ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bah63b10
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AY596553.1| Saccharum officinarum clone SCUTLR1058C02, comple... 232 1e-57
2dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 198 1e-47
3gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 198 1e-47
4emb|AL928749.4|CNS08CBM Oryza sativa chromosome 12, . BAC OSJNBa... 198 1e-47
5dbj|AK071188.1| Oryza sativa (japonica cultivar-group) cDNA clon... 186 6e-44
6gb|AY105327.1| Zea mays PCO147247 mRNA sequence 184 2e-43
7dbj|AK059556.1| Oryza sativa (japonica cultivar-group) cDNA clon... 147 5e-32
8gb|AY570979.1| Xerophyta humilis clone HC437 unknown mRNA 64 5e-07
9dbj|AK111215.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 3e-05
10ref|NM_124894.4| Arabidopsis thaliana unknown protein AT5G55120 ... 54 5e-04
11gb|AY091285.1| Arabidopsis thaliana unknown protein (At5g55120) ... 54 5e-04
12gb|AY063788.1| Arabidopsis thaliana unknown protein (At5g55120) ... 54 5e-04
13dbj|AB010071.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 54 5e-04
14emb|BX831350.1|CNS0A1O4 Arabidopsis thaliana Full-length cDNA Co... 52 0.002
15emb|BX829969.1|CNS0A043 Arabidopsis thaliana Full-length cDNA Co... 52 0.002
16emb|BX831865.1|CNS09ZT1 Arabidopsis thaliana Full-length cDNA Co... 52 0.002
17emb|BX831807.1|CNS09ZUD Arabidopsis thaliana Full-length cDNA Co... 52 0.002
18emb|BX830641.1|CNS09ZZY Arabidopsis thaliana Full-length cDNA Co... 52 0.002
19emb|CT573504.2| Medicago truncatula chromosome 5 clone mth2-178o... 52 0.002
20gb|AY489190.1| Capsicum annuum putative At4g26850-like protein ... 48 0.033
21gb|BT013858.1| Lycopersicon esculentum clone 132824R, mRNA sequence 46 0.13
22gb|CP000252.1| Syntrophus aciditrophicus SB, complete genome 44 0.51
23ref|XM_546598.2| PREDICTED: Canis familiaris similar to 1-beta d... 42 2.0
24gb|AC150683.3| Mus musculus BAC clone RP23-435E16 from chromosom... 42 2.0
25dbj|AK154942.1| Mus musculus NOD-derived CD11c +ve dendritic cel... 42 2.0
26gb|AC158637.3| Mus musculus 10 BAC RP24-79K22 (Roswell Park Canc... 42 2.0
27gb|AC153536.3| Mus musculus 10 BAC RP23-402F24 (Roswell Park Can... 42 2.0
28emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,comp... 42 2.0
29emb|CT030651.6| Mouse DNA sequence from clone RP23-229N10 on chr... 42 2.0
30emb|CT030686.6| Mouse DNA sequence from clone RP23-136C5 on chro... 42 2.0
31gb|AC135634.4| Mus musculus BAC clone RP23-121I20 from 9, comple... 42 2.0
32emb|CT030710.7| Mouse DNA sequence from clone RP23-386A10 on chr... 42 2.0
33gb|AC154126.2| Mus musculus BAC clone RP23-471O11 from chromosom... 42 2.0
34ref|NM_118819.2| Arabidopsis thaliana VTC2 (VITAMIN C DEFECTIVE ... 40 8.0
35gb|AE013206.1| Thermoanaerobacter tengcongensis MB4, section 233... 40 8.0
36gb|AC107865.7| Mus musculus chromosome 1, clone RP23-389C9, comp... 40 8.0
37ref|XM_845849.1| PREDICTED: Canis familiaris similar to BTB (POZ... 40 8.0
38gb|AC149580.19| Medicago truncatula clone mth2-123f14, complete ... 40 8.0
39gb|BT010278.1| Drosophila melanogaster RE07829 full insert cDNA 40 8.0
40emb|AL355315.18| Human DNA sequence from clone RP11-548K23 on ch... 40 8.0
41gb|AC115090.8| Homo sapiens chromosome 17, clone CTC-861O14, com... 40 8.0
42gb|AY056134.1| Arabidopsis thaliana unknown protein (At4g26850) ... 40 8.0
43emb|AL161566.2|ATCHRIV66 Arabidopsis thaliana DNA chromosome 4, ... 40 8.0
44emb|AL161565.2|ATCHRIV65 Arabidopsis thaliana DNA chromosome 4, ... 40 8.0
45emb|AL035440.2|ATF10M23 Arabidopsis thaliana DNA chromosome 4, B... 40 8.0
46emb|CR352285.4| Zebrafish DNA sequence from clone CH211-210K13 i... 40 8.0
47emb|AL662836.7| Mouse DNA sequence from clone RP23-313L19 on chr... 40 8.0
48gb|AF508793.1| Arabidopsis thaliana VTC2 (VTC2) gene, complete cds 40 8.0
49gb|AC009377.7| Drosophila melanogaster 3L BAC RP98-26P20 (Roswel... 40 8.0
50gb|AC009367.9| Drosophila melanogaster 3L BAC RP98-48B15 (Roswel... 40 8.0
51ref|NM_176359.1| Drosophila melanogaster pipe CG9614-RK, transcr... 40 8.0
52ref|NM_176358.1| Drosophila melanogaster pipe CG9614-RL, transcr... 40 8.0
53ref|NM_176357.1| Drosophila melanogaster pipe CG9614-RE, transcr... 40 8.0
54ref|NM_176356.1| Drosophila melanogaster pipe CG9614-RF, transcr... 40 8.0
55ref|NM_176355.1| Drosophila melanogaster pipe CG9614-RD, transcr... 40 8.0
56ref|NM_176354.1| Drosophila melanogaster pipe CG9614-RG, transcr... 40 8.0
57ref|NM_176353.1| Drosophila melanogaster pipe CG9614-RH, transcr... 40 8.0
58ref|NM_176352.1| Drosophila melanogaster pipe CG9614-RI, transcr... 40 8.0
59ref|NM_176351.1| Drosophila melanogaster pipe CG9614-RJ, transcr... 40 8.0
60ref|NM_168793.1| Drosophila melanogaster pipe CG9614-RC, transcr... 40 8.0
61gb|AY093138.1| Arabidopsis thaliana putative protein (At4g26850)... 40 8.0
62ref|NM_079434.2| Drosophila melanogaster pipe CG9614-RA, transcr... 40 8.0
63ref|XM_936572.1| PREDICTED: Homo sapiens suppressor of cytokine ... 40 8.0
64gb|AF085249.1|AF085249 Gallus gallus calcium/calmodulin-dependen... 40 8.0
65gb|BT006589.1| Arabidopsis thaliana At4g26850 mRNA, complete cds 40 8.0
66gb|AF263993.1|AF263993 Drosophila melanogaster pipe sulfotransfe... 40 8.0
67dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.0
68gb|AC124789.12| Homo sapiens chromosome 17, clone RP11-923C2, co... 40 8.0
69ref|NM_204294.1| Gallus gallus calcium/calmodulin-dependent prot... 40 8.0
70ref|XM_573834.1| PREDICTED: Rattus norvegicus similar to OTTHUMP... 40 8.0
71emb|AL928960.25| Mouse DNA sequence from clone RP23-413K16 on ch... 40 8.0
72dbj|AP005647.3| Oryza sativa (japonica cultivar-group) genomic D... 40 8.0
73gb|AE003517.3| Drosophila melanogaster chromosome 3L, section 68... 40 8.0
74gb|AF102136.1|AF102136 Drosophila melanogaster pipe sulfotransfe... 40 8.0
75gb|AF102135.1|AF102135 Drosophila melanogaster pipe sulfotransfe... 40 8.0
76gb|AC124235.11| Mus musculus chromosome 13, clone RP23-273G24, c... 40 8.0
77emb|CR354563.13| Zebrafish DNA sequence from clone DKEY-210I1 in... 40 8.0
78ref|NM_014598.1| Homo sapiens suppressor of cytokine signaling 7... 40 8.0
79emb|AL772288.12| Mouse DNA sequence from clone RP23-360H6 on chr... 40 8.0 
>gb|AY596553.1| Saccharum officinarum clone SCUTLR1058C02, complete sequence
          Length = 1732

 Score =  232 bits (117), Expect = 1e-57
 Identities = 288/345 (83%)
 Strand = Plus / Plus

                                                                       
Query: 242 agtgggaggacagggtagcccgaggcctattcagatatgacgtaacagcctgcgagacca 301
           |||||||||||||| | ||||||||| ||||| | || || || || ||||| |||||||
Sbjct: 374 agtgggaggacaggatggcccgaggcttattccgctacgatgtcactgcctgtgagacca 433

                                                                       
Query: 302 aggtgattcctggcgagcttgggtttgttgcacagcttaacgaaggccgccacctcaaga 361
           |||| || |||||| | ||||||||||||||||| || || ||||| |||||||| ||||
Sbjct: 434 aggtcatccctggcaaccttgggtttgttgcacaactcaatgaagggcgccaccttaaga 493

                                                                       
Query: 362 agcgcccaaccgagttccgtgttgaccgtgtgctccagccattcgattctgccaagttca 421
           ||||||| || ||||| ||||| |||||||||||||||||||| ||  ||||||||||||
Sbjct: 494 agcgccctactgagtttcgtgtggaccgtgtgctccagccatttgaccctgccaagttca 553

                                                                       
Query: 422 acttcaccaaggttggccaggaggaggttctctttcgctttgagaatggtggtggcgaca 481
           | |||||||| ||||||||||| |||||||| || |  ||||||||||||| ||| ||  
Sbjct: 554 atttcaccaaagttggccaggaagaggttcttttccaatttgagaatggtgatggtgatg 613

                                                                       
Query: 482 gcagctatttccttgaaaatgccccaagcattgagggtgaccgtgctcccagcgttgttg 541
            ||||||||||||  |  | || |||| |||||  | ||| |||||||| |  |||||||
Sbjct: 614 acagctatttcctgaatgacgctccaatcattgctgttgatcgtgctccaaatgttgttg 673

                                                        
Query: 542 caatcaatgtgagccctattgagtacggtcatgtgcttctcattc 586
           | |||||||||||||| ||||| || || ||||||||||||||||
Sbjct: 674 ctatcaatgtgagcccaattgaatatggacatgtgcttctcattc 718



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 63/69 (91%)
 Strand = Plus / Plus

                                                                       
Query: 100 ggctgcggcaggaactgcctcggggattgctgcttgcctgcttccaagcttcccctctat 159
           |||||||| |||||||||||||| || |||||| ||||||||||||||||||||||||| 
Sbjct: 235 ggctgcgggaggaactgcctcggcgactgctgcctgcctgcttccaagcttcccctctac 294

                    
Query: 160 gctttcaag 168
           || ||||||
Sbjct: 295 gcgttcaag 303
to top
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
               sequence
          Length = 27566993

 Score =  198 bits (100), Expect = 1e-47
 Identities = 202/236 (85%)
 Strand = Plus / Minus

                                                                           
Query: 241     cagtgggaggacagggtagcccgaggcctattcagatatgacgtaacagcctgcgagacc 300
               |||||||| |||||| | ||||||||  | ||| ||||||| || || ||||| ||||||
Sbjct: 4534249 cagtgggaagacaggatggcccgaggtttgttccgatatgatgtcactgcctgtgagacc 4534190

                                                                           
Query: 301     aaggtgattcctggcgagcttgggtttgttgcacagcttaacgaaggccgccacctcaag 360
               ||||| || || ||| | ||||||||||||||||| || || ||||| ||||||||||||
Sbjct: 4534189 aaggttatcccaggcaaccttgggtttgttgcacaactgaatgaaggacgccacctcaag 4534130

                                                                           
Query: 361     aagcgcccaaccgagttccgtgttgaccgtgtgctccagccattcgattctgccaagttc 420
               |||||||| || || ||||| || ||||||||||| || ||||| ||| |||||||||||
Sbjct: 4534129 aagcgccctactgaattccgcgtggaccgtgtgcttcaaccatttgatgctgccaagttc 4534070

                                                                       
Query: 421     aacttcaccaaggttggccaggaggaggttctctttcgctttgagaatggtggtgg 476
               ||||||||||| ||||||||||||||||| ||||| |  |||||||||||||||||
Sbjct: 4534069 aacttcaccaaagttggccaggaggaggtgctcttccaatttgagaatggtggtgg 4534014



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                     
Query: 100     ggctgcggcaggaactgcctcggggattgctgcttgcc 137
               |||||||| ||| | |||||||||||||||||||||||
Sbjct: 4535708 ggctgcgggagggattgcctcggggattgctgcttgcc 4535671



 Score = 44.1 bits (22), Expect = 0.51
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                             
Query: 141     ttccaagcttcccctctatgctttcaaggc 170
               |||||||||||| || ||||||||||||||
Sbjct: 4535134 ttccaagcttccgctgtatgctttcaaggc 4535105
to top
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score =  198 bits (100), Expect = 1e-47
 Identities = 202/236 (85%)
 Strand = Plus / Minus

                                                                           
Query: 241     cagtgggaggacagggtagcccgaggcctattcagatatgacgtaacagcctgcgagacc 300
               |||||||| |||||| | ||||||||  | ||| ||||||| || || ||||| ||||||
Sbjct: 4534230 cagtgggaagacaggatggcccgaggtttgttccgatatgatgtcactgcctgtgagacc 4534171

                                                                           
Query: 301     aaggtgattcctggcgagcttgggtttgttgcacagcttaacgaaggccgccacctcaag 360
               ||||| || || ||| | ||||||||||||||||| || || ||||| ||||||||||||
Sbjct: 4534170 aaggttatcccaggcaaccttgggtttgttgcacaactgaatgaaggacgccacctcaag 4534111

                                                                           
Query: 361     aagcgcccaaccgagttccgtgttgaccgtgtgctccagccattcgattctgccaagttc 420
               |||||||| || || ||||| || ||||||||||| || ||||| ||| |||||||||||
Sbjct: 4534110 aagcgccctactgaattccgcgtggaccgtgtgcttcaaccatttgatgctgccaagttc 4534051

                                                                       
Query: 421     aacttcaccaaggttggccaggaggaggttctctttcgctttgagaatggtggtgg 476
               ||||||||||| ||||||||||||||||| ||||| |  |||||||||||||||||
Sbjct: 4534050 aacttcaccaaagttggccaggaggaggtgctcttccaatttgagaatggtggtgg 4533995



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                     
Query: 100     ggctgcggcaggaactgcctcggggattgctgcttgcc 137
               |||||||| ||| | |||||||||||||||||||||||
Sbjct: 4535689 ggctgcgggagggattgcctcggggattgctgcttgcc 4535652



 Score = 44.1 bits (22), Expect = 0.51
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                             
Query: 141     ttccaagcttcccctctatgctttcaaggc 170
               |||||||||||| || ||||||||||||||
Sbjct: 4535115 ttccaagcttccgctgtatgctttcaaggc 4535086
to top
>emb|AL928749.4|CNS08CBM Oryza sativa chromosome 12, . BAC OSJNBa0002O20 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 129155

 Score =  198 bits (100), Expect = 1e-47
 Identities = 202/236 (85%)
 Strand = Plus / Plus

                                                                         
Query: 241   cagtgggaggacagggtagcccgaggcctattcagatatgacgtaacagcctgcgagacc 300
             |||||||| |||||| | ||||||||  | ||| ||||||| || || ||||| ||||||
Sbjct: 70529 cagtgggaagacaggatggcccgaggtttgttccgatatgatgtcactgcctgtgagacc 70588

                                                                         
Query: 301   aaggtgattcctggcgagcttgggtttgttgcacagcttaacgaaggccgccacctcaag 360
             ||||| || || ||| | ||||||||||||||||| || || ||||| ||||||||||||
Sbjct: 70589 aaggttatcccaggcaaccttgggtttgttgcacaactgaatgaaggacgccacctcaag 70648

                                                                         
Query: 361   aagcgcccaaccgagttccgtgttgaccgtgtgctccagccattcgattctgccaagttc 420
             |||||||| || || ||||| || ||||||||||| || ||||| ||| |||||||||||
Sbjct: 70649 aagcgccctactgaattccgcgtggaccgtgtgcttcaaccatttgatgctgccaagttc 70708

                                                                     
Query: 421   aacttcaccaaggttggccaggaggaggttctctttcgctttgagaatggtggtgg 476
             ||||||||||| ||||||||||||||||| ||||| |  |||||||||||||||||
Sbjct: 70709 aacttcaccaaagttggccaggaggaggtgctcttccaatttgagaatggtggtgg 70764



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                   
Query: 100   ggctgcggcaggaactgcctcggggattgctgcttgcc 137
             |||||||| ||| | |||||||||||||||||||||||
Sbjct: 69070 ggctgcgggagggattgcctcggggattgctgcttgcc 69107



 Score = 44.1 bits (22), Expect = 0.51
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 141   ttccaagcttcccctctatgctttcaaggc 170
             |||||||||||| || ||||||||||||||
Sbjct: 69644 ttccaagcttccgctgtatgctttcaaggc 69673
to top
>dbj|AK071188.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023086M14, full
           insert sequence
          Length = 2088

 Score =  186 bits (94), Expect = 6e-44
 Identities = 175/202 (86%)
 Strand = Plus / Plus

                                                                       
Query: 275 gatatgacgtaacagcctgcgagaccaaggtgattcctggcgagcttgggtttgttgcac 334
           ||||||| || || ||||| ||||||||||| || || ||| | ||||||||||||||||
Sbjct: 704 gatatgatgtcactgcctgtgagaccaaggttatcccaggcaaccttgggtttgttgcac 763

                                                                       
Query: 335 agcttaacgaaggccgccacctcaagaagcgcccaaccgagttccgtgttgaccgtgtgc 394
           | || || ||||| |||||||||||||||||||| || || ||||| || ||||||||||
Sbjct: 764 aactgaatgaaggacgccacctcaagaagcgccctactgaattccgcgtggaccgtgtgc 823

                                                                       
Query: 395 tccagccattcgattctgccaagttcaacttcaccaaggttggccaggaggaggttctct 454
           | || ||||| ||| |||||||||||||||||||||| ||||||||||||||||| ||||
Sbjct: 824 ttcaaccatttgatgctgccaagttcaacttcaccaaagttggccaggaggaggtgctct 883

                                 
Query: 455 ttcgctttgagaatggtggtgg 476
           | |  |||||||||||||||||
Sbjct: 884 tccaatttgagaatggtggtgg 905



 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 64/71 (90%)
 Strand = Plus / Plus

                                                                       
Query: 100 ggctgcggcaggaactgcctcggggattgctgcttgcctgcttccaagcttcccctctat 159
           |||||||| ||| | ||||||||||||||||||||||| | |||||||||||| || |||
Sbjct: 528 ggctgcgggagggattgcctcggggattgctgcttgcccgattccaagcttccgctgtat 587

                      
Query: 160 gctttcaaggc 170
           |||||||||||
Sbjct: 588 gctttcaaggc 598



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                                
Query: 535  gttgttgcaatcaatgtgagccctattgagtacggtcatgtgcttctcattc 586
            ||||||||||||||||| ||||| ||||| || || ||||| ||||||||||
Sbjct: 964  gttgttgcaatcaatgtaagcccaattgaatatggccatgttcttctcattc 1015
to top
>gb|AY105327.1| Zea mays PCO147247 mRNA sequence
          Length = 1954

 Score =  184 bits (93), Expect = 2e-43
 Identities = 282/345 (81%)
 Strand = Plus / Plus

                                                                       
Query: 242 agtgggaggacagggtagcccgaggcctattcagatatgacgtaacagcctgcgagacca 301
           |||||||||||||| |  | |||||| ||||| | || || || || ||||| |||||||
Sbjct: 632 agtgggaggacaggatgactcgaggcttattccgctacgatgtcactgcctgtgagacca 691

                                                                       
Query: 302 aggtgattcctggcgagcttgggtttgttgcacagcttaacgaaggccgccacctcaaga 361
           |||| ||||||||| | ||||||||||||||||| || || ||||| ||||| || ||||
Sbjct: 692 aggtcattcctggcaaccttgggtttgttgcacaactcaatgaagggcgccatcttaaga 751

                                                                       
Query: 362 agcgcccaaccgagttccgtgttgaccgtgtgctccagccattcgattctgccaagttca 421
           ||||||| || ||||| ||||| ||||||||||||||||| || ||  ||||||| ||||
Sbjct: 752 agcgccctactgagtttcgtgtggaccgtgtgctccagccgtttgaccctgccaaattca 811

                                                                       
Query: 422 acttcaccaaggttggccaggaggaggttctctttcgctttgagaatggtggtggcgaca 481
           | ||||| || ||||||||||| ||||||||||| |  ||||||||| ||||||| ||  
Sbjct: 812 atttcacaaaagttggccaggaagaggttctcttccaatttgagaatagtggtggtgatg 871

                                                                       
Query: 482 gcagctatttccttgaaaatgccccaagcattgagggtgaccgtgctcccagcgttgttg 541
            ||||||||||||  | || || |||| |||||  | ||| || ||||| |  ||| |||
Sbjct: 872 acagctatttcctgaacaacgctccaatcattgctgttgatcgggctccaaatgttattg 931

                                                        
Query: 542 caatcaatgtgagccctattgagtacggtcatgtgcttctcattc 586
           | |||||||| ||||| ||||| || || ||||||||||||||||
Sbjct: 932 ctatcaatgtaagcccaattgaatatggacatgtgcttctcattc 976



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 64/70 (91%)
 Strand = Plus / Plus

                                                                       
Query: 99  gggctgcggcaggaactgcctcggggattgctgcttgcctgcttccaagcttcccctcta 158
           ||||||||| |||||||||||||| || |||||| |||||||||||||||||||||||||
Sbjct: 492 gggctgcgggaggaactgcctcggcgactgctgcctgcctgcttccaagcttcccctcta 551

                     
Query: 159 tgctttcaag 168
            || ||||||
Sbjct: 552 cgcgttcaag 561
to top
>dbj|AK059556.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-029-G08, full
           insert sequence
          Length = 1295

 Score =  147 bits (74), Expect = 5e-32
 Identities = 119/134 (88%)
 Strand = Plus / Plus

                                                                       
Query: 343 gaaggccgccacctcaagaagcgcccaaccgagttccgtgttgaccgtgtgctccagcca 402
           ||||| |||||||||||||||||||| || || ||||| || ||||||||||| || |||
Sbjct: 14  gaaggacgccacctcaagaagcgccctactgaattccgcgtggaccgtgtgcttcaacca 73

                                                                       
Query: 403 ttcgattctgccaagttcaacttcaccaaggttggccaggaggaggttctctttcgcttt 462
           || ||| |||||||||||||||||||||| ||||||||||||||||| ||||| |  |||
Sbjct: 74  tttgatgctgccaagttcaacttcaccaaagttggccaggaggaggtgctcttccaattt 133

                         
Query: 463 gagaatggtggtgg 476
           ||||||||||||||
Sbjct: 134 gagaatggtggtgg 147



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 535 gttgttgcaatcaatgtgagccctattgagtacggtcatgtgcttctcattc 586
           ||||||||||||||||| ||||| ||||| || || ||||| ||||||||||
Sbjct: 206 gttgttgcaatcaatgtaagcccaattgaatatggccatgttcttctcattc 257
to top
>gb|AY570979.1| Xerophyta humilis clone HC437 unknown mRNA
          Length = 1266

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                           
Query: 414 caagttcaacttcaccaaggttggccaggaggaggttctctttcgctt 461
           ||||||||| ||||||||||| || ||||||||||||||||| |||||
Sbjct: 121 caagttcaatttcaccaaggtcgggcaggaggaggttctcttccgctt 168



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 535 gttgttgcaatcaatgtgagccctattgagtacggtcatgt 575
           |||||||||||||| |||||||| || ||||| || |||||
Sbjct: 239 gttgttgcaatcaacgtgagcccaatcgagtatggccatgt 279
to top
>dbj|AK111215.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-179-B04, full
           insert sequence
          Length = 2890

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 89/109 (81%)
 Strand = Plus / Plus

                                                                       
Query: 325 tttgttgcacagcttaacgaaggccgccacctcaagaagcgcccaaccgagttccgtgtt 384
           ||||| |||||||| ||||| |||||| ||  |||||||||||| || ||||||||||| 
Sbjct: 180 tttgtggcacagctgaacgagggccgctacagcaagaagcgccccacagagttccgtgtg 239

                                                            
Query: 385 gaccgtgtgctccagccattcgattctgccaagttcaacttcaccaagg 433
           ||||  ||| | ||| | |||||  |   ||||||||||||||||||||
Sbjct: 240 gaccaggtggtgcaggccttcgaccccaacaagttcaacttcaccaagg 288
to top
>ref|NM_124894.4| Arabidopsis thaliana unknown protein AT5G55120 mRNA, complete cds
          Length = 1874

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 329 ttgcacagcttaacgaaggccgccacctcaagaagcgcccaaccgagttccgtgttgac 387
           |||| ||||| || ||||| || || ||||||||| | |||||||||||||||||||||
Sbjct: 719 ttgcgcagctgaatgaaggtcggcatctcaagaagagaccaaccgagttccgtgttgac 777



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 527 ctcccagcgttgttgcaatcaatgtgagccctattgagtacggtcatgtg 576
           |||| ||||| ||||||||||||||||| || |||||||| || ||||||
Sbjct: 923 ctcctagcgtcgttgcaatcaatgtgagtccgattgagtatgggcatgtg 972
to top
>gb|AY091285.1| Arabidopsis thaliana unknown protein (At5g55120) mRNA, complete cds
          Length = 1327

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 329 ttgcacagcttaacgaaggccgccacctcaagaagcgcccaaccgagttccgtgttgac 387
           |||| ||||| || ||||| || || ||||||||| | |||||||||||||||||||||
Sbjct: 299 ttgcgcagctgaatgaaggtcggcatctcaagaagagaccaaccgagttccgtgttgac 357



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 527 ctcccagcgttgttgcaatcaatgtgagccctattgagtacggtcatgtg 576
           |||| ||||| ||||||||||||||||| || |||||||| || ||||||
Sbjct: 503 ctcctagcgtcgttgcaatcaatgtgagtccgattgagtatgggcatgtg 552
to top
>gb|AY063788.1| Arabidopsis thaliana unknown protein (At5g55120) mRNA, complete cds
          Length = 1788

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 329 ttgcacagcttaacgaaggccgccacctcaagaagcgcccaaccgagttccgtgttgac 387
           |||| ||||| || ||||| || || ||||||||| | |||||||||||||||||||||
Sbjct: 615 ttgcgcagctgaatgaaggtcggcatctcaagaagagaccaaccgagttccgtgttgac 673



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 527 ctcccagcgttgttgcaatcaatgtgagccctattgagtacggtcatgtg 576
           |||| ||||| ||||||||||||||||| || |||||||| || ||||||
Sbjct: 819 ctcctagcgtcgttgcaatcaatgtgagtccgattgagtatgggcatgtg 868
to top
>dbj|AB010071.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MCO15
          Length = 82918

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                        
Query: 329   ttgcacagcttaacgaaggccgccacctcaagaagcgcccaaccgagttccgtgttgac 387
             |||| ||||| || ||||| || || ||||||||| | |||||||||||||||||||||
Sbjct: 29107 ttgcgcagctgaatgaaggtcggcatctcaagaagagaccaaccgagttccgtgttgac 29165
to top
>emb|BX831350.1|CNS0A1O4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS80ZC01 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1806

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 527 ctcccagcgttgttgcaatcaatgtgagccctattgagtacggtcatgtg 576
           |||| ||||| ||||||||||||||||| || |||||||| || ||||||
Sbjct: 857 ctcctagcgtcgttgcaatcaatgtgagtccgattgagtatgggcatgtg 906



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 355 ctcaagaagcgcccaaccgagttccgtgttgac 387
           ||||||||| | |||||||||||||||||||||
Sbjct: 680 ctcaagaagagaccaaccgagttccgtgttgac 712
to top
>emb|BX829969.1|CNS0A043 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB4ZG03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1694

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 527 ctcccagcgttgttgcaatcaatgtgagccctattgagtacggtcatgtg 576
           |||| ||||| ||||||||||||||||| || |||||||| || ||||||
Sbjct: 808 ctcctagcgtcgttgcaatcaatgtgagtccgattgagtatgggcatgtg 857



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 355 ctcaagaagcgcccaaccgagttccgtgttgac 387
           ||||||||| | |||||||||||||||||||||
Sbjct: 630 ctcaagaagagaccaaccgagttccgtgttgac 662
to top
>emb|BX831865.1|CNS09ZT1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH35ZF07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1838

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 527 ctcccagcgttgttgcaatcaatgtgagccctattgagtacggtcatgtg 576
           |||| ||||| ||||||||||||||||| || |||||||| || ||||||
Sbjct: 923 ctcctagcgtcgttgcaatcaatgtgagtccgattgagtatgggcatgtg 972



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 355 ctcaagaagcgcccaaccgagttccgtgttgac 387
           ||||||||| | |||||||||||||||||||||
Sbjct: 745 ctcaagaagagaccaaccgagttccgtgttgac 777
to top
>emb|BX831807.1|CNS09ZUD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH30ZF08 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1692

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 527 ctcccagcgttgttgcaatcaatgtgagccctattgagtacggtcatgtg 576
           |||| ||||| ||||||||||||||||| || |||||||| || ||||||
Sbjct: 783 ctcctagcgtcgttgcaatcaatgtgagtccgattgagtatgggcatgtg 832



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 355 ctcaagaagcgcccaaccgagttccgtgttgac 387
           ||||||||| | |||||||||||||||||||||
Sbjct: 605 ctcaagaagagaccaaccgagttccgtgttgac 637
to top
>emb|BX830641.1|CNS09ZZY Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB9ZD04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1684

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 527 ctcccagcgttgttgcaatcaatgtgagccctattgagtacggtcatgtg 576
           |||| ||||| ||||||||||||||||| || |||||||| || ||||||
Sbjct: 771 ctcctagcgtcgttgcaatcaatgtgagtccgattgagtatgggcatgtg 820



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 357 caagaagcgcccaaccgagttccgtgttgac 387
           ||||||| | |||||||||||||||||||||
Sbjct: 595 caagaagagaccaaccgagttccgtgttgac 625
to top
>emb|CT573504.2| Medicago truncatula chromosome 5 clone mth2-178o19, COMPLETE SEQUENCE
          Length = 132030

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                                
Query: 329    ttgcacagcttaacgaaggccgccacctcaagaagcgcccaaccgagttc 378
              |||| ||||||||||| ||||| |||||||||||| | ||||| ||||||
Sbjct: 101810 ttgctcagcttaacgagggccgacacctcaagaagagaccaactgagttc 101859
to top
>gb|AY489190.1| Capsicum annuum putative At4g26850-like protein  mRNA, complete
           sequence
          Length = 589

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 414 caagttcaacttcaccaaggttggccaggaggaggttctctttc 457
           ||||||||||||||| |||||||| ||||| ||| | |||||||
Sbjct: 524 caagttcaacttcactaaggttggacaggaagagttgctctttc 567



 Score = 44.1 bits (22), Expect = 0.51
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 289 gcctgcgagaccaaggtgattcctgg 314
           |||||||| |||||||||||||||||
Sbjct: 399 gcctgcgaaaccaaggtgattcctgg 424
to top
>gb|BT013858.1| Lycopersicon esculentum clone 132824R, mRNA sequence
          Length = 2013

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 536 ttgttgcaatcaatgtgagccctattgagta 566
           ||||||| |||||||||||||| ||||||||
Sbjct: 947 ttgttgctatcaatgtgagcccaattgagta 977



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 349 cgccacctcaagaagcgcccaaccgagtt 377
           |||||||| |||||||||||||| |||||
Sbjct: 763 cgccacctaaagaagcgcccaacagagtt 791
to top
>gb|CP000252.1| Syntrophus aciditrophicus SB, complete genome
          Length = 3179300

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 8       gacagcagaggaggcgggagga 29
               ||||||||||||||||||||||
Sbjct: 2180803 gacagcagaggaggcgggagga 2180824
to top
>ref|XM_546598.2| PREDICTED: Canis familiaris similar to 1-beta dynein (LOC489480),
            mRNA
          Length = 13413

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 25   gaggagatggaggtgaagctg 45
            |||||||||||||||||||||
Sbjct: 9937 gaggagatggaggtgaagctg 9957
to top
>gb|AC150683.3| Mus musculus BAC clone RP23-435E16 from chromosome 7, complete sequence
          Length = 198646

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 435    tggccaggaggaggttctctt 455
              |||||||||||||||||||||
Sbjct: 158745 tggccaggaggaggttctctt 158765
to top
>dbj|AK154942.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN
           full-length enriched library, clone:F630112C04
           product:5, 10-methenyltetrahydrofolate synthetase, full
           insert sequence
          Length = 1407

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 129 ctgcttgcctgcttccaagcttccc 153
           |||| ||||||||||||||||||||
Sbjct: 128 ctgcctgcctgcttccaagcttccc 104
to top
>gb|AC158637.3| Mus musculus 10 BAC RP24-79K22 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 221409

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 128   gctgcttgcctgcttccaagcttcc 152
             |||||||||||||||||| ||||||
Sbjct: 47851 gctgcttgcctgcttccatgcttcc 47827
to top
>gb|AC153536.3| Mus musculus 10 BAC RP23-402F24 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 208392

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 128    gctgcttgcctgcttccaagcttcc 152
              |||||||||||||||||| ||||||
Sbjct: 107615 gctgcttgcctgcttccatgcttcc 107591
to top
>emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,complete sequence
          Length = 5888780

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 517     ggtgaccgtgctcccagcgtt 537
               |||||||||||||||||||||
Sbjct: 2549882 ggtgaccgtgctcccagcgtt 2549862
to top
>emb|CT030651.6| Mouse DNA sequence from clone RP23-229N10 on chromosome 9, complete
            sequence
          Length = 128191

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 129  ctgcttgcctgcttccaagcttccc 153
            |||| ||||||||||||||||||||
Sbjct: 1673 ctgcctgcctgcttccaagcttccc 1697
to top
>emb|CT030686.6| Mouse DNA sequence from clone RP23-136C5 on chromosome 9, complete
              sequence
          Length = 177760

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 129    ctgcttgcctgcttccaagcttccc 153
              |||| ||||||||||||||||||||
Sbjct: 175112 ctgcctgcctgcttccaagcttccc 175088
to top
>gb|AC135634.4| Mus musculus BAC clone RP23-121I20 from 9, complete sequence
          Length = 209177

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 129    ctgcttgcctgcttccaagcttccc 153
              |||| ||||||||||||||||||||
Sbjct: 102765 ctgcctgcctgcttccaagcttccc 102789
to top
>emb|CT030710.7| Mouse DNA sequence from clone RP23-386A10 on chromosome 9, complete
              sequence
          Length = 206562

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 129    ctgcttgcctgcttccaagcttccc 153
              |||| ||||||||||||||||||||
Sbjct: 150655 ctgcctgcctgcttccaagcttccc 150679
to top
>gb|AC154126.2| Mus musculus BAC clone RP23-471O11 from chromosome 7, complete sequence
          Length = 198860

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 435    tggccaggaggaggttctctt 455
              |||||||||||||||||||||
Sbjct: 186600 tggccaggaggaggttctctt 186580
to top
>ref|NM_118819.2| Arabidopsis thaliana VTC2 (VITAMIN C DEFECTIVE 2) AT4G26850 (VTC2)
           mRNA, complete cds
          Length = 2084

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                   
Query: 328 gttgcacagcttaacgaaggccgccacctcaagaagcgcccaaccgagttccgtgt 383
           ||||| ||||||||||| || || ||| | |||||| | ||||| |||||||||||
Sbjct: 819 gttgctcagcttaacgagggtcgtcacttgaagaagaggccaactgagttccgtgt 874
to top
>gb|AE013206.1| Thermoanaerobacter tengcongensis MB4, section 233 of 244 of the
            complete genome
          Length = 14407

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 14   agaggaggcgggaggagatg 33
            ||||||||||||||||||||
Sbjct: 6401 agaggaggcgggaggagatg 6382
to top
>gb|AC107865.7| Mus musculus chromosome 1, clone RP23-389C9, complete sequence
          Length = 204959

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 129    ctgcttgcctgcttccaagcttcc 152
              ||||||||||||||||| ||||||
Sbjct: 119147 ctgcttgcctgcttccatgcttcc 119124
to top
>ref|XM_845849.1| PREDICTED: Canis familiaris similar to BTB (POZ) domain containing 11
            isoform 3, transcript variant 2 (LOC481292), mRNA
          Length = 3430

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 381  tgttgaccgtgtgctccagc 400
            ||||||||||||||||||||
Sbjct: 1075 tgttgaccgtgtgctccagc 1056
to top
>gb|AC149580.19| Medicago truncatula clone mth2-123f14, complete sequence
          Length = 123565

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 208   actgagttcttcctcaattctctc 231
             |||||||| |||||||||||||||
Sbjct: 79670 actgagtttttcctcaattctctc 79693
to top
>gb|BT010278.1| Drosophila melanogaster RE07829 full insert cDNA
          Length = 1445

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 26  aggagatggaggtgaagctg 45
           ||||||||||||||||||||
Sbjct: 342 aggagatggaggtgaagctg 361
to top
>emb|AL355315.18| Human DNA sequence from clone RP11-548K23 on chromosome 10 Contains the
              ANKRD2 gene for ankyrin repeat domain 2 (stretch responsive
              muscle), six novel genes, the gene for phosphatidylinositol
              4-kinase type II (PI4KII) and four CpG islands, complete
              sequence
          Length = 157193

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 426    caccaaggttggccaggagg 445
              ||||||||||||||||||||
Sbjct: 132404 caccaaggttggccaggagg 132423
to top
>gb|AC115090.8| Homo sapiens chromosome 17, clone CTC-861O14, complete sequence
          Length = 173716

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 562    gagtacggtcatgtgcttct 581
              ||||||||||||||||||||
Sbjct: 155346 gagtacggtcatgtgcttct 155365
to top
>gb|AY056134.1| Arabidopsis thaliana unknown protein (At4g26850) mRNA, complete cds
          Length = 2097

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                   
Query: 328 gttgcacagcttaacgaaggccgccacctcaagaagcgcccaaccgagttccgtgt 383
           ||||| ||||||||||| || || ||| | |||||| | ||||| |||||||||||
Sbjct: 817 gttgctcagcttaacgagggtcgtcacttgaagaagaggccaactgagttccgtgt 872
to top
>emb|AL161566.2|ATCHRIV66 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 66
          Length = 198372

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                    
Query: 328  gttgcacagcttaacgaaggccgccacctcaagaagcgcccaaccgagttccgtgt 383
            ||||| ||||||||||| || || ||| | |||||| | ||||| |||||||||||
Sbjct: 4402 gttgctcagcttaacgagggtcgtcacttgaagaagaggccaactgagttccgtgt 4347
to top
>emb|AL161565.2|ATCHRIV65 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 65
          Length = 198320

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                      
Query: 328    gttgcacagcttaacgaaggccgccacctcaagaagcgcccaaccgagttccgtgt 383
              ||||| ||||||||||| || || ||| | |||||| | ||||| |||||||||||
Sbjct: 197722 gttgctcagcttaacgagggtcgtcacttgaagaagaggccaactgagttccgtgt 197667
to top
>emb|AL035440.2|ATF10M23 Arabidopsis thaliana DNA chromosome 4, BAC clone F10M23 (ESSA project)
          Length = 128574

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                     
Query: 328   gttgcacagcttaacgaaggccgccacctcaagaagcgcccaaccgagttccgtgt 383
             ||||| ||||||||||| || || ||| | |||||| | ||||| |||||||||||
Sbjct: 48559 gttgctcagcttaacgagggtcgtcacttgaagaagaggccaactgagttccgtgt 48504
to top
>emb|CR352285.4| Zebrafish DNA sequence from clone CH211-210K13 in linkage group 11,
             complete sequence
          Length = 133334

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 481   agcagctatttccttgaaaa 500
             ||||||||||||||||||||
Sbjct: 42382 agcagctatttccttgaaaa 42401
to top
>emb|AL662836.7| Mouse DNA sequence from clone RP23-313L19 on chromosome 11, complete
             sequence
          Length = 120749

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 438   ccaggaggaggttctctttc 457
             ||||||||||||||||||||
Sbjct: 60215 ccaggaggaggttctctttc 60196
to top
>gb|AF508793.1| Arabidopsis thaliana VTC2 (VTC2) gene, complete cds
          Length = 1884

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                   
Query: 328 gttgcacagcttaacgaaggccgccacctcaagaagcgcccaaccgagttccgtgt 383
           ||||| ||||||||||| || || ||| | |||||| | ||||| |||||||||||
Sbjct: 599 gttgctcagcttaacgagggtcgtcacttgaagaagaggccaactgagttccgtgt 654
to top
>gb|AC009377.7| Drosophila melanogaster 3L BAC RP98-26P20 (Roswell Park Cancer
             Institute Drosophila BAC Library) complete sequence
          Length = 194308

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 26    aggagatggaggtgaagctg 45
             ||||||||||||||||||||
Sbjct: 60368 aggagatggaggtgaagctg 60349
to top
>gb|AC009367.9| Drosophila melanogaster 3L BAC RP98-48B15 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 178239

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 26     aggagatggaggtgaagctg 45
              ||||||||||||||||||||
Sbjct: 108763 aggagatggaggtgaagctg 108744
to top
>ref|NM_176359.1| Drosophila melanogaster pipe CG9614-RK, transcript variant K (pip),
           mRNA
          Length = 1390

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 26  aggagatggaggtgaagctg 45
           ||||||||||||||||||||
Sbjct: 342 aggagatggaggtgaagctg 361
to top
>ref|NM_176358.1| Drosophila melanogaster pipe CG9614-RL, transcript variant L (pip),
           mRNA
          Length = 1714

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 26  aggagatggaggtgaagctg 45
           ||||||||||||||||||||
Sbjct: 342 aggagatggaggtgaagctg 361
to top
>ref|NM_176357.1| Drosophila melanogaster pipe CG9614-RE, transcript variant E (pip),
           mRNA
          Length = 1399

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 26  aggagatggaggtgaagctg 45
           ||||||||||||||||||||
Sbjct: 342 aggagatggaggtgaagctg 361
to top
>ref|NM_176356.1| Drosophila melanogaster pipe CG9614-RF, transcript variant F (pip),
           mRNA
          Length = 1432

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 26  aggagatggaggtgaagctg 45
           ||||||||||||||||||||
Sbjct: 342 aggagatggaggtgaagctg 361
to top
>ref|NM_176355.1| Drosophila melanogaster pipe CG9614-RD, transcript variant D (pip),
           mRNA
          Length = 1426

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 26  aggagatggaggtgaagctg 45
           ||||||||||||||||||||
Sbjct: 342 aggagatggaggtgaagctg 361
to top
>ref|NM_176354.1| Drosophila melanogaster pipe CG9614-RG, transcript variant G (pip),
           mRNA
          Length = 1393

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 26  aggagatggaggtgaagctg 45
           ||||||||||||||||||||
Sbjct: 342 aggagatggaggtgaagctg 361
to top
>ref|NM_176353.1| Drosophila melanogaster pipe CG9614-RH, transcript variant H (pip),
           mRNA
          Length = 1387

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 26  aggagatggaggtgaagctg 45
           ||||||||||||||||||||
Sbjct: 342 aggagatggaggtgaagctg 361
to top
>ref|NM_176352.1| Drosophila melanogaster pipe CG9614-RI, transcript variant I (pip),
           mRNA
          Length = 1246

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 26  aggagatggaggtgaagctg 45
           ||||||||||||||||||||
Sbjct: 342 aggagatggaggtgaagctg 361
to top
>ref|NM_176351.1| Drosophila melanogaster pipe CG9614-RJ, transcript variant J (pip),
           mRNA
          Length = 1375

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 26  aggagatggaggtgaagctg 45
           ||||||||||||||||||||
Sbjct: 342 aggagatggaggtgaagctg 361
to top
>ref|NM_168793.1| Drosophila melanogaster pipe CG9614-RC, transcript variant C (pip),
           mRNA
          Length = 1387

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 26  aggagatggaggtgaagctg 45
           ||||||||||||||||||||
Sbjct: 342 aggagatggaggtgaagctg 361
to top
>gb|AY093138.1| Arabidopsis thaliana putative protein (At4g26850) mRNA, complete
           cds
          Length = 2045

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                   
Query: 328 gttgcacagcttaacgaaggccgccacctcaagaagcgcccaaccgagttccgtgt 383
           ||||| ||||||||||| || || ||| | |||||| | ||||| |||||||||||
Sbjct: 817 gttgctcagcttaacgagggtcgtcacttgaagaagaggccaactgagttccgtgt 872
to top
>ref|NM_079434.2| Drosophila melanogaster pipe CG9614-RA, transcript variant A (pip),
           mRNA
          Length = 1807

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 26  aggagatggaggtgaagctg 45
           ||||||||||||||||||||
Sbjct: 342 aggagatggaggtgaagctg 361
to top
>ref|XM_936572.1| PREDICTED: Homo sapiens suppressor of cytokine signaling 7 (SOCS7),
            mRNA
          Length = 1725

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 562  gagtacggtcatgtgcttct 581
            ||||||||||||||||||||
Sbjct: 1589 gagtacggtcatgtgcttct 1570
to top
>gb|AF085249.1|AF085249 Gallus gallus calcium/calmodulin-dependent kinase type II beta
           subunit mRNA, complete cds
          Length = 1703

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 435 tggccaggaggaggttctct 454
           ||||||||||||||||||||
Sbjct: 470 tggccaggaggaggttctct 451
to top
>gb|BT006589.1| Arabidopsis thaliana At4g26850 mRNA, complete cds
          Length = 1329

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                   
Query: 328 gttgcacagcttaacgaaggccgccacctcaagaagcgcccaaccgagttccgtgt 383
           ||||| ||||||||||| || || ||| | |||||| | ||||| |||||||||||
Sbjct: 316 gttgctcagcttaacgagggtcgtcacttgaagaagaggccaactgagttccgtgt 371
to top
>gb|AF263993.1|AF263993 Drosophila melanogaster pipe sulfotransferase box 3 isoform (pipe)
           mRNA, complete cds
          Length = 1393

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 26  aggagatggaggtgaagctg 45
           ||||||||||||||||||||
Sbjct: 332 aggagatggaggtgaagctg 351
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
               sequence
          Length = 35954743

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 126     ttgctgcttgcctgcttcca 145
               ||||||||||||||||||||
Sbjct: 2050505 ttgctgcttgcctgcttcca 2050486
to top
>gb|AC124789.12| Homo sapiens chromosome 17, clone RP11-923C2, complete sequence
          Length = 105701

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 562  gagtacggtcatgtgcttct 581
            ||||||||||||||||||||
Sbjct: 9527 gagtacggtcatgtgcttct 9546
to top
>ref|NM_204294.1| Gallus gallus calcium/calmodulin-dependent protein kinase (CaM
           kinase) II beta (CAMK2B), mRNA
          Length = 1703

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 435 tggccaggaggaggttctct 454
           ||||||||||||||||||||
Sbjct: 470 tggccaggaggaggttctct 451
to top
>ref|XM_573834.1| PREDICTED: Rattus norvegicus similar to OTTHUMP00000018508
           (LOC498559), mRNA
          Length = 1111

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 479 acagcagctatttccttgaa 498
           ||||||||||||||||||||
Sbjct: 362 acagcagctatttccttgaa 343
to top
>emb|AL928960.25| Mouse DNA sequence from clone RP23-413K16 on chromosome 2, complete
              sequence
          Length = 195733

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 150    tcccctctatgctttcaagg 169
              ||||||||||||||||||||
Sbjct: 114212 tcccctctatgctttcaagg 114193
to top
>dbj|AP005647.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OSJNBa0026E05
          Length = 159860

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 126    ttgctgcttgcctgcttcca 145
              ||||||||||||||||||||
Sbjct: 100713 ttgctgcttgcctgcttcca 100694
to top
>gb|AE003517.3| Drosophila melanogaster chromosome 3L, section 68 of 83 of the complete
              sequence
          Length = 257692

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 26     aggagatggaggtgaagctg 45
              ||||||||||||||||||||
Sbjct: 119497 aggagatggaggtgaagctg 119478
to top
>gb|AF102136.1|AF102136 Drosophila melanogaster pipe sulfotransferase ST2 isoform
           (pipe-ST2) mRNA, partial cds
          Length = 1219

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 26  aggagatggaggtgaagctg 45
           ||||||||||||||||||||
Sbjct: 253 aggagatggaggtgaagctg 272
to top
>gb|AF102135.1|AF102135 Drosophila melanogaster pipe sulfotransferase ST1 isoform,
           incompletely spliced mRNA sequence
          Length = 3014

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 26  aggagatggaggtgaagctg 45
           ||||||||||||||||||||
Sbjct: 288 aggagatggaggtgaagctg 307
to top
>gb|AC124235.11| Mus musculus chromosome 13, clone RP23-273G24, complete sequence
          Length = 242383

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 145    aagcttcccctctatgcttt 164
              ||||||||||||||||||||
Sbjct: 123425 aagcttcccctctatgcttt 123444
to top
>emb|CR354563.13| Zebrafish DNA sequence from clone DKEY-210I1 in linkage group 7,
             complete sequence
          Length = 147943

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 199   gagctccctactgagttctt 218
             ||||||||||||||||||||
Sbjct: 60496 gagctccctactgagttctt 60515
to top
>ref|NM_014598.1| Homo sapiens suppressor of cytokine signaling 7 (SOCS7), mRNA
          Length = 2162

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 562  gagtacggtcatgtgcttct 581
            ||||||||||||||||||||
Sbjct: 2054 gagtacggtcatgtgcttct 2035
to top
>emb|AL772288.12| Mouse DNA sequence from clone RP23-360H6 on chromosome 4, complete
             sequence
          Length = 132015

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 438   ccaggaggaggttctctttc 457
             ||||||||||||||||||||
Sbjct: 39010 ccaggaggaggttctctttc 38991


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,723,792
Number of Sequences: 3902068
Number of extensions: 4723792
Number of successful extensions: 94257
Number of sequences better than 10.0: 79
Number of HSP's better than 10.0 without gapping: 79
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 93943
Number of HSP's gapped (non-prelim): 314
length of query: 586
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 563
effective length of database: 17,143,297,704
effective search space: 9651676607352
effective search space used: 9651676607352
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top