtgtacgatttgcttctgaagttgctggggtt 782

                                                                        
Query: 317  caagacctgggcatgttaggccgtggcagtggtgaagaaatcggaacatatgtggggaaa 376
            || || || || ||  |||| ||||| ||||| || ||||| ||||| ||||| |  || 
Sbjct: 783  caggatcttggtatactaggtcgtggtagtggagaggaaattggaacttatgttgaaaag 842

                                                                        
Query: 377  ctcatgacaagtgaactatctggaaatgttattgatatctgccccgttggagctcttaca 436
            || ||||| |||||||| ||||||||||||||||||||||| || ||||||||  | || 
Sbjct: 843  cttatgaccagtgaactctctggaaatgttattgatatctgtcctgttggagccttgacc 902

                                                                        
Query: 437  tccaagccgtttgcatttaaagctaggaactgggagatgaagggcactgagactattgat 496
            || ||||| ||||| |||||||| || ||||||||| |||| |  || || |||||||||
Sbjct: 903  tcaaagccttttgcctttaaagccagaaactgggagttgaaagcaacagaaactattgat 962

                                                                       
Query: 497  gttactgatgcagtagggtccaacatccgtgttgacagcagaggtcctgaagttatgcg 555
            |||| |||||| || |||||||||||||||||||| || ||||| || ||||| |||||
Sbjct: 963  gttagtgatgctgttgggtccaacatccgtgttgatagtagaggaccagaagtaatgcg 1021

---

>ref|NM_180772.1| Arabidopsis thaliana EMB1467; NADH dehydrogenase (ubiquinone)/ NADH
            dehydrogenase/ electron transporter/ iron ion binding /
            oxidoreductase AT5G37510 (EMB1467) transcript variant
            AT5G37510.1 mRNA, complete cds
          Length = 2623

 Score =  228 bits (115), Expect = 2e-56
 Identities = 433/539 (80%)
 Strand = Plus / Plus

                                                                        
Query: 17   gccatgcccgccctcccagggatgaagattaagaccaacacaccaattgcgaagaaggca 76
            |||||||| || || || |||||||||||||||||  | ||||| || || |||||||| 
Sbjct: 483  gccatgcctgcgcttcctgggatgaagattaagactgatacaccgatagctaagaaggcg 542

                                                                        
Query: 77   agggagggtgtcatggagttcttgctgatgaaccatccgctcgattgcccaatctgcgat 136
            |||||||| || |||||||| ||| ||||||| || ||  | ||||| || || || || 
Sbjct: 543  agggagggagtgatggagtttttgttgatgaatcaccctttggattgtcctatttgtgac 602

                                                                        
Query: 137  cagggcggggagtgtgacctccaggatcagtccatggcctttggggctgaccgtggtcgt 196
            || || || |||||||| || ||||||||||| ||||| |||||  ||||  | || |||
Sbjct: 603  caaggaggagagtgtgatcttcaggatcagtctatggcttttggatctgatagaggacgt 662

                                                                        
Query: 197  ttcaccgacatgaagcggtcggttgtggataagaatctgggccccttggtgaagacggtg 256
            || || || |||||  | || ||||| ||||||||||| || ||  | |||||||| || 
Sbjct: 663  tttactgagatgaaaagatctgttgttgataagaatcttggtcctcttgtgaagactgtt 722

                                                                        
Query: 257  atgacccgttgcatccagtgtacaaggtgtgtcaggtttgcatctgaggttgctggtgtt 316
            ||||| || || ||||||||||||||||||||  | ||||| ||||| |||||||| |||
Sbjct: 723  atgactcggtgtatccagtgtacaaggtgtgtacgatttgcttctgaagttgctggggtt 782

                                                                        
Query: 317  caagacctgggcatgttaggccgtggcagtggtgaagaaatcggaacatatgtggggaaa 376
            || || || || ||  |||| ||||| ||||| || ||||| ||||| ||||| |  || 
Sbjct: 783  caggatcttggtatactaggtcgtggtagtggagaggaaattggaacttatgttgaaaag 842

                                                                        
Query: 377  ctcatgacaagtgaactatctggaaatgttattgatatctgccccgttggagctcttaca 436
            || ||||| |||||||| ||||||||||||||||||||||| || ||||||||  | || 
Sbjct: 843  cttatgaccagtgaactctctggaaatgttattgatatctgtcctgttggagccttgacc 902

                                                                        
Query: 437  tccaagccgtttgcatttaaagctaggaactgggagatgaagggcactgagactattgat 496
            || ||||| ||||| |||||||| || ||||||||| |||| |  || || |||||||||
Sbjct: 903  tcaaagccttttgcctttaaagccagaaactgggagttgaaagcaacagaaactattgat 962

                                                                       
Query: 497  gttactgatgcagtagggtccaacatccgtgttgacagcagaggtcctgaagttatgcg 555
            |||| |||||| || |||||||||||||||||||| || ||||| || ||||| |||||
Sbjct: 963  gttagtgatgctgttgggtccaacatccgtgttgatagtagaggaccagaagtaatgcg 1021

---

>gb|BT001090.1| Arabidopsis thaliana At4g37510/F6G17_160 mRNA, complete cds
          Length = 2040

 Score =  228 bits (115), Expect = 2e-56
 Identities = 433/539 (80%)
 Strand = Plus / Plus

                                                                       
Query: 17  gccatgcccgccctcccagggatgaagattaagaccaacacaccaattgcgaagaaggca 76
           |||||||| || || || |||||||||||||||||  | ||||| || || |||||||| 
Sbjct: 403 gccatgcctgcgcttcctgggatgaagattaagactgatacaccgatagctaagaaggcg 462

                                                                       
Query: 77  agggagggtgtcatggagttcttgctgatgaaccatccgctcgattgcccaatctgcgat 136
           |||||||| || |||||||| ||| ||||||| || ||  | ||||| || || || || 
Sbjct: 463 agggagggagtgatggagtttttgttgatgaatcaccctttggattgtcctatttgtgac 522

                                                                       
Query: 137 cagggcggggagtgtgacctccaggatcagtccatggcctttggggctgaccgtggtcgt 196
           || || || |||||||| || ||||||||||| ||||| |||||  ||||  | || |||
Sbjct: 523 caaggaggagagtgtgatcttcaggatcagtctatggcttttggatctgatagaggacgt 582

                                                                       
Query: 197 ttcaccgacatgaagcggtcggttgtggataagaatctgggccccttggtgaagacggtg 256
           || || || |||||  | || ||||| ||||||||||| || ||  | |||||||| || 
Sbjct: 583 tttactgagatgaaaagatctgttgttgataagaatcttggtcctcttgtgaagactgtt 642

                                                                       
Query: 257 atgacccgttgcatccagtgtacaaggtgtgtcaggtttgcatctgaggttgctggtgtt 316
           ||||| || || ||||||||||||||||||||  | ||||| ||||| |||||||| |||
Sbjct: 643 atgactcggtgtatccagtgtacaaggtgtgtacgatttgcttctgaagttgctggggtt 702

                                                                       
Query: 317 caagacctgggcatgttaggccgtggcagtggtgaagaaatcggaacatatgtggggaaa 376
           || || || || ||  |||| ||||| ||||| || ||||| ||||| ||||| |  || 
Sbjct: 703 caggatcttggtatactaggtcgtggtagtggagaggaaattggaacttatgttgaaaag 762

                                                                       
Query: 377 ctcatgacaagtgaactatctggaaatgttattgatatctgccccgttggagctcttaca 436
           || ||||| |||||||| ||||||||||||||||||||||| || ||||||||  | || 
Sbjct: 763 cttatgaccagtgaactctctggaaatgttattgatatctgtcctgttggagccttgacc 822

                                                                       
Query: 437 tccaagccgtttgcatttaaagctaggaactgggagatgaagggcactgagactattgat 496
           || ||||| ||||| |||||||| || ||||||||| |||| |  || || |||||||||
Sbjct: 823 tcaaagccttttgcctttaaagccagaaactgggagttgaaagcaacagaaactattgat 882

                                                                      
Query: 497 gttactgatgcagtagggtccaacatccgtgttgacagcagaggtcctgaagttatgcg 555
           |||| |||||| || |||||||||||||||||||| || ||||| || ||||| |||||
Sbjct: 883 gttagtgatgctgttgggtccaacatccgtgttgatagtagaggaccagaagtaatgcg 941

---

>gb|AY056140.1| Arabidopsis thaliana putative NADH dehydrogenase (ubiquinone) 76K
           chain precursor (At5g37510) mRNA, complete cds
          Length = 2526

 Score =  228 bits (115), Expect = 2e-56
 Identities = 433/539 (80%)
 Strand = Plus / Plus

                                                                       
Query: 17  gccatgcccgccctcccagggatgaagattaagaccaacacaccaattgcgaagaaggca 76
           |||||||| || || || |||||||||||||||||  | ||||| || || |||||||| 
Sbjct: 455 gccatgcctgcgcttcctgggatgaagattaagactgatacaccgatagctaagaaggcg 514

                                                                       
Query: 77  agggagggtgtcatggagttcttgctgatgaaccatccgctcgattgcccaatctgcgat 136
           |||||||| || |||||||| ||| ||||||| || ||  | ||||| || || || || 
Sbjct: 515 agggagggagtgatggagtttttgttgatgaatcaccctttggattgtcctatttgtgac 574

                                                                       
Query: 137 cagggcggggagtgtgacctccaggatcagtccatggcctttggggctgaccgtggtcgt 196
           || || || |||||||| || ||||||||||| ||||| |||||  ||||  | || |||
Sbjct: 575 caaggaggagagtgtgatcttcaggatcagtctatggcttttggatctgatagaggacgt 634

                                                                       
Query: 197 ttcaccgacatgaagcggtcggttgtggataagaatctgggccccttggtgaagacggtg 256
           || || || |||||  | || ||||| ||||||||||| || ||  | |||||||| || 
Sbjct: 635 tttactgagatgaaaagatctgttgttgataagaatcttggtcctcttgtgaagactgtt 694

                                                                       
Query: 257 atgacccgttgcatccagtgtacaaggtgtgtcaggtttgcatctgaggttgctggtgtt 316
           ||||| || || ||||||||||||||||||||  | ||||| ||||| |||||||| |||
Sbjct: 695 atgactcggtgtatccagtgtacaaggtgtgtacgatttgcttctgaagttgctggggtt 754

                                                                       
Query: 317 caagacctgggcatgttaggccgtggcagtggtgaagaaatcggaacatatgtggggaaa 376
           || || || || ||  |||| ||||| ||||| || ||||| ||||| ||||| |  || 
Sbjct: 755 caggatcttggtatactaggtcgtggtagtggagaggaaattggaacttatgttgaaaag 814

                                                                       
Query: 377 ctcatgacaagtgaactatctggaaatgttattgatatctgccccgttggagctcttaca 436
           || ||||| |||||||| ||||||||||||||||||||||| || ||||||||  | || 
Sbjct: 815 cttatgaccagtgaactctctggaaatgttattgatatctgtcctgttggagccttgacc 874

                                                                       
Query: 437 tccaagccgtttgcatttaaagctaggaactgggagatgaagggcactgagactattgat 496
           || ||||| ||||| |||||||| || ||||||||| |||| |  || || |||||||||
Sbjct: 875 tcaaagccttttgcctttaaagccagaaactgggagttgaaagcaacagaaactattgat 934

                                                                      
Query: 497 gttactgatgcagtagggtccaacatccgtgttgacagcagaggtcctgaagttatgcg 555
           |||| |||||| || |||||||||||||||||||| || ||||| || ||||| |||||
Sbjct: 935 gttagtgatgctgttgggtccaacatccgtgttgatagtagaggaccagaagtaatgcg 993

---

>gb|AY128304.1| Arabidopsis thaliana AT4g37510/F6G17_160 mRNA, complete cds
          Length = 2473

 Score =  228 bits (115), Expect = 2e-56
 Identities = 433/539 (80%)
 Strand = Plus / Plus

                                                                        
Query: 17   gccatgcccgccctcccagggatgaagattaagaccaacacaccaattgcgaagaaggca 76
            |||||||| || || || |||||||||||||||||  | ||||| || || |||||||| 
Sbjct: 473  gccatgcctgcgcttcctgggatgaagattaagactgatacaccgatagctaagaaggcg 532

                                                                        
Query: 77   agggagggtgtcatggagttcttgctgatgaaccatccgctcgattgcccaatctgcgat 136
            |||||||| || |||||||| ||| ||||||| || ||  | ||||| || || || || 
Sbjct: 533  agggagggagtgatggagtttttgttgatgaatcaccctttggattgtcctatttgtgac 592

                                                                        
Query: 137  cagggcggggagtgtgacctccaggatcagtccatggcctttggggctgaccgtggtcgt 196
            || || || |||||||| || ||||||||||| ||||| |||||  ||||  | || |||
Sbjct: 593  caaggaggagagtgtgatcttcaggatcagtctatggcttttggatctgatagaggacgt 652

                                                                        
Query: 197  ttcaccgacatgaagcggtcggttgtggataagaatctgggccccttggtgaagacggtg 256
            || || || |||||  | || ||||| ||||||||||| || ||  | |||||||| || 
Sbjct: 653  tttactgagatgaaaagatctgttgttgataagaatcttggtcctcttgtgaagactgtt 712

                                                                        
Query: 257  atgacccgttgcatccagtgtacaaggtgtgtcaggtttgcatctgaggttgctggtgtt 316
            ||||| || || ||||||||||||||||||||  | ||||| ||||| |||||||| |||
Sbjct: 713  atgactcggtgtatccagtgtacaaggtgtgtacgatttgcttctgaagttgctggggtt 772

                                                                        
Query: 317  caagacctgggcatgttaggccgtggcagtggtgaagaaatcggaacatatgtggggaaa 376
            || || || || ||  |||| ||||| ||||| || ||||| ||||| ||||| |  || 
Sbjct: 773  caggatcttggtatactaggtcgtggtagtggagaggaaattggaacttatgttgaaaag 832

                                                                        
Query: 377  ctcatgacaagtgaactatctggaaatgttattgatatctgccccgttggagctcttaca 436
            || ||||| |||||||| ||||||||||||||||||||||| || ||||||||  | || 
Sbjct: 833  cttatgaccagtgaactctctggaaatgttattgatatctgtcctgttggagccttgacc 892

                                                                        
Query: 437  tccaagccgtttgcatttaaagctaggaactgggagatgaagggcactgagactattgat 496
            || ||||| ||||| |||||||| || ||||||||| |||| |  || || |||||||||
Sbjct: 893  tcaaagccttttgcctttaaagccagaaactgggagttgaaagcaacagaaactattgat 952

                                                                       
Query: 497  gttactgatgcagtagggtccaacatccgtgttgacagcagaggtcctgaagttatgcg 555
            |||| |||||| || |||||||||||||||||||| || ||||| || ||||| |||||
Sbjct: 953  gttagtgatgctgttgggtccaacatccgtgttgatagtagaggaccagaagtaatgcg 1011

---

>emb|BX831070.1|CNS09YQ6 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS55ZD08 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 2528

 Score =  204 bits (103), Expect = 2e-49
 Identities = 431/539 (79%), Gaps = 1/539 (0%)
 Strand = Plus / Plus

                                                                       
Query: 17  gccatgcccgccctcccagggatgaagattaagaccaacacaccaattgcgaagaaggca 76
           |||||||| || || || |||||||||||||||||  | ||||| || || |||||||| 
Sbjct: 454 gccatgcctgcgcttcctgggatgaagattaagactgatacaccgatagctaagaaggcg 513

                                                                       
Query: 77  agggagggtgtcatggagttcttgctgatgaaccatccgctcgattgcccaatctgcgat 136
           |||||||| || |||||||| ||| ||||||| || ||  | ||||| || || || || 
Sbjct: 514 agggagggagtgatggagtttttgttgatgaatcaccctttggattgtcctatttgtgac 573

                                                                       
Query: 137 cagggcggggagtgtgacctccaggatcagtccatggcctttggggctgaccgtggtcgt 196
           || || || |||||||| || ||||||||||| ||||| |||||  ||||  | || |||
Sbjct: 574 caaggaggagagtgtgatcttcaggatcagtctatggcttttggatctgatagaggacgt 633

                                                                       
Query: 197 ttcaccgacatgaagcggtcggttgtggataagaatctgggccccttggtgaagacggtg 256
           || || || |||||  | || ||||| ||||||||||| || ||  | |||||||| || 
Sbjct: 634 tttactgagatgaaaagatctgttgttgataagaatcttggtcctcttgtgaagactgtt 693

                                                                       
Query: 257 atgacccgttgcatccagtgtacaaggtgtgtcaggtttgcatctgaggttgctggtgtt 316
           ||||| || || ||||||||||||||||||||  | ||||| ||||| |||||||| |||
Sbjct: 694 atgactcggtgtatccagtgtacaaggtgtgtacgatttgcttctgaagttgctggggtt 753

                                                                       
Query: 317 caagacctgggcatgttaggccgtggcagtggtgaagaaatcggaacatatgtggggaaa 376
           || || || || ||  |||| ||||| ||||| || ||||| ||||| ||||| |  || 
Sbjct: 754 caggatcttggtatactaggtcgtggtagtggagaggaaattggaacttatgttgaaaag 813

                                                                       
Query: 377 ctcatgacaagtgaactatctggaaatgttattgatatctgccccgttggagctcttaca 436
           || ||||| |||||||| ||||||||||||||||||||||| || ||||||||  | || 
Sbjct: 814 cttatgaccagtgaactctctggaaatgttattgatatctgtcctgttggagccttgacc 873

                                                                       
Query: 437 tccaagccgtttgcatttaaagctaggaactgggagatgaagggcactgagactattgat 496
           || ||||| ||||| |||| ||| || ||||||||| |||| |  || || |||||||||
Sbjct: 874 tcaaagccttttgcctttagagccagaaactgggagttgaaagcaacagaaactattgat 933

                                                                      
Query: 497 gttactgatgcagtagggtccaacatccgtgttgacagcagaggtcctgaagttatgcg 555
           |||| |||||| || |||| ||||||||||||||| || ||||| || ||||| |||||
Sbjct: 934 gttagtgatgctgttgggt-caacatccgtgttgatagtagaggaccagaagtaatgcg 991

---

>emb|CT009535.6| M.truncatula DNA sequence from clone MTH2-68D12 on chromosome 3,
             complete sequence
          Length = 82241

 Score =  188 bits (95), Expect = 1e-44
 Identities = 233/279 (83%)
 Strand = Plus / Minus

                                                                         
Query: 281   aggtgtgtcaggtttgcatctgaggttgctggtgttcaagacctgggcatgttaggccgt 340
             |||||||| || |||||||| |||||||| || ||||| || || ||||||||||| |||
Sbjct: 40564 aggtgtgttagatttgcatcagaggttgcaggggttcaggatcttggcatgttaggtcgt 40505

                                                                         
Query: 341   ggcagtggtgaagaaatcggaacatatgtggggaaactcatgacaagtgaactatctgga 400
             || ||||| ||||| || ||||||||||| |  |||||||||||||||||||| ||||||
Sbjct: 40504 ggtagtggagaagagattggaacatatgttgaaaaactcatgacaagtgaactctctgga 40445

                                                                         
Query: 401   aatgttattgatatctgccccgttggagctcttacatccaagccgtttgcatttaaagct 460
             ||||| || ||||||||||| || ||||| || || || || || |||||||||||||| 
Sbjct: 40444 aatgtaatagatatctgccctgtaggagcactcacttcaaaaccttttgcatttaaagcc 40385

                                                                         
Query: 461   aggaactgggagatgaagggcactgagactattgatgttactgatgcagtagggtccaac 520
              |||| |||||| |||||   || ||||| ||||||||||||||||| || || ||||| 
Sbjct: 40384 cggaattgggagttgaagaatacagagaccattgatgttactgatgctgttggttccaat 40325

                                                    
Query: 521   atccgtgttgacagcagaggtcctgaagttatgcgcatt 559
             || ||  |||| |||||||| |||||||| |||||||||
Sbjct: 40324 attcgaattgatagcagaggacctgaagtcatgcgcatt 40286



 Score =  133 bits (67), Expect = 7e-28
 Identities = 205/251 (81%)
 Strand = Plus / Minus

                                                                         
Query: 34    agggatgaagattaagaccaacacaccaattgcgaagaaggcaagggagggtgtcatgga 93
             ||||||||| || |||||| ||||||| ||||| ||||| ||| | || || || |||||
Sbjct: 41425 agggatgaaaatcaagaccgacacacctattgccaagaaagcacgagaaggagtgatgga 41366

                                                                         
Query: 94    gttcttgctgatgaaccatccgctcgattgcccaatctgcgatcagggcggggagtgtga 153
              || ||  ||||||| |||||  | ||||||||||| || |||||||| || ||||||||
Sbjct: 41365 atttttattgatgaatcatccattagattgcccaatttgtgatcagggtggagagtgtga 41306

                                                                         
Query: 154   cctccaggatcagtccatggcctttggggctgaccgtggtcgtttcaccgacatgaagcg 213
              || ||||||||||| ||||| |||||  |||| |||||||||||||| || |||||| |
Sbjct: 41305 tcttcaggatcagtcaatggcatttggttctgatcgtggtcgtttcactgatatgaagag 41246

                                                                         
Query: 214   gtcggttgtggataagaatctgggccccttggtgaagacggtgatgacccgttgcatcca 273
              || || |||||||| ||||| || || ||||| ||||| |||||||| || ||||| ||
Sbjct: 41245 atctgtggtggataaaaatcttggacctttggtaaagactgtgatgacacggtgcattca 41186

                        
Query: 274   gtgtacaaggt 284
              ||||||||||
Sbjct: 41185 atgtacaaggt 41175

---

>dbj|AB025630.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MPA22
          Length = 51436

 Score =  149 bits (75), Expect = 1e-32
 Identities = 216/263 (82%)
 Strand = Plus / Plus

                                                                         
Query: 293   tttgcatctgaggttgctggtgttcaagacctgggcatgttaggccgtggcagtggtgaa 352
             ||||| ||||| |||||||| ||||| || || || ||  |||| ||||| ||||| || 
Sbjct: 30508 tttgcttctgaagttgctggggttcaggatcttggtatactaggtcgtggtagtggagag 30567

                                                                         
Query: 353   gaaatcggaacatatgtggggaaactcatgacaagtgaactatctggaaatgttattgat 412
             ||||| ||||| ||||| |  || || ||||| |||||||| ||||||||||||||||||
Sbjct: 30568 gaaattggaacttatgttgaaaagcttatgaccagtgaactctctggaaatgttattgat 30627

                                                                         
Query: 413   atctgccccgttggagctcttacatccaagccgtttgcatttaaagctaggaactgggag 472
             ||||| || ||||||||  | || || ||||| ||||| |||||||| || |||||||||
Sbjct: 30628 atctgtcctgttggagccttgacctcaaagccttttgcctttaaagccagaaactgggag 30687

                                                                         
Query: 473   atgaagggcactgagactattgatgttactgatgcagtagggtccaacatccgtgttgac 532
              |||| |  || || ||||||||||||| |||||| || |||||||||||||||||||| 
Sbjct: 30688 ttgaaagcaacagaaactattgatgttagtgatgctgttgggtccaacatccgtgttgat 30747

                                    
Query: 533   agcagaggtcctgaagttatgcg 555
             || ||||| || ||||| |||||
Sbjct: 30748 agtagaggaccagaagtaatgcg 30770



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 200/252 (79%)
 Strand = Plus / Plus

                                                                         
Query: 33    cagggatgaagattaagaccaacacaccaattgcgaagaaggcaagggagggtgtcatgg 92
             |||||||||||||||||||  | ||||| || || |||||||| |||||||| || ||||
Sbjct: 30152 cagggatgaagattaagactgatacaccgatagctaagaaggcgagggagggagtgatgg 30211

                                                                         
Query: 93    agttcttgctgatgaaccatccgctcgattgcccaatctgcgatcagggcggggagtgtg 152
             |||| ||| ||||||| || ||  | ||||| || || || || || || || |||||||
Sbjct: 30212 agtttttgttgatgaatcaccctttggattgtcctatttgtgaccaaggaggagagtgtg 30271

                                                                         
Query: 153   acctccaggatcagtccatggcctttggggctgaccgtggtcgtttcaccgacatgaagc 212
             | || ||||||||||| ||||| |||||  ||||  | || ||||| || || |||||  
Sbjct: 30272 atcttcaggatcagtctatggcttttggatctgatagaggacgttttactgagatgaaaa 30331

                                                                         
Query: 213   ggtcggttgtggataagaatctgggccccttggtgaagacggtgatgacccgttgcatcc 272
             | || ||||| ||||||||||| || ||  | |||||||| || ||||| || || ||||
Sbjct: 30332 gatctgttgttgataagaatcttggtcctcttgtgaagactgttatgactcggtgtatcc 30391

                         
Query: 273   agtgtacaaggt 284
             ||||||||||||
Sbjct: 30392 agtgtacaaggt 30403

---

>gb|BT011089.1| Drosophila melanogaster RE66734 full insert cDNA
          Length = 2608

 Score =  123 bits (62), Expect = 7e-25
 Identities = 89/98 (90%)
 Strand = Plus / Plus

                                                                       
Query: 80  gagggtgtcatggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcag 139
           ||||| |||||||||||| ||||||||||||||||||| |||||||| ||||||||||||
Sbjct: 488 gagggcgtcatggagttcctgctgatgaaccatccgctggattgccccatctgcgatcag 547

                                                 
Query: 140 ggcggggagtgtgacctccaggatcagtccatggcctt 177
           ||||| ||||| || || ||||||||| ||||||||||
Sbjct: 548 ggcggcgagtgcgatctgcaggatcaggccatggcctt 585

---

>gb|AY075017.1| Drosophila simulans strain HW09 NADH-ubiquinone reductase 75 kDa
           subunit precursor (ND75) gene, partial cds
          Length = 2350

 Score =  123 bits (62), Expect = 7e-25
 Identities = 89/98 (90%)
 Strand = Plus / Plus

                                                                       
Query: 80  gagggtgtcatggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcag 139
           ||||| |||||||||||| ||||||||||||||||||| |||||||| ||||||||||||
Sbjct: 654 gagggcgtcatggagttcctgctgatgaaccatccgctggattgccccatctgcgatcag 713

                                                 
Query: 140 ggcggggagtgtgacctccaggatcagtccatggcctt 177
           ||||| ||||| || || ||||||||| ||||||||||
Sbjct: 714 ggcggcgagtgcgatctgcaggatcaggccatggcctt 751

---

>gb|AY075016.1| Drosophila simulans strain HW00 NADH-ubiquinone reductase 75 kDa
           subunit precursor (ND75) gene, partial cds
          Length = 2350

 Score =  123 bits (62), Expect = 7e-25
 Identities = 89/98 (90%)
 Strand = Plus / Plus

                                                                       
Query: 80  gagggtgtcatggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcag 139
           ||||| |||||||||||| ||||||||||||||||||| |||||||| ||||||||||||
Sbjct: 654 gagggcgtcatggagttcctgctgatgaaccatccgctggattgccccatctgcgatcag 713

                                                 
Query: 140 ggcggggagtgtgacctccaggatcagtccatggcctt 177
           ||||| ||||| || || ||||||||| ||||||||||
Sbjct: 714 ggcggcgagtgcgatctgcaggatcaggccatggcctt 751

---

>gb|AY075015.1| Drosophila simulans strain NC48 NADH-ubiquinone reductase 75 kDa
           subunit precursor (ND75) gene, partial cds
          Length = 2352

 Score =  123 bits (62), Expect = 7e-25
 Identities = 89/98 (90%)
 Strand = Plus / Plus

                                                                       
Query: 80  gagggtgtcatggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcag 139
           ||||| |||||||||||| ||||||||||||||||||| |||||||| ||||||||||||
Sbjct: 654 gagggcgtcatggagttcctgctgatgaaccatccgctggattgccccatctgcgatcag 713

                                                 
Query: 140 ggcggggagtgtgacctccaggatcagtccatggcctt 177
           ||||| ||||| || || ||||||||| ||||||||||
Sbjct: 714 ggcggcgagtgcgatctgcaggatcaggccatggcctt 751

---

>gb|AY075014.1| Drosophila simulans strain NC37 NADH-ubiquinone reductase 75 kDa
           subunit precursor (ND75) gene, partial cds
          Length = 2350

 Score =  123 bits (62), Expect = 7e-25
 Identities = 89/98 (90%)
 Strand = Plus / Plus

                                                                       
Query: 80  gagggtgtcatggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcag 139
           ||||| |||||||||||| ||||||||||||||||||| |||||||| ||||||||||||
Sbjct: 654 gagggcgtcatggagttcctgctgatgaaccatccgctggattgccccatctgcgatcag 713

                                                 
Query: 140 ggcggggagtgtgacctccaggatcagtccatggcctt 177
           ||||| ||||| || || ||||||||| ||||||||||
Sbjct: 714 ggcggcgagtgcgatctgcaggatcaggccatggcctt 751

---

>gb|AY075012.1| Drosophila simulans strain TT00 NADH-ubiquinone reductase 75 kDa
           subunit precursor (ND75) gene, partial cds
          Length = 2350

 Score =  123 bits (62), Expect = 7e-25
 Identities = 89/98 (90%)
 Strand = Plus / Plus

                                                                       
Query: 80  gagggtgtcatggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcag 139
           ||||| |||||||||||| ||||||||||||||||||| |||||||| ||||||||||||
Sbjct: 654 gagggcgtcatggagttcctgctgatgaaccatccgctggattgccccatctgcgatcag 713

                                                 
Query: 140 ggcggggagtgtgacctccaggatcagtccatggcctt 177
           ||||| ||||| || || ||||||||| ||||||||||
Sbjct: 714 ggcggcgagtgcgatctgcaggatcaggccatggcctt 751

---

>gb|AY075011.1| Drosophila simulans strain SCOO NADH-ubiquinone reductase 75 kDa
           subunit precursor (ND75) gene, partial cds
          Length = 2350

 Score =  123 bits (62), Expect = 7e-25
 Identities = 89/98 (90%)
 Strand = Plus / Plus

                                                                       
Query: 80  gagggtgtcatggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcag 139
           ||||| |||||||||||| ||||||||||||||||||| |||||||| ||||||||||||
Sbjct: 654 gagggcgtcatggagttcctgctgatgaaccatccgctggattgccccatctgcgatcag 713

                                                 
Query: 140 ggcggggagtgtgacctccaggatcagtccatggcctt 177
           ||||| ||||| || || ||||||||| ||||||||||
Sbjct: 714 ggcggcgagtgcgatctgcaggatcaggccatggcctt 751

---

>gb|AY075010.1| Drosophila simulans strain RU35 NADH-ubiquinone reductase 75 kDa
           subunit precursor (ND75) gene, partial cds
          Length = 2350

 Score =  123 bits (62), Expect = 7e-25
 Identities = 89/98 (90%)
 Strand = Plus / Plus

                                                                       
Query: 80  gagggtgtcatggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcag 139
           ||||| |||||||||||| ||||||||||||||||||| |||||||| ||||||||||||
Sbjct: 654 gagggcgtcatggagttcctgctgatgaaccatccgctggattgccccatctgcgatcag 713

                                                 
Query: 140 ggcggggagtgtgacctccaggatcagtccatggcctt 177
           ||||| ||||| || || ||||||||| ||||||||||
Sbjct: 714 ggcggcgagtgcgatctgcaggatcaggccatggcctt 751

---

>gb|AY075009.1| Drosophila simulans strain C167 NADH-ubiquinone reductase 75 kDa
           subunit precursor (ND75) gene, partial cds
          Length = 2350

 Score =  123 bits (62), Expect = 7e-25
 Identities = 89/98 (90%)
 Strand = Plus / Plus

                                                                       
Query: 80  gagggtgtcatggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcag 139
           ||||| |||||||||||| ||||||||||||||||||| |||||||| ||||||||||||
Sbjct: 654 gagggcgtcatggagttcctgctgatgaaccatccgctggattgccccatctgcgatcag 713

                                                 
Query: 140 ggcggggagtgtgacctccaggatcagtccatggcctt 177
           ||||| ||||| || || ||||||||| ||||||||||
Sbjct: 714 ggcggcgagtgcgatctgcaggatcaggccatggcctt 751

---

>gb|AY075007.1| Drosophila simulans strain RU07 NADH-ubiquinone reductase 75 kDa
           subunit precursor (ND75) gene, partial cds
          Length = 2349

 Score =  123 bits (62), Expect = 7e-25
 Identities = 89/98 (90%)
 Strand = Plus / Plus

                                                                       
Query: 80  gagggtgtcatggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcag 139
           ||||| |||||||||||| ||||||||||||||||||| |||||||| ||||||||||||
Sbjct: 654 gagggcgtcatggagttcctgctgatgaaccatccgctggattgccccatctgcgatcag 713

                                                 
Query: 140 ggcggggagtgtgacctccaggatcagtccatggcctt 177
           ||||| ||||| || || ||||||||| ||||||||||
Sbjct: 714 ggcggcgagtgcgatctgcaggatcaggccatggcctt 751

---

>gb|AY075006.1| Drosophila simulans strain RU01 NADH-ubiquinone reductase 75 kDa
           subunit precursor (ND75) gene, partial cds
          Length = 2352

 Score =  123 bits (62), Expect = 7e-25
 Identities = 89/98 (90%)
 Strand = Plus / Plus

                                                                       
Query: 80  gagggtgtcatggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcag 139
           ||||| |||||||||||| ||||||||||||||||||| |||||||| ||||||||||||
Sbjct: 654 gagggcgtcatggagttcctgctgatgaaccatccgctggattgccccatctgcgatcag 713

                                                 
Query: 140 ggcggggagtgtgacctccaggatcagtccatggcctt 177
           ||||| ||||| || || ||||||||| ||||||||||
Sbjct: 714 ggcggcgagtgcgatctgcaggatcaggccatggcctt 751

---

>gb|AY075005.1| Drosophila simulans strain RU00 NADH-ubiquinone reductase 75 kDa
           subunit precursor (ND75) gene, partial cds
          Length = 2350

 Score =  123 bits (62), Expect = 7e-25
 Identities = 89/98 (90%)
 Strand = Plus / Plus

                                                                       
Query: 80  gagggtgtcatggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcag 139
           ||||| |||||||||||| ||||||||||||||||||| |||||||| ||||||||||||
Sbjct: 654 gagggcgtcatggagttcctgctgatgaaccatccgctggattgccccatctgcgatcag 713

                                                 
Query: 140 ggcggggagtgtgacctccaggatcagtccatggcctt 177
           ||||| ||||| || || ||||||||| ||||||||||
Sbjct: 714 ggcggcgagtgcgatctgcaggatcaggccatggcctt 751

---

>gb|AY075003.1| Drosophila simulans strain W86 NADH-ubiquinone reductase 75 kDa
           subunit precursor (ND75) gene, partial cds
          Length = 2349

 Score =  123 bits (62), Expect = 7e-25
 Identities = 89/98 (90%)
 Strand = Plus / Plus

                                                                       
Query: 80  gagggtgtcatggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcag 139
           ||||| |||||||||||| ||||||||||||||||||| |||||||| ||||||||||||
Sbjct: 654 gagggcgtcatggagttcctgctgatgaaccatccgctggattgccccatctgcgatcag 713

                                                 
Query: 140 ggcggggagtgtgacctccaggatcagtccatggcctt 177
           ||||| ||||| || || ||||||||| ||||||||||
Sbjct: 714 ggcggcgagtgcgatctgcaggatcaggccatggcctt 751

---

>gb|AY075002.1| Drosophila simulans strain MD221 NADH-ubiquinone reductase 75 kDa
           subunit precursor (ND75) gene, partial cds
          Length = 2350

 Score =  123 bits (62), Expect = 7e-25
 Identities = 89/98 (90%)
 Strand = Plus / Plus

                                                                       
Query: 80  gagggtgtcatggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcag 139
           ||||| |||||||||||| ||||||||||||||||||| |||||||| ||||||||||||
Sbjct: 654 gagggcgtcatggagttcctgctgatgaaccatccgctggattgccccatctgcgatcag 713

                                                 
Query: 140 ggcggggagtgtgacctccaggatcagtccatggcctt 177
           ||||| ||||| || || ||||||||| ||||||||||
Sbjct: 714 ggcggcgagtgcgatctgcaggatcaggccatggcctt 751

---

>gb|AY075001.1| Drosophila simulans strain MD199 NADH-ubiquinone reductase 75 kDa
           subunit precursor (ND75) gene, partial cds
          Length = 2349

 Score =  123 bits (62), Expect = 7e-25
 Identities = 89/98 (90%)
 Strand = Plus / Plus

                                                                       
Query: 80  gagggtgtcatggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcag 139
           ||||| |||||||||||| ||||||||||||||||||| |||||||| ||||||||||||
Sbjct: 654 gagggcgtcatggagttcctgctgatgaaccatccgctggattgccccatctgcgatcag 713

                                                 
Query: 140 ggcggggagtgtgacctccaggatcagtccatggcctt 177
           ||||| ||||| || || ||||||||| ||||||||||
Sbjct: 714 ggcggcgagtgcgatctgcaggatcaggccatggcctt 751

---

>gb|AY074998.1| Drosophila simulans strain MD106 NADH-ubiquinone reductase 75 kDa
           subunit precursor (ND75) gene, partial cds
          Length = 2349

 Score =  123 bits (62), Expect = 7e-25
 Identities = 89/98 (90%)
 Strand = Plus / Plus

                                                                       
Query: 80  gagggtgtcatggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcag 139
           ||||| |||||||||||| ||||||||||||||||||| |||||||| ||||||||||||
Sbjct: 654 gagggcgtcatggagttcctgctgatgaaccatccgctggattgccccatctgcgatcag 713

                                                 
Query: 140 ggcggggagtgtgacctccaggatcagtccatggcctt 177
           ||||| ||||| || || ||||||||| ||||||||||
Sbjct: 714 ggcggtgagtgcgatctgcaggatcaggccatggcctt 751

---

>gb|AY074997.1| Drosophila simulans strain DSW NADH-ubiquinone reductase 75 kDa
           subunit precursor (ND75) gene, partial cds
          Length = 2350

 Score =  123 bits (62), Expect = 7e-25
 Identities = 89/98 (90%)
 Strand = Plus / Plus

                                                                       
Query: 80  gagggtgtcatggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcag 139
           ||||| |||||||||||| ||||||||||||||||||| |||||||| ||||||||||||
Sbjct: 654 gagggcgtcatggagttcctgctgatgaaccatccgctggattgccccatctgcgatcag 713

                                                 
Query: 140 ggcggggagtgtgacctccaggatcagtccatggcctt 177
           ||||| ||||| || || ||||||||| ||||||||||
Sbjct: 714 ggcggcgagtgcgatctgcaggatcaggccatggcctt 751

---

>gb|AY074996.1| Drosophila simulans strain DSR NADH-ubiquinone reductase 75 kDa
           subunit precursor (ND75) gene, partial cds
          Length = 2350

 Score =  123 bits (62), Expect = 7e-25
 Identities = 89/98 (90%)
 Strand = Plus / Plus

                                                                       
Query: 80  gagggtgtcatggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcag 139
           ||||| |||||||||||| ||||||||||||||||||| |||||||| ||||||||||||
Sbjct: 654 gagggcgtcatggagttcctgctgatgaaccatccgctggattgccccatctgcgatcag 713

                                                 
Query: 140 ggcggggagtgtgacctccaggatcagtccatggcctt 177
           ||||| ||||| || || ||||||||| ||||||||||
Sbjct: 714 ggcggcgagtgcgatctgcaggatcaggccatggcctt 751

---

>gb|AY074994.1| Drosophila melanogaster strain Oregon R NADH-ubiquinone reductase
           75 kDa subunit precursor (ND75) gene, partial cds
          Length = 2350

 Score =  123 bits (62), Expect = 7e-25
 Identities = 89/98 (90%)
 Strand = Plus / Plus

                                                                       
Query: 80  gagggtgtcatggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcag 139
           ||||| |||||||||||| ||||||||||||||||||| |||||||| ||||||||||||
Sbjct: 654 gagggcgtcatggagttcctgctgatgaaccatccgctggattgccccatctgcgatcag 713

                                                 
Query: 140 ggcggggagtgtgacctccaggatcagtccatggcctt 177
           ||||| ||||| || || ||||||||| ||||||||||
Sbjct: 714 ggcggcgagtgcgatctgcaggatcaggccatggcctt 751

---

>gb|AC104609.10| Drosophila melanogaster X BAC RP98-39F18 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 165014

 Score =  123 bits (62), Expect = 7e-25
 Identities = 89/98 (90%)
 Strand = Plus / Minus

                                                                          
Query: 80     gagggtgtcatggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcag 139
              ||||| |||||||||||| ||||||||||||||||||| |||||||| ||||||||||||
Sbjct: 140654 gagggcgtcatggagttcctgctgatgaaccatccgctggattgccccatctgcgatcag 140595

                                                    
Query: 140    ggcggggagtgtgacctccaggatcagtccatggcctt 177
              ||||| ||||| || || ||||||||| ||||||||||
Sbjct: 140594 ggcggcgagtgcgatctgcaggatcaggccatggcctt 140557

---

>ref|NM_167152.1| Drosophila melanogaster NADH:ubiquinone reductase 75kD subunit
           precursor CG2286-RB, transcript variant B (ND75), mRNA
          Length = 2741

 Score =  123 bits (62), Expect = 7e-25
 Identities = 89/98 (90%)
 Strand = Plus / Plus

                                                                       
Query: 80  gagggtgtcatggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcag 139
           ||||| |||||||||||| ||||||||||||||||||| |||||||| ||||||||||||
Sbjct: 636 gagggcgtcatggagttcctgctgatgaaccatccgctggattgccccatctgcgatcag 695

                                                 
Query: 140 ggcggggagtgtgacctccaggatcagtccatggcctt 177
           ||||| ||||| || || ||||||||| ||||||||||
Sbjct: 696 ggcggcgagtgcgatctgcaggatcaggccatggcctt 733

---

>ref|NM_078528.1| Drosophila melanogaster NADH:ubiquinone reductase 75kD subunit
           precursor CG2286-RA, transcript variant A (ND75), mRNA
          Length = 2519

 Score =  123 bits (62), Expect = 7e-25
 Identities = 89/98 (90%)
 Strand = Plus / Plus

                                                                       
Query: 80  gagggtgtcatggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcag 139
           ||||| |||||||||||| ||||||||||||||||||| |||||||| ||||||||||||
Sbjct: 445 gagggcgtcatggagttcctgctgatgaaccatccgctggattgccccatctgcgatcag 504

                                                 
Query: 140 ggcggggagtgtgacctccaggatcagtccatggcctt 177
           ||||| ||||| || || ||||||||| ||||||||||
Sbjct: 505 ggcggcgagtgcgatctgcaggatcaggccatggcctt 542

---

>gb|AE003443.2| Drosophila melanogaster chromosome X, section 27 of 74 of the complete
              sequence
          Length = 299153

 Score =  123 bits (62), Expect = 7e-25
 Identities = 89/98 (90%)
 Strand = Plus / Minus

                                                                          
Query: 80     gagggtgtcatggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcag 139
              ||||| |||||||||||| ||||||||||||||||||| |||||||| ||||||||||||
Sbjct: 134759 gagggcgtcatggagttcctgctgatgaaccatccgctggattgccccatctgcgatcag 134700

                                                    
Query: 140    ggcggggagtgtgacctccaggatcagtccatggcctt 177
              ||||| ||||| || || ||||||||| ||||||||||
Sbjct: 134699 ggcggcgagtgcgatctgcaggatcaggccatggcctt 134662

---

>emb|Y09063.1|DM75KNADH D.melanogaster mRNA for NADH:ubiquinone reductase 75 kDa subunit
           precursor
          Length = 2011

 Score =  123 bits (62), Expect = 7e-25
 Identities = 89/98 (90%)
 Strand = Plus / Plus

                                                                       
Query: 80  gagggtgtcatggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcag 139
           ||||| |||||||||||| ||||||||||||||||||| |||||||| ||||||||||||
Sbjct: 420 gagggcgtcatggagttcctgctgatgaaccatccgctggattgccccatctgcgatcag 479

                                                 
Query: 140 ggcggggagtgtgacctccaggatcagtccatggcctt 177
           ||||| ||||| || || ||||||||| ||||||||||
Sbjct: 480 ggcggcgagtgcgatctgcaggatcaggccatggcctt 517

---

>gb|AY075008.1| Drosophila simulans strain RU259 NADH-ubiquinone reductase 75 kDa
           subunit precursor (ND75) gene, partial cds
          Length = 2350

 Score =  115 bits (58), Expect = 2e-22
 Identities = 88/98 (89%)
 Strand = Plus / Plus

                                                                       
Query: 80  gagggtgtcatggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcag 139
           ||||| |||||||||||| ||||||||||||||||||| ||||| || ||||||||||||
Sbjct: 654 gagggcgtcatggagttcctgctgatgaaccatccgctggattgtcccatctgcgatcag 713

                                                 
Query: 140 ggcggggagtgtgacctccaggatcagtccatggcctt 177
           ||||| ||||| || || ||||||||| ||||||||||
Sbjct: 714 ggcggcgagtgcgatctgcaggatcaggccatggcctt 751

---

>gb|AY075004.1| Drosophila simulans strain MD225 NADH-ubiquinone reductase 75 kDa
           subunit precursor (ND75) gene, partial cds
          Length = 2350

 Score =  113 bits (57), Expect = 6e-22
 Identities = 90/101 (89%)
 Strand = Plus / Plus

                                                                       
Query: 80  gagggtgtcatggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcag 139
           ||||| |||||||||||| |||| ||||||||||| || |||||||| ||||||||||||
Sbjct: 654 gagggcgtcatggagttcctgctcatgaaccatcctctggattgccccatctgcgatcag 713

                                                    
Query: 140 ggcggggagtgtgacctccaggatcagtccatggcctttgg 180
           ||||| ||||| || || ||||||||| |||||||||||||
Sbjct: 714 ggcggcgagtgcgatctgcaggatcaggccatggcctttgg 754

---

>gb|AY075000.1| Drosophila simulans strain MD112 NADH-ubiquinone reductase 75 kDa
           subunit precursor (ND75) gene, partial cds
          Length = 2350

 Score =  113 bits (57), Expect = 6e-22
 Identities = 90/101 (89%)
 Strand = Plus / Plus

                                                                       
Query: 80  gagggtgtcatggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcag 139
           ||||| |||||||||||| |||| ||||||||||| || |||||||| ||||||||||||
Sbjct: 654 gagggcgtcatggagttcctgctcatgaaccatcctctggattgccccatctgcgatcag 713

                                                    
Query: 140 ggcggggagtgtgacctccaggatcagtccatggcctttgg 180
           ||||| ||||| || || ||||||||| |||||||||||||
Sbjct: 714 ggcggcgagtgcgatctgcaggatcaggccatggcctttgg 754

---

>gb|AY074995.1| Drosophila melanogaster strain Zimbabwe 53 NADH-ubiquinone
           reductase 75 kDa subunit precursor (ND75) gene, partial
           cds
          Length = 2350

 Score =  109 bits (55), Expect = 1e-20
 Identities = 85/95 (89%)
 Strand = Plus / Plus

                                                                       
Query: 80  gagggtgtcatggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcag 139
           ||||| |||||||||||| ||||||||||||||||||| |||||||| ||||||||||||
Sbjct: 654 gagggcgtcatggagttcctgctgatgaaccatccgctggattgccccatctgcgatcag 713

                                              
Query: 140 ggcggggagtgtgacctccaggatcagtccatggc 174
           ||||| ||||| || || ||||||||  |||||||
Sbjct: 714 ggcggcgagtgcgatctgcaggatcaagccatggc 748

---

>gb|AY075013.1| Drosophila simulans strain TTO1 NADH-ubiquinone reductase 75 kDa
           subunit precursor (ND75) gene, partial cds
          Length = 2350

 Score =  107 bits (54), Expect = 4e-20
 Identities = 87/98 (88%)
 Strand = Plus / Plus

                                                                       
Query: 80  gagggtgtcatggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcag 139
           ||||| |||||||||||| ||||||||||||||||||| ||||| || ||||||||||||
Sbjct: 654 gagggcgtcatggagttcctgctgatgaaccatccgctggattgtcccatctgcgatcag 713

                                                 
Query: 140 ggcggggagtgtgacctccaggatcagtccatggcctt 177
           ||||| ||||| || || || |||||| ||||||||||
Sbjct: 714 ggcggcgagtgcgatctgcaagatcaggccatggcctt 751

---

>gb|AY074999.1| Drosophila simulans strain MD111 NADH-ubiquinone reductase 75 kDa
           subunit precursor (ND75) gene, partial cds
          Length = 2350

 Score =  107 bits (54), Expect = 4e-20
 Identities = 87/98 (88%)
 Strand = Plus / Plus

                                                                       
Query: 80  gagggtgtcatggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcag 139
           ||||| |||||||||||| ||||||||||||||||||| ||||| || ||||||||||||
Sbjct: 654 gagggcgtcatggagttcctgctgatgaaccatccgctggattgtcccatctgcgatcag 713

                                                 
Query: 140 ggcggggagtgtgacctccaggatcagtccatggcctt 177
           ||||| ||||| || || || |||||| ||||||||||
Sbjct: 714 ggcggcgagtgcgatctgcaagatcaggccatggcctt 751

---

>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome
          Length = 4892717

 Score =  103 bits (52), Expect = 6e-19
 Identities = 88/100 (88%)
 Strand = Plus / Minus

                                                                           
Query: 67      gaagaaggcaagggagggtgtcatggagttcttgctgatgaaccatccgctcgattgccc 126
               |||||||||  | ||||| || ||||||||| ||||||| |||||||||||||| |||||
Sbjct: 3209244 gaagaaggcccgcgagggcgtgatggagttcctgctgatcaaccatccgctcgactgccc 3209185

                                                       
Query: 127     aatctgcgatcagggcggggagtgtgacctccaggatcag 166
                ||||||||||||||||| ||||| ||||| |||||||||
Sbjct: 3209184 gatctgcgatcagggcggcgagtgcgacctgcaggatcag 3209145

---

>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome
          Length = 5331656

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 84/96 (87%)
 Strand = Plus / Plus

                                                                           
Query: 67      gaagaaggcaagggagggtgtcatggagttcttgctgatgaaccatccgctcgattgccc 126
               |||||||||  | ||||| || ||||||||| ||||||| |||||||||||||| |||||
Sbjct: 2960904 gaagaaggcccgcgagggcgtgatggagttcctgctgatcaaccatccgctcgactgccc 2960963

                                                   
Query: 127     aatctgcgatcagggcggggagtgtgacctccagga 162
                ||||||||||||||||| ||||| ||||| |||||
Sbjct: 2960964 gatctgcgatcagggcggcgagtgcgacctgcagga 2960999

---

>gb|CP000319.1| Nitrobacter hamburgensis X14, complete genome
          Length = 4406967

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 70/78 (89%)
 Strand = Plus / Minus

                                                                           
Query: 89      atggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcagggcggggag 148
               ||||| ||| ||||||| |||||||||||||||||||| ||||||||||||||||| |||
Sbjct: 2464876 atggaattcctgctgatcaaccatccgctcgattgcccgatctgcgatcagggcggcgag 2464817

                                 
Query: 149     tgtgacctccaggatcag 166
               |||||  | |||||||||
Sbjct: 2464816 tgtgatttgcaggatcag 2464799

---

>emb|BX572602.1| Rhodopseudomonas palustris CGA009 complete genome; segment 10/16
          Length = 349981

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 67/74 (90%)
 Strand = Plus / Minus

                                                                          
Query: 89     atggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcagggcggggag 148
              ||||||||| ||||||| |||||||||||||| ||||| ||||||||||||||||| |||
Sbjct: 190900 atggagttcctgctgatcaaccatccgctcgactgcccgatctgcgatcagggcggcgag 190841

                            
Query: 149    tgtgacctccagga 162
              || ||||| |||||
Sbjct: 190840 tgcgacctgcagga 190827

---

>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome
          Length = 7036071

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 94/110 (85%)
 Strand = Plus / Minus

                                                                           
Query: 68      aagaaggcaagggagggtgtcatggagttcttgctgatgaaccatccgctcgattgccca 127
               ||||||||  |||| || || ||||||||| ||||||| ||||||||||| |||||||| 
Sbjct: 1141111 aagaaggcccgggaaggcgtgatggagttcctgctgatcaaccatccgctggattgcccg 1141052

                                                                 
Query: 128     atctgcgatcagggcggggagtgtgacctccaggatcagtccatggcctt 177
               |||||||| |||||||| ||||| ||||| ||||| ||| | ||||||||
Sbjct: 1141051 atctgcgaccagggcggcgagtgcgacctgcaggaccaggcgatggcctt 1141002

---

>gb|AE009089.1| Agrobacterium tumefaciens str. C58 circular chromosome, section 115
            of 256 of the complete sequence
          Length = 10144

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 82/95 (86%)
 Strand = Plus / Plus

                                                                        
Query: 83   ggtgtcatggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcagggc 142
            ||||| ||||||||| |||| || ||||| |||||||||||||| |||||||| ||||||
Sbjct: 6656 ggtgtgatggagttcctgctcatcaaccacccgctcgattgcccgatctgcgaccagggc 6715

                                               
Query: 143  ggggagtgtgacctccaggatcagtccatggcctt 177
            || || || ||||| ||||| ||| ||||||||||
Sbjct: 6716 ggcgaatgcgacctgcaggaccaggccatggcctt 6750

---

>gb|AE007869.1| Agrobacterium tumefaciens str. C58, complete genome
          Length = 2841581

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 82/95 (86%)
 Strand = Plus / Plus

                                                                           
Query: 83      ggtgtcatggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcagggc 142
               ||||| ||||||||| |||| || ||||| |||||||||||||| |||||||| ||||||
Sbjct: 1262328 ggtgtgatggagttcctgctcatcaaccacccgctcgattgcccgatctgcgaccagggc 1262387

                                                  
Query: 143     ggggagtgtgacctccaggatcagtccatggcctt 177
               || || || ||||| ||||| ||| ||||||||||
Sbjct: 1262388 ggcgaatgcgacctgcaggaccaggccatggcctt 1262422



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 1      gcccgtcgcctcctgcgcca 20
              ||||||||||||||||||||
Sbjct: 651793 gcccgtcgcctcctgcgcca 651812

---

>gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome
          Length = 3402093

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                           
Query: 89      atggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcagggcggggag 148
               ||||||||  ||||||| |||||||||||||||||||| ||||||||||||||||| |||
Sbjct: 2065412 atggagtttctgctgatcaaccatccgctcgattgcccgatctgcgatcagggcggcgag 2065353

                 
Query: 149     tg 150
               ||
Sbjct: 2065352 tg 2065351

---

>gb|AY367780.1| Chlamydomonas reinhardtii NADH:ubiquinone oxidoreductase 78 kDa
           subunit mRNA, complete cds; nuclear gene for
           mitochondrial product
          Length = 2312

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 139/172 (80%)
 Strand = Plus / Plus

                                                                       
Query: 1   gcccgtcgcctcctgcgccatgcccgccctcccagggatgaagattaagaccaacacacc 60
           |||||| || |||||||| ||||||||   ||| || ||||||||||||||  | || ||
Sbjct: 388 gcccgtggcatcctgcgcgatgcccgcgggcccgggcatgaagattaagacggagacgcc 447

                                                                       
Query: 61  aattgcgaagaaggcaagggagggtgtcatggagttcttgctgatgaaccatccgctcga 120
            || | |||||||||  | ||||| || ||||||||  ||||||| ||||| ||||| ||
Sbjct: 448 gatggtgaagaaggcgcgcgagggcgtgatggagtttctgctgatcaaccacccgctgga 507

                                                               
Query: 121 ttgcccaatctgcgatcagggcggggagtgtgacctccaggatcagtccatg 172
            ||||| |||||||| |||||||| ||||| ||||| ||||| ||| |||||
Sbjct: 508 ctgccccatctgcgaccagggcggcgagtgcgacctgcaggaccaggccatg 559

---

>gb|CP000264.1| Jannaschia sp. CCS1, complete genome
          Length = 4317977

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 63/71 (88%)
 Strand = Plus / Plus

                                                                           
Query: 80      gagggtgtcatggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcag 139
               ||||| || ||||||||  ||||||| ||||||||||| |||||||| ||||||||||||
Sbjct: 1145254 gagggggtgatggagtttctgctgatcaaccatccgctggattgcccgatctgcgatcag 1145313

                          
Query: 140     ggcggggagtg 150
               ||||| |||||
Sbjct: 1145314 ggcggcgagtg 1145324

---

>gb|AF029365.1|AF029365 Rhodobacter capsulatus B10 nuo gene cluster, NADH-CoQ reductase
            subunits NUOA (nuoA), NUOB (nuoB), NUOC (nuoC), NUOD
            (nuoD), NUOE (nuoE), NUOF (nuoF), NUOG (nuoG), NUOH
            (nuoH), NUOI (nuoI), NUOJ (nuoJ), NUOK (nuoK), NUOL
            (nuoL), NUOM (nuoM), and NUON (nuoN) genes, and BIRA
            (birA) gene, complete cds
          Length = 19614

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 66/75 (88%)
 Strand = Plus / Plus

                                                                        
Query: 102  tgatgaaccatccgctcgattgcccaatctgcgatcagggcggggagtgtgacctccagg 161
            |||| |||||||||||||||||||| ||||||||||||||||| || || || || ||||
Sbjct: 8257 tgatcaaccatccgctcgattgcccgatctgcgatcagggcggcgaatgcgatctgcagg 8316

                           
Query: 162  atcagtccatggcct 176
            ||||| | |||||||
Sbjct: 8317 atcaggcgatggcct 8331

---

>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome
          Length = 4109442

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 68/78 (87%)
 Strand = Plus / Minus

                                                                           
Query: 89      atggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcagggcggggag 148
               ||||| ||| ||||||| ||||| ||||| |||||||| ||||||||||||||||| || 
Sbjct: 2964487 atggaattcctgctgatcaaccacccgctggattgcccgatctgcgatcagggcggcgaa 2964428

                                 
Query: 149     tgtgacctccaggatcag 166
               || ||||| |||||||||
Sbjct: 2964427 tgcgacctgcaggatcag 2964410

---

>emb|CR555306.1| Azoarcus sp. EbN1 complete genome
          Length = 4296230

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Plus

                                                                           
Query: 89      atggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcagggcggggag 148
               |||||||| ||||| || ||||| |||||||||||||| ||||||||||||||||| |||
Sbjct: 2871303 atggagtttttgctcatcaaccacccgctcgattgcccgatctgcgatcagggcggcgag 2871362

                 
Query: 149     tg 150
               ||
Sbjct: 2871363 tg 2871364

---

>gb|CP000133.1| Rhizobium etli CFN 42, complete genome
          Length = 4381608

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 76/89 (85%)
 Strand = Plus / Plus

                                                                           
Query: 89      atggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcagggcggggag 148
               ||||| ||| ||||||| |||||||||||||||||||| |||||||| ||||| || || 
Sbjct: 1690295 atggaattcctgctgatcaaccatccgctcgattgcccgatctgcgaccagggtggcgaa 1690354

                                            
Query: 149     tgtgacctccaggatcagtccatggcctt 177
               || ||||| ||||| ||| | ||||||||
Sbjct: 1690355 tgcgacctgcaggaccaggcgatggcctt 1690383

---

>gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, complete sequence
          Length = 3510148

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                       
Query: 89      atggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcagggcgg 144
               ||||||||| |||| || |||||||||||||| ||||| |||||||||||||||||
Sbjct: 1915107 atggagttcctgctcatcaaccatccgctcgactgcccgatctgcgatcagggcgg 1915052

---

>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence
          Length = 4126292

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 51/56 (91%)
 Strand = Plus / Plus

                                                                       
Query: 89      atggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcagggcgg 144
               ||||||||| |||| || |||||||||||||| ||||| |||||||||||||||||
Sbjct: 1514793 atggagttcctgctcatcaaccatccgctcgactgcccgatctgcgatcagggcgg 1514848

---

>emb|AL591786.1|SME591786 Sinorhizobium meliloti 1021 complete chromosome; segment 5/12
          Length = 299350

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 78/92 (84%)
 Strand = Plus / Plus

                                                                          
Query: 86     gtcatggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcagggcggg 145
              |||||||||||| |||| || || || |||||||| ||||| |||||||| |||||||| 
Sbjct: 231564 gtcatggagttcctgctcatcaatcacccgctcgactgcccgatctgcgaccagggcggc 231623

                                              
Query: 146    gagtgtgacctccaggatcagtccatggcctt 177
              ||||| ||||| ||||| ||| | ||||||||
Sbjct: 231624 gagtgcgacctgcaggaccaggcgatggcctt 231655

---

>emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromosome 1, complete sequence
          Length = 4074542

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 51/56 (91%)
 Strand = Plus / Plus

                                                                       
Query: 89      atggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcagggcgg 144
               ||||||||| |||| || |||||||||||||| ||||| |||||||||||||||||
Sbjct: 1401881 atggagttcctgctcatcaaccatccgctcgactgcccgatctgcgatcagggcgg 1401936

---

>emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome complete sequence
          Length = 3716413

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                       
Query: 89      atggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcagggcgg 144
               ||||||||| ||||||| ||||| ||||| |||||||| |||||||||||||||||
Sbjct: 2231044 atggagttcctgctgatcaaccacccgctggattgcccgatctgcgatcagggcgg 2230989

---

>gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, complete sequence
          Length = 3809201

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 51/56 (91%)
 Strand = Plus / Plus

                                                                       
Query: 89      atggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcagggcgg 144
               ||||||||| |||| || |||||||||||||| ||||| |||||||||||||||||
Sbjct: 1208709 atggagttcctgctcatcaaccatccgctcgactgcccgatctgcgatcagggcgg 1208764

---

>ref|XM_321442.2| Anopheles gambiae str. PEST ENSANGP00000022170
           (ENSANGG00000019681), mRNA
          Length = 2322

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 74/87 (85%)
 Strand = Plus / Plus

                                                                       
Query: 80  gagggtgtcatggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcag 139
           ||||| |||||||||||  ||||||||||||| |||||||| || || ||||| || |||
Sbjct: 488 gagggcgtcatggagtttctgctgatgaaccacccgctcgactgtccgatctgtgaccag 547

                                      
Query: 140 ggcggggagtgtgacctccaggatcag 166
           ||||| ||||| || || |||||||||
Sbjct: 548 ggcggcgagtgcgatctgcaggatcag 574

---

>gb|AE014291.4| Brucella suis 1330 chromosome I, complete sequence
          Length = 2107794

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 67/78 (85%)
 Strand = Plus / Plus

                                                                          
Query: 89     atggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcagggcggggag 148
              ||||| ||| |||| || ||||| ||||| |||||||| ||||||||||||||||| |||
Sbjct: 784690 atggaattcctgctcatcaaccacccgctggattgcccgatctgcgatcagggcggcgag 784749

                                
Query: 149    tgtgacctccaggatcag 166
              || ||| | |||||||||
Sbjct: 784750 tgcgacttgcaggatcag 784767

---

>gb|AE011910.1| Xanthomonas axonopodis pv. citri str. 306,  section 288 of 469 of the
            complete genome
          Length = 13393

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                        
Query: 89   atggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcagggcggggag 148
            ||||||||| ||||||| ||||| ||||| || ||||| ||||||||||||||||| |||
Sbjct: 2020 atggagttcctgctgatcaaccacccgctggactgcccgatctgcgatcagggcggcgag 1961

              
Query: 149  tg 150
            ||
Sbjct: 1960 tg 1959

---

>gb|AE009555.1| Brucella melitensis 16M chromosome I, section 112 of 195 of the
            complete sequence
          Length = 10607

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 67/78 (85%)
 Strand = Plus / Minus

                                                                        
Query: 89   atggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcagggcggggag 148
            ||||| ||| |||| || ||||| ||||| |||||||| ||||||||||||||||| |||
Sbjct: 1877 atggaattcctgctcatcaaccacccgctggattgcccgatctgcgatcagggcggcgag 1818

                              
Query: 149  tgtgacctccaggatcag 166
            || ||| | |||||||||
Sbjct: 1817 tgcgacttgcaggatcag 1800

---

>gb|AE017223.1| Brucella abortus biovar 1 str. 9-941 chromosome I, complete sequence
          Length = 2124241

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 67/78 (85%)
 Strand = Plus / Plus

                                                                          
Query: 89     atggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcagggcggggag 148
              ||||| ||| |||| || ||||| ||||| |||||||| ||||||||||||||||| |||
Sbjct: 806370 atggaattcctgctcatcaaccacccgctggattgcccgatctgcgatcagggcggcgag 806429

                                
Query: 149    tgtgacctccaggatcag 166
              || ||| | |||||||||
Sbjct: 806430 tgcgacttgcaggatcag 806447

---

>emb|AM040264.1| Brucella melitensis biovar Abortus chromosome I, complete sequence,
              strain 2308
          Length = 2121359

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 67/78 (85%)
 Strand = Plus / Plus

                                                                          
Query: 89     atggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcagggcggggag 148
              ||||| ||| |||| || ||||| ||||| |||||||| ||||||||||||||||| |||
Sbjct: 802648 atggaattcctgctcatcaaccacccgctggattgcccgatctgcgatcagggcggcgag 802707

                                
Query: 149    tgtgacctccaggatcag 166
              || ||| | |||||||||
Sbjct: 802708 tgcgacttgcaggatcag 802725

---

>gb|DQ167767.1| Drosophila teissieri putative NADH:ubiquinone reductase 75 kD
           subunit precursor (ND75) gene, exons 3 through 6 and
           partial cds
          Length = 1838

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                
Query: 128 atctgcgatcagggcggggagtgtgacctccaggatcagtccatggcctttgg 180
           |||||||||||||| || |||||||| || ||||||||| |||||||||||||
Sbjct: 7   atctgcgatcagggtggcgagtgtgatctgcaggatcaggccatggcctttgg 59

---

>gb|DQ167766.1| Drosophila simulans putative NADH:ubiquinone reductase 75 kD
           subunit precursor (ND75) gene, exons 3 through 6 and
           partial cds
          Length = 1831

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                
Query: 128 atctgcgatcagggcggggagtgtgacctccaggatcagtccatggcctttgg 180
           ||||||||||||||||| ||||| || || ||||||||| |||||||||||||
Sbjct: 4   atctgcgatcagggcggcgagtgcgatctgcaggatcaggccatggcctttgg 56

---

>gb|DQ167765.1| Drosophila orena putative NADH:ubiquinone reductase 75 kD subunit
           precursor (ND75) gene, exons 3 through 6 and partial cds
          Length = 1833

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                
Query: 128 atctgcgatcagggcggggagtgtgacctccaggatcagtccatggcctttgg 180
           |||||||||||||| || |||||||| || ||||||||| |||||||||||||
Sbjct: 4   atctgcgatcagggtggcgagtgtgatctgcaggatcaggccatggcctttgg 56

---

>gb|CP000352.1| Ralstonia metallidurans CH34, complete genome
          Length = 3928089

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                       
Query: 89      atggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcagggcgg 144
               ||||| ||| ||||||| ||||| |||||||| ||||| |||||||||||||||||
Sbjct: 1017540 atggaattcctgctgatcaaccacccgctcgactgcccgatctgcgatcagggcgg 1017595

---

>gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete sequence
          Length = 3806533

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                       
Query: 89      atggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcagggcgg 144
               ||||| ||| ||||||| ||||| |||||||| ||||| |||||||||||||||||
Sbjct: 1054329 atggaattcctgctgatcaaccacccgctcgactgcccgatctgcgatcagggcgg 1054384

---

>emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete genome
          Length = 5178466

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                           
Query: 89      atggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcagggcggggag 148
               ||||| ||| ||||||| ||||| ||||| || ||||| ||||||||||||||||| |||
Sbjct: 3241516 atggaattcctgctgatcaaccacccgctggactgcccgatctgcgatcagggcggcgag 3241457

                 
Query: 149     tg 150
               ||
Sbjct: 3241456 tg 3241455

---

>gb|DQ167768.1| Drosophila yakuba putative NADH:ubiquinone reductase 75 kD subunit
           precursor (ND75) gene, exons 3 through 6 and partial cds
          Length = 1832

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 128 atctgcgatcagggcggggagtgtgacctccaggatcagtccatggcctt 177
           |||||||||||||| || |||||||| || ||||||||| ||||||||||
Sbjct: 7   atctgcgatcagggtggcgagtgtgatctgcaggatcaggccatggcctt 56

---

>gb|AE012364.1| Xanthomonas campestris pv. campestris str. ATCC 33913,  section 272
            of 460 of the complete genome
          Length = 11146

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                        
Query: 89   atggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcagggcggggag 148
            ||||| ||| ||||||| ||||| ||||| || ||||| ||||||||||||||||| |||
Sbjct: 2020 atggaattcctgctgatcaaccacccgctggactgcccgatctgcgatcagggcggcgag 1961

              
Query: 149  tg 150
            ||
Sbjct: 1960 tg 1959

---

>gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, complete genome
          Length = 5148708

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                           
Query: 89      atggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcagggcggggag 148
               ||||| ||| ||||||| ||||| ||||| || ||||| ||||||||||||||||| |||
Sbjct: 1913647 atggaattcctgctgatcaaccacccgctggactgcccgatctgcgatcagggcggcgag 1913706

                 
Query: 149     tg 150
               ||
Sbjct: 1913707 tg 1913708

---

>gb|DQ167764.1| Drosophila erecta putative NADH:ubiquinone reductase 75 kD subunit
           precursor (ND75) gene, exons 3 through 6 and partial cds
          Length = 1909

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                
Query: 128 atctgcgatcagggcggggagtgtgacctccaggatcagtccatggcctttgg 180
           |||||||||||||| || ||||| || || ||||||||| |||||||||||||
Sbjct: 7   atctgcgatcagggtggcgagtgcgatctgcaggatcaggccatggcctttgg 59

---

>gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome
          Length = 4352825

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                       
Query: 89      atggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcagggcgg 144
               ||||| ||| ||||||| ||||||||  | |||||||| |||||||||||||||||
Sbjct: 1841168 atggaattcctgctgatcaaccatcctttggattgcccgatctgcgatcagggcgg 1841223

---

>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                       
Query: 107     aaccatccgctcgattgcccaatctgcgatcagggcggggagtgtgacctccagga 162
               ||||||||||| || ||||| |||||||| |||||||| ||||| ||||| |||||
Sbjct: 5445895 aaccatccgctggactgcccgatctgcgaccagggcggcgagtgcgacctgcagga 5445840

---

>gb|BC049394.1| Xenopus laevis NADH dehydrogenase (ubiquinone) Fe-S protein 1,
           75kDa (NADH-coenzyme Q reductase), mRNA (cDNA clone
           MGC:53276 IMAGE:5570071), complete cds
          Length = 2482

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 81/99 (81%)
 Strand = Plus / Plus

                                                                       
Query: 74  gcaagggagggtgtcatggagttcttgctgatgaaccatccgctcgattgcccaatctgc 133
           |||||||| ||||| ||||| ||||||||    |||||||| || || ||||| ||||| 
Sbjct: 398 gcaagggaaggtgtaatggaattcttgcttgcaaaccatcccctggactgccctatctgt 457

                                                  
Query: 134 gatcagggcggggagtgtgacctccaggatcagtccatg 172
           ||||| || || ||||||||  | |||||||||||||||
Sbjct: 458 gatcaaggaggagagtgtgatttacaggatcagtccatg 496

---

>ref|XM_796826.1| PREDICTED: Strongylocentrotus purpuratus similar to NADH
           dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa,
           transcript variant 2 (LOC582178), mRNA
          Length = 3290

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 122 tgcccaatctgcgatcagggcggggagtgtgacctccaggatcagtccatggcctttgg 180
           ||||| ||||| |||||||| || ||||| || |||||||| ||||||||||| |||||
Sbjct: 586 tgccccatctgtgatcagggaggagagtgcgatctccaggaccagtccatggcttttgg 644

---

>ref|XM_775031.1| PREDICTED: Strongylocentrotus purpuratus similar to NADH
           dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa,
           transcript variant 1 (LOC582178), mRNA
          Length = 3284

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 122 tgcccaatctgcgatcagggcggggagtgtgacctccaggatcagtccatggcctttgg 180
           ||||| ||||| |||||||| || ||||| || |||||||| ||||||||||| |||||
Sbjct: 586 tgccccatctgtgatcagggaggagagtgcgatctccaggaccagtccatggcttttgg 644

---

>dbj|AP007162.1| Aspergillus oryzae RIB40 genomic DNA, SC102
          Length = 1779707

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                          
Query: 110     catccgctcgattgcccaatctgcgatcagggcggggagtgtgacctccaggatcagtc 168
               ||||| ||||||||||| ||||| || |||||||| || ||||| || |||||||||||
Sbjct: 1755069 catcctctcgattgccctatctgtgaccagggcggtgaatgtgatcttcaggatcagtc 1755127

---

>gb|AY972100.1| Rhodothermus marinus strain PRQ 62B putative adenylosuccinate lyase
            gene, partial cds; and Nqo7, Nqo6, Nqo5, Nqo4, Nqo2,
            Nqo1, Nqo3, putative malate synthase, and putative
            transcriptional regulator genes, complete cds
          Length = 12551

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                      
Query: 99   tgctgatgaaccatccgctcgattgcccaatctgcgatcagg 140
            ||||||| ||||| |||||||| ||||| |||||||||||||
Sbjct: 7979 tgctgatcaaccacccgctcgactgcccgatctgcgatcagg 8020

---

>gb|CP000088.1| Thermobifida fusca YX, complete genome
          Length = 3642249

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                           
Query: 83      ggtgtcatggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcagggc 142
               ||||||||||||||| |||| || ||||| ||||| || ||||| ||||||||  |||||
Sbjct: 3166054 ggtgtcatggagttcctgctcatcaaccacccgctggactgcccgatctgcgacaagggc 3165995

                 
Query: 143     gg 144
               ||
Sbjct: 3165994 gg 3165993

---

>dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, complete genome
          Length = 4940217

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                           
Query: 89      atggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcagggcggggag 148
               ||||| ||| ||||||| || || ||||| || ||||| ||||||||||||||||| |||
Sbjct: 3475390 atggaattcctgctgatcaatcacccgctggactgcccgatctgcgatcagggcggcgag 3475331

                 
Query: 149     tg 150
               ||
Sbjct: 3475330 tg 3475329

---

>gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete genome
          Length = 4941439

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                           
Query: 89      atggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcagggcggggag 148
               ||||| ||| ||||||| || || ||||| || ||||| ||||||||||||||||| |||
Sbjct: 3471123 atggaattcctgctgatcaatcacccgctggactgcccgatctgcgatcagggcggcgag 3471064

                 
Query: 149     tg 150
               ||
Sbjct: 3471063 tg 3471062

---

>gb|AE017196.1| Wolbachia endosymbiont of Drosophila melanogaster, complete genome
          Length = 1267782

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                                
Query: 92     gagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcaggg 141
              ||||| ||||| || ||||| ||||| ||||||||||| |||||||||||
Sbjct: 150379 gagtttttgctaattaaccacccgcttgattgcccaatttgcgatcaggg 150330

---

>gb|BC085651.1| Danio rerio zgc:92209, mRNA (cDNA clone MGC:92209 IMAGE:7052019),
           complete cds
          Length = 2540

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 73/89 (82%)
 Strand = Plus / Plus

                                                                       
Query: 80  gagggtgtcatggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcag 139
           ||||| |||||||||||||||||    ||||| || || || || |||||||| ||||||
Sbjct: 400 gagggagtcatggagttcttgcttgccaaccaccctcttgactgtccaatctgtgatcag 459

                                        
Query: 140 ggcggggagtgtgacctccaggatcagtc 168
           || || |||||||| || ||||| |||||
Sbjct: 460 ggaggagagtgtgatctgcaggaccagtc 488

---

>ref|NM_001007765.1| Danio rerio zgc:92209 (zgc:92209), mRNA
          Length = 2540

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 73/89 (82%)
 Strand = Plus / Plus

                                                                       
Query: 80  gagggtgtcatggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcag 139
           ||||| |||||||||||||||||    ||||| || || || || |||||||| ||||||
Sbjct: 400 gagggagtcatggagttcttgcttgccaaccaccctcttgactgtccaatctgtgatcag 459

                                        
Query: 140 ggcggggagtgtgacctccaggatcagtc 168
           || || |||||||| || ||||| |||||
Sbjct: 460 ggaggagagtgtgatctgcaggaccagtc 488

---

>emb|AL162752.2|NMA1Z2491 Neisseria meningitidis serogroup A strain Z2491 complete genome;
            segment 1/7
          Length = 340806

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                    
Query: 89   atggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcagggcgg 144
            ||||||||| |||| || ||||||||||| ||||| || | |||||| ||||||||
Sbjct: 8949 atggagttcctgctcatcaaccatccgcttgattgtccgacctgcgaccagggcgg 8894

---

>gb|CP000249.1| Frankia sp. CcI3, complete genome
          Length = 5433628

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                          
Query: 107    aaccatccgctcgattgcccaatctgcgatcagggcggggagtg 150
              |||||||||||||| ||||| ||||||||  ||||||| |||||
Sbjct: 630882 aaccatccgctcgactgcccgatctgcgacaagggcggcgagtg 630925

---

>gb|AE004969.1| Neisseria gonorrhoeae FA 1090, complete genome
          Length = 2153922

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                       
Query: 89      atggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcagggcgg 144
               ||||||||| |||| || ||||||||||| ||||| || | |||||| ||||||||
Sbjct: 1706487 atggagttcctgctcatcaaccatccgcttgattgtccgacctgcgaccagggcgg 1706432

---

>gb|AE016828.2| Coxiella burnetii RSA 493, complete genome
          Length = 1995281

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                  
Query: 119     gattgcccaatctgcgatcagggcggggagtgtga 153
               |||||||| ||||||||||| |||||||| |||||
Sbjct: 1396553 gattgccctatctgcgatcaaggcggggaatgtga 1396519

---

>gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence
          Length = 3694126

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                     
Query: 107     aaccatccgctcgattgcccaatctgcgatcagggcgg 144
               ||||| || ||||| ||||| |||||||||||||||||
Sbjct: 2669930 aaccacccactcgactgcccgatctgcgatcagggcgg 2669893

---

>gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome
          Length = 4403837

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                             
Query: 99      tgctgatgaaccatccgctcgattgcccaatctgcgatcagggcgg 144
               ||||||| ||||||||||| |||||||| || |||||  |||||||
Sbjct: 3512550 tgctgatcaaccatccgctggattgcccgatgtgcgacaagggcgg 3512595

---

>gb|AY809738.1| Schistosoma japonicum SJCHGC05264 protein mRNA, partial cds
          Length = 1308

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 58/70 (82%)
 Strand = Plus / Plus

                                                                       
Query: 386 agtgaactatctggaaatgttattgatatctgccccgttggagctcttacatccaagccg 445
           |||||||||||||| ||||| |||||| | || || ||||| ||||| || || || |||
Sbjct: 756 agtgaactatctggtaatgtgattgatttatgtcctgttggcgctctgacttcgaaaccg 815

                     
Query: 446 tttgcattta 455
           | ||||||||
Sbjct: 816 tatgcattta 825

---

>gb|AE007270.1| Sinorhizobium meliloti 1021 plasmid pSymA section 76 of 121 of the
            complete plasmid sequence
          Length = 14695

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 113  ccgctcgattgcccaatctgcgatcagggcggggagtg 150
            |||||||||||||| ||||||||  ||||||| |||||
Sbjct: 2354 ccgctcgattgcccgatctgcgacaagggcggcgagtg 2317

---

>ref|XM_568803.1| Cryptococcus neoformans var. neoformans JEC21 NADH-ubiquinone
           oxidoreductase (CNB01310) partial mRNA
          Length = 2454

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 52/62 (83%)
 Strand = Plus / Plus

                                                                       
Query: 107 aaccatccgctcgattgcccaatctgcgatcagggcggggagtgtgacctccaggatcag 166
           ||||| |||||||| ||||| ||||| || || || || |||||||| || |||||||||
Sbjct: 484 aaccacccgctcgactgccctatctgtgaccaaggtggcgagtgtgatcttcaggatcag 543

             
Query: 167 tc 168
           ||
Sbjct: 544 tc 545

---

>emb|AJ245399.2|RME245399 Sinorhizobium meliloti ORF-378 (partial), nuoJ2 gene, nuoK2 gene, nuoL2
             gene, nuoM2 gene, nuoM3 gene, nuoN2 gene, nuoA2 gene,
             nuoB2 gene, nuoC2 gene, nuoD2 gene, nuoE2 gene, nuoF2
             gene, nuoG2 gene, nuoI2 gene, nuoH2 gene and ORFX
             (partial)
          Length = 18681

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                   
Query: 113   ccgctcgattgcccaatctgcgatcagggcggggagtg 150
             |||||||||||||| ||||||||  ||||||| |||||
Sbjct: 12812 ccgctcgattgcccgatctgcgacaagggcggcgagtg 12849

---

>gb|CP000053.1| Rickettsia felis URRWXCal2, complete genome
          Length = 1485148

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 64/78 (82%)
 Strand = Plus / Minus

                                                                           
Query: 89      atggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcagggcggggag 148
               |||||||| || || || || ||||| || |||||||| || || ||||||||||| |||
Sbjct: 1341297 atggagtttttacttattaatcatcctctagattgccctatttgtgatcagggcggtgag 1341238

                                 
Query: 149     tgtgacctccaggatcag 166
               |||||  | |||||||||
Sbjct: 1341237 tgtgatttacaggatcag 1341220

---

>ref|XM_968704.1| PREDICTED: Tribolium castaneum similar to NADH-ubiquinone
           oxidoreductase 75 kDa subunit, mitochondrial precursor
           (Complex I-75Kd) (CI-75Kd) (LOC662618), mRNA
          Length = 2236

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 61/74 (82%)
 Strand = Plus / Plus

                                                                       
Query: 80  gagggtgtcatggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcag 139
           ||||| |||||||||||| |  || ||||||| || ||||||||||| || ||||| || 
Sbjct: 355 gagggggtcatggagttccttttggtgaaccaccccctcgattgccccatttgcgaccaa 414

                         
Query: 140 ggcggggagtgtga 153
           || || ||||||||
Sbjct: 415 gggggcgagtgtga 428

---

>emb|BX842582.1| Mycobacterium tuberculosis H37Rv complete genome; segment 11/13
          Length = 349563

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                           
Query: 99    tgctgatgaaccatccgctcgattgcccaatctgcgatcagggcgg 144
             ||||||| ||||||||||| |||||||| || |||||  |||||||
Sbjct: 49402 tgctgatcaaccatccgctggattgcccgatgtgcgacaagggcgg 49447

---

>emb|BX248345.1| Mycobacterium bovis subsp. bovis AF2122/97 complete genome; segment
             12/14
          Length = 308050

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                           
Query: 99    tgctgatgaaccatccgctcgattgcccaatctgcgatcagggcgg 144
             ||||||| ||||||||||| |||||||| || |||||  |||||||
Sbjct: 29174 tgctgatcaaccatccgctggattgcccgatgtgcgacaagggcgg 29219

---

>gb|AE017342.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 2, complete
              sequence
          Length = 1632307

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                          
Query: 107    aaccatccgctcgattgcccaatctgcgatcagggcggggagtgtgacctccaggatcag 166
              ||||| |||||||| ||||| ||||| || || || || |||||||| || |||||||||
Sbjct: 399805 aaccacccgctcgactgccctatctgtgaccaaggtggcgagtgtgatcttcaggatcag 399746

                
Query: 167    tc 168
              ||
Sbjct: 399745 tc 399744

---

>gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome
          Length = 3345170

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                            
Query: 248     aagacggtgatgacccgttgcatccagtg 276
               ||||||||||||||||| || ||||||||
Sbjct: 1364316 aagacggtgatgacccgctgtatccagtg 1364288

---

>gb|BC015300.1| Mus musculus NADH dehydrogenase (ubiquinone) Fe-S protein 1, mRNA
           (cDNA clone MGC:19199 IMAGE:4236882), complete cds
          Length = 2502

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 388 tgaactatctggaaatgttattgatatctgccc 420
           |||||| ||||| ||||| ||||||||||||||
Sbjct: 710 tgaactgtctgggaatgtcattgatatctgccc 742

---

>ref|NM_145518.1| Mus musculus NADH dehydrogenase (ubiquinone) Fe-S protein 1
           (Ndufs1), mRNA
          Length = 2564

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 388 tgaactatctggaaatgttattgatatctgccc 420
           |||||| ||||| ||||| ||||||||||||||
Sbjct: 777 tgaactgtctgggaatgtcattgatatctgccc 809

---

>gb|AC141109.13| Medicago truncatula clone mth2-16p3, complete sequence
          Length = 116180

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 399   gaaatgttattgatatctgcc 419
             |||||||||||||||||||||
Sbjct: 59340 gaaatgttattgatatctgcc 59320

---

>emb|AL590393.7| Human DNA sequence from clone RP11-191O13 on chromosome 1, complete
             sequence
          Length = 40866

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 225   ataagaatctgggccccttggtgaa 249
             |||||||| ||||||||||||||||
Sbjct: 32345 ataagaatatgggccccttggtgaa 32321

---

>emb|AL645950.13| Mouse DNA sequence from clone RP23-13C17 on chromosome 1 Contains the
             Eef1b2 gene for eukaryotic translation elongation factor 1
             beta 2, the Ndufs1 gene for NADH dehydrogenase
             (ubiquinone) Fe-S protein 1 (Ndufs1), the Gpr1 gene for
             G-protein coupled receptor 1, the 5' end of a novel gene,
             two novel genes and two CpG islands, complete sequence
          Length = 138564

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                              
Query: 388   tgaactatctggaaatgttattgatatctgccc 420
             |||||| ||||| ||||| ||||||||||||||
Sbjct: 58780 tgaactgtctgggaatgtcattgatatctgccc 58748

---

>emb|AL645704.9| Mouse DNA sequence from clone RP23-414F19 on chromosome 13 Contains the
             Spi11 and Spi14 genes for serine protease inhibitors 11
             and 14, the gene for a novel serine protease inhibitor
             (Spi) family member and a Spi11 pseudogene, complete
             sequence
          Length = 150424

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 530   gacagcagaggtcctgaagtt 550
             |||||||||||||||||||||
Sbjct: 12486 gacagcagaggtcctgaagtt 12466

---

>dbj|AK142711.1| Mus musculus 16 days neonate heart cDNA, RIKEN full-length enriched
           library, clone:D830019B05 product:NADH dehydrogenase
           (ubiquinone) Fe-S protein 1, full insert sequence
          Length = 2543

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 388 tgaactatctggaaatgttattgatatctgccc 420
           |||||| ||||| ||||| ||||||||||||||
Sbjct: 770 tgaactgtctgggaatgtcattgatatctgccc 802

---

>dbj|AK146814.1| Mus musculus 16 days embryo heart cDNA, RIKEN full-length enriched
           library, clone:I920061D05 product:NADH dehydrogenase
           (ubiquinone) Fe-S protein 1, full insert sequence
          Length = 2672

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 388 tgaactatctggaaatgttattgatatctgccc 420
           |||||| ||||| ||||| ||||||||||||||
Sbjct: 908 tgaactgtctgggaatgtcattgatatctgccc 940

---

>dbj|AK167705.1| Mus musculus 12 days pregnant adult female placenta cDNA, RIKEN
           full-length enriched library, clone:I530029A22
           product:NADH dehydrogenase (ubiquinone) Fe-S protein 1,
           full insert sequence
          Length = 2499

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 388 tgaactatctggaaatgttattgatatctgccc 420
           |||||| ||||| ||||| ||||||||||||||
Sbjct: 738 tgaactgtctgggaatgtcattgatatctgccc 770

---

>dbj|AK166604.1| Mus musculus 4 cells embryo 4 cells cDNA, RIKEN full-length
           enriched library, clone:I0C0034O09 product:NADH
           dehydrogenase (ubiquinone) Fe-S protein 1, full insert
           sequence
          Length = 1775

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 388 tgaactatctggaaatgttattgatatctgccc 420
           |||||| ||||| ||||| ||||||||||||||
Sbjct: 841 tgaactgtctgggaatgtcattgatatctgccc 873

---

>dbj|AK034597.1| Mus musculus 12 days embryo embryonic body between diaphragm region
           and neck cDNA, RIKEN full-length enriched library,
           clone:9430013A22 product:NADH dehydrogenase (ubiquinone)
           Fe-S protein 1, full insert sequence
          Length = 2591

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 388 tgaactatctggaaatgttattgatatctgccc 420
           |||||| ||||| ||||| ||||||||||||||
Sbjct: 959 tgaactgtctgggaatgtcattgatatctgccc 991

---

>dbj|AK036926.1| Mus musculus adult female vagina cDNA, RIKEN full-length enriched
           library, clone:9930026A05 product:NADH-UBIQUINONE
           OXIDOREDUCTASE 75 KDA SUBUNIT, MITOCHONDRIAL PRECURSOR
           (EC 1.6.5.3) (EC 1.6.99.3) (COMPLEX I-75KD) (CI-75KD)
           homolog [Bos taurus], full insert sequence
          Length = 2519

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 388 tgaactatctggaaatgttattgatatctgccc 420
           |||||| ||||| ||||| ||||||||||||||
Sbjct: 755 tgaactgtctgggaatgtcattgatatctgccc 787

---

>dbj|AK078590.1| Mus musculus 11 days embryo gonad cDNA, RIKEN full-length enriched
           library, clone:7030412O03 product:weakly similar to NADH
           DEHYDROGENASE, SUBUNIT 11 (EC 1.6.5.3) (NADH
           DEHYDROGENASE (UBIQUINONE)) (UBIQUINONE REDUCTASE) (TYPE
           I DEHYDROGENASE) (COMPLEX I DEHYDROGENASE) [Acanthamoeba
           castellanii], full insert sequence
          Length = 1925

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 388 tgaactatctggaaatgttattgatatctgccc 420
           |||||| ||||| ||||| ||||||||||||||
Sbjct: 736 tgaactgtctgggaatgtcattgatatctgccc 768

---

>gb|BC006660.1| Mus musculus NADH dehydrogenase (ubiquinone) Fe-S protein 1, mRNA
           (cDNA clone MGC:7850 IMAGE:3501043), complete cds
          Length = 2564

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 388 tgaactatctggaaatgttattgatatctgccc 420
           |||||| ||||| ||||| ||||||||||||||
Sbjct: 777 tgaactgtctgggaatgtcattgatatctgccc 809

---

>gb|AC158162.13| Mus musculus chromosome 3, clone RP23-335E20, complete sequence
          Length = 206835

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 9      cctcctgcgccatgcccgcc 28
              ||||||||||||||||||||
Sbjct: 168138 cctcctgcgccatgcccgcc 168157

---

>gb|AC149783.2| Bos taurus  BAC CH240-3K17 (Children's Hospital Oakland Research
             Institute Bovine BAC Library (male)) complete sequence
          Length = 205084

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 490   tattgatgttactgatgcag 509
             ||||||||||||||||||||
Sbjct: 55753 tattgatgttactgatgcag 55772

---

>gb|AE006430.1| Lactococcus lactis subsp. lactis IL1403 section 192 of 218 of the
            complete genome
          Length = 10560

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 345  gtggtgaagaaatcggaaca 364
            ||||||||||||||||||||
Sbjct: 9803 gtggtgaagaaatcggaaca 9784

---

>gb|AE009034.1| Agrobacterium tumefaciens str. C58 circular chromosome, section 60 of
            256 of the complete sequence
          Length = 9948

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 1    gcccgtcgcctcctgcgcca 20
            ||||||||||||||||||||
Sbjct: 2803 gcccgtcgcctcctgcgcca 2822

---

>gb|DQ491003.1| Chlorella virus AR158 ctg_1047243734156 genomic sequence
          Length = 344691

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 85    tgtcatggagttcttgctgatgaa 108
             ||||||||| ||||||||||||||
Sbjct: 26466 tgtcatggatttcttgctgatgaa 26443

---

>gb|DQ491002.1| Paramecium bursaria Chlorella virus NY2A Chlorella virus NY2A ctg_13
              genomic sequence
          Length = 368683

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 85     tgtcatggagttcttgctgatgaa 108
              ||||||||| ||||||||||||||
Sbjct: 346768 tgtcatggatttcttgctgatgaa 346791

---

>gb|AC126260.3| Mus musculus BAC clone RP23-338J1 from chromosome 9, complete sequence
          Length = 208028

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 71     aaggcaagggagggtgtcat 90
              ||||||||||||||||||||
Sbjct: 182456 aaggcaagggagggtgtcat 182475

---

>gb|AC121885.3| Mus musculus BAC clone RP24-138N20 from chromosome 3, complete sequence
          Length = 155690

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 9      cctcctgcgccatgcccgcc 28
              ||||||||||||||||||||
Sbjct: 143517 cctcctgcgccatgcccgcc 143498

---

>emb|AL138700.18| Human DNA sequence from clone RP11-401G12 on chromosome 13q31.3-33.1,
            complete sequence
          Length = 20172

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 388  tgaactatctggaaatgtta 407
            ||||||||||||||||||||
Sbjct: 9786 tgaactatctggaaatgtta 9805

---

>gb|AC160015.2| Mus musculus BAC clone RP23-433E2 from chromosome 9, complete sequence
          Length = 209970

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 154   cctccaggatcagtccatgg 173
             ||||||||||||||||||||
Sbjct: 16840 cctccaggatcagtccatgg 16859

---

>emb|AL772195.4| Mouse DNA sequence from clone RP23-218C5 on chromosome 11 Contains the
             5' end of the Ugp2 gene for  UDP-glucose pyrophosphorylase
             2, two novel genes, a cytoplasmic dynein light chain 1
             (Dnclc1) pseudogene, a RAB5A member RAS oncogene family
             (Rab5a) pseudogene, a novel pseudogene and a CpG island,
             complete sequence
          Length = 173182

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 9     cctcctgcgccatgcccgcc 28
             ||||||||||||||||||||
Sbjct: 67271 cctcctgcgccatgcccgcc 67290

---

>gb|AC063953.13| Homo sapiens 3 BAC RP11-317I15 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 185259

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 157   ccaggatcagtccatggcct 176
             ||||||||||||||||||||
Sbjct: 87746 ccaggatcagtccatggcct 87727

---

>gb|AC007431.8| Homo sapiens chromosome 17, clone RP11-118E18, complete sequence
          Length = 166518

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 460   taggaactgggagatgaagggcac 483
             |||||||||||||||| |||||||
Sbjct: 40546 taggaactgggagatgtagggcac 40569

---

>dbj|AK048234.1| Mus musculus 16 days embryo head cDNA, RIKEN full-length enriched
            library, clone:C130041P16 product:unclassifiable, full
            insert sequence
          Length = 4100

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 154  cctccaggatcagtccatgg 173
            ||||||||||||||||||||
Sbjct: 3964 cctccaggatcagtccatgg 3945

---

>gb|AE002098.2| Neisseria meningitidis MC58, complete genome
          Length = 2272360

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                      
Query: 89     atggagttcttgctgatgaaccatccgctcgattgcccaatctgcgatcagggcgg 144
              ||||||||| |||| || ||||||||||| ||||| || | |||||| || |||||
Sbjct: 252991 atggagttcctgctcatcaaccatccgcttgattgtccgacctgcgaccaaggcgg 253046

---

>emb|AL603630.11| Mouse DNA sequence from clone RP23-350M23 on chromosome 9, complete
              sequence
          Length = 202081

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 71     aaggcaagggagggtgtcat 90
              ||||||||||||||||||||
Sbjct: 114963 aaggcaagggagggtgtcat 114982

---

>gb|BC084851.1| Xenopus laevis hypothetical LOC495383, mRNA (cDNA clone MGC:85475
            IMAGE:6938018), complete cds
          Length = 2108

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 383  acaagtgaactatctggaaa 402
            ||||||||||||||||||||
Sbjct: 1575 acaagtgaactatctggaaa 1594

---

>emb|CT025676.10| Mouse DNA sequence from clone RP24-372B7 on chromosome 9, complete
              sequence
          Length = 174177

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 154    cctccaggatcagtccatgg 173
              ||||||||||||||||||||
Sbjct: 103694 cctccaggatcagtccatgg 103675

---

>emb|AL669921.13| Mouse DNA sequence from clone RP23-67P9 on chromosome 2, complete
             sequence
          Length = 203592

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 490   tattgatgttactgatgcag 509
             ||||||||||||||||||||
Sbjct: 50046 tattgatgttactgatgcag 50065


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,009,617
Number of Sequences: 3902068
Number of extensions: 4009617
Number of successful extensions: 91173
Number of sequences better than 10.0: 142
Number of HSP's better than 10.0 without gapping: 139
Number of HSP's successfully gapped in prelim test: 3
Number of HSP's that attempted gapping in prelim test: 90130
Number of HSP's gapped (non-prelim): 1031
length of query: 559
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 536
effective length of database: 17,143,297,704
effective search space: 9188807569344
effective search space used: 9188807569344
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---