ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bah63c02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_463779.1| Oryza sativa (japonica cultivar-group), mRNA 632 e-178
2dbj|AK072105.1| Oryza sativa (japonica cultivar-group) cDNA clon... 632 e-178
3dbj|AK067642.1| Oryza sativa (japonica cultivar-group) cDNA clon... 632 e-178
4dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 161 3e-36
5dbj|AP005873.3| Oryza sativa (japonica cultivar-group) genomic D... 161 3e-36
6dbj|AP004187.3| Oryza sativa (japonica cultivar-group) genomic D... 161 3e-36
7ref|NM_105471.2| Arabidopsis thaliana HPR; oxidoreductase, actin... 113 7e-22
8gb|AY113871.1| Arabidopsis thaliana putative hydroxypyruvate red... 113 7e-22
9gb|AF370221.1| Arabidopsis thaliana putative hydroxypyruvate red... 113 7e-22
10dbj|D85339.1| Arabidopsis thaliana mRNA for hydroxypyruvate redu... 113 7e-22
11gb|AY099552.1| Arabidopsis thaliana hydroxypyruvate reductase (H... 113 7e-22
12emb|BX814872.1|CNS0ABHT Arabidopsis thaliana Full-length cDNA Co... 113 7e-22
13gb|BT001237.1| Arabidopsis thaliana hydroxypyruvate reductase (H... 113 7e-22
14gb|U01067.1|PUMHPR Cucurbita pepo Halloween NADH-dependent hydro... 105 2e-19
15dbj|D49432.1| Cucurbita cv. Kurokawa Amakuri mRNA for hydroxypyr... 105 2e-19
16dbj|D49433.1| Cucurbita cv. Kurokawa Amakuri mRNA for hydroxypyr... 103 7e-19
17gb|AF503361.1| Glycine max clone P42-2 putative NADH-dependent h... 96 2e-16
18emb|X14609.1|CSNDHR Cucumis sativus mRNA for NAPH-dependent hydr... 94 7e-16
19gb|AF503360.1| Glycine max clone P42-1 putative NADH-dependent h... 90 1e-14
20dbj|AB060810.1| Bruguiera gymnorhiza HPR mRNA for hydroxypyruvat... 78 4e-11
21emb|X58542.1|CSHPRAG C.sativus hpr-A gene for NADH-dependent hyd... 76 2e-10
22gb|AC012563.7|AC012563 Arabidopsis thaliana chromosome 1 BAC T23... 52 0.002
23emb|AJ879065.1| Capsicum chinense partial mRNA for ABC transport... 44 0.55
24gb|AC009197.9| Drosophila melanogaster clone BACR14M08, complete... 42 2.2
25ref|XM_418106.1| PREDICTED: Gallus gallus similar to ets domain ... 42 2.2
26ref|XM_845102.1| PREDICTED: Canis familiaris similar to Homeobox... 42 2.2
27ref|XM_855787.1| PREDICTED: Canis familiaris similar to Homeobox... 42 2.2
28ref|XM_745604.1| Aspergillus fumigatus Af293 hypothetical protei... 42 2.2
29gb|DQ438981.1| Klebsiella oxytoca D-lactate dehydrogenase (ldhA)... 42 2.2
30gb|AC008182.2|AC008182 Drosophila melanogaster, chromosome 2L, r... 42 2.2
31gb|AC125435.8| Homo sapiens chromosome 15, clone CTD-2235H24, co... 42 2.2
32gb|AC091230.23| Homo sapiens chromosome 15, clone RP11-414J4, co... 42 2.2
33gb|AE003623.2| Drosophila melanogaster chromosome 2L, section 32... 42 2.2
34gb|AY842251.1| Chlamydomonas reinhardtii hydroxypyruvate reducta... 40 8.6
35gb|AC165229.7| Mus musculus chromosome 1, clone RP23-47K10, comp... 40 8.6
36gb|AC132905.13| Mus musculus chromosome 13, clone RP24-295E18, c... 40 8.6
37gb|AC084390.1| Mus musculus BAC clone RP23-285H9 from 1, complet... 40 8.6
38emb|AL365260.11| Human DNA sequence from clone RP11-433J22 on ch... 40 8.6
39gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome 40 8.6
40emb|AL359259.18| Human DNA sequence from clone RP11-182B22 on ch... 40 8.6
41gb|AE017159.1| Chlamydophila pneumoniae TW-183, section 3 of 4 o... 40 8.6
42emb|AL049649.7|HSJ734C18 Human DNA sequence from clone RP4-734C1... 40 8.6
43emb|Z99120.2|BSUB0017 Bacillus subtilis complete genome (section... 40 8.6
44emb|BX294146.1| Pirellula sp. strain 1 complete genome; segment ... 40 8.6
45emb|AJ223978.1|BS43KBDNA Bacillus subtilis 42.7kB DNA fragment f... 40 8.6
46emb|AL672199.16| Mouse DNA sequence from clone RP23-171O21 on ch... 40 8.6
47dbj|AP007151.1| Aspergillus oryzae RIB40 genomic DNA, SC005 40 8.6
48gb|CP000249.1| Frankia sp. CcI3, complete genome 40 8.6
49gb|AE002161.1| Chlamydophila pneumoniae AR39, complete genome 40 8.6
50gb|AC154830.2| Mus musculus BAC clone RP24-553I3 from chromosome... 40 8.6
51gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome 40 8.6
52dbj|AK053655.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN f... 40 8.6
53gb|AE001363.1| Chlamydophila pneumoniae CWL029, complete genome 40 8.6
54dbj|BA000008.3| Chlamydophila pneumoniae J138 genomic DNA, compl... 40 8.6
55emb|BX296539.5| Zebrafish DNA sequence from clone DKEYP-13E2 in ... 40 8.6

>ref|XM_463779.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1663

 Score =  632 bits (319), Expect = e-178
 Identities = 517/583 (88%)
 Strand = Plus / Plus

                                                                       
Query: 48  atggcgaagccgatatcgattgaggtgtggaacccaagcggcaagtaccgcgtggtgagc 107
           |||||||||||||||||||| ||||||||||| || ||||| ||||| ||||||||||||
Sbjct: 150 atggcgaagccgatatcgatcgaggtgtggaatccgagcggaaagtatcgcgtggtgagc 209

                                                                       
Query: 108 accaagtccatgcctggcacccgctggatcaagctcctcactgacaacgactgccgcctt 167
           |||||||||||||| |||||||||||||||   |||||| | ||||||||||||||||| 
Sbjct: 210 accaagtccatgcccggcacccgctggatccgcctcctcgccgacaacgactgccgcctc 269

                                                                       
Query: 168 gagatatgcacggagaagaagaccatcctctccgtcgacgacatcctggctctcatcggc 227
           ||||| |||||||||| ||||||||||||||| |||||||||||||| || ||||| |||
Sbjct: 270 gagatctgcacggagacgaagaccatcctctctgtcgacgacatcctcgccctcattggc 329

                                                                       
Query: 228 gatcactgccacggtgtcatcggccagctaacagaggactggggggaagtgctcttctct 287
           |||| |||| | ||||||||||||||||| || ||||| ||||| || ||||| ||||| 
Sbjct: 330 gatcgctgcgatggtgtcatcggccagctgacggaggagtggggagaggtgctgttctcg 389

                                                                       
Query: 288 gccctcaagcgcgctggtgggacagccttcagcaatatggctgtcgggtacaacaacgtt 347
           || || |||||||| || || |||||||||||||| ||||| ||||||||||||||||| 
Sbjct: 390 gcgctgaagcgcgccggcggaacagccttcagcaacatggccgtcgggtacaacaacgtc 449

                                                                       
Query: 348 gacgtcgatgctgccaacaagaacggcatcgccatcggcaacacacctggggttcttact 407
           ||||| || || ||||| | ||||||||||||| |||||||||| ||||| ||||| || 
Sbjct: 450 gacgtggaggccgccaataggaacggcatcgccgtcggcaacacgcctggcgttctgacg 509

                                                                       
Query: 408 gagacgacggcggagctggcggcgtctctgtcggtggcggctgcccggaggatcgttgag 467
           |||||||||||||||||||| |||||||||||| ||||||| || ||||||||||| |||
Sbjct: 510 gagacgacggcggagctggccgcgtctctgtcgctggcggcggcgcggaggatcgtggag 569

                                                                       
Query: 468 gccgaccaattcatgagggctggcctctacgacggatggctcccgcacctgtttgttggg 527
           || || || |||||||||||||||||||||||||||||||||||||||||||| || |||
Sbjct: 570 gcagatcagttcatgagggctggcctctacgacggatggctcccgcacctgttcgtgggg 629

                                                                       
Query: 528 aacttgctcaaggggcagaccgttggagtgattggagctggccgcatcggctcagcttat 587
           |||||||||||||| ||||| || ||||| || |||||||| || |||||||||||||| 
Sbjct: 630 aacttgctcaagggtcagactgtgggagtcatcggagctggtcgaatcggctcagcttac 689

                                                      
Query: 588 gcaaggatgatgattgagggcttcaagatgaacttgatctact 630
           ||||| |||||||| ||||||||||||||||||||||||||||
Sbjct: 690 gcaagaatgatgatcgagggcttcaagatgaacttgatctact 732



to top

>dbj|AK072105.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013119J12, full
           insert sequence
          Length = 2837

 Score =  632 bits (319), Expect = e-178
 Identities = 517/583 (88%)
 Strand = Plus / Plus

                                                                       
Query: 48  atggcgaagccgatatcgattgaggtgtggaacccaagcggcaagtaccgcgtggtgagc 107
           |||||||||||||||||||| ||||||||||| || ||||| ||||| ||||||||||||
Sbjct: 78  atggcgaagccgatatcgatcgaggtgtggaatccgagcggaaagtatcgcgtggtgagc 137

                                                                       
Query: 108 accaagtccatgcctggcacccgctggatcaagctcctcactgacaacgactgccgcctt 167
           |||||||||||||| |||||||||||||||   |||||| | ||||||||||||||||| 
Sbjct: 138 accaagtccatgcccggcacccgctggatccgcctcctcgccgacaacgactgccgcctc 197

                                                                       
Query: 168 gagatatgcacggagaagaagaccatcctctccgtcgacgacatcctggctctcatcggc 227
           ||||| |||||||||| ||||||||||||||| |||||||||||||| || ||||| |||
Sbjct: 198 gagatctgcacggagacgaagaccatcctctctgtcgacgacatcctcgccctcattggc 257

                                                                       
Query: 228 gatcactgccacggtgtcatcggccagctaacagaggactggggggaagtgctcttctct 287
           |||| |||| | ||||||||||||||||| || ||||| ||||| || ||||| ||||| 
Sbjct: 258 gatcgctgcgatggtgtcatcggccagctgacggaggagtggggagaggtgctgttctcg 317

                                                                       
Query: 288 gccctcaagcgcgctggtgggacagccttcagcaatatggctgtcgggtacaacaacgtt 347
           || || |||||||| || || |||||||||||||| ||||| ||||||||||||||||| 
Sbjct: 318 gcgctgaagcgcgccggcggaacagccttcagcaacatggccgtcgggtacaacaacgtc 377

                                                                       
Query: 348 gacgtcgatgctgccaacaagaacggcatcgccatcggcaacacacctggggttcttact 407
           ||||| || || ||||| | ||||||||||||| |||||||||| ||||| ||||| || 
Sbjct: 378 gacgtggaggccgccaataggaacggcatcgccgtcggcaacacgcctggcgttctgacg 437

                                                                       
Query: 408 gagacgacggcggagctggcggcgtctctgtcggtggcggctgcccggaggatcgttgag 467
           |||||||||||||||||||| |||||||||||| ||||||| || ||||||||||| |||
Sbjct: 438 gagacgacggcggagctggccgcgtctctgtcgctggcggcggcgcggaggatcgtggag 497

                                                                       
Query: 468 gccgaccaattcatgagggctggcctctacgacggatggctcccgcacctgtttgttggg 527
           || || || |||||||||||||||||||||||||||||||||||||||||||| || |||
Sbjct: 498 gcagatcagttcatgagggctggcctctacgacggatggctcccgcacctgttcgtgggg 557

                                                                       
Query: 528 aacttgctcaaggggcagaccgttggagtgattggagctggccgcatcggctcagcttat 587
           |||||||||||||| ||||| || ||||| || |||||||| || |||||||||||||| 
Sbjct: 558 aacttgctcaagggtcagactgtgggagtcatcggagctggtcgaatcggctcagcttac 617

                                                      
Query: 588 gcaaggatgatgattgagggcttcaagatgaacttgatctact 630
           ||||| |||||||| ||||||||||||||||||||||||||||
Sbjct: 618 gcaagaatgatgatcgagggcttcaagatgaacttgatctact 660



to top

>dbj|AK067642.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013108J23, full
           insert sequence
          Length = 1662

 Score =  632 bits (319), Expect = e-178
 Identities = 517/583 (88%)
 Strand = Plus / Plus

                                                                       
Query: 48  atggcgaagccgatatcgattgaggtgtggaacccaagcggcaagtaccgcgtggtgagc 107
           |||||||||||||||||||| ||||||||||| || ||||| ||||| ||||||||||||
Sbjct: 151 atggcgaagccgatatcgatcgaggtgtggaatccgagcggaaagtatcgcgtggtgagc 210

                                                                       
Query: 108 accaagtccatgcctggcacccgctggatcaagctcctcactgacaacgactgccgcctt 167
           |||||||||||||| |||||||||||||||   |||||| | ||||||||||||||||| 
Sbjct: 211 accaagtccatgcccggcacccgctggatccgcctcctcgccgacaacgactgccgcctc 270

                                                                       
Query: 168 gagatatgcacggagaagaagaccatcctctccgtcgacgacatcctggctctcatcggc 227
           ||||| |||||||||| ||||||||||||||| |||||||||||||| || ||||| |||
Sbjct: 271 gagatctgcacggagacgaagaccatcctctctgtcgacgacatcctcgccctcattggc 330

                                                                       
Query: 228 gatcactgccacggtgtcatcggccagctaacagaggactggggggaagtgctcttctct 287
           |||| |||| | ||||||||||||||||| || ||||| ||||| || ||||| ||||| 
Sbjct: 331 gatcgctgcgatggtgtcatcggccagctgacggaggagtggggagaggtgctgttctcg 390

                                                                       
Query: 288 gccctcaagcgcgctggtgggacagccttcagcaatatggctgtcgggtacaacaacgtt 347
           || || |||||||| || || |||||||||||||| ||||| ||||||||||||||||| 
Sbjct: 391 gcgctgaagcgcgccggcggaacagccttcagcaacatggccgtcgggtacaacaacgtc 450

                                                                       
Query: 348 gacgtcgatgctgccaacaagaacggcatcgccatcggcaacacacctggggttcttact 407
           ||||| || || ||||| | ||||||||||||| |||||||||| ||||| ||||| || 
Sbjct: 451 gacgtggaggccgccaataggaacggcatcgccgtcggcaacacgcctggcgttctgacg 510

                                                                       
Query: 408 gagacgacggcggagctggcggcgtctctgtcggtggcggctgcccggaggatcgttgag 467
           |||||||||||||||||||| |||||||||||| ||||||| || ||||||||||| |||
Sbjct: 511 gagacgacggcggagctggccgcgtctctgtcgctggcggcggcgcggaggatcgtggag 570

                                                                       
Query: 468 gccgaccaattcatgagggctggcctctacgacggatggctcccgcacctgtttgttggg 527
           || || || |||||||||||||||||||||||||||||||||||||||||||| || |||
Sbjct: 571 gcagatcagttcatgagggctggcctctacgacggatggctcccgcacctgttcgtgggg 630

                                                                       
Query: 528 aacttgctcaaggggcagaccgttggagtgattggagctggccgcatcggctcagcttat 587
           |||||||||||||| ||||| || ||||| || |||||||| || |||||||||||||| 
Sbjct: 631 aacttgctcaagggtcagactgtgggagtcatcggagctggtcgaatcggctcagcttac 690

                                                      
Query: 588 gcaaggatgatgattgagggcttcaagatgaacttgatctact 630
           ||||| |||||||| ||||||||||||||||||||||||||||
Sbjct: 691 gcaagaatgatgatcgagggcttcaagatgaacttgatctact 733



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2,
             complete sequence
          Length = 35954743

 Score =  161 bits (81), Expect = 3e-36
 Identities = 111/121 (91%)
 Strand = Plus / Minus

                                                                         
Query: 399   gttcttactgagacgacggcggagctggcggcgtctctgtcggtggcggctgcccggagg 458
             ||||| || |||||||||||||||||||| |||||||||||| ||||||| || ||||||
Sbjct: 82214 gttctgacggagacgacggcggagctggccgcgtctctgtcgctggcggcggcgcggagg 82155

                                                                         
Query: 459   atcgttgaggccgaccaattcatgagggctggcctctacgacggatggctcccgcacctg 518
             ||||| ||||| || || ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 82154 atcgtggaggcagatcagttcatgagggctggcctctacgacggatggctcccgcacctg 82095

              
Query: 519   t 519
             |
Sbjct: 82094 t 82094



 Score =  149 bits (75), Expect = 1e-32
 Identities = 108/119 (90%)
 Strand = Plus / Minus

                                                                         
Query: 48    atggcgaagccgatatcgattgaggtgtggaacccaagcggcaagtaccgcgtggtgagc 107
             |||||||||||||||||||| ||||||||||| || ||||| ||||| ||||||||||||
Sbjct: 82804 atggcgaagccgatatcgatcgaggtgtggaatccgagcggaaagtatcgcgtggtgagc 82745

                                                                        
Query: 108   accaagtccatgcctggcacccgctggatcaagctcctcactgacaacgactgccgcct 166
             |||||||||||||| |||||||||||||||   |||||| | |||||||||||||||||
Sbjct: 82744 accaagtccatgcccggcacccgctggatccgcctcctcgccgacaacgactgccgcct 82686



 Score =  113 bits (57), Expect = 7e-22
 Identities = 123/145 (84%)
 Strand = Plus / Minus

                                                                         
Query: 252   cagctaacagaggactggggggaagtgctcttctctgccctcaagcgcgctggtgggaca 311
             ||||| || ||||| ||||| || ||||| ||||| || || |||||||| || || |||
Sbjct: 82443 cagctgacggaggagtggggagaggtgctgttctcggcgctgaagcgcgccggcggaaca 82384

                                                                         
Query: 312   gccttcagcaatatggctgtcgggtacaacaacgttgacgtcgatgctgccaacaagaac 371
             ||||||||||| ||||| ||||||||||||||||| ||||| || || ||||| | ||||
Sbjct: 82383 gccttcagcaacatggccgtcgggtacaacaacgtcgacgtggaggccgccaataggaac 82324

                                      
Query: 372   ggcatcgccatcggcaacacacctg 396
             ||||||||| |||||||||| ||||
Sbjct: 82323 ggcatcgccgtcggcaacacgcctg 82299



 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 77/86 (89%)
 Strand = Plus / Minus

                                                                         
Query: 169   agatatgcacggagaagaagaccatcctctccgtcgacgacatcctggctctcatcggcg 228
             |||| |||||||||| ||||||||||||||| |||||||||||||| || ||||| ||||
Sbjct: 82594 agatctgcacggagacgaagaccatcctctctgtcgacgacatcctcgccctcattggcg 82535

                                       
Query: 229   atcactgccacggtgtcatcggccag 254
             ||| |||| | |||||||||||||||
Sbjct: 82534 atcgctgcgatggtgtcatcggccag 82509



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 66/75 (88%)
 Strand = Plus / Minus

                                                                         
Query: 525   gggaacttgctcaaggggcagaccgttggagtgattggagctggccgcatcggctcagct 584
             ||||||||||||||||| ||||| || ||||| || |||||||| || ||||||||||||
Sbjct: 81997 gggaacttgctcaagggtcagactgtgggagtcatcggagctggtcgaatcggctcagct 81938

                            
Query: 585   tatgcaaggatgatg 599
             || ||||| ||||||
Sbjct: 81937 tacgcaagaatgatg 81923



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                         
Query: 603   gagggcttcaagatgaacttgatctact 630
             ||||||||||||||||||||||||||||
Sbjct: 81800 gagggcttcaagatgaacttgatctact 81773



to top

>dbj|AP005873.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:B1370C05
          Length = 148271

 Score =  161 bits (81), Expect = 3e-36
 Identities = 111/121 (91%)
 Strand = Plus / Minus

                                                                         
Query: 399   gttcttactgagacgacggcggagctggcggcgtctctgtcggtggcggctgcccggagg 458
             ||||| || |||||||||||||||||||| |||||||||||| ||||||| || ||||||
Sbjct: 76823 gttctgacggagacgacggcggagctggccgcgtctctgtcgctggcggcggcgcggagg 76764

                                                                         
Query: 459   atcgttgaggccgaccaattcatgagggctggcctctacgacggatggctcccgcacctg 518
             ||||| ||||| || || ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 76763 atcgtggaggcagatcagttcatgagggctggcctctacgacggatggctcccgcacctg 76704

              
Query: 519   t 519
             |
Sbjct: 76703 t 76703



 Score =  149 bits (75), Expect = 1e-32
 Identities = 108/119 (90%)
 Strand = Plus / Minus

                                                                         
Query: 48    atggcgaagccgatatcgattgaggtgtggaacccaagcggcaagtaccgcgtggtgagc 107
             |||||||||||||||||||| ||||||||||| || ||||| ||||| ||||||||||||
Sbjct: 77413 atggcgaagccgatatcgatcgaggtgtggaatccgagcggaaagtatcgcgtggtgagc 77354

                                                                        
Query: 108   accaagtccatgcctggcacccgctggatcaagctcctcactgacaacgactgccgcct 166
             |||||||||||||| |||||||||||||||   |||||| | |||||||||||||||||
Sbjct: 77353 accaagtccatgcccggcacccgctggatccgcctcctcgccgacaacgactgccgcct 77295



 Score =  113 bits (57), Expect = 7e-22
 Identities = 123/145 (84%)
 Strand = Plus / Minus

                                                                         
Query: 252   cagctaacagaggactggggggaagtgctcttctctgccctcaagcgcgctggtgggaca 311
             ||||| || ||||| ||||| || ||||| ||||| || || |||||||| || || |||
Sbjct: 77052 cagctgacggaggagtggggagaggtgctgttctcggcgctgaagcgcgccggcggaaca 76993

                                                                         
Query: 312   gccttcagcaatatggctgtcgggtacaacaacgttgacgtcgatgctgccaacaagaac 371
             ||||||||||| ||||| ||||||||||||||||| ||||| || || ||||| | ||||
Sbjct: 76992 gccttcagcaacatggccgtcgggtacaacaacgtcgacgtggaggccgccaataggaac 76933

                                      
Query: 372   ggcatcgccatcggcaacacacctg 396
             ||||||||| |||||||||| ||||
Sbjct: 76932 ggcatcgccgtcggcaacacgcctg 76908



 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 77/86 (89%)
 Strand = Plus / Minus

                                                                         
Query: 169   agatatgcacggagaagaagaccatcctctccgtcgacgacatcctggctctcatcggcg 228
             |||| |||||||||| ||||||||||||||| |||||||||||||| || ||||| ||||
Sbjct: 77203 agatctgcacggagacgaagaccatcctctctgtcgacgacatcctcgccctcattggcg 77144

                                       
Query: 229   atcactgccacggtgtcatcggccag 254
             ||| |||| | |||||||||||||||
Sbjct: 77143 atcgctgcgatggtgtcatcggccag 77118



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 66/75 (88%)
 Strand = Plus / Minus

                                                                         
Query: 525   gggaacttgctcaaggggcagaccgttggagtgattggagctggccgcatcggctcagct 584
             ||||||||||||||||| ||||| || ||||| || |||||||| || ||||||||||||
Sbjct: 76606 gggaacttgctcaagggtcagactgtgggagtcatcggagctggtcgaatcggctcagct 76547

                            
Query: 585   tatgcaaggatgatg 599
             || ||||| ||||||
Sbjct: 76546 tacgcaagaatgatg 76532



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                         
Query: 603   gagggcttcaagatgaacttgatctact 630
             ||||||||||||||||||||||||||||
Sbjct: 76409 gagggcttcaagatgaacttgatctact 76382



to top

>dbj|AP004187.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1435_F07
          Length = 139041

 Score =  161 bits (81), Expect = 3e-36
 Identities = 111/121 (91%)
 Strand = Plus / Minus

                                                                         
Query: 399   gttcttactgagacgacggcggagctggcggcgtctctgtcggtggcggctgcccggagg 458
             ||||| || |||||||||||||||||||| |||||||||||| ||||||| || ||||||
Sbjct: 31241 gttctgacggagacgacggcggagctggccgcgtctctgtcgctggcggcggcgcggagg 31182

                                                                         
Query: 459   atcgttgaggccgaccaattcatgagggctggcctctacgacggatggctcccgcacctg 518
             ||||| ||||| || || ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 31181 atcgtggaggcagatcagttcatgagggctggcctctacgacggatggctcccgcacctg 31122

              
Query: 519   t 519
             |
Sbjct: 31121 t 31121



 Score =  149 bits (75), Expect = 1e-32
 Identities = 108/119 (90%)
 Strand = Plus / Minus

                                                                         
Query: 48    atggcgaagccgatatcgattgaggtgtggaacccaagcggcaagtaccgcgtggtgagc 107
             |||||||||||||||||||| ||||||||||| || ||||| ||||| ||||||||||||
Sbjct: 31831 atggcgaagccgatatcgatcgaggtgtggaatccgagcggaaagtatcgcgtggtgagc 31772

                                                                        
Query: 108   accaagtccatgcctggcacccgctggatcaagctcctcactgacaacgactgccgcct 166
             |||||||||||||| |||||||||||||||   |||||| | |||||||||||||||||
Sbjct: 31771 accaagtccatgcccggcacccgctggatccgcctcctcgccgacaacgactgccgcct 31713



 Score =  113 bits (57), Expect = 7e-22
 Identities = 123/145 (84%)
 Strand = Plus / Minus

                                                                         
Query: 252   cagctaacagaggactggggggaagtgctcttctctgccctcaagcgcgctggtgggaca 311
             ||||| || ||||| ||||| || ||||| ||||| || || |||||||| || || |||
Sbjct: 31470 cagctgacggaggagtggggagaggtgctgttctcggcgctgaagcgcgccggcggaaca 31411

                                                                         
Query: 312   gccttcagcaatatggctgtcgggtacaacaacgttgacgtcgatgctgccaacaagaac 371
             ||||||||||| ||||| ||||||||||||||||| ||||| || || ||||| | ||||
Sbjct: 31410 gccttcagcaacatggccgtcgggtacaacaacgtcgacgtggaggccgccaataggaac 31351

                                      
Query: 372   ggcatcgccatcggcaacacacctg 396
             ||||||||| |||||||||| ||||
Sbjct: 31350 ggcatcgccgtcggcaacacgcctg 31326



 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 77/86 (89%)
 Strand = Plus / Minus

                                                                         
Query: 169   agatatgcacggagaagaagaccatcctctccgtcgacgacatcctggctctcatcggcg 228
             |||| |||||||||| ||||||||||||||| |||||||||||||| || ||||| ||||
Sbjct: 31621 agatctgcacggagacgaagaccatcctctctgtcgacgacatcctcgccctcattggcg 31562

                                       
Query: 229   atcactgccacggtgtcatcggccag 254
             ||| |||| | |||||||||||||||
Sbjct: 31561 atcgctgcgatggtgtcatcggccag 31536



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 66/75 (88%)
 Strand = Plus / Minus

                                                                         
Query: 525   gggaacttgctcaaggggcagaccgttggagtgattggagctggccgcatcggctcagct 584
             ||||||||||||||||| ||||| || ||||| || |||||||| || ||||||||||||
Sbjct: 31024 gggaacttgctcaagggtcagactgtgggagtcatcggagctggtcgaatcggctcagct 30965

                            
Query: 585   tatgcaaggatgatg 599
             || ||||| ||||||
Sbjct: 30964 tacgcaagaatgatg 30950



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                         
Query: 603   gagggcttcaagatgaacttgatctact 630
             ||||||||||||||||||||||||||||
Sbjct: 30827 gagggcttcaagatgaacttgatctact 30800



to top

>ref|NM_105471.2| Arabidopsis thaliana HPR; oxidoreductase, acting on the CH-OH group
           of donors, NAD or NADP as acceptor AT1G68010 (HPR) mRNA,
           complete cds
          Length = 1494

 Score =  113 bits (57), Expect = 7e-22
 Identities = 264/333 (79%)
 Strand = Plus / Plus

                                                                       
Query: 300 gctggtgggacagccttcagcaatatggctgtcgggtacaacaacgttgacgtcgatgct 359
           ||||| |||| ||| ||||| || ||||| || || || ||||||||||| || || |||
Sbjct: 318 gctggagggaaagctttcagtaacatggccgttggttataacaacgttgatgttgaagct 377

                                                                       
Query: 360 gccaacaagaacggcatcgccatcggcaacacacctggggttcttactgagacgacggcg 419
           ||||| ||| | || || ||  |||| ||||| || || ||  | |||||||||||||| 
Sbjct: 378 gccaataagtatggaattgctgtcggtaacactccgggagtgttgactgagacgacggct 437

                                                                       
Query: 420 gagctggcggcgtctctgtcggtggcggctgcccggaggatcgttgaggccgaccaattc 479
           || || || || ||||| ||  |||| |||||  | || || ||||| |||||| |||||
Sbjct: 438 gaactagctgcttctctttccttggctgctgcaagaagaattgttgaagccgacgaattc 497

                                                                       
Query: 480 atgagggctggcctctacgacggatggctcccgcacctgtttgttgggaacttgctcaag 539
           ||||| | |||| | ||||| |||||||| || || |||||||| |||||||| || || 
Sbjct: 498 atgagaggtggcttgtacgagggatggcttcctcatctgtttgtggggaacttacttaaa 557

                                                                       
Query: 540 gggcagaccgttggagtgattggagctggccgcatcggctcagcttatgcaaggatgatg 599
           || ||||| |||||||| ||||||||||| || || || || |||||||| || ||||||
Sbjct: 558 ggacagactgttggagttattggagctggacgtattggatctgcttatgctagaatgatg 617

                                            
Query: 600 attgagggcttcaagatgaacttgatctacttt 632
            | || || ||||||||||| ||||||||||||
Sbjct: 618 gtggaagggttcaagatgaatttgatctacttt 650



to top

>gb|AY113871.1| Arabidopsis thaliana putative hydroxypyruvate reductase (At1g68010)
           mRNA, complete cds
          Length = 1192

 Score =  113 bits (57), Expect = 7e-22
 Identities = 264/333 (79%)
 Strand = Plus / Plus

                                                                       
Query: 300 gctggtgggacagccttcagcaatatggctgtcgggtacaacaacgttgacgtcgatgct 359
           ||||| |||| ||| ||||| || ||||| || || || ||||||||||| || || |||
Sbjct: 253 gctggagggaaagctttcagtaacatggccgttggttataacaacgttgatgttgaagct 312

                                                                       
Query: 360 gccaacaagaacggcatcgccatcggcaacacacctggggttcttactgagacgacggcg 419
           ||||| ||| | || || ||  |||| ||||| || || ||  | |||||||||||||| 
Sbjct: 313 gccaataagtatggaattgctgtcggtaacactccgggagtgttgactgagacgacggct 372

                                                                       
Query: 420 gagctggcggcgtctctgtcggtggcggctgcccggaggatcgttgaggccgaccaattc 479
           || || || || ||||| ||  |||| |||||  | || || ||||| |||||| |||||
Sbjct: 373 gaactagctgcttctctttccttggctgctgcaagaagaattgttgaagccgacgaattc 432

                                                                       
Query: 480 atgagggctggcctctacgacggatggctcccgcacctgtttgttgggaacttgctcaag 539
           ||||| | |||| | ||||| |||||||| || || |||||||| |||||||| || || 
Sbjct: 433 atgagaggtggcttgtacgagggatggcttcctcatctgtttgtggggaacttacttaaa 492

                                                                       
Query: 540 gggcagaccgttggagtgattggagctggccgcatcggctcagcttatgcaaggatgatg 599
           || ||||| |||||||| ||||||||||| || || || || |||||||| || ||||||
Sbjct: 493 ggacagactgttggagttattggagctggacgtattggatctgcttatgctagaatgatg 552

                                            
Query: 600 attgagggcttcaagatgaacttgatctacttt 632
            | || || ||||||||||| ||||||||||||
Sbjct: 553 gtggaagggttcaagatgaatttgatctacttt 585



to top

>gb|AF370221.1| Arabidopsis thaliana putative hydroxypyruvate reductase HPR
           (At1g68010) mRNA, complete cds
          Length = 1417

 Score =  113 bits (57), Expect = 7e-22
 Identities = 264/333 (79%)
 Strand = Plus / Plus

                                                                       
Query: 300 gctggtgggacagccttcagcaatatggctgtcgggtacaacaacgttgacgtcgatgct 359
           ||||| |||| ||| ||||| || ||||| || || || ||||||||||| || || |||
Sbjct: 318 gctggagggaaagctttcagtaacatggccgttggttataacaacgttgatgttgaagct 377

                                                                       
Query: 360 gccaacaagaacggcatcgccatcggcaacacacctggggttcttactgagacgacggcg 419
           ||||| ||| | || || ||  |||| ||||| || || ||  | |||||||||||||| 
Sbjct: 378 gccaataagtatggaattgctgtcggtaacactccgggagtgttgactgagacgacggct 437

                                                                       
Query: 420 gagctggcggcgtctctgtcggtggcggctgcccggaggatcgttgaggccgaccaattc 479
           || || || || ||||| ||  |||| |||||  | || || ||||| |||||| |||||
Sbjct: 438 gaactagctgcttctctttccttggctgctgcaagaagaattgttgaagccgacgaattc 497

                                                                       
Query: 480 atgagggctggcctctacgacggatggctcccgcacctgtttgttgggaacttgctcaag 539
           ||||| | |||| | ||||| |||||||| || || |||||||| |||||||| || || 
Sbjct: 498 atgagaggtggcttgtacgagggatggcttcctcatctgtttgtggggaacttacttaaa 557

                                                                       
Query: 540 gggcagaccgttggagtgattggagctggccgcatcggctcagcttatgcaaggatgatg 599
           || ||||| |||||||| ||||||||||| || || || || |||||||| || ||||||
Sbjct: 558 ggacagactgttggagttattggagctggacgtattggatctgcttatgctagaatgatg 617

                                            
Query: 600 attgagggcttcaagatgaacttgatctacttt 632
            | || || ||||||||||| ||||||||||||
Sbjct: 618 gtggaagggttcaagatgaatttgatctacttt 650



to top

>dbj|D85339.1| Arabidopsis thaliana mRNA for hydroxypyruvate reductase, complete
           cds
          Length = 1428

 Score =  113 bits (57), Expect = 7e-22
 Identities = 264/333 (79%)
 Strand = Plus / Plus

                                                                       
Query: 300 gctggtgggacagccttcagcaatatggctgtcgggtacaacaacgttgacgtcgatgct 359
           ||||| |||| ||| ||||| || ||||| || || || ||||||||||| || || |||
Sbjct: 333 gctggagggaaagctttcagtaacatggccgttggttataacaacgttgatgttgaagct 392

                                                                       
Query: 360 gccaacaagaacggcatcgccatcggcaacacacctggggttcttactgagacgacggcg 419
           ||||| ||| | || || ||  |||| ||||| || || ||  | |||||||||||||| 
Sbjct: 393 gccaataagtatggaattgctgtcggtaacactccgggagtgttgactgagacgacggct 452

                                                                       
Query: 420 gagctggcggcgtctctgtcggtggcggctgcccggaggatcgttgaggccgaccaattc 479
           || || || || ||||| ||  |||| |||||  | || || ||||| |||||| |||||
Sbjct: 453 gaactagctgcttctctttccttggctgctgcaagaagaattgttgaagccgacgaattc 512

                                                                       
Query: 480 atgagggctggcctctacgacggatggctcccgcacctgtttgttgggaacttgctcaag 539
           ||||| | |||| | ||||| |||||||| || || |||||||| |||||||| || || 
Sbjct: 513 atgagaggtggcttgtacgagggatggcttcctcatctgtttgtggggaacttacttaaa 572

                                                                       
Query: 540 gggcagaccgttggagtgattggagctggccgcatcggctcagcttatgcaaggatgatg 599
           || ||||| |||||||| ||||||||||| || || || || |||||||| || ||||||
Sbjct: 573 ggacagactgttggagttattggagctggacgtattggatctgcttatgctagaatgatg 632

                                            
Query: 600 attgagggcttcaagatgaacttgatctacttt 632
            | || || ||||||||||| ||||||||||||
Sbjct: 633 gtggaagggttcaagatgaatttgatctacttt 665



to top

>gb|AY099552.1| Arabidopsis thaliana hydroxypyruvate reductase (HPR) (At1g68010)
           mRNA, complete cds
          Length = 1376

 Score =  113 bits (57), Expect = 7e-22
 Identities = 264/333 (79%)
 Strand = Plus / Plus

                                                                       
Query: 300 gctggtgggacagccttcagcaatatggctgtcgggtacaacaacgttgacgtcgatgct 359
           ||||| |||| ||| ||||| || ||||| || || || ||||||||||| || || |||
Sbjct: 310 gctggagggaaagctttcagtaacatggccgttggttataacaacgttgatgttgaagct 369

                                                                       
Query: 360 gccaacaagaacggcatcgccatcggcaacacacctggggttcttactgagacgacggcg 419
           ||||| ||| | || || ||  |||| ||||| || || ||  | |||||||||||||| 
Sbjct: 370 gccaataagtatggaattgctgtcggtaacactccgggagtgttgactgagacgacggct 429

                                                                       
Query: 420 gagctggcggcgtctctgtcggtggcggctgcccggaggatcgttgaggccgaccaattc 479
           || || || || ||||| ||  |||| |||||  | || || ||||| |||||| |||||
Sbjct: 430 gaactagctgcttctctttccttggctgctgcaagaagaattgttgaagccgacgaattc 489

                                                                       
Query: 480 atgagggctggcctctacgacggatggctcccgcacctgtttgttgggaacttgctcaag 539
           ||||| | |||| | ||||| |||||||| || || |||||||| |||||||| || || 
Sbjct: 490 atgagaggtggcttgtacgagggatggcttcctcatctgtttgtggggaacttacttaaa 549

                                                                       
Query: 540 gggcagaccgttggagtgattggagctggccgcatcggctcagcttatgcaaggatgatg 599
           || ||||| |||||||| ||||||||||| || || || || |||||||| || ||||||
Sbjct: 550 ggacagactgttggagttattggagctggacgtattggatctgcttatgctagaatgatg 609

                                            
Query: 600 attgagggcttcaagatgaacttgatctacttt 632
            | || || ||||||||||| ||||||||||||
Sbjct: 610 gtggaagggttcaagatgaatttgatctacttt 642



to top

>emb|BX814872.1|CNS0ABHT Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS14ZG09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1321

 Score =  113 bits (57), Expect = 7e-22
 Identities = 264/333 (79%)
 Strand = Plus / Plus

                                                                       
Query: 300 gctggtgggacagccttcagcaatatggctgtcgggtacaacaacgttgacgtcgatgct 359
           ||||| |||| ||| ||||| || ||||| || || || ||||||||||| || || |||
Sbjct: 283 gctggagggaaagctttcagtaacatggccgttggttataacaacgttgatgttgaagct 342

                                                                       
Query: 360 gccaacaagaacggcatcgccatcggcaacacacctggggttcttactgagacgacggcg 419
           ||||| ||| | || || ||  |||| ||||| || || ||  | |||||||||||||| 
Sbjct: 343 gccaataagtatggaattgctgtcggtaacactccgggagtgttgactgagacgacggct 402

                                                                       
Query: 420 gagctggcggcgtctctgtcggtggcggctgcccggaggatcgttgaggccgaccaattc 479
           || || || || ||||| ||  |||| |||||  | || || ||||| |||||| |||||
Sbjct: 403 gaactagctgcttctctttccttggctgctgcaagaagaattgttgaagccgacgaattc 462

                                                                       
Query: 480 atgagggctggcctctacgacggatggctcccgcacctgtttgttgggaacttgctcaag 539
           ||||| | |||| | ||||| |||||||| || || |||||||| |||||||| || || 
Sbjct: 463 atgagaggtggcttgtacgagggatggcttcctcatctgtttgtggggaacttacttaaa 522

                                                                       
Query: 540 gggcagaccgttggagtgattggagctggccgcatcggctcagcttatgcaaggatgatg 599
           || ||||| |||||||| ||||||||||| || || || || |||||||| || ||||||
Sbjct: 523 ggacagactgttggagttattggagctggacgtattggatctgcttatgctagaatgatg 582

                                            
Query: 600 attgagggcttcaagatgaacttgatctacttt 632
            | || || ||||||||||| ||||||||||||
Sbjct: 583 gtggaagggttcaagatgaatttgatctacttt 615



to top

>gb|BT001237.1| Arabidopsis thaliana hydroxypyruvate reductase (HPR) (At1g68010)
           mRNA, complete cds
          Length = 1194

 Score =  113 bits (57), Expect = 7e-22
 Identities = 264/333 (79%)
 Strand = Plus / Plus

                                                                       
Query: 300 gctggtgggacagccttcagcaatatggctgtcgggtacaacaacgttgacgtcgatgct 359
           ||||| |||| ||| ||||| || ||||| || || || ||||||||||| || || |||
Sbjct: 253 gctggagggaaagctttcagtaacatggccgttggttataacaacgttgatgttgaagct 312

                                                                       
Query: 360 gccaacaagaacggcatcgccatcggcaacacacctggggttcttactgagacgacggcg 419
           ||||| ||| | || || ||  |||| ||||| || || ||  | |||||||||||||| 
Sbjct: 313 gccaataagtatggaattgctgtcggtaacactccgggagtgttgactgagacgacggct 372

                                                                       
Query: 420 gagctggcggcgtctctgtcggtggcggctgcccggaggatcgttgaggccgaccaattc 479
           || || || || ||||| ||  |||| |||||  | || || ||||| |||||| |||||
Sbjct: 373 gaactagctgcttctctttccttggctgctgcaagaagaattgttgaagccgacgaattc 432

                                                                       
Query: 480 atgagggctggcctctacgacggatggctcccgcacctgtttgttgggaacttgctcaag 539
           ||||| | |||| | ||||| |||||||| || || |||||||| |||||||| || || 
Sbjct: 433 atgagaggtggcttgtacgagggatggcttcctcatctgtttgtggggaacttacttaaa 492

                                                                       
Query: 540 gggcagaccgttggagtgattggagctggccgcatcggctcagcttatgcaaggatgatg 599
           || ||||| |||||||| ||||||||||| || || || || |||||||| || ||||||
Sbjct: 493 ggacagactgttggagttattggagctggacgtattggatctgcttatgctagaatgatg 552

                                            
Query: 600 attgagggcttcaagatgaacttgatctacttt 632
            | || || ||||||||||| ||||||||||||
Sbjct: 553 gtggaagggttcaagatgaatttgatctacttt 585



to top

>gb|U01067.1|PUMHPR Cucurbita pepo Halloween NADH-dependent hydroxypyruvate reductase
           mRNA, partial cds
          Length = 815

 Score =  105 bits (53), Expect = 2e-19
 Identities = 146/177 (82%)
 Strand = Plus / Plus

                                                                       
Query: 456 aggatcgttgaggccgaccaattcatgagggctggcctctacgacggatggctcccgcac 515
           ||||||||||| || ||| | ||||||||||| |||| ||| || |||||||| ||  | 
Sbjct: 312 aggatcgttgaagctgacgagttcatgagggcaggccgctatgatggatggcttccaaat 371

                                                                       
Query: 516 ctgtttgttgggaacttgctcaaggggcagaccgttggagtgattggagctggccgcatc 575
            |||||||||| |||||||| || || ||||| ||||| |||||||||||||| || || 
Sbjct: 372 ttgtttgttggaaacttgctgaaaggccagactgttggtgtgattggagctggtcgtatt 431

                                                                    
Query: 576 ggctcagcttatgcaaggatgatgattgagggcttcaagatgaacttgatctacttt 632
           || || ||||||||||| |||||| | || || || ||||||||| |||||||||||
Sbjct: 432 ggatctgcttatgcaagaatgatggtagaagggtttaagatgaacctgatctacttt 488



to top

>dbj|D49432.1| Cucurbita cv. Kurokawa Amakuri mRNA for hydroxypyruvate reductase,
           complete cds
          Length = 1269

 Score =  105 bits (53), Expect = 2e-19
 Identities = 146/177 (82%)
 Strand = Plus / Plus

                                                                       
Query: 456 aggatcgttgaggccgaccaattcatgagggctggcctctacgacggatggctcccgcac 515
           ||||||||||| || ||| | ||||||||||| |||| ||| || |||||||| ||  | 
Sbjct: 439 aggatcgttgaagctgacgagttcatgagggcaggccactatgatggatggcttccaaat 498

                                                                       
Query: 516 ctgtttgttgggaacttgctcaaggggcagaccgttggagtgattggagctggccgcatc 575
            |||||||||| |||||||| || || ||||| ||||| |||||||||||||| || || 
Sbjct: 499 ttgtttgttggaaacttgctgaaaggccagactgttggtgtgattggagctggtcgtatt 558

                                                                    
Query: 576 ggctcagcttatgcaaggatgatgattgagggcttcaagatgaacttgatctacttt 632
           || || ||||||||||| |||||| | || || || ||||||||| |||||||||||
Sbjct: 559 ggatctgcttatgcaagaatgatggtagaagggtttaagatgaacctgatctacttt 615



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 102 gtgagcaccaagtccatgcctggcacccgctggatcaa 139
           |||||||||||| | |||||||| || |||||||||||
Sbjct: 85  gtgagcaccaagcctatgcctggaactcgctggatcaa 122



to top

>dbj|D49433.1| Cucurbita cv. Kurokawa Amakuri mRNA for hydroxypyruvate reductase,
           complete cds
          Length = 1362

 Score =  103 bits (52), Expect = 7e-19
 Identities = 145/176 (82%)
 Strand = Plus / Plus

                                                                       
Query: 456 aggatcgttgaggccgaccaattcatgagggctggcctctacgacggatggctcccgcac 515
           ||||||||||| || ||| | ||||||||||| |||| ||| || |||||||| ||  | 
Sbjct: 439 aggatcgttgaagctgacgagttcatgagggcaggccactatgatggatggcttccaaat 498

                                                                       
Query: 516 ctgtttgttgggaacttgctcaaggggcagaccgttggagtgattggagctggccgcatc 575
            |||||||||| |||||||| || || ||||| ||||| |||||||||||||| || || 
Sbjct: 499 ttgtttgttggaaacttgctgaaaggccagactgttggtgtgattggagctggtcgtatt 558

                                                                   
Query: 576 ggctcagcttatgcaaggatgatgattgagggcttcaagatgaacttgatctactt 631
           || || ||||||||||| |||||| | || || || ||||||||| ||||||||||
Sbjct: 559 ggatctgcttatgcaagaatgatggtagaagggtttaagatgaacctgatctactt 614



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 102 gtgagcaccaagtccatgcctggcacccgctggatcaa 139
           |||||||||||| | |||||||| || |||||||||||
Sbjct: 85  gtgagcaccaagcctatgcctggaactcgctggatcaa 122



to top

>gb|AF503361.1| Glycine max clone P42-2 putative NADH-dependent hydroxypyruvate
           reductase mRNA, complete cds
          Length = 1414

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 102/120 (85%)
 Strand = Plus / Plus

                                                                       
Query: 501 ggatggctcccgcacctgtttgttgggaacttgctcaaggggcagaccgttggagtgatt 560
           |||||||| || || || |||||||| ||||||||||||||||| || ||||| || |||
Sbjct: 496 ggatggctacctcatctatttgttggaaacttgctcaaggggcaaacagttggtgtaatt 555

                                                                       
Query: 561 ggagctggccgcatcggctcagcttatgcaaggatgatgattgagggcttcaagatgaac 620
           |||||||| || || || || ||||||||||| |||||| |||| || ||||||||||||
Sbjct: 556 ggagctggtcgaattggatctgcttatgcaagaatgatggttgaagggttcaagatgaac 615



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 61/74 (82%)
 Strand = Plus / Plus

                                                                       
Query: 66  attgaggtgtggaacccaagcggcaagtaccgcgtggtgagcaccaagtccatgcctggc 125
           |||||||| ||||||||||| ||||| ||| | || || ||||||||  | |||||||| 
Sbjct: 61  attgaggtatggaacccaagtggcaaatacagagttgtcagcaccaaaccaatgcctgga 120

                         
Query: 126 acccgctggatcaa 139
           || || ||||||||
Sbjct: 121 actcgttggatcaa 134



to top

>emb|X14609.1|CSNDHR Cucumis sativus mRNA for NAPH-dependent hydroxypyruvate reductase
           (EC 1.1.1.29)
          Length = 1437

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 98/115 (85%)
 Strand = Plus / Plus

                                                                       
Query: 517 tgtttgttgggaacttgctcaaggggcagaccgttggagtgattggagctggccgcatcg 576
           ||||||||||||||||||| || || ||||| ||||| |||||||||||||| || || |
Sbjct: 510 tgtttgttgggaacttgctgaaaggacagactgttggtgtgattggagctggtcgtattg 569

                                                                  
Query: 577 gctcagcttatgcaaggatgatgattgagggcttcaagatgaacttgatctactt 631
           | || ||||||||||| |||||| | || || || ||||||||| ||||||||||
Sbjct: 570 gatctgcttatgcaagaatgatggtagaagggtttaagatgaacctgatctactt 624



to top

>gb|AF503360.1| Glycine max clone P42-1 putative NADH-dependent hydroxypyruvate
           reductase mRNA, complete cds
          Length = 1492

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 135/165 (81%)
 Strand = Plus / Plus

                                                                       
Query: 456 aggatcgttgaggccgaccaattcatgagggctggcctctacgacggatggctcccgcac 515
           ||||| |||||||| ||  | ||||||||||| ||  | || || |||||||| || || 
Sbjct: 453 aggatagttgaggcagatgagttcatgagggcaggattatatgatggatggctacctcat 512

                                                                       
Query: 516 ctgtttgttgggaacttgctcaaggggcagaccgttggagtgattggagctggccgcatc 575
           || |||||||| |||||||||||||| || || ||||| || ||||||||||| || || 
Sbjct: 513 ctatttgttggaaacttgctcaagggacaaactgttggtgtaattggagctggtcgaatt 572

                                                        
Query: 576 ggctcagcttatgcaaggatgatgattgagggcttcaagatgaac 620
           || || ||||||||||| |||||| |||| || ||||||||||||
Sbjct: 573 ggatccgcttatgcaagaatgatggttgaagggttcaagatgaac 617



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 61/74 (82%)
 Strand = Plus / Plus

                                                                       
Query: 66  attgaggtgtggaacccaagcggcaagtaccgcgtggtgagcaccaagtccatgcctggc 125
           |||||||| ||||||||||| ||||| ||| | || || ||||||||  | |||||||| 
Sbjct: 63  attgaggtatggaacccaagtggcaaatacagagttgttagcaccaaaccaatgcctgga 122

                         
Query: 126 acccgctggatcaa 139
           || || ||||||||
Sbjct: 123 actcgttggatcaa 136



to top

>dbj|AB060810.1| Bruguiera gymnorhiza HPR mRNA for hydroxypyruvate reductase,
           complete cds
          Length = 1576

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 117/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 477 ttcatgagggctggcctctacgacggatggctcccgcacctgtttgttgggaacttgctc 536
           ||||||||||| ||| | || || |||||||||||  |  |||||||||| |||||||||
Sbjct: 464 ttcatgagggcaggcttatatgatggatggctccctaatttgtttgttggaaacttgctc 523

                                                                       
Query: 537 aaggggcagaccgttggagtgattggagctggccgcatcggctcagcttatgcaaggatg 596
           || || ||||| ||||| || ||||||||||| || || || || |||||||| || |||
Sbjct: 524 aaaggacagactgttggtgtcattggagctggtcgtattggatctgcttatgctagaatg 583

                                  
Query: 597 atgattgagggcttcaagatgaa 619
           ||| |||| || ||||| |||||
Sbjct: 584 atggttgaagggttcaaaatgaa 606



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 75  tggaacccaagcggcaagtaccgcgtggtgagcaccaagtccatgcctggcacccgctgg 134
           ||||||||||| || | |||| | || || ||||||||  ||||||| || |||||||||
Sbjct: 62  tggaacccaagaggaaggtacagagtagttagcaccaaacccatgcccggaacccgctgg 121

                
Query: 135 atcaa 139
           |||||
Sbjct: 122 atcaa 126



to top

>emb|X58542.1|CSHPRAG C.sativus hpr-A gene for NADH-dependent hydroxypyruvate reductase
          Length = 6740

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 71/82 (86%)
 Strand = Plus / Plus

                                                                        
Query: 518  gtttgttgggaacttgctcaaggggcagaccgttggagtgattggagctggccgcatcgg 577
            |||||||||||||||||| || || ||||| ||||| |||||||||||||| || || ||
Sbjct: 3179 gtttgttgggaacttgctgaaaggacagactgttggtgtgattggagctggtcgtattgg 3238

                                  
Query: 578  ctcagcttatgcaaggatgatg 599
             || ||||||||||| ||||||
Sbjct: 3239 atctgcttatgcaagaatgatg 3260



to top

>gb|AC012563.7|AC012563 Arabidopsis thaliana chromosome 1 BAC T23K23 genomic sequence, complete
             sequence
          Length = 101966

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 68/82 (82%)
 Strand = Plus / Minus

                                                                         
Query: 518   gtttgttgggaacttgctcaaggggcagaccgttggagtgattggagctggccgcatcgg 577
             |||||| |||||||| || || || ||||| |||||||| ||||||||||| || || ||
Sbjct: 50138 gtttgtggggaacttacttaaaggacagactgttggagttattggagctggacgtattgg 50079

                                   
Query: 578   ctcagcttatgcaaggatgatg 599
              || |||||||| || ||||||
Sbjct: 50078 atctgcttatgctagaatgatg 50057



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 83/104 (79%)
 Strand = Plus / Minus

                                                                         
Query: 405   actgagacgacggcggagctggcggcgtctctgtcggtggcggctgcccggaggatcgtt 464
             |||||||||||||| || || || || ||||| ||  |||| |||||  | || || |||
Sbjct: 50343 actgagacgacggctgaactagctgcttctctttccttggctgctgcaagaagaattgtt 50284

                                                         
Query: 465   gaggccgaccaattcatgagggctggcctctacgacggatggct 508
             || |||||| |||||||||| | |||| | ||||| ||||||||
Sbjct: 50283 gaagccgacgaattcatgagaggtggcttgtacgagggatggct 50240



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 609   ttcaagatgaacttgatctacttt 632
             ||||||||||| ||||||||||||
Sbjct: 49958 ttcaagatgaatttgatctacttt 49935



to top

>emb|AJ879065.1| Capsicum chinense partial mRNA for ABC transporter protein
          Length = 848

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 12  tcccctccttgcagctgctgcc 33
           ||||||||||||||||||||||
Sbjct: 164 tcccctccttgcagctgctgcc 143



to top

>gb|AC009197.9| Drosophila melanogaster clone BACR14M08, complete sequence
          Length = 170053

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 540   gggcagaccgttggagtgattggagctgg 568
             |||||||| |||||||| |||||||||||
Sbjct: 40478 gggcagacagttggagtcattggagctgg 40450



to top

>ref|XM_418106.1| PREDICTED: Gallus gallus similar to ets domain protein (LOC419983),
           mRNA
          Length = 2681

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 22  gcagctgctgcccgcctgctc 42
           |||||||||||||||||||||
Sbjct: 580 gcagctgctgcccgcctgctc 560



to top

>ref|XM_845102.1| PREDICTED: Canis familiaris similar to Homeobox protein DLX-2,
           transcript variant 1 (LOC607779), mRNA
          Length = 1005

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 417 gcggagctggcggcgtctctg 437
           |||||||||||||||||||||
Sbjct: 559 gcggagctggcggcgtctctg 579



to top

>ref|XM_855787.1| PREDICTED: Canis familiaris similar to Homeobox protein DLX-2,
           transcript variant 2 (LOC607779), mRNA
          Length = 939

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 417 gcggagctggcggcgtctctg 437
           |||||||||||||||||||||
Sbjct: 493 gcggagctggcggcgtctctg 513



to top

>ref|XM_745604.1| Aspergillus fumigatus Af293 hypothetical protein (Afu6g08060)
           partial mRNA
          Length = 231

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 194 cctctccgtcgacgacatcct 214
           |||||||||||||||||||||
Sbjct: 152 cctctccgtcgacgacatcct 172



to top

>gb|DQ438981.1| Klebsiella oxytoca D-lactate dehydrogenase (ldhA) gene, complete
           cds
          Length = 990

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 332 cgggtacaacaacgttgacgtcgatgctgccaa 364
           ||||| ||||||||||||| ||||||| |||||
Sbjct: 231 cgggttcaacaacgttgacctcgatgccgccaa 263



to top

>gb|AC008182.2|AC008182 Drosophila melanogaster, chromosome 2L, region 29F6-30A4, BAC clone
             BACR48E15, complete sequence
          Length = 192350

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 540   gggcagaccgttggagtgattggagctgg 568
             |||||||| |||||||| |||||||||||
Sbjct: 69634 gggcagacagttggagtcattggagctgg 69662



to top

>gb|AC125435.8| Homo sapiens chromosome 15, clone CTD-2235H24, complete sequence
          Length = 124255

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 68    tgaggtgtggaacccaagcgg 88
             |||||||||||||||||||||
Sbjct: 97940 tgaggtgtggaacccaagcgg 97960



to top

>gb|AC091230.23| Homo sapiens chromosome 15, clone RP11-414J4, complete sequence
          Length = 206482

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 68    tgaggtgtggaacccaagcgg 88
             |||||||||||||||||||||
Sbjct: 17788 tgaggtgtggaacccaagcgg 17808



to top

>gb|AE003623.2| Drosophila melanogaster chromosome 2L, section 32 of 83 of the complete
              sequence
          Length = 234635

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 540    gggcagaccgttggagtgattggagctgg 568
              |||||||| |||||||| |||||||||||
Sbjct: 168712 gggcagacagttggagtcattggagctgg 168684



to top

>gb|AY842251.1| Chlamydomonas reinhardtii hydroxypyruvate reductase mRNA, partial
           cds
          Length = 931

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 408 gagacgacggcggagctggc 427
           ||||||||||||||||||||
Sbjct: 226 gagacgacggcggagctggc 245



to top

>gb|AC165229.7| Mus musculus chromosome 1, clone RP23-47K10, complete sequence
          Length = 218929

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 265   actggggggaagtgctcttc 284
             ||||||||||||||||||||
Sbjct: 84787 actggggggaagtgctcttc 84806



to top

>gb|AC132905.13| Mus musculus chromosome 13, clone RP24-295E18, complete sequence
          Length = 187116

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 611   caagatgaacttgatctact 630
             ||||||||||||||||||||
Sbjct: 23773 caagatgaacttgatctact 23754



to top

>gb|AC084390.1| Mus musculus BAC clone RP23-285H9 from 1, complete sequence
          Length = 177050

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 520   ttgttgggaacttgctcaag 539
             ||||||||||||||||||||
Sbjct: 58964 ttgttgggaacttgctcaag 58983



to top

>emb|AL365260.11| Human DNA sequence from clone RP11-433J22 on chromosome 1 Contains the
             GJA5 gene for gap junction protein, alpha 5, 40kDa
             (connexin 40) protein, complete sequence
          Length = 114412

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     cttgtttgtttcccctcctt 21
             ||||||||||||||||||||
Sbjct: 82001 cttgtttgtttcccctcctt 81982



to top

>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome
          Length = 4892717

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 85      gcggcaagtaccgcgtggtg 104
               ||||||||||||||||||||
Sbjct: 2725274 gcggcaagtaccgcgtggtg 2725293



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 24      agctgctgcccgcctgctccagat 47
               |||||||||||||||| |||||||
Sbjct: 2144193 agctgctgcccgcctgatccagat 2144170



to top

>emb|AL359259.18| Human DNA sequence from clone RP11-182B22 on chromosome 1 Contains the 3'
              end of the MTR gene for
              5-methyltetrahydrofolate-homocysteine methyltransferase, a
              novel gene (LOC149448), a ribosomal protein L35 (RPL35)
              pseudogene, and a novel gene similar to metallothionein 1H
              (MT1H), complete sequence
          Length = 172753

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 583    cttatgcaaggatgatgatt 602
              ||||||||||||||||||||
Sbjct: 105015 cttatgcaaggatgatgatt 105034



to top

>gb|AE017159.1| Chlamydophila pneumoniae TW-183, section 3 of 4 of the complete genome
          Length = 300066

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 181    agaagaagaccatcctctcc 200
              ||||||||||||||||||||
Sbjct: 262535 agaagaagaccatcctctcc 262516



to top

>emb|AL049649.7|HSJ734C18 Human DNA sequence from clone RP4-734C18 on chromosome 20 Contains a
              putative novel gene, ESTs, STSs, GSSs and genomic marker
              D20S6, complete sequence
          Length = 135636

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 384    ggcaacacacctggggttct 403
              ||||||||||||||||||||
Sbjct: 124976 ggcaacacacctggggttct 124957



to top

>emb|Z99120.2|BSUB0017 Bacillus subtilis complete genome (section 17 of 21): from 3213330 to
              3414388
          Length = 201059

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 607    gcttcaagatgaacttgatc 626
              ||||||||||||||||||||
Sbjct: 200468 gcttcaagatgaacttgatc 200449



to top

>emb|BX294146.1| Pirellula sp. strain 1 complete genome; segment 14/24
          Length = 324450

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 371    cggcatcgccatcggcaaca 390
              ||||||||||||||||||||
Sbjct: 150262 cggcatcgccatcggcaaca 150281



to top

>emb|AJ223978.1|BS43KBDNA Bacillus subtilis 42.7kB DNA fragment from yvsA to yvqA
          Length = 42782

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 607   gcttcaagatgaacttgatc 626
             ||||||||||||||||||||
Sbjct: 13458 gcttcaagatgaacttgatc 13477



to top

>emb|AL672199.16| Mouse DNA sequence from clone RP23-171O21 on chromosome 11 Contains the
             Srcasm gene for Src activating and signaling molecule and
             the 3' end of a novel gene, complete sequence
          Length = 150260

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 14    ccctccttgcagctgctgcc 33
             ||||||||||||||||||||
Sbjct: 25755 ccctccttgcagctgctgcc 25774



to top

>dbj|AP007151.1| Aspergillus oryzae RIB40 genomic DNA, SC005
          Length = 4429080

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 134    gatcaagctcctcactgaca 153
              ||||||||||||||||||||
Sbjct: 695112 gatcaagctcctcactgaca 695131



to top

>gb|CP000249.1| Frankia sp. CcI3, complete genome
          Length = 5433628

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 408     gagacgacggcggagctggc 427
               ||||||||||||||||||||
Sbjct: 3006119 gagacgacggcggagctggc 3006138



to top

>gb|AE002161.1| Chlamydophila pneumoniae AR39, complete genome
          Length = 1229853

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 181     agaagaagaccatcctctcc 200
               ||||||||||||||||||||
Sbjct: 1205047 agaagaagaccatcctctcc 1205066



to top

>gb|AC154830.2| Mus musculus BAC clone RP24-553I3 from chromosome 13, complete sequence
          Length = 178942

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 611   caagatgaacttgatctact 630
             ||||||||||||||||||||
Sbjct: 20960 caagatgaacttgatctact 20979



to top

>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome
          Length = 5331656

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 85      gcggcaagtaccgcgtggtg 104
               ||||||||||||||||||||
Sbjct: 3428298 gcggcaagtaccgcgtggtg 3428279



to top

>dbj|AK053655.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN full-length enriched
            library, clone:E130119A05 product:macrophage stimulating
            1 receptor (c-met-related tyrosine kinase), full insert
            sequence
          Length = 4719

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 207  gacatcctggctctcatcgg 226
            ||||||||||||||||||||
Sbjct: 3625 gacatcctggctctcatcgg 3644



to top

>gb|AE001363.1| Chlamydophila pneumoniae CWL029, complete genome
          Length = 1230230

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 181    agaagaagaccatcctctcc 200
              ||||||||||||||||||||
Sbjct: 866396 agaagaagaccatcctctcc 866377



to top

>dbj|BA000008.3| Chlamydophila pneumoniae J138 genomic DNA, complete sequence
          Length = 1226565

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 181    agaagaagaccatcctctcc 200
              ||||||||||||||||||||
Sbjct: 865717 agaagaagaccatcctctcc 865698



to top

>emb|BX296539.5| Zebrafish DNA sequence from clone DKEYP-13E2 in linkage group 15,
             complete sequence
          Length = 135623

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 72    gtgtggaacccaagcggcaa 91
             ||||||||||||||||||||
Sbjct: 42030 gtgtggaacccaagcggcaa 42011


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,691,827
Number of Sequences: 3902068
Number of extensions: 4691827
Number of successful extensions: 77869
Number of sequences better than 10.0: 55
Number of HSP's better than 10.0 without gapping: 55
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 77439
Number of HSP's gapped (non-prelim): 420
length of query: 632
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 609
effective length of database: 17,143,297,704
effective search space: 10440268301736
effective search space used: 10440268301736
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top