ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bah63c24
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_466605.1| Oryza sativa (japonica cultivar-group), mRNA 238 2e-59
2ref|XM_506856.1| PREDICTED Oryza sativa (japonica cultivar-group... 238 2e-59
3dbj|AK120769.1| Oryza sativa (japonica cultivar-group) cDNA clon... 238 2e-59
4dbj|AK105762.1| Oryza sativa (japonica cultivar-group) cDNA clon... 238 2e-59
5gb|AY562489.1| Zea mays hydroxymethylbutenyl 4-diphosphate synth... 192 8e-46
6gb|AY562488.1| Zea mays hydroxymethylbutenyl 4-diphosphate synth... 125 2e-25
7dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 125 2e-25
8dbj|AP004124.3| Oryza sativa (japonica cultivar-group) genomic D... 125 2e-25
9ref|XM_752536.1| Ustilago maydis 521 hypothetical protein (UM014... 46 0.12
10ref|XM_415558.1| PREDICTED: Gallus gallus similar to phosphohist... 42 1.8
11gb|BT014629.1| Lycopersicon esculentum clone 134132R, mRNA sequence 42 1.8
12dbj|AP007161.1| Aspergillus oryzae RIB40 genomic DNA, SC012 42 1.8
13gb|AF435086.1| Lycopersicon esculentum GcpE mRNA, complete cds 42 1.8
14gb|AY515283.1| Pseudemys concinna haplotype 79 cytochrome b-like... 40 7.2
15gb|AY515281.1| Pseudemys concinna haplotype 87 cytochrome b-like... 40 7.2
16ref|NM_101931.2| Arabidopsis thaliana unknown protein AT1G20790 ... 40 7.2
17emb|AL929089.5| Mouse DNA sequence from clone RP24-402O2 on chro... 40 7.2
18gb|AF258877.1| Deirochelys reticularia cytochrome b gene, comple... 40 7.2
19gb|AC007665.24| Mus musculus strain RIII Fibroblast cell line C1... 40 7.2
20gb|AC069251.5|AC069251 Genomic sequence for Arabidopsis thaliana... 40 7.2
21dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 40 7.2
22dbj|AP006424.1| Lotus japonicus genomic DNA, chromosome 6, clone... 40 7.2

>ref|XM_466605.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2494

 Score =  238 bits (120), Expect = 2e-59
 Identities = 282/336 (83%)
 Strand = Plus / Plus

                                                                       
Query: 194 atagccatggccaccggggtggcaccggctccgcttccgtacgtcaaggtccgcgacgga 253
           ||||||||||||||||| |||||||| || ||||| ||  | |||| |||||| || || 
Sbjct: 156 atagccatggccaccggagtggcaccagcgccgctcccacatgtcagggtccgtgatggt 215

                                                                       
Query: 254 ggcgtcggctacaccaagagcgtcgacttcgccaagatcctctccgttcccggtgcgctg 313
           ||| |||||| ||| | |||||||||||| || |||||| | || ||||| | | | || 
Sbjct: 216 ggcatcggcttcacgaggagcgtcgactttgctaagatcttgtcggttcctgctactcta 275

                                                                       
Query: 314 aggatggggtccgcaagaggcagggcgctcgtggtcaagagctcaagtacagagtctgat 373
           ||| |||| ||  |||||||||||| ||| |||| ||||||||||||||| |  ||||||
Sbjct: 276 agggtgggctcatcaagaggcagggtgcttgtggccaagagctcaagtaccggttctgat 335

                                                                       
Query: 374 accatggagctcgagccggcctccgaaggaagcccacttctagttcccaggcagaagtac 433
           |||||||||||||||||  | || ||||||||||||||| ||||||||||||| ||||| 
Sbjct: 336 accatggagctcgagccatcttcagaaggaagcccacttttagttcccaggcaaaagtat 395

                                                                       
Query: 434 tgcgaatctatacaccagacaaggaggaggaaaacacgcactgtgatggtcgggaacgtg 493
           || ||||||||| |  ||||||||||||| ||||| |||||||||||||| ||||| |||
Sbjct: 396 tgtgaatctatatatgagacaaggaggagaaaaacccgcactgtgatggttgggaatgtg 455

                                               
Query: 494 gcactcggcagtgatcaccccatgaggattcagact 529
            |||| ||||||||||| ||||| ||||||||||||
Sbjct: 456 ccacttggcagtgatcatcccattaggattcagact 491



to top

>ref|XM_506856.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1669_F01.30
           mRNA
          Length = 2675

 Score =  238 bits (120), Expect = 2e-59
 Identities = 282/336 (83%)
 Strand = Plus / Plus

                                                                       
Query: 194 atagccatggccaccggggtggcaccggctccgcttccgtacgtcaaggtccgcgacgga 253
           ||||||||||||||||| |||||||| || ||||| ||  | |||| |||||| || || 
Sbjct: 149 atagccatggccaccggagtggcaccagcgccgctcccacatgtcagggtccgtgatggt 208

                                                                       
Query: 254 ggcgtcggctacaccaagagcgtcgacttcgccaagatcctctccgttcccggtgcgctg 313
           ||| |||||| ||| | |||||||||||| || |||||| | || ||||| | | | || 
Sbjct: 209 ggcatcggcttcacgaggagcgtcgactttgctaagatcttgtcggttcctgctactcta 268

                                                                       
Query: 314 aggatggggtccgcaagaggcagggcgctcgtggtcaagagctcaagtacagagtctgat 373
           ||| |||| ||  |||||||||||| ||| |||| ||||||||||||||| |  ||||||
Sbjct: 269 agggtgggctcatcaagaggcagggtgcttgtggccaagagctcaagtaccggttctgat 328

                                                                       
Query: 374 accatggagctcgagccggcctccgaaggaagcccacttctagttcccaggcagaagtac 433
           |||||||||||||||||  | || ||||||||||||||| ||||||||||||| ||||| 
Sbjct: 329 accatggagctcgagccatcttcagaaggaagcccacttttagttcccaggcaaaagtat 388

                                                                       
Query: 434 tgcgaatctatacaccagacaaggaggaggaaaacacgcactgtgatggtcgggaacgtg 493
           || ||||||||| |  ||||||||||||| ||||| |||||||||||||| ||||| |||
Sbjct: 389 tgtgaatctatatatgagacaaggaggagaaaaacccgcactgtgatggttgggaatgtg 448

                                               
Query: 494 gcactcggcagtgatcaccccatgaggattcagact 529
            |||| ||||||||||| ||||| ||||||||||||
Sbjct: 449 ccacttggcagtgatcatcccattaggattcagact 484



to top

>dbj|AK120769.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023008D09, full
           insert sequence
          Length = 2675

 Score =  238 bits (120), Expect = 2e-59
 Identities = 282/336 (83%)
 Strand = Plus / Plus

                                                                       
Query: 194 atagccatggccaccggggtggcaccggctccgcttccgtacgtcaaggtccgcgacgga 253
           ||||||||||||||||| |||||||| || ||||| ||  | |||| |||||| || || 
Sbjct: 149 atagccatggccaccggagtggcaccagcgccgctcccacatgtcagggtccgtgatggt 208

                                                                       
Query: 254 ggcgtcggctacaccaagagcgtcgacttcgccaagatcctctccgttcccggtgcgctg 313
           ||| |||||| ||| | |||||||||||| || |||||| | || ||||| | | | || 
Sbjct: 209 ggcatcggcttcacgaggagcgtcgactttgctaagatcttgtcggttcctgctactcta 268

                                                                       
Query: 314 aggatggggtccgcaagaggcagggcgctcgtggtcaagagctcaagtacagagtctgat 373
           ||| |||| ||  |||||||||||| ||| |||| ||||||||||||||| |  ||||||
Sbjct: 269 agggtgggctcatcaagaggcagggtgcttgtggccaagagctcaagtaccggttctgat 328

                                                                       
Query: 374 accatggagctcgagccggcctccgaaggaagcccacttctagttcccaggcagaagtac 433
           |||||||||||||||||  | || ||||||||||||||| ||||||||||||| ||||| 
Sbjct: 329 accatggagctcgagccatcttcagaaggaagcccacttttagttcccaggcaaaagtat 388

                                                                       
Query: 434 tgcgaatctatacaccagacaaggaggaggaaaacacgcactgtgatggtcgggaacgtg 493
           || ||||||||| |  ||||||||||||| ||||| |||||||||||||| ||||| |||
Sbjct: 389 tgtgaatctatatatgagacaaggaggagaaaaacccgcactgtgatggttgggaatgtg 448

                                               
Query: 494 gcactcggcagtgatcaccccatgaggattcagact 529
            |||| ||||||||||| ||||| ||||||||||||
Sbjct: 449 ccacttggcagtgatcatcccattaggattcagact 484



to top

>dbj|AK105762.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-202-D08, full
           insert sequence
          Length = 2494

 Score =  238 bits (120), Expect = 2e-59
 Identities = 282/336 (83%)
 Strand = Plus / Plus

                                                                       
Query: 194 atagccatggccaccggggtggcaccggctccgcttccgtacgtcaaggtccgcgacgga 253
           ||||||||||||||||| |||||||| || ||||| ||  | |||| |||||| || || 
Sbjct: 156 atagccatggccaccggagtggcaccagcgccgctcccacatgtcagggtccgtgatggt 215

                                                                       
Query: 254 ggcgtcggctacaccaagagcgtcgacttcgccaagatcctctccgttcccggtgcgctg 313
           ||| |||||| ||| | |||||||||||| || |||||| | || ||||| | | | || 
Sbjct: 216 ggcatcggcttcacgaggagcgtcgactttgctaagatcttgtcggttcctgctactcta 275

                                                                       
Query: 314 aggatggggtccgcaagaggcagggcgctcgtggtcaagagctcaagtacagagtctgat 373
           ||| |||| ||  |||||||||||| ||| |||| ||||||||||||||| |  ||||||
Sbjct: 276 agggtgggctcatcaagaggcagggtgcttgtggccaagagctcaagtaccggttctgat 335

                                                                       
Query: 374 accatggagctcgagccggcctccgaaggaagcccacttctagttcccaggcagaagtac 433
           |||||||||||||||||  | || ||||||||||||||| ||||||||||||| ||||| 
Sbjct: 336 accatggagctcgagccatcttcagaaggaagcccacttttagttcccaggcaaaagtat 395

                                                                       
Query: 434 tgcgaatctatacaccagacaaggaggaggaaaacacgcactgtgatggtcgggaacgtg 493
           || ||||||||| |  ||||||||||||| ||||| |||||||||||||| ||||| |||
Sbjct: 396 tgtgaatctatatatgagacaaggaggagaaaaacccgcactgtgatggttgggaatgtg 455

                                               
Query: 494 gcactcggcagtgatcaccccatgaggattcagact 529
            |||| ||||||||||| ||||| ||||||||||||
Sbjct: 456 ccacttggcagtgatcatcccattaggattcagact 491



to top

>gb|AY562489.1| Zea mays hydroxymethylbutenyl 4-diphosphate synthase (Hds1) mRNA,
           complete cds
          Length = 2631

 Score =  192 bits (97), Expect = 8e-46
 Identities = 172/197 (87%)
 Strand = Plus / Plus

                                                                       
Query: 329 agaggcagggcgctcgtggtcaagagctcaagtacagagtctgataccatggagctcgag 388
           |||||||||||||||||||  |||||||| ||||| |  || || |||||||||||||||
Sbjct: 337 agaggcagggcgctcgtggcgaagagctctagtactggctcggagaccatggagctcgag 396

                                                                       
Query: 389 ccggcctccgaaggaagcccacttctagttcccaggcagaagtactgcgaatctatacac 448
           ||  | || ||||||||||||||| |||| ||||||||||||||||| ||||| | ||||
Sbjct: 397 ccatcttcagaaggaagcccacttttagtacccaggcagaagtactgtgaatcaacacac 456

                                                                       
Query: 449 cagacaaggaggaggaaaacacgcactgtgatggtcgggaacgtggcactcggcagtgat 508
           |||||||||||||||||||| || ||||||||||| ||||| ||| |||| |||||||||
Sbjct: 457 cagacaaggaggaggaaaactcgaactgtgatggtggggaatgtgccacttggcagtgat 516

                            
Query: 509 caccccatgaggattca 525
           || ||||| ||||||||
Sbjct: 517 catcccataaggattca 533



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 134 acggtgctgcgaggtgtttgtaggat 159
           |||| |||||||||||||||||||||
Sbjct: 142 acggagctgcgaggtgtttgtaggat 167



to top

>gb|AY562488.1| Zea mays hydroxymethylbutenyl 4-diphosphate synthase (Hds1) gene,
            complete cds
          Length = 6353

 Score =  125 bits (63), Expect = 2e-25
 Identities = 96/107 (89%)
 Strand = Plus / Plus

                                                                        
Query: 419  cccaggcagaagtactgcgaatctatacaccagacaaggaggaggaaaacacgcactgtg 478
            ||||||||||||||||| ||||| | |||||||||||||||||||||||| || ||||||
Sbjct: 1187 cccaggcagaagtactgtgaatcaacacaccagacaaggaggaggaaaactcgaactgtg 1246

                                                           
Query: 479  atggtcgggaacgtggcactcggcagtgatcaccccatgaggattca 525
            ||||| ||||| ||| |||| ||||||||||| ||||| ||||||||
Sbjct: 1247 atggtggggaatgtgccacttggcagtgatcatcccataaggattca 1293



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 72/84 (85%)
 Strand = Plus / Plus

                                                                        
Query: 329  agaggcagggcgctcgtggtcaagagctcaagtacagagtctgataccatggagctcgag 388
            |||||||||||||||||||  |||||||| ||||| |  || || |||||||||||||||
Sbjct: 977  agaggcagggcgctcgtggcgaagagctctagtactggctcggagaccatggagctcgag 1036

                                    
Query: 389  ccggcctccgaaggaagcccactt 412
            ||  | || |||||||||||||||
Sbjct: 1037 ccatcttcagaaggaagcccactt 1060



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  125 bits (63), Expect = 2e-25
 Identities = 180/219 (82%)
 Strand = Plus / Minus

                                                                            
Query: 194      atagccatggccaccggggtggcaccggctccgcttccgtacgtcaaggtccgcgacgga 253
                ||||||||||||||||| |||||||| || ||||| ||  | |||| |||||| || || 
Sbjct: 23677605 atagccatggccaccggagtggcaccagcgccgctcccacatgtcagggtccgtgatggt 23677546

                                                                            
Query: 254      ggcgtcggctacaccaagagcgtcgacttcgccaagatcctctccgttcccggtgcgctg 313
                ||| |||||| ||| | |||||||||||| || |||||| | || ||||| | | | || 
Sbjct: 23677545 ggcatcggcttcacgaggagcgtcgactttgctaagatcttgtcggttcctgctactcta 23677486

                                                                            
Query: 314      aggatggggtccgcaagaggcagggcgctcgtggtcaagagctcaagtacagagtctgat 373
                ||| |||| ||  |||||||||||| ||| |||| ||||||||||||||| |  ||||||
Sbjct: 23677485 agggtgggctcatcaagaggcagggtgcttgtggccaagagctcaagtaccggttctgat 23677426

                                                       
Query: 374      accatggagctcgagccggcctccgaaggaagcccactt 412
                |||||||||||||||||  | || |||||||||||||||
Sbjct: 23677425 accatggagctcgagccatcttcagaaggaagcccactt 23677387



 Score =  119 bits (60), Expect = 1e-23
 Identities = 102/116 (87%)
 Strand = Plus / Minus

                                                                            
Query: 414      tagttcccaggcagaagtactgcgaatctatacaccagacaaggaggaggaaaacacgca 473
                ||||||||||||| ||||| || ||||||||| |  ||||||||||||| ||||| ||||
Sbjct: 23677254 tagttcccaggcaaaagtattgtgaatctatatatgagacaaggaggagaaaaacccgca 23677195

                                                                        
Query: 474      ctgtgatggtcgggaacgtggcactcggcagtgatcaccccatgaggattcagact 529
                |||||||||| ||||| ||| |||| ||||||||||| ||||| ||||||||||||
Sbjct: 23677194 ctgtgatggttgggaatgtgccacttggcagtgatcatcccattaggattcagact 23677139



to top

>dbj|AP004124.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OJ1669_F01
          Length = 140019

 Score =  125 bits (63), Expect = 2e-25
 Identities = 180/219 (82%)
 Strand = Plus / Minus

                                                                          
Query: 194    atagccatggccaccggggtggcaccggctccgcttccgtacgtcaaggtccgcgacgga 253
              ||||||||||||||||| |||||||| || ||||| ||  | |||| |||||| || || 
Sbjct: 118705 atagccatggccaccggagtggcaccagcgccgctcccacatgtcagggtccgtgatggt 118646

                                                                          
Query: 254    ggcgtcggctacaccaagagcgtcgacttcgccaagatcctctccgttcccggtgcgctg 313
              ||| |||||| ||| | |||||||||||| || |||||| | || ||||| | | | || 
Sbjct: 118645 ggcatcggcttcacgaggagcgtcgactttgctaagatcttgtcggttcctgctactcta 118586

                                                                          
Query: 314    aggatggggtccgcaagaggcagggcgctcgtggtcaagagctcaagtacagagtctgat 373
              ||| |||| ||  |||||||||||| ||| |||| ||||||||||||||| |  ||||||
Sbjct: 118585 agggtgggctcatcaagaggcagggtgcttgtggccaagagctcaagtaccggttctgat 118526

                                                     
Query: 374    accatggagctcgagccggcctccgaaggaagcccactt 412
              |||||||||||||||||  | || |||||||||||||||
Sbjct: 118525 accatggagctcgagccatcttcagaaggaagcccactt 118487



 Score =  119 bits (60), Expect = 1e-23
 Identities = 102/116 (87%)
 Strand = Plus / Minus

                                                                          
Query: 414    tagttcccaggcagaagtactgcgaatctatacaccagacaaggaggaggaaaacacgca 473
              ||||||||||||| ||||| || ||||||||| |  ||||||||||||| ||||| ||||
Sbjct: 118354 tagttcccaggcaaaagtattgtgaatctatatatgagacaaggaggagaaaaacccgca 118295

                                                                      
Query: 474    ctgtgatggtcgggaacgtggcactcggcagtgatcaccccatgaggattcagact 529
              |||||||||| ||||| ||| |||| ||||||||||| ||||| ||||||||||||
Sbjct: 118294 ctgtgatggttgggaatgtgccacttggcagtgatcatcccattaggattcagact 118239



to top

>ref|XM_752536.1| Ustilago maydis 521 hypothetical protein (UM01482.1) partial mRNA
          Length = 3066

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 372  ataccatggagctcgagccggcc 394
            |||||||||||||||||||||||
Sbjct: 1949 ataccatggagctcgagccggcc 1971



to top

>ref|XM_415558.1| PREDICTED: Gallus gallus similar to phosphohistidine phosphatase 1;
           1700008C22Rik; sex-regulated protein janus-a
           (LOC417285), mRNA
          Length = 1129

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 123 ggcgccgcgggacggtgctgcgagg 147
           ||||||||||||||| |||||||||
Sbjct: 295 ggcgccgcgggacggggctgcgagg 319



to top

>gb|BT014629.1| Lycopersicon esculentum clone 134132R, mRNA sequence
          Length = 2527

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 471 gcactgtgatggtcgggaacgtggc 495
           ||||||||||||| |||||||||||
Sbjct: 312 gcactgtgatggttgggaacgtggc 336



to top

>dbj|AP007161.1| Aspergillus oryzae RIB40 genomic DNA, SC012
          Length = 2668010

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 174     ttcgaagcttgggcataggca 194
               |||||||||||||||||||||
Sbjct: 2255341 ttcgaagcttgggcataggca 2255321



to top

>gb|AF435086.1| Lycopersicon esculentum GcpE mRNA, complete cds
          Length = 2373

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 471 gcactgtgatggtcgggaacgtggc 495
           ||||||||||||| |||||||||||
Sbjct: 334 gcactgtgatggttgggaacgtggc 358



to top

>gb|AY515283.1| Pseudemys concinna haplotype 79 cytochrome b-like (cytb) gene,
           partial sequence; tRNA-Thr and tRNA-Pro genes, complete
           sequence; and control region, partial sequence;
           mitochondrial
          Length = 1310

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 151 ttgtaggattgcgtaggcga 170
           ||||||||||||||||||||
Sbjct: 312 ttgtaggattgcgtaggcga 293



to top

>gb|AY515281.1| Pseudemys concinna haplotype 87 cytochrome b-like (cytb) gene,
           partial sequence; tRNA-Thr and tRNA-Pro genes, complete
           sequence; and control region, partial sequence;
           mitochondrial
          Length = 1318

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 151 ttgtaggattgcgtaggcga 170
           ||||||||||||||||||||
Sbjct: 310 ttgtaggattgcgtaggcga 291



to top

>ref|NM_101931.2| Arabidopsis thaliana unknown protein AT1G20790 mRNA, complete cds
          Length = 1308

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 185  ggcataggcatagccatggc 204
            ||||||||||||||||||||
Sbjct: 1181 ggcataggcatagccatggc 1162



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 183  tgggcataggcatagccatggcca 206
            ||||||||||||||| ||||||||
Sbjct: 1159 tgggcataggcataggcatggcca 1136



to top

>emb|AL929089.5| Mouse DNA sequence from clone RP24-402O2 on chromosome 11 Contains a
             novel gene (1700106J16Rik), complete sequence
          Length = 71354

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 202   ggccaccggggtggcaccggctcc 225
             |||||||||| |||||||||||||
Sbjct: 35165 ggccaccgggctggcaccggctcc 35142



to top

>gb|AF258877.1| Deirochelys reticularia cytochrome b gene, complete cds;
           mitochondrial gene for mitochondrial product
          Length = 1190

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 151 ttgtaggattgcgtaggcga 170
           ||||||||||||||||||||
Sbjct: 849 ttgtaggattgcgtaggcga 830



to top

>gb|AC007665.24| Mus musculus strain RIII Fibroblast cell line C127 chromosome 18 clone
             mgsriii-p1_3084, complete sequence
          Length = 85548

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 448   ccagacaaggaggaggaaaa 467
             ||||||||||||||||||||
Sbjct: 83262 ccagacaaggaggaggaaaa 83243



to top

>gb|AC069251.5|AC069251 Genomic sequence for Arabidopsis thaliana BAC F2D10 from chromosome I,
              complete sequence
          Length = 143879

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 183    tgggcataggcatagccatggcca 206
              ||||||||||||||| ||||||||
Sbjct: 111567 tgggcataggcataggcatggcca 111590



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 185    ggcataggcatagccatggc 204
              ||||||||||||||||||||
Sbjct: 111545 ggcataggcatagccatggc 111564



to top

>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 64      ttccccgcgtcgctgccgtcggct 87
               |||| |||||||||||||||||||
Sbjct: 4022326 ttccgcgcgtcgctgccgtcggct 4022303



to top

>dbj|AP006424.1| Lotus japonicus genomic DNA, chromosome 6, clone:LjT13E04, TM0314,
              complete sequence
          Length = 126349

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 183    tgggcataggcatagccatg 202
              ||||||||||||||||||||
Sbjct: 102218 tgggcataggcatagccatg 102237


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,100,792
Number of Sequences: 3902068
Number of extensions: 3100792
Number of successful extensions: 55780
Number of sequences better than 10.0: 22
Number of HSP's better than 10.0 without gapping: 22
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 55629
Number of HSP's gapped (non-prelim): 145
length of query: 529
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 506
effective length of database: 17,143,297,704
effective search space: 8674508638224
effective search space used: 8674508638224
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top