ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bah63b03
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AF542188.1| Triticum aestivum cyc07 mRNA, complete cds 432 e-118
2gb|AY290725.1| Triticum aestivum ribosomal protein S3a-like mRNA... 394 e-106
3dbj|D26060.1|RICT151 Oryza sativa mRNA for cyc07, complete cds 353 4e-94
4dbj|AK104243.1| Oryza sativa (japonica cultivar-group) cDNA clon... 353 4e-94
5dbj|AK069251.1| Oryza sativa (japonica cultivar-group) cDNA clon... 353 4e-94
6dbj|AK104699.1| Oryza sativa (japonica cultivar-group) cDNA clon... 331 1e-87
7ref|XM_464995.1| Oryza sativa (japonica cultivar-group), mRNA 313 3e-82
8ref|XM_506775.1| PREDICTED Oryza sativa (japonica cultivar-group... 313 3e-82
9dbj|AK099131.1| Oryza sativa (japonica cultivar-group) cDNA clon... 305 9e-80
10dbj|AK059647.1| Oryza sativa (japonica cultivar-group) cDNA clon... 305 9e-80
11gb|AF052503.1|AF052503 Oryza sativa S-phase-specific ribosomal p... 276 8e-71
12gb|BT016390.1| Zea mays clone Contig223 mRNA sequence 270 5e-69
13dbj|AK071037.1| Oryza sativa (japonica cultivar-group) cDNA clon... 262 1e-66
14gb|DQ445133.1| Striga asiatica isolate St513 S phase protein mRN... 184 2e-43
15gb|AY109383.1| Zea mays CL7224_1 mRNA sequence 159 1e-35
16gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 125 2e-25
17gb|AC146581.1| Oryza sativa (japonica cultivar-group) Nipponbare... 125 2e-25
18gb|AC115687.1| Genomic sequence for Oryza sativa, Nipponbare str... 125 2e-25
19gb|DQ164221.1| Nicotiana tabacum cyc07 mRNA, complete cds 125 2e-25
20dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 125 2e-25
21dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 125 2e-25
22gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 125 2e-25
23emb|AL713942.4|CNS07YPB Oryza sativa chromosome 12, . BAC OSJNBa... 125 2e-25
24dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 113 7e-22
25gb|AY849388.1| Vitis vinifera cultivar Riesling cyc07 mRNA, part... 113 7e-22
26dbj|AP004168.3| Oryza sativa (japonica cultivar-group) genomic D... 113 7e-22
27dbj|AP004001.3| Oryza sativa (japonica cultivar-group) genomic D... 113 7e-22
28dbj|AB029635.1| Daucus carota mRNA for cyc07, complete cds 109 1e-20
29emb|Z25769.1|BRSPSG B.rapa mRNA for S phase specific gene 107 4e-20
30gb|L23553.1|BRRSPSK Brassica rapa S-phase-specific (BIS289) mRNA... 107 4e-20
31ref|NM_111356.3| Arabidopsis thaliana structural constituent of ... 96 2e-16
32gb|AY081585.1| Arabidopsis thaliana putative 40S ribosomal prote... 96 2e-16
33gb|AY062796.1| Arabidopsis thaliana putative 40S ribosomal prote... 96 2e-16
34emb|BX822077.1|CNS0A7LX Arabidopsis thaliana Full-length cDNA Co... 96 2e-16
35emb|BX824488.1|CNS0A5KP Arabidopsis thaliana Full-length cDNA Co... 96 2e-16
36gb|AY085787.1| Arabidopsis thaliana clone 18185 mRNA, complete s... 96 2e-16
37emb|AJ515028.1|CAR515028 Cicer arietinum mRNA for ribosomal prot... 94 6e-16
38dbj|D01058.1|CTRCYC07 Catharanthus roseus cyc07 mRNA, complete cds 94 6e-16
39gb|AC009465.7|AC009465 Arabidopsis thaliana chromosome 3 BAC T9J... 88 4e-14
40gb|DQ241862.1| Solanum tuberosum clone 027B03 40S ribosomal prot... 86 1e-13
41gb|AC146852.15| Medicago truncatula clone mth2-58k21, complete s... 84 6e-13
42gb|AC135320.6| Medicago truncatula clone mth2-28e9, complete seq... 84 6e-13
43dbj|AB116637.1| Lentinula edodes Le. cyc07 mRNA for putative S-p... 78 4e-11
44gb|AF093109.1| Tortula ruralis ribosomal protein S3 (rps3) mRNA,... 76 1e-10
45ref|NM_119633.2| Arabidopsis thaliana structural constituent of ... 72 2e-09
46gb|BT000122.1| Arabidopsis thaliana Putative S-phase-specific ri... 72 2e-09
47gb|AY062500.1| Arabidopsis thaliana Putative S-phase-specific ri... 72 2e-09
48emb|BX826401.1|CNS0A38P Arabidopsis thaliana Full-length cDNA Co... 72 2e-09
49emb|BX828268.1|CNS0A2YE Arabidopsis thaliana Full-length cDNA Co... 72 2e-09
50emb|AJ001342.1|ATCYC07 Arabidopsis thaliana mRNA for S-phase-spe... 72 2e-09
51emb|AL161586.2|ATCHRIV82 Arabidopsis thaliana DNA chromosome 4, ... 68 3e-08
52emb|AL161585.2|ATCHRIV81 Arabidopsis thaliana DNA chromosome 4, ... 68 3e-08
53emb|AL023094.2|ATT4L20 Arabidopsis thaliana DNA chromosome 4, BA... 68 3e-08
54ref|XM_774945.1| PREDICTED: Strongylocentrotus purpuratus simila... 66 1e-07
55ref|XM_796644.1| PREDICTED: Strongylocentrotus purpuratus simila... 66 1e-07
56ref|XM_785062.1| PREDICTED: Strongylocentrotus purpuratus simila... 66 1e-07
57gb|AY661558.1| Hordeum vulgare subsp. vulgare eIF4E gene locus, ... 66 1e-07
58gb|BT019079.1| Zea mays clone Contig661.F mRNA sequence 64 5e-07
59gb|AF479043.1| Triticum aestivum 40S ribosomal protein mRNA, par... 64 5e-07
60gb|AY648734.1| Danio rerio 40S ribosomal protein S3a mRNA, compl... 62 2e-06
61gb|BC059543.1| Danio rerio ribosomal protein S3A, mRNA (cDNA clo... 62 2e-06
62ref|NM_200059.1| Danio rerio ribosomal protein S3A (rps3a), mRNA 62 2e-06
63gb|BC078649.1| Danio rerio ribosomal protein S3A, mRNA (cDNA clo... 62 2e-06
64gb|DQ268856.1| Solanum tuberosum clone 174A02 cyc07-like protein... 62 2e-06
65gb|DQ268849.1| Solanum tuberosum clone 155F06 cyc07-like protein... 62 2e-06
66gb|DQ252485.1| Solanum tuberosum clone 048H05 cyc07-like mRNA, c... 62 2e-06
67gb|DQ268842.1| Solanum tuberosum clone 135C12 40S ribosomal prot... 58 3e-05
68dbj|D26058.1|CTRCYC07A Catharanthus roseus cyc07 gene, exon1-7, ... 58 3e-05
69emb|CR354380.7| Zebrafish DNA sequence from clone CH211-182L2 in... 56 1e-04
70emb|BX005068.13| Zebrafish DNA sequence from clone DKEY-40H17 in... 56 1e-04
71ref|XM_862563.1| PREDICTED: Canis familiaris Ribosomal protein S... 54 5e-04
72ref|XM_862552.1| PREDICTED: Canis familiaris Ribosomal protein S... 54 5e-04
73ref|XM_862541.1| PREDICTED: Canis familiaris Ribosomal protein S... 54 5e-04
74ref|XM_862533.1| PREDICTED: Canis familiaris Ribosomal protein S... 54 5e-04
75ref|XM_862525.1| PREDICTED: Canis familiaris Ribosomal protein S... 54 5e-04
76ref|XM_862515.1| PREDICTED: Canis familiaris Ribosomal protein S... 54 5e-04
77ref|XM_862504.1| PREDICTED: Canis familiaris Ribosomal protein S... 54 5e-04
78ref|XM_862496.1| PREDICTED: Canis familiaris Ribosomal protein S... 54 5e-04
79ref|XM_534275.2| PREDICTED: Canis familiaris Ribosomal protein S... 54 5e-04
80ref|XM_862466.1| PREDICTED: Canis familiaris Ribosomal protein S... 54 5e-04
81ref|XM_862454.1| PREDICTED: Canis familiaris Ribosomal protein S... 54 5e-04
82ref|XM_862446.1| PREDICTED: Canis familiaris Ribosomal protein S... 54 5e-04
83ref|XM_860742.1| PREDICTED: Canis familiaris similar to ribosoma... 54 5e-04
84ref|XM_860726.1| PREDICTED: Canis familiaris similar to ribosoma... 54 5e-04
85ref|XM_860710.1| PREDICTED: Canis familiaris similar to ribosoma... 54 5e-04
86ref|XM_860701.1| PREDICTED: Canis familiaris similar to ribosoma... 54 5e-04
87ref|XM_860686.1| PREDICTED: Canis familiaris similar to ribosoma... 54 5e-04
88ref|XM_847366.1| PREDICTED: Canis familiaris similar to ribosoma... 54 5e-04
89ref|XM_860652.1| PREDICTED: Canis familiaris similar to ribosoma... 54 5e-04
90ref|XM_856691.1| PREDICTED: Canis familiaris similar to ribosoma... 54 5e-04
91ref|XM_856663.1| PREDICTED: Canis familiaris similar to ribosoma... 54 5e-04
92ref|XM_856635.1| PREDICTED: Canis familiaris similar to ribosoma... 54 5e-04
93ref|XM_856605.1| PREDICTED: Canis familiaris similar to ribosoma... 54 5e-04
94ref|XM_856573.1| PREDICTED: Canis familiaris similar to ribosoma... 54 5e-04
95ref|XM_856546.1| PREDICTED: Canis familiaris similar to ribosoma... 54 5e-04
96ref|XM_856515.1| PREDICTED: Canis familiaris similar to ribosoma... 54 5e-04
97ref|XM_856484.1| PREDICTED: Canis familiaris similar to ribosoma... 54 5e-04
98ref|XM_856455.1| PREDICTED: Canis familiaris similar to ribosoma... 54 5e-04
99ref|XM_845382.1| PREDICTED: Canis familiaris similar to ribosoma... 54 5e-04
100ref|XM_856398.1| PREDICTED: Canis familiaris similar to ribosoma... 54 5e-04
101ref|XM_535263.2| PREDICTED: Canis familiaris similar to ribosoma... 54 5e-04
102gb|BC106115.1| Mus musculus ribosomal protein S3a, mRNA (cDNA cl... 52 0.002
103gb|AY643844.1|AY643842S3 Hordeum vulgare subsp. vulgare clones B... 52 0.002
104gb|AC156571.3| Mus musculus BAC clone RP23-264I19 from chromosom... 52 0.002
105gb|AC104414.8| Mus musculus chromosome 3, clone RP23-99I7, compl... 52 0.002
106gb|BC084675.1| Mus musculus ribosomal protein S3a, mRNA (cDNA cl... 52 0.002
107gb|BC083338.1| Mus musculus ribosomal protein S3a, mRNA (cDNA cl... 52 0.002
108ref|XM_871858.1| PREDICTED: Bos taurus similar to ribosomal prot... 52 0.002
109ref|XM_863937.1| PREDICTED: Bos taurus similar to ribosomal prot... 52 0.002
110ref|XM_871665.1| PREDICTED: Bos taurus similar to ribosomal prot... 52 0.002
111ref|XM_871576.1| PREDICTED: Bos taurus similar to ribosomal prot... 52 0.002
112ref|XM_872846.1| PREDICTED: Bos taurus similar to 40S ribosomal ... 52 0.002
113ref|XM_872754.1| PREDICTED: Bos taurus similar to 40S ribosomal ... 52 0.002
114ref|XM_593124.2| PREDICTED: Bos taurus similar to 40S ribosomal ... 52 0.002
115ref|XM_872539.1| PREDICTED: Bos taurus similar to 40S ribosomal ... 52 0.002
116ref|XM_872447.1| PREDICTED: Bos taurus similar to 40S ribosomal ... 52 0.002
117ref|XM_420443.1| PREDICTED: Gallus gallus similar to 40S ribosom... 52 0.002
118gb|AC133508.3| Mus musculus BAC clone RP23-383K24 from chromosom... 52 0.002
119ref|NM_016959.2| Mus musculus ribosomal protein S3a (Rps3a), mRNA 52 0.002
120ref|XM_974769.1| PREDICTED: Mus musculus similar to 40S ribosoma... 52 0.002
121ref|XM_994545.1| PREDICTED: Mus musculus similar to 40S ribosoma... 52 0.002
122ref|XR_002919.1| PREDICTED: Mus musculus similar to 40S ribosoma... 52 0.002
123ref|XR_002253.1| PREDICTED: Mus musculus similar to 40S ribosoma... 52 0.002
124ref|XR_005031.1| PREDICTED: Mus musculus similar to 40S ribosoma... 52 0.002
125emb|Z83368.1|MMRPS3A M.musculus RPS3a gene 52 0.002
126emb|AJ720257.1| Gallus gallus partial mRNA for hypothetical prot... 52 0.002
127gb|BC081451.1| Mus musculus ribosomal protein S3a, mRNA (cDNA cl... 52 0.002
128gb|AF402811.1| Ictalurus punctatus 40S ribosomal protein S3a mRN... 52 0.002
129dbj|AK146304.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length... 52 0.002
130dbj|AK135318.1| Mus musculus 12 days embryo male wolffian duct i... 52 0.002
131dbj|AK151982.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 52 0.002
132dbj|AK150814.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 52 0.002
133dbj|AK150796.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 52 0.002
134dbj|AK148513.1| Mus musculus adult pancreas islet cells cDNA, RI... 52 0.002
135dbj|AK151429.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 52 0.002
136dbj|AK150441.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 52 0.002
137dbj|AK166713.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 52 0.002
138dbj|AK153480.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 52 0.002
139dbj|AK167562.1| Mus musculus 11 days pregnant adult female place... 52 0.002
140dbj|AK167512.1| Mus musculus 11 days pregnant adult female place... 52 0.002
141dbj|AK159777.1| Mus musculus osteoclast-like cell cDNA, RIKEN fu... 52 0.002
142dbj|AK168240.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length... 52 0.002
143dbj|AK010605.1| Mus musculus ES cells cDNA, RIKEN full-length en... 52 0.002
144dbj|AK003158.1| Mus musculus 18-day embryo whole body cDNA, RIKE... 52 0.002
145dbj|AK088113.1| Mus musculus 2 days neonate thymus thymic cells ... 52 0.002
146dbj|AK050610.1| Mus musculus 2 days neonate thymus thymic cells ... 52 0.002
147gb|BC039659.1| Mus musculus ribosomal protein S3a, mRNA (cDNA cl... 52 0.002
148dbj|AK012345.1| Mus musculus 11 days embryo whole body cDNA, RIK... 52 0.002
149gb|AC112969.12| Mus musculus chromosome 8, clone RP24-331K7, com... 52 0.002
150dbj|AK196258.1| Mus musculus cDNA, clone:Y1G0121E15, strand:minu... 52 0.002
151emb|CT571277.10| Mouse DNA sequence from clone RP24-327L5 on chr... 52 0.002
152gb|AF042107.1|AF042107 Eimeria tenella ribosomal protein S3a mRN... 52 0.002
153emb|X68555.1|ACKRPA A.californica KRP-A gene 52 0.002
154emb|AL691416.9| Mouse DNA sequence from clone RP23-110I8 on chro... 52 0.002
155gb|DQ268835.1| Solanum tuberosum clone 115A11 cyc07-like protein... 52 0.002
156gb|DQ252490.1| Solanum tuberosum clone 059D09 cyc07-like mRNA, c... 52 0.002
157dbj|AB023436.1| Hordeum vulgare DNA, down stream region of HvNAS... 52 0.002
158gb|AY643842.1|AY643842S1 Hordeum vulgare subsp. vulgare clone BA... 50 0.008
159gb|BT012853.1| Lycopersicon esculentum clone 113933F, mRNA sequence 50 0.008
160ref|XM_505043.1| Yarrowia lipolytica CLIB122, YALI0F05676g predi... 50 0.008
161emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB1... 50 0.008
162ref|XM_875949.1| PREDICTED: Bos taurus similar to 40S ribosomal ... 46 0.13
163ref|XM_875867.1| PREDICTED: Bos taurus similar to 40S ribosomal ... 46 0.13
164ref|XM_875801.1| PREDICTED: Bos taurus similar to 40S ribosomal ... 46 0.13
165ref|XM_875730.1| PREDICTED: Bos taurus similar to 40S ribosomal ... 46 0.13
166ref|XM_875654.1| PREDICTED: Bos taurus similar to 40S ribosomal ... 46 0.13
167ref|XM_875583.1| PREDICTED: Bos taurus similar to 40S ribosomal ... 46 0.13
168ref|XM_865235.1| PREDICTED: Bos taurus similar to 40S ribosomal ... 46 0.13
169ref|XM_855573.1| PREDICTED: Canis familiaris similar to ribosoma... 46 0.13
170ref|XM_844989.1| PREDICTED: Canis familiaris similar to ribosoma... 46 0.13
171ref|XM_855510.1| PREDICTED: Canis familiaris similar to ribosoma... 46 0.13
172ref|XM_855476.1| PREDICTED: Canis familiaris similar to ribosoma... 46 0.13
173ref|XM_844705.1| PREDICTED: Canis familiaris similar to 40S ribo... 46 0.13
174ref|XM_851147.1| PREDICTED: Canis familiaris similar to ribosoma... 46 0.13
175ref|XM_851102.1| PREDICTED: Canis familiaris similar to ribosoma... 46 0.13
176ref|XM_851056.1| PREDICTED: Canis familiaris similar to ribosoma... 46 0.13
177ref|XM_843347.1| PREDICTED: Canis familiaris similar to ribosoma... 46 0.13
178ref|XM_843648.1| PREDICTED: Canis familiaris similar to ribosoma... 46 0.13
179ref|XM_535614.2| PREDICTED: Canis familiaris similar to ribosoma... 46 0.13
180ref|XM_534831.2| PREDICTED: Canis familiaris similar to ribosoma... 46 0.13
181ref|XM_859165.1| PREDICTED: Canis familiaris similar to ribosoma... 46 0.13
182ref|XM_859142.1| PREDICTED: Canis familiaris similar to ribosoma... 46 0.13
183ref|XM_534259.2| PREDICTED: Canis familiaris similar to ribosoma... 46 0.13
184ref|XM_846199.1| PREDICTED: Canis familiaris similar to ribosoma... 46 0.13
185ref|XM_519223.1| PREDICTED: Pan troglodytes similar to ribosomal... 44 0.50
186ref|XM_526720.1| PREDICTED: Pan troglodytes similar to Rps3a-pro... 44 0.50
187ref|NM_001034038.1| Bos taurus ribosomal protein S3A (RPS3A), mRNA 44 0.50
188ref|XM_868916.1| PREDICTED: Bos taurus similar to 40S ribosomal ... 44 0.50
189gb|BC058483.1| Rattus norvegicus ribosomal protein S3a, mRNA (cD... 44 0.50
190gb|AC093799.2| Homo sapiens BAC clone RP11-307C18 from 7, comple... 44 0.50
191ref|XR_003814.1| PREDICTED: Mus musculus similar to 40S ribosoma... 44 0.50
192gb|BC045105.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA cl... 44 0.50
193gb|BC023666.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA cl... 44 0.50
194emb|CR701956.2|CNS0G4KW Tetraodon nigroviridis full-length cDNA 44 0.50
195emb|CR655410.2|CNS0F4OO Tetraodon nigroviridis full-length cDNA 44 0.50
196gb|BC094829.1| Homo sapiens cDNA clone IMAGE:4647813, **** WARNI... 44 0.50
197gb|BC099924.1| Homo sapiens cDNA clone IMAGE:6371780, **** WARNI... 44 0.50
198gb|BC011660.1| Homo sapiens cDNA clone IMAGE:4120690, **** WARNI... 44 0.50
199gb|BC021075.1| Homo sapiens cDNA clone IMAGE:3530401, **** WARNI... 44 0.50
200gb|BC066926.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA cl... 44 0.50
201gb|BC004981.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA cl... 44 0.50
202emb|CR860858.1| Pongo pygmaeus mRNA; cDNA DKFZp469E172 (from clo... 44 0.50
203gb|AC095055.3| Homo sapiens BAC clone RP11-372K14 from 4, comple... 44 0.50
204gb|AC090771.4| Homo sapiens chromosome 18, clone RP11-795H16, co... 44 0.50
205gb|BC102789.1| Bos taurus ribosomal protein S3A, mRNA (cDNA clon... 44 0.50
206ref|XM_944491.1| PREDICTED: Homo sapiens similar to 40S ribosoma... 44 0.50
207ref|XM_944488.1| PREDICTED: Homo sapiens similar to 40S ribosoma... 44 0.50
208ref|XM_944486.1| PREDICTED: Homo sapiens similar to 40S ribosoma... 44 0.50
209ref|XM_940167.1| PREDICTED: Homo sapiens similar to 40S ribosoma... 44 0.50
210ref|XM_931855.1| PREDICTED: Homo sapiens similar to 40S ribosoma... 44 0.50
211ref|XM_931846.1| PREDICTED: Homo sapiens similar to 40S ribosoma... 44 0.50
212ref|XM_931841.1| PREDICTED: Homo sapiens similar to 40S ribosoma... 44 0.50
213ref|XM_927103.1| PREDICTED: Homo sapiens similar to 40S ribosoma... 44 0.50
214ref|XR_001455.1| PREDICTED: Homo sapiens similar to 40S ribosoma... 44 0.50
215ref|XR_001456.1| PREDICTED: Homo sapiens similar to ribosomal pr... 44 0.50
216ref|XR_001449.1| PREDICTED: Homo sapiens similar to ribosomal pr... 44 0.50
217ref|XM_943063.1| PREDICTED: Homo sapiens similar to 40S ribosoma... 44 0.50
218ref|XM_943058.1| PREDICTED: Homo sapiens similar to 40S ribosoma... 44 0.50
219ref|XM_943052.1| PREDICTED: Homo sapiens similar to 40S ribosoma... 44 0.50
220ref|XM_380021.2| PREDICTED: Homo sapiens similar to 40S ribosoma... 44 0.50
221ref|XM_936883.1| PREDICTED: Homo sapiens similar to 40S ribosoma... 44 0.50
222ref|XM_943039.1| PREDICTED: Homo sapiens similar to 40S ribosoma... 44 0.50
223dbj|AB169748.1| Macaca fascicularis brain cDNA, clone: QnpA-1570... 44 0.50
224gb|AC090621.10| Homo sapiens chromosome 18, clone RP11-396N11, c... 44 0.50
225gb|AC020925.8| Homo sapiens chromosome 5 clone CTD-2134K2, compl... 44 0.50
226gb|AY550961.1| Sparus aurata V-Fos transformation effector-like ... 44 0.50
227gb|AC010468.5|AC010468 Homo sapiens chromosome 5 clone CTD-2290C... 44 0.50
228ref|NM_017153.1| Rattus norvegicus ribosomal protein S3a (Rps3a)... 44 0.50
229gb|AY911372.1| Bos taurus clone IMAGE:7961511 ribosomal protein ... 44 0.50
230gb|BC001708.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA cl... 44 0.50
231gb|BC071916.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA cl... 44 0.50
232gb|BC017123.2| Homo sapiens ribosomal protein S3A, mRNA (cDNA cl... 44 0.50
233gb|BC030161.2| Homo sapiens ribosomal protein S3A, mRNA (cDNA cl... 44 0.50
234gb|BC019072.2| Homo sapiens ribosomal protein S3A, mRNA (cDNA cl... 44 0.50
235gb|BC000204.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA cl... 44 0.50
236gb|BC009219.2| Homo sapiens ribosomal protein S3A, mRNA (cDNA cl... 44 0.50
237gb|BC009404.2| Homo sapiens ribosomal protein S3A, mRNA (cDNA cl... 44 0.50
238dbj|AK129825.1| Homo sapiens cDNA FLJ26315 fis, clone DMC09112, ... 44 0.50
239gb|AC004841.2|AC004841 Homo sapiens PAC clone RP4-607J23 from 7q... 44 0.50
240ref|NM_001006.3| Homo sapiens ribosomal protein S3A (RPS3A), mRNA 44 0.50
241emb|X75161.1|RNRNAS3A R.norvegicus (Sprague-Dawley) mRNA for rib... 44 0.50
242emb|Z83334.1|HSZ83334 H.sapiens RPS3a gene 44 0.50
243dbj|AB099017.1| Bos taurus mRNA for similar to ribosomal protein... 44 0.50
244gb|AC129329.3| Mus musculus BAC clone RP23-43M12 from 10, comple... 44 0.50
245gb|BC070211.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA cl... 44 0.50
246gb|BC018954.2| Homo sapiens ribosomal protein S3A, mRNA (cDNA cl... 44 0.50
247gb|BC006298.2| Homo sapiens ribosomal protein S3A, mRNA (cDNA cl... 44 0.50
248emb|AL845262.3| Mouse DNA sequence from clone RP23-14N22 on chro... 44 0.50
249gb|M77234.1|HUMRPSA3A Human ribosomal protein S3a mRNA, complete... 44 0.50
250gb|M84711.1|HUMFTE1A Human v-fos transformation effector protein... 44 0.50
251emb|X87373.1|HSRPS3AGE Homo sapiens RPS3a gene for ribosomal pro... 44 0.50
252gb|M84716.1|RATVFOSPR R.norvegicus putative v-fos transformation... 44 0.50
253gb|L13802.1|HUMCH13C3A Homo sapiens (clone 03) liver expessed ri... 44 0.50
254ref|XM_637659.1| Dictyostelium discoideum 40S ribosomal protein ... 42 2.0
255ref|XM_508181.1| PREDICTED: Pan troglodytes similar to bA486O22.... 42 2.0
256gb|DQ214673.1| Taeniopygia guttata clone 0061P0008B04 ribosomal ... 42 2.0
257gb|DQ214672.1| Taeniopygia guttata clone 0058P0017B06 ribosomal ... 42 2.0
258gb|DQ214671.1| Taeniopygia guttata clone 0058P0045E12 ribosomal ... 42 2.0
259gb|DQ214670.1| Taeniopygia guttata clone 0058P0030H07 ribosomal ... 42 2.0
260gb|DQ214668.1| Taeniopygia guttata clone 0063P0025A12 ribosomal ... 42 2.0
261gb|AC116977.2| Dictyostelium discoideum chromosome 2 map 5515173... 42 2.0
262ref|XM_534535.2| PREDICTED: Canis familiaris similar to ribosoma... 42 2.0
263ref|XM_855228.1| PREDICTED: Canis familiaris similar to ribosoma... 42 2.0
264ref|XM_855188.1| PREDICTED: Canis familiaris similar to ribosoma... 42 2.0
265gb|BC047260.1| Xenopus laevis ribosomal protein S3a, mRNA (cDNA ... 42 2.0
266emb|CR680516.2|CNS0FO1C Tetraodon nigroviridis full-length cDNA 42 2.0
267emb|CR667565.2|CNS0FE2B Tetraodon nigroviridis full-length cDNA 42 2.0
268emb|AL356115.9| Human DNA sequence from clone RP11-486O22 on chr... 42 2.0
269ref|XM_937069.1| PREDICTED: Homo sapiens similar to ribosomal pr... 42 2.0
270ref|XM_943177.1| PREDICTED: Homo sapiens similar to ribosomal pr... 42 2.0
271ref|XM_943171.1| PREDICTED: Homo sapiens similar to ribosomal pr... 42 2.0
272ref|XM_926528.1| PREDICTED: Homo sapiens similar to ribosomal pr... 42 2.0
273ref|XM_931362.1| PREDICTED: Homo sapiens similar to ribosomal pr... 42 2.0
274ref|XM_495839.2| PREDICTED: Homo sapiens similar to ribosomal pr... 42 2.0
275gb|AC010545.9| Homo sapiens chromosome 16 clone RP11-449H11, com... 42 2.0
276gb|AY151152.1| Ilyanassa obsoleta 40S ribosomal protein-like pro... 42 2.0
277emb|BX546465.7| Mouse DNA sequence from clone RP23-167N13 on chr... 42 2.0
278gb|AC154699.2| Mus musculus BAC clone RP24-344D19 from 9, comple... 42 2.0
279emb|CT030695.5| Mouse DNA sequence from clone RP23-259F10 on chr... 42 2.0
280ref|XM_413713.1| PREDICTED: Gallus gallus similar to CPEB1 prote... 40 7.9
281ref|XM_458876.1| Debaryomyces hansenii CBS767 hypothetical prote... 40 7.9
282gb|AC126800.3| Mus musculus BAC clone RP24-447D19 from chromosom... 40 7.9
283ref|XM_858394.1| PREDICTED: Canis familiaris similar to ribosoma... 40 7.9
284ref|XM_855284.1| PREDICTED: Canis familiaris similar to ribosoma... 40 7.9
285ref|XM_855250.1| PREDICTED: Canis familiaris similar to ribosoma... 40 7.9
286ref|XM_844866.1| PREDICTED: Canis familiaris similar to ribosoma... 40 7.9
287ref|XM_855146.1| PREDICTED: Canis familiaris similar to ribosoma... 40 7.9
288gb|AY373965.1| Hyaloperonospora parasitica clone 72T-2G4 mRNA se... 40 7.9
289emb|AL589847.6| Human DNA sequence from clone RP13-477D10 on chr... 40 7.9
290gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome 40 7.9
291emb|CR382136.1| Debaryomyces hansenii chromosome D of strain CBS... 40 7.9
292dbj|AP006861.1| Chlamydophila felis Fe/C-56 DNA, complete genome 40 7.9
293dbj|AK156982.1| Mus musculus activated spleen cDNA, RIKEN full-l... 40 7.9
294ref|XM_938933.1| PREDICTED: Homo sapiens similar to 40S ribosoma... 40 7.9
295ref|XM_943962.1| PREDICTED: Homo sapiens similar to 40S ribosoma... 40 7.9
296ref|XM_929221.1| PREDICTED: Homo sapiens similar to 40S ribosoma... 40 7.9
297ref|XM_933511.1| PREDICTED: Homo sapiens similar to 40S ribosoma... 40 7.9
298gb|AY857460.1| Suberites domuncula S3a mRNA, complete cds 40 7.9
299gb|AC020898.6| Homo sapiens chromosome 5 clone CTC-451P13, compl... 40 7.9
300gb|AE006470.1| Chlorobium tepidum TLS, complete genome 40 7.9
301gb|AC093802.3| Homo sapiens BAC clone RP11-315F22 from 2, comple... 40 7.9
302gb|AE004471.1| Pseudomonas aeruginosa PAO1, section 32 of 529 of... 40 7.9
303dbj|AK208628.1| Mus musculus cDNA, clone:Y2G0112D21, strand:plus... 40 7.9
304dbj|AK208520.1| Mus musculus cDNA, clone:Y2G0111M05, strand:minu... 40 7.9
305dbj|AK207259.1| Mus musculus cDNA, clone:Y2G0107H03, strand:minu... 40 7.9
306dbj|AK200497.1| Mus musculus cDNA, clone:Y1G0134L23, strand:plus... 40 7.9
307dbj|AK190515.1| Mus musculus cDNA, clone:Y1G0102P22, strand:plus... 40 7.9
308emb|AJ563455.1|CGI563455 Crassostrea gigas partial mRNA for ribo... 40 7.9
309gb|AC154762.2| Mus musculus BAC clone RP24-418J10 from 16, compl... 40 7.9

>gb|AF542188.1| Triticum aestivum cyc07 mRNA, complete cds
          Length = 820

 Score =  432 bits (218), Expect = e-118
 Identities = 440/514 (85%)
 Strand = Plus / Plus

                                                                       
Query: 63  ccatggcggtcggcaagaacaagcgcatctcgaaaggtcggaagggaagcaaaaagaaaa 122
           ||||||||||||||||||||||||||||||| || ||  ||||||||||||| |||||  
Sbjct: 65  ccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggaagcaagaagaagg 124

                                                                       
Query: 123 cggtcgatcccttcaccaagaaggactggtatgacataaaggcgccgacgttgttcaaca 182
           | |||||||| |||||||||||| | ||||||||||| |||||||||  | |||||| ||
Sbjct: 125 ccgtcgatccgttcaccaagaagcagtggtatgacatcaaggcgccgctgctgttcacca 184

                                                                       
Query: 183 cccgcaacatcggcaagaccctcgtctccaggacacaggggaccaagattgcatctgagg 242
            ||||||| |||||||||||||||| |||||||| ||||| ||||||||||| || ||||
Sbjct: 185 gccgcaacgtcggcaagaccctcgtgtccaggacgcagggtaccaagattgcctcagagg 244

                                                                       
Query: 243 gtcttaagcacagagtttttgaggtttccttggcagacctccagggtgatgaggaccagg 302
           |||| |||||||| || || || || ||  | || || || |||   |||||||||||||
Sbjct: 245 gtctgaagcacagggtgttcgaagtatctctagctgatcttcagaacgatgaggaccagg 304

                                                                       
Query: 303 ctttcaggaagatcagacttcgtgcagaggatgtgcaaggaaagaatgttctcacaaact 362
           | | ||||||||||||||| ||||| |||||||||||||| | |||||| ||||||||||
Sbjct: 305 cctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaact 364

                                                                       
Query: 363 tttggggtatggatttcaccaccgacaagcttagatcacttgtaaggaagtggcagacac 422
           | ||||| ||||| |||||||| |||||||| || || ||||| ||||||||||||||||
Sbjct: 365 tctggggcatggacttcaccactgacaagctcaggtctcttgtgaggaagtggcagacac 424

                                                                       
Query: 423 taattgaggcccatgttgatgttaagaccactgacaattacatgctccggctgttctgca 482
           | |||||||| ||||| ||||| |||||||||||||| |||||||||||  |||||  ||
Sbjct: 425 tcattgaggctcatgtggatgtgaagaccactgacaactacatgctccgcatgttcgcca 484

                                                                       
Query: 483 ttggcttcactaagagacgtcccaaccaagtgaaacggacttgctatgctcaggcgagcc 542
           |||||||||| |||||||| || ||||| ||||| || ||||||||||| || || || |
Sbjct: 485 ttggcttcaccaagagacgcccaaaccaggtgaagcgcacttgctatgcccaagcaagtc 544

                                             
Query: 543 agatcagacagattcgccggaagatggttgagat 576
           ||||||||||||| ||||| ||||||||||||||
Sbjct: 545 agatcagacagatccgccgcaagatggttgagat 578



to top

>gb|AY290725.1| Triticum aestivum ribosomal protein S3a-like mRNA, partial sequence
          Length = 885

 Score =  394 bits (199), Expect = e-106
 Identities = 436/515 (84%), Gaps = 1/515 (0%)
 Strand = Plus / Plus

                                                                       
Query: 63  ccatggcggtcggcaagaacaagcgcatctcgaaaggtc-ggaagggaagcaaaaagaaa 121
           ||||||||||||||||||||||||||||||| || ||   ||||||||||||| ||||| 
Sbjct: 66  ccatggcggtcggcaagaacaagcgcatctccaagggggaggaagggaagcaagaagaag 125

                                                                       
Query: 122 acggtcgatcccttcaccaagaaggactggtatgacataaaggcgccgacgttgttcaac 181
            | |||||||| |||||||||||| | ||||||||||| |||||||||  | |||||| |
Sbjct: 126 gccgtcgatccgttcaccaagaagcagtggtatgacatcaaggcgccgctgctgttcacc 185

                                                                       
Query: 182 acccgcaacatcggcaagaccctcgtctccaggacacaggggaccaagattgcatctgag 241
           | ||||||| |||||||||||||||| |||||||| ||||| ||||||||||  || |||
Sbjct: 186 agccgcaacgtcggcaagaccctcgtgtccaggacgcagggtaccaagattgnctcagag 245

                                                                       
Query: 242 ggtcttaagcacagagtttttgaggtttccttggcagacctccagggtgatgaggaccag 301
           ||||| |||||||  || || || || ||  | || || || |||   ||||||||||||
Sbjct: 246 ggtctgaagcacanggtgttcgaagtatctctagctgatcttcagaacgatgaggaccag 305

                                                                       
Query: 302 gctttcaggaagatcagacttcgtgcagaggatgtgcaaggaaagaatgttctcacaaac 361
           || | ||||||||||||||| ||||| |||||||||||||| | |||||| |||||||||
Sbjct: 306 gcctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaac 365

                                                                       
Query: 362 ttttggggtatggatttcaccaccgacaagcttagatcacttgtaaggaagtggcagaca 421
           || ||||| ||||| |||||||| |||||||| |  || ||||| |||||||||||||||
Sbjct: 366 ttctggggcatggacttcaccactgacaagctcaagtctcttgtgaggaagtggcagaca 425

                                                                       
Query: 422 ctaattgaggcccatgttgatgttaagaccactgacaattacatgctccggctgttctgc 481
           || |||||||| ||||| ||||| |||||||||||||| |||||||||||  |||||  |
Sbjct: 426 ctcattgaggctcatgtggatgtgaagaccactgacaactacatgctccgcatgttcgcc 485

                                                                       
Query: 482 attggcttcactaagagacgtcccaaccaagtgaaacggacttgctatgctcaggcgagc 541
           ||||||||||| |||||||| || ||||| ||||| || ||||||||||| || || || 
Sbjct: 486 attggcttcaccaagagacgcccaaaccaggtgaagcgcacttgctatgcccaagcnagt 545

                                              
Query: 542 cagatcagacagattcgccggaagatggttgagat 576
           |||||||||||||| ||||| ||||||| ||||||
Sbjct: 546 cagatcagacagatccgccgcaagatggntgagat 580



to top

>dbj|D26060.1|RICT151 Oryza sativa mRNA for cyc07, complete cds
          Length = 1065

 Score =  353 bits (178), Expect = 4e-94
 Identities = 430/514 (83%)
 Strand = Plus / Plus

                                                                       
Query: 60  cagccatggcggtcggcaagaacaagcgcatctcgaaaggtcggaagggaagcaaaaaga 119
           |||||||||| || || ||||||||||||||||| || ||   |||||||  ||| ||||
Sbjct: 91  cagccatggccgtaggtaagaacaagcgcatctccaaggggaagaagggatccaagaaga 150

                                                                       
Query: 120 aaacggtcgatcccttcaccaagaaggactggtatgacataaaggcgccgacgttgttca 179
           | || |||||||||||  | ||||||||||||||||| || ||||| ||| || ||||||
Sbjct: 151 agaccgtcgatccctttgctaagaaggactggtatgatatcaaggccccgtcggtgttca 210

                                                                       
Query: 180 acacccgcaacatcggcaagaccctcgtctccaggacacaggggaccaagattgcatctg 239
           |    || |||||||||||||||||||| |||||||||||||| || |||||||| ||||
Sbjct: 211 atgtgcggaacatcggcaagaccctcgtgtccaggacacagggtacaaagattgcttctg 270

                                                                       
Query: 240 agggtcttaagcacagagtttttgaggtttccttggcagacctccagggtgatgaggacc 299
           |||| || ||||| ||||| |||||||| ||||| || || ||||||   |||||||| |
Sbjct: 271 agggcctaaagcatagagtgtttgaggtctccttagctgatctccagaacgatgaggatc 330

                                                                       
Query: 300 aggctttcaggaagatcagacttcgtgcagaggatgtgcaaggaaagaatgttctcacaa 359
           |||| | ||||||||||||||||||||| |||||||||||||| ||||| || ||||| |
Sbjct: 331 aggcgtacaggaagatcagacttcgtgctgaggatgtgcaagggaagaacgtgctcacca 390

                                                                       
Query: 360 acttttggggtatggatttcaccaccgacaagcttagatcacttgtaaggaagtggcaga 419
           |||||||||| |||   || || ||||| ||||| ||||||||||| | |||||||||||
Sbjct: 391 acttttggggcatgtcgtttactaccgataagctcagatcacttgttaagaagtggcaga 450

                                                                       
Query: 420 cactaattgaggcccatgttgatgttaagaccactgacaattacatgctccggctgttct 479
           |||| |||||||| ||||| ||||| || ||||| |||   |||||||| || |||||||
Sbjct: 451 cactgattgaggctcatgtggatgtcaaaaccacagacggctacatgctgcgtctgttct 510

                                                                       
Query: 480 gcattggcttcactaagagacgtcccaaccaagtgaaacggacttgctatgctcaggcga 539
           | || |||||||| ||| | || || ||||| |||||  |||||||||||||||| ||||
Sbjct: 511 gtatcggcttcaccaagcggcggcctaaccaggtgaagaggacttgctatgctcaagcga 570

                                             
Query: 540 gccagatcagacagattcgccggaagatggttga 573
           | ||||||||||||||||| || |||||||||||
Sbjct: 571 gtcagatcagacagattcgtcgcaagatggttga 604



to top

>dbj|AK104243.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-308-D02, full
           insert sequence
          Length = 1032

 Score =  353 bits (178), Expect = 4e-94
 Identities = 430/514 (83%)
 Strand = Plus / Plus

                                                                       
Query: 60  cagccatggcggtcggcaagaacaagcgcatctcgaaaggtcggaagggaagcaaaaaga 119
           |||||||||| || || ||||||||||||||||| || ||   |||||||  ||| ||||
Sbjct: 67  cagccatggccgtaggtaagaacaagcgcatctccaaggggaagaagggatccaagaaga 126

                                                                       
Query: 120 aaacggtcgatcccttcaccaagaaggactggtatgacataaaggcgccgacgttgttca 179
           | || |||||||||||  | ||||||||||||||||| || ||||| ||| || ||||||
Sbjct: 127 agaccgtcgatccctttgctaagaaggactggtatgatatcaaggccccgtcggtgttca 186

                                                                       
Query: 180 acacccgcaacatcggcaagaccctcgtctccaggacacaggggaccaagattgcatctg 239
           |    || |||||||||||||||||||| |||||||||||||| || |||||||| ||||
Sbjct: 187 atgtgcggaacatcggcaagaccctcgtgtccaggacacagggtacaaagattgcttctg 246

                                                                       
Query: 240 agggtcttaagcacagagtttttgaggtttccttggcagacctccagggtgatgaggacc 299
           |||| || ||||| ||||| |||||||| ||||| || || ||||||   |||||||| |
Sbjct: 247 agggcctaaagcatagagtgtttgaggtctccttagctgatctccagaacgatgaggatc 306

                                                                       
Query: 300 aggctttcaggaagatcagacttcgtgcagaggatgtgcaaggaaagaatgttctcacaa 359
           |||| | ||||||||||||||||||||| |||||||||||||| ||||| || ||||| |
Sbjct: 307 aggcgtacaggaagatcagacttcgtgctgaggatgtgcaagggaagaacgtgctcacca 366

                                                                       
Query: 360 acttttggggtatggatttcaccaccgacaagcttagatcacttgtaaggaagtggcaga 419
           |||||||||| |||   || || ||||| ||||| ||||||||||| | |||||||||||
Sbjct: 367 acttttggggcatgtcgtttactaccgataagctcagatcacttgttaagaagtggcaga 426

                                                                       
Query: 420 cactaattgaggcccatgttgatgttaagaccactgacaattacatgctccggctgttct 479
           |||| |||||||| ||||| ||||| || ||||| |||   |||||||| || |||||||
Sbjct: 427 cactgattgaggctcatgtggatgtcaaaaccacagacggctacatgctgcgtctgttct 486

                                                                       
Query: 480 gcattggcttcactaagagacgtcccaaccaagtgaaacggacttgctatgctcaggcga 539
           | || |||||||| ||| | || || ||||| |||||  |||||||||||||||| ||||
Sbjct: 487 gtatcggcttcaccaagcggcggcctaaccaggtgaagaggacttgctatgctcaagcga 546

                                             
Query: 540 gccagatcagacagattcgccggaagatggttga 573
           | ||||||||||||||||| || |||||||||||
Sbjct: 547 gtcagatcagacagattcgtcgcaagatggttga 580



to top

>dbj|AK069251.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023013H23, full
           insert sequence
          Length = 1097

 Score =  353 bits (178), Expect = 4e-94
 Identities = 430/514 (83%)
 Strand = Plus / Plus

                                                                       
Query: 60  cagccatggcggtcggcaagaacaagcgcatctcgaaaggtcggaagggaagcaaaaaga 119
           |||||||||| || || ||||||||||||||||| || ||   |||||||  ||| ||||
Sbjct: 68  cagccatggccgtaggtaagaacaagcgcatctccaaggggaagaagggatccaagaaga 127

                                                                       
Query: 120 aaacggtcgatcccttcaccaagaaggactggtatgacataaaggcgccgacgttgttca 179
           | || |||||||||||  | ||||||||||||||||| || ||||| ||| || ||||||
Sbjct: 128 agaccgtcgatccctttgctaagaaggactggtatgatatcaaggccccgtcggtgttca 187

                                                                       
Query: 180 acacccgcaacatcggcaagaccctcgtctccaggacacaggggaccaagattgcatctg 239
           |    || |||||||||||||||||||| |||||||||||||| || |||||||| ||||
Sbjct: 188 atgtgcggaacatcggcaagaccctcgtgtccaggacacagggtacaaagattgcttctg 247

                                                                       
Query: 240 agggtcttaagcacagagtttttgaggtttccttggcagacctccagggtgatgaggacc 299
           |||| || ||||| ||||| |||||||| ||||| || || ||||||   |||||||| |
Sbjct: 248 agggcctaaagcatagagtgtttgaggtctccttagctgatctccagaacgatgaggatc 307

                                                                       
Query: 300 aggctttcaggaagatcagacttcgtgcagaggatgtgcaaggaaagaatgttctcacaa 359
           |||| | ||||||||||||||||||||| |||||||||||||| ||||| || ||||| |
Sbjct: 308 aggcgtacaggaagatcagacttcgtgctgaggatgtgcaagggaagaacgtgctcacca 367

                                                                       
Query: 360 acttttggggtatggatttcaccaccgacaagcttagatcacttgtaaggaagtggcaga 419
           |||||||||| |||   || || ||||| ||||| ||||||||||| | |||||||||||
Sbjct: 368 acttttggggcatgtcgtttactaccgataagctcagatcacttgttaagaagtggcaga 427

                                                                       
Query: 420 cactaattgaggcccatgttgatgttaagaccactgacaattacatgctccggctgttct 479
           |||| |||||||| ||||| ||||| || ||||| |||   |||||||| || |||||||
Sbjct: 428 cactgattgaggctcatgtggatgtcaaaaccacagacggctacatgctgcgtctgttct 487

                                                                       
Query: 480 gcattggcttcactaagagacgtcccaaccaagtgaaacggacttgctatgctcaggcga 539
           | || |||||||| ||| | || || ||||| |||||  |||||||||||||||| ||||
Sbjct: 488 gtatcggcttcaccaagcggcggcctaaccaggtgaagaggacttgctatgctcaagcga 547

                                             
Query: 540 gccagatcagacagattcgccggaagatggttga 573
           | ||||||||||||||||| || |||||||||||
Sbjct: 548 gtcagatcagacagattcgtcgcaagatggttga 581



to top

>dbj|AK104699.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-C03, full
           insert sequence
          Length = 942

 Score =  331 bits (167), Expect = 1e-87
 Identities = 395/471 (83%)
 Strand = Plus / Plus

                                                                       
Query: 103 gaagggaagcaaaaagaaaacggtcgatcccttcaccaagaaggactggtatgacataaa 162
           |||||||  ||| ||||| || |||||||||||  | ||||||||||||||||| || ||
Sbjct: 20  gaagggatccaagaagaagaccgtcgatccctttgctaagaaggactggtatgatatcaa 79

                                                                       
Query: 163 ggcgccgacgttgttcaacacccgcaacatcggcaagaccctcgtctccaggacacaggg 222
           ||| ||| || |||||||    || |||||||||||||||||||| ||||||||||||||
Sbjct: 80  ggccccgtcggtgttcaatgtgcggaacatcggcaagaccctcgtgtccaggacacaggg 139

                                                                       
Query: 223 gaccaagattgcatctgagggtcttaagcacagagtttttgaggtttccttggcagacct 282
            || |||||||| |||||||| || ||||| ||||| |||||||| ||||| || || ||
Sbjct: 140 tacaaagattgcttctgagggcctaaagcatagagtgtttgaggtctccttagctgatct 199

                                                                       
Query: 283 ccagggtgatgaggaccaggctttcaggaagatcagacttcgtgcagaggatgtgcaagg 342
           ||||   |||||||| ||||| | ||||||||||||||||||||| ||||||||||||||
Sbjct: 200 ccagaacgatgaggatcaggcgtacaggaagatcagacttcgtgctgaggatgtgcaagg 259

                                                                       
Query: 343 aaagaatgttctcacaaacttttggggtatggatttcaccaccgacaagcttagatcact 402
            ||||| || ||||| ||||||||||| |||   || || ||||| ||||| ||||||||
Sbjct: 260 gaagaacgtgctcaccaacttttggggcatgtcgtttactaccgataagctcagatcact 319

                                                                       
Query: 403 tgtaaggaagtggcagacactaattgaggcccatgttgatgttaagaccactgacaatta 462
           ||| | ||||||||||||||| |||||||| ||||| ||||| || ||||| |||   ||
Sbjct: 320 tgttaagaagtggcagacactgattgaggctcatgtggatgtcaaaaccacagacggcta 379

                                                                       
Query: 463 catgctccggctgttctgcattggcttcactaagagacgtcccaaccaagtgaaacggac 522
           |||||| || |||||||| || |||||||| ||| | || || ||||| |||||  ||||
Sbjct: 380 catgctgcgtctgttctgtatcggcttcaccaagcggcggcctaaccaggtgaagaggac 439

                                                              
Query: 523 ttgctatgctcaggcgagccagatcagacagattcgccggaagatggttga 573
           |||||||||||| ||||| ||||||||||||||||| || |||||||||||
Sbjct: 440 ttgctatgctcaagcgagtcagatcagacagattcgtcgcaagatggttga 490



to top

>ref|XM_464995.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1063

 Score =  313 bits (158), Expect = 3e-82
 Identities = 428/518 (82%)
 Strand = Plus / Plus

                                                                       
Query: 59  gcagccatggcggtcggcaagaacaagcgcatctcgaaaggtcggaagggaagcaaaaag 118
           ||||||||||| || |||||||||||| | ||||| || ||  ||||||| ||||| |||
Sbjct: 30  gcagccatggccgtgggcaagaacaagaggatctccaagggcaggaagggcagcaagaag 89

                                                                       
Query: 119 aaaacggtcgatcccttcaccaagaaggactggtatgacataaaggcgccgacgttgttc 178
           || || |||||||||||  |||||||||| ||||| ||||| |||||||||||  |||||
Sbjct: 90  aagaccgtcgatcccttttccaagaaggattggtacgacatcaaggcgccgaccgtgttc 149

                                                                       
Query: 179 aacacccgcaacatcggcaagaccctcgtctccaggacacaggggaccaagattgcatct 238
             |  ||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 150 tccgtccgcaacatcggcaagaccctcgtctccaggacccaggggaccaagattgcatct 209

                                                                       
Query: 239 gagggtcttaagcacagagtttttgaggtttccttggcagacctccagggtgatgaggac 298
           |||||||| |||||  | || ||||| || |||||||| || || |||  ||| ||||| 
Sbjct: 210 gagggtctcaagcatcgtgtctttgaagtctccttggcggatcttcagaatgacgaggat 269

                                                                       
Query: 299 caggctttcaggaagatcagacttcgtgcagaggatgtgcaaggaaagaatgttctcaca 358
           ||||||| ||||||| | ||||||||||| |||||||| || || | |||||| ||||| 
Sbjct: 270 caggcttacaggaaggttagacttcgtgctgaggatgttcaggggaggaatgtcctcacg 329

                                                                       
Query: 359 aacttttggggtatggatttcaccaccgacaagcttagatcacttgtaaggaagtggcag 418
           || || ||||| |||  ||| ||||| ||||| ||||| ||  | || | ||| ||||| 
Sbjct: 330 aatttctggggcatgagttttaccacggacaaacttaggtccttggtcaagaaatggcaa 389

                                                                       
Query: 419 acactaattgaggcccatgttgatgttaagaccactgacaattacatgctccggctgttc 478
           ||| | ||||| |||||||| |||||||||||||| || || ||||||||||| ||||| 
Sbjct: 390 acattgattgaagcccatgtggatgttaagaccacagataactacatgctccgcctgttt 449

                                                                       
Query: 479 tgcattggcttcactaagagacgtcccaaccaagtgaaacggacttgctatgctcaggcg 538
           |||||||| ||||| ||| | || || || || ||||| || || || || |||||||| 
Sbjct: 450 tgcattggtttcaccaagcgccgcccaaatcaggtgaagcgtacctgttacgctcaggct 509

                                                 
Query: 539 agccagatcagacagattcgccggaagatggttgagat 576
           ||||||||| | ||||| ||||||||||||||||||||
Sbjct: 510 agccagatccggcagatccgccggaagatggttgagat 547



to top

>ref|XM_506775.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1115_D03.49
           mRNA
          Length = 1171

 Score =  313 bits (158), Expect = 3e-82
 Identities = 428/518 (82%)
 Strand = Plus / Plus

                                                                       
Query: 59  gcagccatggcggtcggcaagaacaagcgcatctcgaaaggtcggaagggaagcaaaaag 118
           ||||||||||| || |||||||||||| | ||||| || ||  ||||||| ||||| |||
Sbjct: 66  gcagccatggccgtgggcaagaacaagaggatctccaagggcaggaagggcagcaagaag 125

                                                                       
Query: 119 aaaacggtcgatcccttcaccaagaaggactggtatgacataaaggcgccgacgttgttc 178
           || || |||||||||||  |||||||||| ||||| ||||| |||||||||||  |||||
Sbjct: 126 aagaccgtcgatcccttttccaagaaggattggtacgacatcaaggcgccgaccgtgttc 185

                                                                       
Query: 179 aacacccgcaacatcggcaagaccctcgtctccaggacacaggggaccaagattgcatct 238
             |  ||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 186 tccgtccgcaacatcggcaagaccctcgtctccaggacccaggggaccaagattgcatct 245

                                                                       
Query: 239 gagggtcttaagcacagagtttttgaggtttccttggcagacctccagggtgatgaggac 298
           |||||||| |||||  | || ||||| || |||||||| || || |||  ||| ||||| 
Sbjct: 246 gagggtctcaagcatcgtgtctttgaagtctccttggcggatcttcagaatgacgaggat 305

                                                                       
Query: 299 caggctttcaggaagatcagacttcgtgcagaggatgtgcaaggaaagaatgttctcaca 358
           ||||||| ||||||| | ||||||||||| |||||||| || || | |||||| ||||| 
Sbjct: 306 caggcttacaggaaggttagacttcgtgctgaggatgttcaggggaggaatgtcctcacg 365

                                                                       
Query: 359 aacttttggggtatggatttcaccaccgacaagcttagatcacttgtaaggaagtggcag 418
           || || ||||| |||  ||| ||||| ||||| ||||| ||  | || | ||| ||||| 
Sbjct: 366 aatttctggggcatgagttttaccacggacaaacttaggtccttggtcaagaaatggcaa 425

                                                                       
Query: 419 acactaattgaggcccatgttgatgttaagaccactgacaattacatgctccggctgttc 478
           ||| | ||||| |||||||| |||||||||||||| || || ||||||||||| ||||| 
Sbjct: 426 acattgattgaagcccatgtggatgttaagaccacagataactacatgctccgcctgttt 485

                                                                       
Query: 479 tgcattggcttcactaagagacgtcccaaccaagtgaaacggacttgctatgctcaggcg 538
           |||||||| ||||| ||| | || || || || ||||| || || || || |||||||| 
Sbjct: 486 tgcattggtttcaccaagcgccgcccaaatcaggtgaagcgtacctgttacgctcaggct 545

                                                 
Query: 539 agccagatcagacagattcgccggaagatggttgagat 576
           ||||||||| | ||||| ||||||||||||||||||||
Sbjct: 546 agccagatccggcagatccgccggaagatggttgagat 583



to top

>dbj|AK099131.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023048M05, full
           insert sequence
          Length = 1063

 Score =  305 bits (154), Expect = 9e-80
 Identities = 427/518 (82%)
 Strand = Plus / Plus

                                                                       
Query: 59  gcagccatggcggtcggcaagaacaagcgcatctcgaaaggtcggaagggaagcaaaaag 118
           ||||||||||| || ||||||||| || | ||||| || ||  ||||||| ||||| |||
Sbjct: 30  gcagccatggccgtgggcaagaacgagaggatctccaagggcaggaagggcagcaagaag 89

                                                                       
Query: 119 aaaacggtcgatcccttcaccaagaaggactggtatgacataaaggcgccgacgttgttc 178
           || || |||||||||||  |||||||||| ||||| ||||| |||||||||||  |||||
Sbjct: 90  aagaccgtcgatcccttttccaagaaggattggtacgacatcaaggcgccgaccgtgttc 149

                                                                       
Query: 179 aacacccgcaacatcggcaagaccctcgtctccaggacacaggggaccaagattgcatct 238
             |  ||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 150 tccgtccgcaacatcggcaagaccctcgtctccaggacccaggggaccaagattgcatct 209

                                                                       
Query: 239 gagggtcttaagcacagagtttttgaggtttccttggcagacctccagggtgatgaggac 298
           |||||||| |||||  | || ||||| || |||||||| || || |||  ||| ||||| 
Sbjct: 210 gagggtctcaagcatcgtgtctttgaagtctccttggcggatcttcagaatgacgaggat 269

                                                                       
Query: 299 caggctttcaggaagatcagacttcgtgcagaggatgtgcaaggaaagaatgttctcaca 358
           ||||||| ||||||| | ||||||||||| |||||||| || || | |||||| ||||| 
Sbjct: 270 caggcttacaggaaggttagacttcgtgctgaggatgttcaggggaggaatgtcctcacg 329

                                                                       
Query: 359 aacttttggggtatggatttcaccaccgacaagcttagatcacttgtaaggaagtggcag 418
           || || ||||| |||  ||| ||||| ||||| ||||| ||  | || | ||| ||||| 
Sbjct: 330 aatttctggggcatgagttttaccacggacaaacttaggtccttggtcaagaaatggcaa 389

                                                                       
Query: 419 acactaattgaggcccatgttgatgttaagaccactgacaattacatgctccggctgttc 478
           ||| | ||||| |||||||| |||||||||||||| || || ||||||||||| ||||| 
Sbjct: 390 acattgattgaagcccatgtggatgttaagaccacagataactacatgctccgcctgttt 449

                                                                       
Query: 479 tgcattggcttcactaagagacgtcccaaccaagtgaaacggacttgctatgctcaggcg 538
           |||||||| ||||| ||| | || || || || ||||| || || || || |||||||| 
Sbjct: 450 tgcattggtttcaccaagcgccgcccaaatcaggtgaagcgtacctgttacgctcaggct 509

                                                 
Query: 539 agccagatcagacagattcgccggaagatggttgagat 576
           ||||||||| | ||||| ||||||||||||||||||||
Sbjct: 510 agccagatccggcagatccgccggaagatggttgagat 547



to top

>dbj|AK059647.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-031-C03, full
           insert sequence
          Length = 1171

 Score =  305 bits (154), Expect = 9e-80
 Identities = 427/518 (82%)
 Strand = Plus / Plus

                                                                       
Query: 59  gcagccatggcggtcggcaagaacaagcgcatctcgaaaggtcggaagggaagcaaaaag 118
           ||||||||||| || |||||||||||| | ||||| || ||  ||||||| ||||| |||
Sbjct: 66  gcagccatggccgtgggcaagaacaagaggatctccaagggcaggaagggcagcaagaag 125

                                                                       
Query: 119 aaaacggtcgatcccttcaccaagaaggactggtatgacataaaggcgccgacgttgttc 178
           || || |||||||||||  |||||||||| ||||| ||||| |||||||||||  |||||
Sbjct: 126 aagaccgtcgatcccttttccaagaaggattggtacgacatcaaggcgccgaccgtgttc 185

                                                                       
Query: 179 aacacccgcaacatcggcaagaccctcgtctccaggacacaggggaccaagattgcatct 238
             |  ||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 186 tccgtccgcaacatcggcaagaccctcgtctccaggacccaggggaccaagattgcatct 245

                                                                       
Query: 239 gagggtcttaagcacagagtttttgaggtttccttggcagacctccagggtgatgaggac 298
           |||||||| |||||  | || ||||| || |||||||| || || |||  ||| ||||| 
Sbjct: 246 gagggtctcaagcatcgtgtctttgaagtctccttggcggatcttcagaatgacgaggat 305

                                                                       
Query: 299 caggctttcaggaagatcagacttcgtgcagaggatgtgcaaggaaagaatgttctcaca 358
           ||||||| ||||||| | ||||||||||| |||||||| || || | |||||| ||||| 
Sbjct: 306 caggcttacaggaaggttagacttcgtgctgaggatgttcaggggaggaatgtcctcacg 365

                                                                       
Query: 359 aacttttggggtatggatttcaccaccgacaagcttagatcacttgtaaggaagtggcag 418
           || || ||||| |||  ||| ||||| ||||| ||||| ||  | || | ||| ||||| 
Sbjct: 366 aatttctggggcatgagttttaccacggacaaacttaggtccttggtcaagaaatggcaa 425

                                                                       
Query: 419 acactaattgaggcccatgttgatgttaagaccactgacaattacatgctccggctgttc 478
           ||| | ||||| |||||||| |||||||||||||| || || ||||||||||| ||||| 
Sbjct: 426 acattgattgaagcccatgtggatgttaagaccacagataactacatgctccgcctgttt 485

                                                                       
Query: 479 tgcattggcttcactaagagacgtcccaaccaagtgaaacggacttgctatgctcaggcg 538
           |||||||| ||||| ||| | || || || || ||||| || || || || |||||||| 
Sbjct: 486 tgcattggtttcaccaagcgccgcccaaatcaggtgaagcgtacctgttacgctcaggct 545

                                                 
Query: 539 agccagatcagacagattcgccggaagatggttgagat 576
           ||||||||| | ||||| | ||||||||||||||||||
Sbjct: 546 agccagatccggcagatcctccggaagatggttgagat 583



to top

>gb|AF052503.1|AF052503 Oryza sativa S-phase-specific ribosomal protein (RSPSP94) mRNA,
           complete cds
          Length = 1027

 Score =  276 bits (139), Expect = 8e-71
 Identities = 426/519 (82%), Gaps = 2/519 (0%)
 Strand = Plus / Plus

                                                                       
Query: 59  gcagccatggcggtcggcaagaacaagcgcatctcgaaaggtcggaagggaagcaaaaag 118
           ||||||||||| || |||||||||||| | ||||| || ||  ||||||| ||||| |||
Sbjct: 27  gcagccatggccgtgggcaagaacaagaggatctccaagggcaggaagggcagcaagaag 86

                                                                       
Query: 119 aaaacggtcgatcccttcaccaagaaggactggtatgacataaaggcgccgacgttgttc 178
           || || |||||||||||  |||||||||| ||||| ||||| |||||||||||  |||||
Sbjct: 87  aagaccgtcgatcccttttccaagaaggattggtacgacatcaaggcgccgaccgtgttc 146

                                                                       
Query: 179 aacacccgcaacatcggcaagaccctcgtctccaggacacaggggaccaagattgcatct 238
             |  ||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 147 tccgtccgcaacatcggcaagaccctcgtctccaggacccaggggaccaagattgcatct 206

                                                                       
Query: 239 gagggtcttaagcacagagtttttgaggtttccttggcagacctccagggtgatgaggac 298
           |||||||| |||||  | || ||||| || |||||||| || || | |  ||| ||||| 
Sbjct: 207 gagggtctcaagcatcgtgtctttgaagtctccttggcggatcttcggaatgacgaggat 266

                                                                       
Query: 299 caggctttcaggaagatcagacttcgtgcagaggatgtgcaaggaaagaatgttctcaca 358
           ||||||| ||||||| | ||||||||||| |||||||| || || | |||||| ||||| 
Sbjct: 267 caggcttacaggaaggttagacttcgtgctgaggatgttcaggggaggaatgtcctcacg 326

                                                                       
Query: 359 aacttttggggtatggatttcaccaccgacaagcttagatcacttgtaaggaagtggcag 418
           || || ||||| |||  ||| ||||| ||||| ||||| ||  | || | ||| ||||| 
Sbjct: 327 aatttctggggcatgagttttaccacggacaaacttaggtccttggtcaagaaatggcaa 386

                                                                       
Query: 419 acactaattgaggcccatgttgatgttaagaccactgacaattacatgctccggctgttc 478
           ||| | ||||| |||||||| |||||||||||||| || || ||||||||||| ||||| 
Sbjct: 387 acattgattgaagcccatgtggatgttaagaccacagataactacatgctccgcctgttt 446

                                                                       
Query: 479 tgcattggcttcactaagagacgtcccaaccaagtgaaacggacttgctatgctcaggcg 538
           |||||||| ||||| ||| | || || || || ||||| || || || || |||||||  
Sbjct: 447 tgcattggtttcaccaagcgccgcccaaatcaggtgaagcgtacctgttacgctcagg-t 505

                                                  
Query: 539 agccagatcagacagat-tcgccggaagatggttgagat 576
           ||||||||| | |||||  ||||||||||||||||||||
Sbjct: 506 agccagatccggcagatcccgccggaagatggttgagat 544



to top

>gb|BT016390.1| Zea mays clone Contig223 mRNA sequence
          Length = 1104

 Score =  270 bits (136), Expect = 5e-69
 Identities = 421/516 (81%)
 Strand = Plus / Plus

                                                                       
Query: 63  ccatggcggtcggcaagaacaagcgcatctcgaaaggtcggaagggaagcaaaaagaaaa 122
           ||||||| ||||| ||||||||| | ||||| || ||   ||||||  |||| || || |
Sbjct: 72  ccatggctgtcggaaagaacaagaggatctccaagggaaagaagggtggcaagaaaaaga 131

                                                                       
Query: 123 cggtcgatcccttcaccaagaaggactggtatgacataaaggcgccgacgttgttcaaca 182
           | ||||| || ||| | |||||||| ||||||||||| ||||| ||| || ||||||   
Sbjct: 132 ccgtcgaccctttctctaagaaggattggtatgacatcaaggcaccgtcggtgttcagtg 191

                                                                       
Query: 183 cccgcaacatcggcaagaccctcgtctccaggacacaggggaccaagattgcatctgagg 242
             ||||||||||| ||||| ||||| |||||||||||||| |||| |||||| |||||||
Sbjct: 192 tgcgcaacatcgggaagactctcgtatccaggacacagggtaccaggattgcttctgagg 251

                                                                       
Query: 243 gtcttaagcacagagtttttgaggtttccttggcagacctccagggtgatgaggaccagg 302
           |||| ||||||||||| |||||||||| | | || || || ||||| || ||||| || |
Sbjct: 252 gtctgaagcacagagtctttgaggtttgcctagctgatcttcagggcgacgaggatcaag 311

                                                                       
Query: 303 ctttcaggaagatcagacttcgtgcagaggatgtgcaaggaaagaatgttctcacaaact 362
           ||| |||||| ||||| || ||||| || |||||||| || | |||||| ||||||||||
Sbjct: 312 cttacaggaaaatcaggctccgtgctgaagatgtgcagggcaggaatgtgctcacaaact 371

                                                                       
Query: 363 tttggggtatggatttcaccaccgacaagcttagatcacttgtaaggaagtggcagacac 422
           ||||||||||| |||| ||||| || || || ||||| || || | ||||||||||||| 
Sbjct: 372 tttggggtatgaattttaccactgataaactgagatccctagtgaagaagtggcagacat 431

                                                                       
Query: 423 taattgaggcccatgttgatgttaagaccactgacaattacatgctccggctgttctgca 482
           |||| || |||||||||||||| ||||| || ||||| |||||| | ||  |||||||||
Sbjct: 432 taatcgaagcccatgttgatgtcaagacaaccgacaactacatgttgcgtttgttctgca 491

                                                                       
Query: 483 ttggcttcactaagagacgtcccaaccaagtgaaacggacttgctatgctcaggcgagcc 542
           | |||||||| ||||| || || |||||||| ||  | || ||||||||||||||   ||
Sbjct: 492 tcggcttcaccaagaggcgcccaaaccaagtcaagagaacctgctatgctcaggcatccc 551

                                               
Query: 543 agatcagacagattcgccggaagatggttgagatta 578
           ||||| | ||||| ||||| ||||||||||||||||
Sbjct: 552 agatccgtcagatccgccgaaagatggttgagatta 587



to top

>dbj|AK071037.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023079A13, full
           insert sequence
          Length = 1118

 Score =  262 bits (132), Expect = 1e-66
 Identities = 420/516 (81%)
 Strand = Plus / Plus

                                                                       
Query: 60  cagccatggcggtcggcaagaacaagcgcatctcgaaaggtcggaagggaagcaaaaaga 119
           |||||||||| ||||||||||||||||| |||||||| ||   |||||||  ||| ||||
Sbjct: 99  cagccatggccgtcggcaagaacaagcggatctcgaaggggaagaagggatccaagaaga 158

                                                                       
Query: 120 aaacggtcgatcccttcaccaagaaggactggtatgacataaaggcgccgacgttgttca 179
           | || |||||||| ||  | |||||||| |||||||| || ||||| ||| || ||||||
Sbjct: 159 agaccgtcgatccttttgcgaagaaggattggtatgatatcaaggccccgtcggtgttca 218

                                                                       
Query: 180 acacccgcaacatcggcaagaccctcgtctccaggacacaggggaccaagattgcatctg 239
           ||    | ||| |||| ||||| ||||| |||||||||||||| || |||||||| || |
Sbjct: 219 acgtgagaaacgtcgggaagacgctcgtgtccaggacacagggcacaaagattgcttcag 278

                                                                       
Query: 240 agggtcttaagcacagagtttttgaggtttccttggcagacctccagggtgatgaggacc 299
           |||| || |||||| | || |||||||| |||||||| || || |||   |||||||| |
Sbjct: 279 agggcctcaagcaccgtgtgtttgaggtctccttggctgatcttcagaacgatgaggatc 338

                                                                       
Query: 300 aggctttcaggaagatcagacttcgtgcagaggatgtgcaaggaaagaatgttctcacaa 359
           |||| | | | ||||||||||| ||||| ||||||||||| || || |||||||| ||||
Sbjct: 339 aggcgtaccgtaagatcagactacgtgccgaggatgtgcaggggaaaaatgttcttacaa 398

                                                                       
Query: 360 acttttggggtatggatttcaccaccgacaagcttagatcacttgtaaggaagtggcaga 419
           |||| ||||| |||  |||||| ||||||||||| |||||| | || | ||| |||||||
Sbjct: 399 acttctggggcatgagtttcacgaccgacaagctcagatcattggtcaagaaatggcaga 458

                                                                       
Query: 420 cactaattgaggcccatgttgatgttaagaccactgacaattacatgctccggctgttct 479
           | ||||| ||||| ||||| |||||  |||||||||| || |||||||| || || ||||
Sbjct: 459 cgctaatagaggctcatgtggatgtagagaccactgataactacatgctgcgtctcttct 518

                                                                       
Query: 480 gcattggcttcactaagagacgtcccaaccaagtgaaacggacttgctatgctcaggcga 539
           || |||||||||| |||||  | || || ||||| |||||||| ||||||||||| || |
Sbjct: 519 gcgttggcttcaccaagaggaggccaaatcaagtcaaacggacatgctatgctcaagcaa 578

                                               
Query: 540 gccagatcagacagattcgccggaagatggttgaga 575
           |||||||  ||||||| || || |||||||| ||||
Sbjct: 579 gccagattcgacagatccgtcgcaagatggtggaga 614



to top

>gb|DQ445133.1| Striga asiatica isolate St513 S phase protein mRNA, partial cds
          Length = 571

 Score =  184 bits (93), Expect = 2e-43
 Identities = 198/233 (84%)
 Strand = Plus / Plus

                                                                       
Query: 227 aagattgcatctgagggtcttaagcacagagtttttgaggtttccttggcagacctccag 286
           |||||||| ||||| ||||| |||||| | || |||||||| |||||||| ||||| || 
Sbjct: 4   aagattgcttctgaaggtctcaagcaccgtgtgtttgaggtgtccttggctgaccttcaa 63

                                                                       
Query: 287 ggtgatgaggaccaggctttcaggaagatcagacttcgtgcagaggatgtgcaaggaaag 346
           ||||||||||||||  | |||||||||||| |  |  | || || ||||| || ||||||
Sbjct: 64  ggtgatgaggaccactccttcaggaagatccgtttgagagctgaagatgttcagggaaag 123

                                                                       
Query: 347 aatgttctcacaaacttttggggtatggatttcaccaccgacaagcttagatcacttgta 406
           ||||||||||||||||| ||||| ||||||||||||||||||||||| ||||| || || 
Sbjct: 124 aatgttctcacaaacttctggggcatggatttcaccaccgacaagctgagatctctcgtg 183

                                                                
Query: 407 aggaagtggcagacactaattgaggcccatgttgatgttaagaccactgacaa 459
           ||||| |||||| ||||||||||||| ||||||||||| ||||| || |||||
Sbjct: 184 aggaaatggcagtcactaattgaggctcatgttgatgtcaagactaccgacaa 236



to top

>gb|AY109383.1| Zea mays CL7224_1 mRNA sequence
          Length = 1236

 Score =  159 bits (80), Expect = 1e-35
 Identities = 212/256 (82%)
 Strand = Plus / Minus

                                                                       
Query: 323 cgtgcagaggatgtgcaaggaaagaatgttctcacaaacttttggggtatggatttcacc 382
           ||||| || ||||||||||| | |||||| ||||||||||||||||||||| |||| |||
Sbjct: 863 cgtgctgaagatgtgcaaggcaggaatgtgctcacaaacttttggggtatgaattttacc 804

                                                                       
Query: 383 accgacaagcttagatcacttgtaaggaagtggcagacactaattgaggcccatgttgat 442
           || || || || ||||| || || | ||||||||||||| |||| || ||||||||||||
Sbjct: 803 actgataaactgagatccctagtgaagaagtggcagacattaatcgaagcccatgttgat 744

                                                                       
Query: 443 gttaagaccactgacaattacatgctccggctgttctgcattggcttcactaagagacgt 502
           || ||||| || ||||| |||||| | ||  |||||||||| |||||||| ||||| || 
Sbjct: 743 gtcaagacaaccgacaactacatgttgcgtttgttctgcatcggcttcaccaagaggcgc 684

                                                                       
Query: 503 cccaaccaagtgaaacggacttgctatgctcaggcgagccagatcagacagattcgccgg 562
           || ||||| || ||  | || ||||||||||||||   ||||||| | ||||| ||||| 
Sbjct: 683 ccaaaccaggtcaagagaacctgctatgctcaggcatcccagatccgtcagatccgccgt 624

                           
Query: 563 aagatggttgagatta 578
           ||||||||||||||||
Sbjct: 623 aagatggttgagatta 608



 Score =  105 bits (53), Expect = 2e-19
 Identities = 107/125 (85%)
 Strand = Plus / Minus

                                                                        
Query: 140  aagaaggactggtatgacataaaggcgccgacgttgttcaacacccgcaacatcggcaag 199
            |||||||| ||||||||||| ||||| ||| || ||||||     ||||||||||| |||
Sbjct: 1046 aagaaggattggtatgacatcaaggcaccgtcggtgttcagtgtgcgcaacatcgggaag 987

                                                                        
Query: 200  accctcgtctccaggacacaggggaccaagattgcatctgagggtcttaagcacagagtt 259
            || ||||| |||||||||||||| |||| |||||| ||||||||||| ||||||||||| 
Sbjct: 986  actctcgtatccaggacacagggtaccaggattgcttctgagggtctgaagcacagagtc 927

                 
Query: 260  tttga 264
            |||||
Sbjct: 926  tttga 922



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  125 bits (63), Expect = 2e-25
 Identities = 144/171 (84%)
 Strand = Plus / Plus

                                                                           
Query: 383     accgacaagcttagatcacttgtaaggaagtggcagacactaattgaggcccatgttgat 442
               ||||| ||||| ||||||||||| | ||||||||||||||| |||||||| ||||| |||
Sbjct: 5244594 accgataagctcagatcacttgttaagaagtggcagacactgattgaggctcatgtggat 5244653

                                                                           
Query: 443     gttaagaccactgacaattacatgctccggctgttctgcattggcttcactaagagacgt 502
               || || ||||| |||   |||||||| || |||||||| || |||||||| ||| | || 
Sbjct: 5244654 gtcaaaaccacagacggctacatgctgcgtctgttctgtatcggcttcaccaagcggcgg 5244713

                                                                  
Query: 503     cccaaccaagtgaaacggacttgctatgctcaggcgagccagatcagacag 553
               || ||||| |||||  |||||||||||||||| ||||| ||||||||||||
Sbjct: 5244714 cctaaccaggtgaagaggacttgctatgctcaagcgagtcagatcagacag 5244764



 Score =  121 bits (61), Expect = 3e-24
 Identities = 121/141 (85%)
 Strand = Plus / Plus

                                                                           
Query: 228     agattgcatctgagggtcttaagcacagagtttttgaggtttccttggcagacctccagg 287
               ||||||| |||||||| || ||||| ||||| |||||||| ||||| || || |||||| 
Sbjct: 5244369 agattgcttctgagggcctaaagcatagagtgtttgaggtctccttagctgatctccaga 5244428

                                                                           
Query: 288     gtgatgaggaccaggctttcaggaagatcagacttcgtgcagaggatgtgcaaggaaaga 347
                 |||||||| ||||| | ||||||||||||||||||||| |||||||||||||| ||||
Sbjct: 5244429 acgatgaggatcaggcgtacaggaagatcagacttcgtgctgaggatgtgcaagggaaga 5244488

                                    
Query: 348     atgttctcacaaacttttggg 368
               | || ||||| ||||||||||
Sbjct: 5244489 acgtgctcaccaacttttggg 5244509



 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 84/98 (85%)
 Strand = Plus / Plus

                                                                           
Query: 125     gtcgatcccttcaccaagaaggactggtatgacataaaggcgccgacgttgttcaacacc 184
               |||||||||||  | ||||||||||||||||| || ||||| ||| || |||||||    
Sbjct: 5243459 gtcgatccctttgctaagaaggactggtatgatatcaaggccccgtcggtgttcaatgtg 5243518

                                                     
Query: 185     cgcaacatcggcaagaccctcgtctccaggacacaggg 222
               || |||||||||||||||||||| ||||||||||||||
Sbjct: 5243519 cggaacatcggcaagaccctcgtgtccaggacacaggg 5243556



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                                 
Query: 60      cagccatggcggtcggcaagaacaagcgcatctc 93
               |||||||||| || || |||||||||||||||||
Sbjct: 5243276 cagccatggccgtaggtaagaacaagcgcatctc 5243309



to top

>gb|AC146581.1| Oryza sativa (japonica cultivar-group) Nipponbare strain chromosome 3
             clone OSJNBa0021H20, complete sequence
          Length = 133079

 Score =  125 bits (63), Expect = 2e-25
 Identities = 144/171 (84%)
 Strand = Plus / Plus

                                                                         
Query: 383   accgacaagcttagatcacttgtaaggaagtggcagacactaattgaggcccatgttgat 442
             ||||| ||||| ||||||||||| | ||||||||||||||| |||||||| ||||| |||
Sbjct: 67996 accgataagctcagatcacttgttaagaagtggcagacactgattgaggctcatgtggat 68055

                                                                         
Query: 443   gttaagaccactgacaattacatgctccggctgttctgcattggcttcactaagagacgt 502
             || || ||||| |||   |||||||| || |||||||| || |||||||| ||| | || 
Sbjct: 68056 gtcaaaaccacagacggctacatgctgcgtctgttctgtatcggcttcaccaagcggcgg 68115

                                                                
Query: 503   cccaaccaagtgaaacggacttgctatgctcaggcgagccagatcagacag 553
             || ||||| |||||  |||||||||||||||| ||||| ||||||||||||
Sbjct: 68116 cctaaccaggtgaagaggacttgctatgctcaagcgagtcagatcagacag 68166



 Score =  121 bits (61), Expect = 3e-24
 Identities = 121/141 (85%)
 Strand = Plus / Plus

                                                                         
Query: 228   agattgcatctgagggtcttaagcacagagtttttgaggtttccttggcagacctccagg 287
             ||||||| |||||||| || ||||| ||||| |||||||| ||||| || || |||||| 
Sbjct: 67771 agattgcttctgagggcctaaagcatagagtgtttgaggtctccttagctgatctccaga 67830

                                                                         
Query: 288   gtgatgaggaccaggctttcaggaagatcagacttcgtgcagaggatgtgcaaggaaaga 347
               |||||||| ||||| | ||||||||||||||||||||| |||||||||||||| ||||
Sbjct: 67831 acgatgaggatcaggcgtacaggaagatcagacttcgtgctgaggatgtgcaagggaaga 67890

                                  
Query: 348   atgttctcacaaacttttggg 368
             | || ||||| ||||||||||
Sbjct: 67891 acgtgctcaccaacttttggg 67911



 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 84/98 (85%)
 Strand = Plus / Plus

                                                                         
Query: 125   gtcgatcccttcaccaagaaggactggtatgacataaaggcgccgacgttgttcaacacc 184
             |||||||||||  | ||||||||||||||||| || ||||| ||| || |||||||    
Sbjct: 66861 gtcgatccctttgctaagaaggactggtatgatatcaaggccccgtcggtgttcaatgtg 66920

                                                   
Query: 185   cgcaacatcggcaagaccctcgtctccaggacacaggg 222
             || |||||||||||||||||||| ||||||||||||||
Sbjct: 66921 cggaacatcggcaagaccctcgtgtccaggacacaggg 66958



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                               
Query: 60    cagccatggcggtcggcaagaacaagcgcatctc 93
             |||||||||| || || |||||||||||||||||
Sbjct: 66678 cagccatggccgtaggtaagaacaagcgcatctc 66711



to top

>gb|AC115687.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBa0091J11, from chromosome 3, complete sequence
          Length = 181163

 Score =  125 bits (63), Expect = 2e-25
 Identities = 144/171 (84%)
 Strand = Plus / Minus

                                                                         
Query: 383   accgacaagcttagatcacttgtaaggaagtggcagacactaattgaggcccatgttgat 442
             ||||| ||||| ||||||||||| | ||||||||||||||| |||||||| ||||| |||
Sbjct: 11924 accgataagctcagatcacttgttaagaagtggcagacactgattgaggctcatgtggat 11865

                                                                         
Query: 443   gttaagaccactgacaattacatgctccggctgttctgcattggcttcactaagagacgt 502
             || || ||||| |||   |||||||| || |||||||| || |||||||| ||| | || 
Sbjct: 11864 gtcaaaaccacagacggctacatgctgcgtctgttctgtatcggcttcaccaagcggcgg 11805

                                                                
Query: 503   cccaaccaagtgaaacggacttgctatgctcaggcgagccagatcagacag 553
             || ||||| |||||  |||||||||||||||| ||||| ||||||||||||
Sbjct: 11804 cctaaccaggtgaagaggacttgctatgctcaagcgagtcagatcagacag 11754



 Score =  121 bits (61), Expect = 3e-24
 Identities = 121/141 (85%)
 Strand = Plus / Minus

                                                                         
Query: 228   agattgcatctgagggtcttaagcacagagtttttgaggtttccttggcagacctccagg 287
             ||||||| |||||||| || ||||| ||||| |||||||| ||||| || || |||||| 
Sbjct: 12149 agattgcttctgagggcctaaagcatagagtgtttgaggtctccttagctgatctccaga 12090

                                                                         
Query: 288   gtgatgaggaccaggctttcaggaagatcagacttcgtgcagaggatgtgcaaggaaaga 347
               |||||||| ||||| | ||||||||||||||||||||| |||||||||||||| ||||
Sbjct: 12089 acgatgaggatcaggcgtacaggaagatcagacttcgtgctgaggatgtgcaagggaaga 12030

                                  
Query: 348   atgttctcacaaacttttggg 368
             | || ||||| ||||||||||
Sbjct: 12029 acgtgctcaccaacttttggg 12009



 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 84/98 (85%)
 Strand = Plus / Minus

                                                                         
Query: 125   gtcgatcccttcaccaagaaggactggtatgacataaaggcgccgacgttgttcaacacc 184
             |||||||||||  | ||||||||||||||||| || ||||| ||| || |||||||    
Sbjct: 13059 gtcgatccctttgctaagaaggactggtatgatatcaaggccccgtcggtgttcaatgtg 13000

                                                   
Query: 185   cgcaacatcggcaagaccctcgtctccaggacacaggg 222
             || |||||||||||||||||||| ||||||||||||||
Sbjct: 12999 cggaacatcggcaagaccctcgtgtccaggacacaggg 12962



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                               
Query: 60    cagccatggcggtcggcaagaacaagcgcatctc 93
             |||||||||| || || |||||||||||||||||
Sbjct: 13242 cagccatggccgtaggtaagaacaagcgcatctc 13209



to top

>gb|DQ164221.1| Nicotiana tabacum cyc07 mRNA, complete cds
          Length = 786

 Score =  125 bits (63), Expect = 2e-25
 Identities = 303/383 (79%)
 Strand = Plus / Plus

                                                                       
Query: 194 ggcaagaccctcgtctccaggacacaggggaccaagattgcatctgagggtcttaagcac 253
           ||||||||||| ||| | ||||| ||||| || |||||||| || || || || ||||||
Sbjct: 130 ggcaagaccctggtcactaggactcagggtactaagattgcttcggaaggactaaagcac 189

                                                                       
Query: 254 agagtttttgaggtttccttggcagacctccagggtgatgaggaccaggctttcaggaag 313
           ||||| ||||| ||    ||||| || || |||   |||||||| ||  |||||||||||
Sbjct: 190 agagtatttgaagtcagtttggctgatcttcagaaggatgaggatcaatctttcaggaag 249

                                                                       
Query: 314 atcagacttcgtgcagaggatgtgcaaggaaagaatgttctcacaaacttttggggtatg 373
           ||| |  |  | ||||| ||||||||||| |||||||| ||||||||||| ||||| |||
Sbjct: 250 atccgcttgagggcagaagatgtgcaagggaagaatgtcctcacaaacttctggggaatg 309

                                                                       
Query: 374 gatttcaccaccgacaagcttagatcacttgtaaggaagtggcagacactaattgaggcc 433
           |||||||| || |||||| | || || || |||| ||||||||||||| | |||||||| 
Sbjct: 310 gatttcacaacagacaagttgaggtctctggtaaagaagtggcagacattgattgaggct 369

                                                                       
Query: 434 catgttgatgttaagaccactgacaattacatgctccggctgttctgcattggcttcact 493
           ||||| ||||| || || || || |  ||||  ||| || ||||||||||||  || || 
Sbjct: 370 catgtggatgtcaaaactacagatagctacactctcaggatgttctgcattgcttttaca 429

                                                                       
Query: 494 aagagacgtcccaaccaagtgaaacggacttgctatgctcaggcgagccagatcagacag 553
           |||| |||||| |||||   ||| ||||| || |||||||||   ||||||||| | |||
Sbjct: 430 aagaaacgtccaaaccagcagaagcggacatgttatgctcagagcagccagatccgtcag 489

                                  
Query: 554 attcgccggaagatggttgagat 576
           || || ||||| |||||||||||
Sbjct: 490 atccgtcggaaaatggttgagat 512



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 140 aagaaggactggtatgacataaaggc 165
           ||||||||||||||||||||||||||
Sbjct: 76  aagaaggactggtatgacataaaggc 101



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score =  125 bits (63), Expect = 2e-25
 Identities = 144/171 (84%)
 Strand = Plus / Minus

                                                                            
Query: 376      tttcaccaccgacaagcttagatcacttgtaaggaagtggcagacactaattgaggccca 435
                |||||| ||||||||||| |||||| | || | ||| |||||||| ||||| ||||| ||
Sbjct: 12315789 tttcacgaccgacaagctcagatcattggtcaagaaatggcagacgctaatagaggctca 12315730

                                                                            
Query: 436      tgttgatgttaagaccactgacaattacatgctccggctgttctgcattggcttcactaa 495
                ||| ||||| ||||||||||| || |||||||| || || ||||||||||||||||| ||
Sbjct: 12315729 tgtggatgtaaagaccactgataactacatgctgcgtctcttctgcattggcttcaccaa 12315670

                                                                   
Query: 496      gagacgtcccaaccaagtgaaacggacttgctatgctcaggcgagccagat 546
                |||  | || || ||||| |||||||| ||||||||||| || ||||||||
Sbjct: 12315669 gaggaggccaaatcaagtcaaacggacatgctatgctcaagcaagccagat 12315619



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 115/141 (81%)
 Strand = Plus / Minus

                                                                            
Query: 228      agattgcatctgagggtcttaagcacagagtttttgaggtttccttggcagacctccagg 287
                ||||||| || ||||| || |||||| | || |||||||| |||||||| || || ||| 
Sbjct: 12316009 agattgcttcagagggcctcaagcaccgtgtgtttgaggtctccttggctgatcttcaga 12315950

                                                                            
Query: 288      gtgatgaggaccaggctttcaggaagatcagacttcgtgcagaggatgtgcaaggaaaga 347
                  |||||||| ||||| | | | ||||||||||| ||||| ||||||||||| || || |
Sbjct: 12315949 acgatgaggatcaggcgtaccgtaagatcagactacgtgccgaggatgtgcaggggaaaa 12315890

                                     
Query: 348      atgttctcacaaacttttggg 368
                ||||||| |||||||| ||||
Sbjct: 12315889 atgttcttacaaacttctggg 12315869



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                     
Query: 60       cagccatggcggtcggcaagaacaagcgcatctcgaa 96
                |||||||||| ||||||||||||||||| ||||||||
Sbjct: 12318592 cagccatggccgtcggcaagaacaagcggatctcgaa 12318556



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 68/83 (81%)
 Strand = Plus / Minus

                                                                            
Query: 140      aagaaggactggtatgacataaaggcgccgacgttgttcaacacccgcaacatcggcaag 199
                |||||||| |||||||| || ||||| ||| || ||||||||    | ||| |||| |||
Sbjct: 12318400 aagaaggattggtatgatatcaaggccccgtcggtgttcaacgtgagaaacgtcgggaag 12318341

                                       
Query: 200      accctcgtctccaggacacaggg 222
                || ||||| ||||||||||||||
Sbjct: 12318340 acgctcgtgtccaggacacaggg 12318318



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  125 bits (63), Expect = 2e-25
 Identities = 144/171 (84%)
 Strand = Plus / Plus

                                                                           
Query: 383     accgacaagcttagatcacttgtaaggaagtggcagacactaattgaggcccatgttgat 442
               ||||| ||||| ||||||||||| | ||||||||||||||| |||||||| ||||| |||
Sbjct: 5243809 accgataagctcagatcacttgttaagaagtggcagacactgattgaggctcatgtggat 5243868

                                                                           
Query: 443     gttaagaccactgacaattacatgctccggctgttctgcattggcttcactaagagacgt 502
               || || ||||| |||   |||||||| || |||||||| || |||||||| ||| | || 
Sbjct: 5243869 gtcaaaaccacagacggctacatgctgcgtctgttctgtatcggcttcaccaagcggcgg 5243928

                                                                  
Query: 503     cccaaccaagtgaaacggacttgctatgctcaggcgagccagatcagacag 553
               || ||||| |||||  |||||||||||||||| ||||| ||||||||||||
Sbjct: 5243929 cctaaccaggtgaagaggacttgctatgctcaagcgagtcagatcagacag 5243979



 Score =  121 bits (61), Expect = 3e-24
 Identities = 121/141 (85%)
 Strand = Plus / Plus

                                                                           
Query: 228     agattgcatctgagggtcttaagcacagagtttttgaggtttccttggcagacctccagg 287
               ||||||| |||||||| || ||||| ||||| |||||||| ||||| || || |||||| 
Sbjct: 5243584 agattgcttctgagggcctaaagcatagagtgtttgaggtctccttagctgatctccaga 5243643

                                                                           
Query: 288     gtgatgaggaccaggctttcaggaagatcagacttcgtgcagaggatgtgcaaggaaaga 347
                 |||||||| ||||| | ||||||||||||||||||||| |||||||||||||| ||||
Sbjct: 5243644 acgatgaggatcaggcgtacaggaagatcagacttcgtgctgaggatgtgcaagggaaga 5243703

                                    
Query: 348     atgttctcacaaacttttggg 368
               | || ||||| ||||||||||
Sbjct: 5243704 acgtgctcaccaacttttggg 5243724



 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 84/98 (85%)
 Strand = Plus / Plus

                                                                           
Query: 125     gtcgatcccttcaccaagaaggactggtatgacataaaggcgccgacgttgttcaacacc 184
               |||||||||||  | ||||||||||||||||| || ||||| ||| || |||||||    
Sbjct: 5242674 gtcgatccctttgctaagaaggactggtatgatatcaaggccccgtcggtgttcaatgtg 5242733

                                                     
Query: 185     cgcaacatcggcaagaccctcgtctccaggacacaggg 222
               || |||||||||||||||||||| ||||||||||||||
Sbjct: 5242734 cggaacatcggcaagaccctcgtgtccaggacacaggg 5242771



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                                 
Query: 60      cagccatggcggtcggcaagaacaagcgcatctc 93
               |||||||||| || || |||||||||||||||||
Sbjct: 5242491 cagccatggccgtaggtaagaacaagcgcatctc 5242524



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score =  125 bits (63), Expect = 2e-25
 Identities = 144/171 (84%)
 Strand = Plus / Minus

                                                                            
Query: 376      tttcaccaccgacaagcttagatcacttgtaaggaagtggcagacactaattgaggccca 435
                |||||| ||||||||||| |||||| | || | ||| |||||||| ||||| ||||| ||
Sbjct: 12270159 tttcacgaccgacaagctcagatcattggtcaagaaatggcagacgctaatagaggctca 12270100

                                                                            
Query: 436      tgttgatgttaagaccactgacaattacatgctccggctgttctgcattggcttcactaa 495
                ||| ||||| ||||||||||| || |||||||| || || ||||||||||||||||| ||
Sbjct: 12270099 tgtggatgtaaagaccactgataactacatgctgcgtctcttctgcattggcttcaccaa 12270040

                                                                   
Query: 496      gagacgtcccaaccaagtgaaacggacttgctatgctcaggcgagccagat 546
                |||  | || || ||||| |||||||| ||||||||||| || ||||||||
Sbjct: 12270039 gaggaggccaaatcaagtcaaacggacatgctatgctcaagcaagccagat 12269989



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 115/141 (81%)
 Strand = Plus / Minus

                                                                            
Query: 228      agattgcatctgagggtcttaagcacagagtttttgaggtttccttggcagacctccagg 287
                ||||||| || ||||| || |||||| | || |||||||| |||||||| || || ||| 
Sbjct: 12270379 agattgcttcagagggcctcaagcaccgtgtgtttgaggtctccttggctgatcttcaga 12270320

                                                                            
Query: 288      gtgatgaggaccaggctttcaggaagatcagacttcgtgcagaggatgtgcaaggaaaga 347
                  |||||||| ||||| | | | ||||||||||| ||||| ||||||||||| || || |
Sbjct: 12270319 acgatgaggatcaggcgtaccgtaagatcagactacgtgccgaggatgtgcaggggaaaa 12270260

                                     
Query: 348      atgttctcacaaacttttggg 368
                ||||||| |||||||| ||||
Sbjct: 12270259 atgttcttacaaacttctggg 12270239



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                     
Query: 60       cagccatggcggtcggcaagaacaagcgcatctcgaa 96
                |||||||||| ||||||||||||||||| ||||||||
Sbjct: 12272962 cagccatggccgtcggcaagaacaagcggatctcgaa 12272926



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 68/83 (81%)
 Strand = Plus / Minus

                                                                            
Query: 140      aagaaggactggtatgacataaaggcgccgacgttgttcaacacccgcaacatcggcaag 199
                |||||||| |||||||| || ||||| ||| || ||||||||    | ||| |||| |||
Sbjct: 12272770 aagaaggattggtatgatatcaaggccccgtcggtgttcaacgtgagaaacgtcgggaag 12272711

                                       
Query: 200      accctcgtctccaggacacaggg 222
                || ||||| ||||||||||||||
Sbjct: 12272710 acgctcgtgtccaggacacaggg 12272688



to top

>emb|AL713942.4|CNS07YPB Oryza sativa chromosome 12, . BAC OSJNBa0009F05 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 163702

 Score =  125 bits (63), Expect = 2e-25
 Identities = 144/171 (84%)
 Strand = Plus / Minus

                                                                         
Query: 376   tttcaccaccgacaagcttagatcacttgtaaggaagtggcagacactaattgaggccca 435
             |||||| ||||||||||| |||||| | || | ||| |||||||| ||||| ||||| ||
Sbjct: 30154 tttcacgaccgacaagctcagatcattggtcaagaaatggcagacgctaatagaggctca 30095

                                                                         
Query: 436   tgttgatgttaagaccactgacaattacatgctccggctgttctgcattggcttcactaa 495
             ||| ||||| ||||||||||| || |||||||| || || ||||||||||||||||| ||
Sbjct: 30094 tgtggatgtaaagaccactgataactacatgctgcgtctcttctgcattggcttcaccaa 30035

                                                                
Query: 496   gagacgtcccaaccaagtgaaacggacttgctatgctcaggcgagccagat 546
             |||  | || || ||||| |||||||| ||||||||||| || ||||||||
Sbjct: 30034 gaggaggccaaatcaagtcaaacggacatgctatgctcaagcaagccagat 29984



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 115/141 (81%)
 Strand = Plus / Minus

                                                                         
Query: 228   agattgcatctgagggtcttaagcacagagtttttgaggtttccttggcagacctccagg 287
             ||||||| || ||||| || |||||| | || |||||||| |||||||| || || ||| 
Sbjct: 30374 agattgcttcagagggcctcaagcaccgtgtgtttgaggtctccttggctgatcttcaga 30315

                                                                         
Query: 288   gtgatgaggaccaggctttcaggaagatcagacttcgtgcagaggatgtgcaaggaaaga 347
               |||||||| ||||| | | | ||||||||||| ||||| ||||||||||| || || |
Sbjct: 30314 acgatgaggatcaggcgtaccgtaagatcagactacgtgccgaggatgtgcaggggaaaa 30255

                                  
Query: 348   atgttctcacaaacttttggg 368
             ||||||| |||||||| ||||
Sbjct: 30254 atgttcttacaaacttctggg 30234



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                  
Query: 60    cagccatggcggtcggcaagaacaagcgcatctcgaa 96
             |||||||||| ||||||||||||||||| ||||||||
Sbjct: 32957 cagccatggccgtcggcaagaacaagcggatctcgaa 32921



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 68/83 (81%)
 Strand = Plus / Minus

                                                                         
Query: 140   aagaaggactggtatgacataaaggcgccgacgttgttcaacacccgcaacatcggcaag 199
             |||||||| |||||||| || ||||| ||| || ||||||||    | ||| |||| |||
Sbjct: 32765 aagaaggattggtatgatatcaaggccccgtcggtgttcaacgtgagaaacgtcgggaag 32706

                                    
Query: 200   accctcgtctccaggacacaggg 222
             || ||||| ||||||||||||||
Sbjct: 32705 acgctcgtgtccaggacacaggg 32683



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  113 bits (57), Expect = 7e-22
 Identities = 93/105 (88%)
 Strand = Plus / Minus

                                                                            
Query: 125      gtcgatcccttcaccaagaaggactggtatgacataaaggcgccgacgttgttcaacacc 184
                |||||||||||  |||||||||| ||||| ||||| |||||||||||  |||||  |  |
Sbjct: 10824500 gtcgatcccttttccaagaaggattggtacgacatcaaggcgccgaccgtgttctccgtc 10824441

                                                             
Query: 185      cgcaacatcggcaagaccctcgtctccaggacacaggggaccaag 229
                |||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 10824440 cgcaacatcggcaagaccctcgtctccaggacccaggggaccaag 10824396



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 102/123 (82%)
 Strand = Plus / Minus

                                                                            
Query: 425      attgaggcccatgttgatgttaagaccactgacaattacatgctccggctgttctgcatt 484
                ||||| |||||||| |||||||||||||| || || ||||||||||| ||||| ||||||
Sbjct: 10823493 attgaagcccatgtggatgttaagaccacagataactacatgctccgcctgttttgcatt 10823434

                                                                            
Query: 485      ggcttcactaagagacgtcccaaccaagtgaaacggacttgctatgctcaggcgagccag 544
                || ||||| ||| | || || || || ||||| || || || || |||||||| ||||||
Sbjct: 10823433 ggtttcaccaagcgccgcccaaatcaggtgaagcgtacctgttacgctcaggctagccag 10823374

                   
Query: 545      atc 547
                |||
Sbjct: 10823373 atc 10823371



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 107/130 (82%)
 Strand = Plus / Minus

                                                                            
Query: 228      agattgcatctgagggtcttaagcacagagtttttgaggtttccttggcagacctccagg 287
                ||||||||||||||||||| |||||  | || ||||| || |||||||| || || ||| 
Sbjct: 10823785 agattgcatctgagggtctcaagcatcgtgtctttgaagtctccttggcggatcttcaga 10823726

                                                                            
Query: 288      gtgatgaggaccaggctttcaggaagatcagacttcgtgcagaggatgtgcaaggaaaga 347
                 ||| ||||| ||||||| ||||||| | ||||||||||| |||||||| || || | ||
Sbjct: 10823725 atgacgaggatcaggcttacaggaaggttagacttcgtgctgaggatgttcaggggagga 10823666

                          
Query: 348      atgttctcac 357
                |||| |||||
Sbjct: 10823665 atgtcctcac 10823656



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                            
Query: 59       gcagccatggcggtcggcaagaacaagcgcatctcgaaaggtcggaagggaagcaaaaag 118
                ||||||||||| || |||||||||||| | ||||| || ||  ||||||| ||||| |||
Sbjct: 10824698 gcagccatggccgtgggcaagaacaagaggatctccaagggcaggaagggcagcaagaag 10824639

                  
Query: 119      aa 120
                ||
Sbjct: 10824638 aa 10824637



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 552      agattcgccggaagatggttgagat 576
                |||| ||||||||||||||||||||
Sbjct: 10823258 agatccgccggaagatggttgagat 10823234



to top

>gb|AY849388.1| Vitis vinifera cultivar Riesling cyc07 mRNA, partial cds
          Length = 879

 Score =  113 bits (57), Expect = 7e-22
 Identities = 189/233 (81%)
 Strand = Plus / Plus

                                                                       
Query: 218 caggggaccaagattgcatctgagggtcttaagcacagagtttttgaggtttccttggca 277
           ||||| ||||||||||| ||||| || || ||||||||||| | || | |||||||||| 
Sbjct: 88  cagggaaccaagattgcctctgaagggctcaagcacagagtgtctgggatttccttggct 147

                                                                       
Query: 278 gacctccagggtgatgaggaccaggctttcaggaagatcagacttcgtgcagaggatgtg 337
           || || |||   |||||||| |  || | |||||||||| ||||  | || |||||||||
Sbjct: 148 gatcttcagaacgatgaggatcgtgcctacaggaagatccgactgagagctgaggatgtg 207

                                                                       
Query: 338 caaggaaagaatgttctcacaaacttttggggtatggatttcaccaccgacaagcttaga 397
           |||||||||||||| ||||||||||| ||||| ||||| || || || |||||||| || 
Sbjct: 208 caaggaaagaatgtcctcacaaacttctggggaatggactttacaacagacaagctgagg 267

                                                                
Query: 398 tcacttgtaaggaagtggcagacactaattgaggcccatgttgatgttaagac 450
           ||  | ||  | |||||||||||| | |||||||| ||||| |||||||||||
Sbjct: 268 tctttggtgcgcaagtggcagacattgattgaggctcatgtggatgttaagac 320



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 140 aagaaggactggtatgacataaaggcgcc 168
           |||||||||||||||||||| ||||||||
Sbjct: 10  aagaaggactggtatgacattaaggcgcc 38



to top

>dbj|AP004168.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1756_H07
          Length = 217205

 Score =  113 bits (57), Expect = 7e-22
 Identities = 93/105 (88%)
 Strand = Plus / Minus

                                                                         
Query: 125   gtcgatcccttcaccaagaaggactggtatgacataaaggcgccgacgttgttcaacacc 184
             |||||||||||  |||||||||| ||||| ||||| |||||||||||  |||||  |  |
Sbjct: 30699 gtcgatcccttttccaagaaggattggtacgacatcaaggcgccgaccgtgttctccgtc 30640

                                                          
Query: 185   cgcaacatcggcaagaccctcgtctccaggacacaggggaccaag 229
             |||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 30639 cgcaacatcggcaagaccctcgtctccaggacccaggggaccaag 30595



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 102/123 (82%)
 Strand = Plus / Minus

                                                                         
Query: 425   attgaggcccatgttgatgttaagaccactgacaattacatgctccggctgttctgcatt 484
             ||||| |||||||| |||||||||||||| || || ||||||||||| ||||| ||||||
Sbjct: 29692 attgaagcccatgtggatgttaagaccacagataactacatgctccgcctgttttgcatt 29633

                                                                         
Query: 485   ggcttcactaagagacgtcccaaccaagtgaaacggacttgctatgctcaggcgagccag 544
             || ||||| ||| | || || || || ||||| || || || || |||||||| ||||||
Sbjct: 29632 ggtttcaccaagcgccgcccaaatcaggtgaagcgtacctgttacgctcaggctagccag 29573

                
Query: 545   atc 547
             |||
Sbjct: 29572 atc 29570



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 107/130 (82%)
 Strand = Plus / Minus

                                                                         
Query: 228   agattgcatctgagggtcttaagcacagagtttttgaggtttccttggcagacctccagg 287
             ||||||||||||||||||| |||||  | || ||||| || |||||||| || || ||| 
Sbjct: 29984 agattgcatctgagggtctcaagcatcgtgtctttgaagtctccttggcggatcttcaga 29925

                                                                         
Query: 288   gtgatgaggaccaggctttcaggaagatcagacttcgtgcagaggatgtgcaaggaaaga 347
              ||| ||||| ||||||| ||||||| | ||||||||||| |||||||| || || | ||
Sbjct: 29924 atgacgaggatcaggcttacaggaaggttagacttcgtgctgaggatgttcaggggagga 29865

                       
Query: 348   atgttctcac 357
             |||| |||||
Sbjct: 29864 atgtcctcac 29855



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                         
Query: 59    gcagccatggcggtcggcaagaacaagcgcatctcgaaaggtcggaagggaagcaaaaag 118
             ||||||||||| || |||||||||||| | ||||| || ||  ||||||| ||||| |||
Sbjct: 30897 gcagccatggccgtgggcaagaacaagaggatctccaagggcaggaagggcagcaagaag 30838

               
Query: 119   aa 120
             ||
Sbjct: 30837 aa 30836



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 552   agattcgccggaagatggttgagat 576
             |||| ||||||||||||||||||||
Sbjct: 29457 agatccgccggaagatggttgagat 29433



to top

>dbj|AP004001.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OJ1115_D03
          Length = 169378

 Score =  113 bits (57), Expect = 7e-22
 Identities = 93/105 (88%)
 Strand = Plus / Minus

                                                                          
Query: 125    gtcgatcccttcaccaagaaggactggtatgacataaaggcgccgacgttgttcaacacc 184
              |||||||||||  |||||||||| ||||| ||||| |||||||||||  |||||  |  |
Sbjct: 163981 gtcgatcccttttccaagaaggattggtacgacatcaaggcgccgaccgtgttctccgtc 163922

                                                           
Query: 185    cgcaacatcggcaagaccctcgtctccaggacacaggggaccaag 229
              |||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 163921 cgcaacatcggcaagaccctcgtctccaggacccaggggaccaag 163877



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 102/123 (82%)
 Strand = Plus / Minus

                                                                          
Query: 425    attgaggcccatgttgatgttaagaccactgacaattacatgctccggctgttctgcatt 484
              ||||| |||||||| |||||||||||||| || || ||||||||||| ||||| ||||||
Sbjct: 162974 attgaagcccatgtggatgttaagaccacagataactacatgctccgcctgttttgcatt 162915

                                                                          
Query: 485    ggcttcactaagagacgtcccaaccaagtgaaacggacttgctatgctcaggcgagccag 544
              || ||||| ||| | || || || || ||||| || || || || |||||||| ||||||
Sbjct: 162914 ggtttcaccaagcgccgcccaaatcaggtgaagcgtacctgttacgctcaggctagccag 162855

                 
Query: 545    atc 547
              |||
Sbjct: 162854 atc 162852



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 107/130 (82%)
 Strand = Plus / Minus

                                                                          
Query: 228    agattgcatctgagggtcttaagcacagagtttttgaggtttccttggcagacctccagg 287
              ||||||||||||||||||| |||||  | || ||||| || |||||||| || || ||| 
Sbjct: 163266 agattgcatctgagggtctcaagcatcgtgtctttgaagtctccttggcggatcttcaga 163207

                                                                          
Query: 288    gtgatgaggaccaggctttcaggaagatcagacttcgtgcagaggatgtgcaaggaaaga 347
               ||| ||||| ||||||| ||||||| | ||||||||||| |||||||| || || | ||
Sbjct: 163206 atgacgaggatcaggcttacaggaaggttagacttcgtgctgaggatgttcaggggagga 163147

                        
Query: 348    atgttctcac 357
              |||| |||||
Sbjct: 163146 atgtcctcac 163137



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                          
Query: 59     gcagccatggcggtcggcaagaacaagcgcatctcgaaaggtcggaagggaagcaaaaag 118
              ||||||||||| || |||||||||||| | ||||| || ||  ||||||| ||||| |||
Sbjct: 164179 gcagccatggccgtgggcaagaacaagaggatctccaagggcaggaagggcagcaagaag 164120

                
Query: 119    aa 120
              ||
Sbjct: 164119 aa 164118



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 552    agattcgccggaagatggttgagat 576
              |||| ||||||||||||||||||||
Sbjct: 162739 agatccgccggaagatggttgagat 162715



to top

>dbj|AB029635.1| Daucus carota mRNA for cyc07, complete cds
          Length = 1050

 Score =  109 bits (55), Expect = 1e-20
 Identities = 193/239 (80%)
 Strand = Plus / Plus

                                                                       
Query: 218 caggggaccaagattgcatctgagggtcttaagcacagagtttttgaggtttccttggca 277
           ||||| ||||||||||| ||||| || || || ||| |||| || ||||||| | | || 
Sbjct: 175 cagggtaccaagattgcttctgaaggactcaaacaccgagtgttcgaggtttgccttgct 234

                                                                       
Query: 278 gacctccagggtgatgaggaccaggctttcaggaagatcagacttcgtgcagaggatgtg 337
           ||||| ||||| ||||||||||||||||  ||||||||  | ||  | ||||||||||||
Sbjct: 235 gaccttcagggagatgaggaccaggcttataggaagattcgcctgagagcagaggatgtg 294

                                                                       
Query: 338 caaggaaagaatgttctcacaaacttttggggtatggatttcaccaccgacaagcttaga 397
           ||||| |||||||| || |||||||| |  || ||||| ||||| || |||||| | || 
Sbjct: 295 caagggaagaatgtgcttacaaacttctatggaatggacttcacaactgacaagttgagg 354

                                                                      
Query: 398 tcacttgtaaggaagtggcagacactaattgaggcccatgttgatgttaagaccactga 456
           || || ||| | |||||||||||||| ||||| || ||||| ||||| ||||| |||||
Sbjct: 355 tctctggtacgcaagtggcagacactgattgaagctcatgtagatgtgaagacaactga 413



 Score = 48.1 bits (24), Expect = 0.032
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 539 agccagatcagacagattcgccggaagatggttgagatta 578
           ||||||||| | ||||||||||| ||||||||||| ||||
Sbjct: 496 agccagatccggcagattcgccgtaagatggttgaaatta 535



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                 
Query: 58 tgcagccatggcggtcggcaagaacaagcgcatctcgaa 96
          |||| ||||||| ||||||||||||||| | ||||||||
Sbjct: 15 tgcaaccatggctgtcggcaagaacaagaggatctcgaa 53



to top

>emb|Z25769.1|BRSPSG B.rapa mRNA for S phase specific gene
          Length = 1050

 Score =  107 bits (54), Expect = 4e-20
 Identities = 159/194 (81%)
 Strand = Plus / Plus

                                                                       
Query: 365 tggggtatggatttcaccaccgacaagcttagatcacttgtaaggaagtggcagacacta 424
           ||||||||||| ||||| |||||||| || || ||  | || | ||||||||||||  | 
Sbjct: 406 tggggtatggacttcacaaccgacaaactcaggtccttggttaagaagtggcagactttg 465

                                                                       
Query: 425 attgaggcccatgttgatgttaagaccactgacaattacatgctccggctgttctgcatt 484
           || ||| | |||||||||||||||||||||||||| ||||  ||  |||| |||||||| 
Sbjct: 466 atcgagtctcatgttgatgttaagaccactgacaactacacactgaggcttttctgcatc 525

                                                                       
Query: 485 ggcttcactaagagacgtcccaaccaagtgaaacggacttgctatgctcaggcgagccag 544
           | |||||| ||||||||| | |||||||| ||  | ||||||||||||||| | ||||||
Sbjct: 526 gccttcaccaagagacgtgctaaccaagttaagagaacttgctatgctcagtctagccag 585

                         
Query: 545 atcagacagattcg 558
           ||| | ||||||||
Sbjct: 586 atccgtcagattcg 599



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 64/76 (84%)
 Strand = Plus / Plus

                                                                       
Query: 192 tcggcaagaccctcgtctccaggacacaggggaccaagattgcatctgagggtcttaagc 251
           |||| ||||| || || ||||| || ||||| |||||||||||||| |||||| | || |
Sbjct: 233 tcggaaagacacttgtttccagaactcagggtaccaagattgcatcagagggtttgaaac 292

                           
Query: 252 acagagtttttgaggt 267
           ||||||| ||||||||
Sbjct: 293 acagagtctttgaggt 308



to top

>gb|L23553.1|BRRSPSK Brassica rapa S-phase-specific (BIS289) mRNA, complete cds
          Length = 1050

 Score =  107 bits (54), Expect = 4e-20
 Identities = 159/194 (81%)
 Strand = Plus / Plus

                                                                       
Query: 365 tggggtatggatttcaccaccgacaagcttagatcacttgtaaggaagtggcagacacta 424
           ||||||||||| ||||| |||||||| || || ||  | || | ||||||||||||  | 
Sbjct: 406 tggggtatggacttcacaaccgacaaactcaggtccttggttaagaagtggcagactttg 465

                                                                       
Query: 425 attgaggcccatgttgatgttaagaccactgacaattacatgctccggctgttctgcatt 484
           || ||| | |||||||||||||||||||||||||| ||||  ||  |||| |||||||| 
Sbjct: 466 atcgagtctcatgttgatgttaagaccactgacaactacacactgaggcttttctgcatc 525

                                                                       
Query: 485 ggcttcactaagagacgtcccaaccaagtgaaacggacttgctatgctcaggcgagccag 544
           | |||||| ||||||||| | |||||||| ||  | ||||||||||||||| | ||||||
Sbjct: 526 gccttcaccaagagacgtgctaaccaagttaagagaacttgctatgctcagtctagccag 585

                         
Query: 545 atcagacagattcg 558
           ||| | ||||||||
Sbjct: 586 atccgtcagattcg 599



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 64/76 (84%)
 Strand = Plus / Plus

                                                                       
Query: 192 tcggcaagaccctcgtctccaggacacaggggaccaagattgcatctgagggtcttaagc 251
           |||| ||||| || || ||||| || ||||| |||||||||||||| |||||| | || |
Sbjct: 233 tcggaaagacacttgtttccagaactcagggtaccaagattgcatcagagggtttgaaac 292

                           
Query: 252 acagagtttttgaggt 267
           ||||||| ||||||||
Sbjct: 293 acagagtctttgaggt 308



to top

>ref|NM_111356.3| Arabidopsis thaliana structural constituent of ribosome AT3G04840
           mRNA, complete cds
          Length = 1004

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 165/204 (80%)
 Strand = Plus / Plus

                                                                       
Query: 365 tggggtatggatttcaccaccgacaagcttagatcacttgtaaggaagtggcagacacta 424
           ||||| ||||| ||||||||||| || ||||| ||| | || | ||||||||||||  | 
Sbjct: 359 tggggcatggacttcaccaccgataaacttaggtcattggttaagaagtggcagactttg 418

                                                                       
Query: 425 attgaggcccatgttgatgttaagaccactgacaattacatgctccggctgttctgcatt 484
           |||||||| |||||||||||||| ||||| |||| |||||  ||| |||| ||||| || 
Sbjct: 419 attgaggctcatgttgatgttaaaaccaccgacagttacactctcaggctattctgtatc 478

                                                                       
Query: 485 ggcttcactaagagacgtcccaaccaagtgaaacggacttgctatgctcaggcgagccag 544
           | |||||| ||||||||| | ||||| || ||  |||||||||| |||||  | ||||| 
Sbjct: 479 gccttcaccaagagacgtgctaaccaggtcaagaggacttgctacgctcaatccagccaa 538

                                   
Query: 545 atcagacagattcgccggaagatg 568
           ||| | ||||| ||| ||||||||
Sbjct: 539 atccgtcagatccgcaggaagatg 562



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 55/66 (83%)
 Strand = Plus / Plus

                                                                       
Query: 251 cacagagtttttgaggtttccttggcagacctccagggtgatgaggaccaggctttcagg 310
           ||||||||||||||||||||  | || || || || |||||||||||  | |||| ||||
Sbjct: 245 cacagagtttttgaggtttctcttgctgatcttcaaggtgatgaggataacgcttacagg 304

                 
Query: 311 aagatc 316
           ||||||
Sbjct: 305 aagatc 310



to top

>gb|AY081585.1| Arabidopsis thaliana putative 40S ribosomal protein S3A (S phase
           specific) (At3g04840) mRNA, complete cds
          Length = 870

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 165/204 (80%)
 Strand = Plus / Plus

                                                                       
Query: 365 tggggtatggatttcaccaccgacaagcttagatcacttgtaaggaagtggcagacacta 424
           ||||| ||||| ||||||||||| || ||||| ||| | || | ||||||||||||  | 
Sbjct: 301 tggggcatggacttcaccaccgataaacttaggtcattggttaagaagtggcagactttg 360

                                                                       
Query: 425 attgaggcccatgttgatgttaagaccactgacaattacatgctccggctgttctgcatt 484
           |||||||| |||||||||||||| ||||| |||| |||||  ||| |||| ||||| || 
Sbjct: 361 attgaggctcatgttgatgttaaaaccaccgacagttacactctcaggctattctgtatc 420

                                                                       
Query: 485 ggcttcactaagagacgtcccaaccaagtgaaacggacttgctatgctcaggcgagccag 544
           | |||||| ||||||||| | ||||| || ||  |||||||||| |||||  | ||||| 
Sbjct: 421 gccttcaccaagagacgtgctaaccaggtcaagaggacttgctacgctcaatccagccaa 480

                                   
Query: 545 atcagacagattcgccggaagatg 568
           ||| | ||||| ||| ||||||||
Sbjct: 481 atccgtcagatccgcaggaagatg 504



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 55/66 (83%)
 Strand = Plus / Plus

                                                                       
Query: 251 cacagagtttttgaggtttccttggcagacctccagggtgatgaggaccaggctttcagg 310
           ||||||||||||||||||||  | || || || || |||||||||||  | |||| ||||
Sbjct: 187 cacagagtttttgaggtttctcttgctgatcttcaaggtgatgaggataacgcttacagg 246

                 
Query: 311 aagatc 316
           ||||||
Sbjct: 247 aagatc 252



to top

>gb|AY062796.1| Arabidopsis thaliana putative 40S ribosomal protein S3A (S phase
           specific) (At3g04840; T9J14.21) mRNA, complete cds
          Length = 1000

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 165/204 (80%)
 Strand = Plus / Plus

                                                                       
Query: 365 tggggtatggatttcaccaccgacaagcttagatcacttgtaaggaagtggcagacacta 424
           ||||| ||||| ||||||||||| || ||||| ||| | || | ||||||||||||  | 
Sbjct: 358 tggggcatggacttcaccaccgataaacttaggtcattggttaagaagtggcagactttg 417

                                                                       
Query: 425 attgaggcccatgttgatgttaagaccactgacaattacatgctccggctgttctgcatt 484
           |||||||| |||||||||||||| ||||| |||| |||||  ||| |||| ||||| || 
Sbjct: 418 attgaggctcatgttgatgttaaaaccaccgacagttacactctcaggctattctgtatc 477

                                                                       
Query: 485 ggcttcactaagagacgtcccaaccaagtgaaacggacttgctatgctcaggcgagccag 544
           | |||||| ||||||||| | ||||| || ||  |||||||||| |||||  | ||||| 
Sbjct: 478 gccttcaccaagagacgtgctaaccaggtcaagaggacttgctacgctcaatccagccaa 537

                                   
Query: 545 atcagacagattcgccggaagatg 568
           ||| | ||||| ||| ||||||||
Sbjct: 538 atccgtcagatccgcaggaagatg 561



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 55/66 (83%)
 Strand = Plus / Plus

                                                                       
Query: 251 cacagagtttttgaggtttccttggcagacctccagggtgatgaggaccaggctttcagg 310
           ||||||||||||||||||||  | || || || || |||||||||||  | |||| ||||
Sbjct: 244 cacagagtttttgaggtttctcttgctgatcttcaaggtgatgaggataacgcttacagg 303

                 
Query: 311 aagatc 316
           ||||||
Sbjct: 304 aagatc 309



to top

>emb|BX822077.1|CNS0A7LX Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB10ZB01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 716

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 165/204 (80%)
 Strand = Plus / Plus

                                                                       
Query: 365 tggggtatggatttcaccaccgacaagcttagatcacttgtaaggaagtggcagacacta 424
           ||||| ||||| ||||||||||| || ||||| ||| | || | ||||||||||||  | 
Sbjct: 71  tggggcatggacttcaccaccgataaacttaggtcattggttaagaagtggcagactttg 130

                                                                       
Query: 425 attgaggcccatgttgatgttaagaccactgacaattacatgctccggctgttctgcatt 484
           |||||||| |||||||||||||| ||||| |||| |||||  ||| |||| ||||| || 
Sbjct: 131 attgaggctcatgttgatgttaaaaccaccgacagttacactctcaggctattctgtatc 190

                                                                       
Query: 485 ggcttcactaagagacgtcccaaccaagtgaaacggacttgctatgctcaggcgagccag 544
           | |||||| ||||||||| | ||||| || ||  |||||||||| |||||  | ||||| 
Sbjct: 191 gccttcaccaagagacgtgctaaccaggtcaagaggacttgctacgctcaatccagccaa 250

                                   
Query: 545 atcagacagattcgccggaagatg 568
           ||| | ||||| ||| ||||||||
Sbjct: 251 atccgtcagatccgcaggaagatg 274



to top

>emb|BX824488.1|CNS0A5KP Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH51ZC05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 927

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 165/204 (80%)
 Strand = Plus / Plus

                                                                       
Query: 365 tggggtatggatttcaccaccgacaagcttagatcacttgtaaggaagtggcagacacta 424
           ||||| ||||| ||||||||||| || ||||| ||| | || | ||||||||||||  | 
Sbjct: 291 tggggcatggacttcaccaccgataaacttaggtcattggttaagaagtggcagactttg 350

                                                                       
Query: 425 attgaggcccatgttgatgttaagaccactgacaattacatgctccggctgttctgcatt 484
           |||||||| |||||||||||||| ||||| |||| |||||  ||| |||| ||||| || 
Sbjct: 351 attgaggctcatgttgatgttaaaaccaccgacagttacactctcaggctattctgtatc 410

                                                                       
Query: 485 ggcttcactaagagacgtcccaaccaagtgaaacggacttgctatgctcaggcgagccag 544
           | |||||| ||||||||| | ||||| || ||  |||||||||| |||||  | ||||| 
Sbjct: 411 gccttcaccaagagacgtgctaaccaggtcaagaggacttgctacgctcaatccagccaa 470

                                   
Query: 545 atcagacagattcgccggaagatg 568
           ||| | ||||| ||| ||||||||
Sbjct: 471 atccgtcagatccgcaggaagatg 494



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 55/66 (83%)
 Strand = Plus / Plus

                                                                       
Query: 251 cacagagtttttgaggtttccttggcagacctccagggtgatgaggaccaggctttcagg 310
           ||||||||||||||||||||  | || || || || |||||||||||  | |||| ||||
Sbjct: 177 cacagagtttttgaggtttctcttgctgatcttcaaggtgatgaggataacgcttacagg 236

                 
Query: 311 aagatc 316
           ||||||
Sbjct: 237 aagatc 242



to top

>gb|AY085787.1| Arabidopsis thaliana clone 18185 mRNA, complete sequence
          Length = 1001

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 165/204 (80%)
 Strand = Plus / Plus

                                                                       
Query: 365 tggggtatggatttcaccaccgacaagcttagatcacttgtaaggaagtggcagacacta 424
           ||||| ||||| ||||||||||| || ||||| ||| | || | ||||||||||||  | 
Sbjct: 359 tggggcatggacttcaccaccgataaacttaggtcattggttaagaagtggcagactttg 418

                                                                       
Query: 425 attgaggcccatgttgatgttaagaccactgacaattacatgctccggctgttctgcatt 484
           |||||||| |||||||||||||| ||||| |||| |||||  ||| |||| ||||| || 
Sbjct: 419 attgaggctcatgttgatgttaaaaccaccgacagttacactctcaggctattctgtatc 478

                                                                       
Query: 485 ggcttcactaagagacgtcccaaccaagtgaaacggacttgctatgctcaggcgagccag 544
           | |||||| ||||||||| | ||||| || ||  |||||||||| |||||  | ||||| 
Sbjct: 479 gccttcaccaagagacgtgctaaccaggtcaagaggacttgctacgctcaatccagccaa 538

                                   
Query: 545 atcagacagattcgccggaagatg 568
           ||| | ||||| ||| ||||||||
Sbjct: 539 atccgtcagatccgcaggaagatg 562



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 55/66 (83%)
 Strand = Plus / Plus

                                                                       
Query: 251 cacagagtttttgaggtttccttggcagacctccagggtgatgaggaccaggctttcagg 310
           ||||||||||||||||||||  | || || || || |||||||||||  | |||| ||||
Sbjct: 245 cacagagtttttgaggtttctcttgctgatcttcaaggtgatgaggataacgcttacagg 304

                 
Query: 311 aagatc 316
           ||||||
Sbjct: 305 aagatc 310



to top

>emb|AJ515028.1|CAR515028 Cicer arietinum mRNA for ribosomal protein S3a (rs3a gene)
          Length = 1026

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 275/351 (78%)
 Strand = Plus / Plus

                                                                       
Query: 218 caggggaccaagattgcatctgagggtcttaagcacagagtttttgaggtttccttggca 277
           ||||| ||||||||||| ||||| || || || ||  | || |||||| | || ||||| 
Sbjct: 204 cagggtaccaagattgcttctgaaggactcaaacatcgtgtgtttgagatctcattggct 263

                                                                       
Query: 278 gacctccagggtgatgaggaccaggctttcaggaagatcagacttcgtgcagaggatgtg 337
           || || || |||||||||||  | |||||||||||||| ||  |  | || || ||||| 
Sbjct: 264 gatcttcaaggtgatgaggataatgctttcaggaagattaggttgagggctgaagatgtt 323

                                                                       
Query: 338 caaggaaagaatgttctcacaaacttttggggtatggatttcaccaccgacaagcttaga 397
           || || |||||||| ||||| |||||||  ||||||||||||||||| |||||||| || 
Sbjct: 324 cagggcaagaatgtcctcaccaacttttatggtatggatttcaccactgacaagctcagg 383

                                                                       
Query: 398 tcacttgtaaggaagtggcagacactaattgaggcccatgttgatgttaagaccactgac 457
           ||  | ||  | || ||||| || || ||||| || ||||| ||||||||||||||||| 
Sbjct: 384 tctttggtccgtaaatggcaaactctcattgaagctcatgtggatgttaagaccactgat 443

                                                                       
Query: 458 aattacatgctccggctgttctgcattggcttcactaagagacgtcccaaccaagtgaaa 517
           ||||| |   |  |  |||||||||||||||| || ||||||||    ||||||||||| 
Sbjct: 444 aattataccttgagaatgttctgcattggctttaccaagagacgcagtaaccaagtgaag 503

                                                              
Query: 518 cggacttgctatgctcaggcgagccagatcagacagattcgccggaagatg 568
            | || || ||||||||  | ||||||||||||||||| ||| ||||||||
Sbjct: 504 agaacctgttatgctcaatccagccagatcagacagatccgcaggaagatg 554



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 85/103 (82%)
 Strand = Plus / Plus

                                                                       
Query: 63  ccatggcggtcggcaagaacaagcgcatctcgaaaggtcggaagggaagcaaaaagaaaa 122
           ||||||||||||||||||||||| | || || || ||   ||||||| |||| |||||| 
Sbjct: 49  ccatggcggtcggcaagaacaagagaatttccaagggaaagaagggaggcaagaagaaag 108

                                                      
Query: 123 cggtcgatcccttcaccaagaaggactggtatgacataaaggc 165
           | | |||||||||  |||||||||| |||||||| || |||||
Sbjct: 109 ccgccgatcccttttccaagaaggattggtatgatatcaaggc 151



to top

>dbj|D01058.1|CTRCYC07 Catharanthus roseus cyc07 mRNA, complete cds
          Length = 1100

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 218/275 (79%)
 Strand = Plus / Plus

                                                                       
Query: 218 caggggaccaagattgcatctgagggtcttaagcacagagtttttgaggtttccttggca 277
           ||||| ||||||||||| || ||||||||  |||| |||||||| ||| ||||  | || 
Sbjct: 225 cagggtaccaagattgcttccgagggtctcgagcatagagttttcgagatttctcttgct 284

                                                                       
Query: 278 gacctccagggtgatgaggaccaggctttcaggaagatcagacttcgtgcagaggatgtg 337
           || || |||||||||||||||||  | |||||||||||| || |  | || || ||| | 
Sbjct: 285 gatcttcagggtgatgaggaccactcattcaggaagatccgattgagagccgaagatatt 344

                                                                       
Query: 338 caaggaaagaatgttctcacaaacttttggggtatggatttcaccaccgacaagcttaga 397
           || ||||| |||||||| || ||||| ||||||||||| ||||| || || ||| | || 
Sbjct: 345 cagggaaaaaatgttctgactaacttctggggtatggacttcactacagataagttgagg 404

                                                                       
Query: 398 tcacttgtaaggaagtggcagacactaattgaggcccatgttgatgttaagaccactgac 457
           || ||||| |||||||||||  |  | || || || ||||||||||||||||| ||||||
Sbjct: 405 tctcttgtgaggaagtggcaatccttgatagaagctcatgttgatgttaagacaactgac 464

                                              
Query: 458 aattacatgctccggctgttctgcattggcttcac 492
           |  ||||   |  || |||||||||||||||||||
Sbjct: 465 agctacacattgaggatgttctgcattggcttcac 499



to top

>gb|AC009465.7|AC009465 Arabidopsis thaliana chromosome 3 BAC T9J14 genomic sequence, complete
             sequence
          Length = 93234

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 134/164 (81%)
 Strand = Plus / Minus

                                                                         
Query: 371   atggatttcaccaccgacaagcttagatcacttgtaaggaagtggcagacactaattgag 430
             ||||| ||||||||||| || ||||| ||| | || | ||||||||||||  | ||||||
Sbjct: 74311 atggacttcaccaccgataaacttaggtcattggttaagaagtggcagactttgattgag 74252

                                                                         
Query: 431   gcccatgttgatgttaagaccactgacaattacatgctccggctgttctgcattggcttc 490
             || |||||||||||||| ||||| |||| |||||  ||| |||| ||||| || | ||||
Sbjct: 74251 gctcatgttgatgttaaaaccaccgacagttacactctcaggctattctgtatcgccttc 74192

                                                         
Query: 491   actaagagacgtcccaaccaagtgaaacggacttgctatgctca 534
             || ||||||||| | ||||| || ||  |||||||||| |||||
Sbjct: 74191 accaagagacgtgctaaccaggtcaagaggacttgctacgctca 74148



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 55/66 (83%)
 Strand = Plus / Minus

                                                                         
Query: 251   cacagagtttttgaggtttccttggcagacctccagggtgatgaggaccaggctttcagg 310
             ||||||||||||||||||||  | || || || || |||||||||||  | |||| ||||
Sbjct: 74540 cacagagtttttgaggtttctcttgctgatcttcaaggtgatgaggataacgcttacagg 74481

                   
Query: 311   aagatc 316
             ||||||
Sbjct: 74480 aagatc 74475



to top

>gb|DQ241862.1| Solanum tuberosum clone 027B03 40S ribosomal protein S3a-like mRNA,
           complete cds
          Length = 1118

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 205/259 (79%)
 Strand = Plus / Plus

                                                                       
Query: 192 tcggcaagaccctcgtctccaggacacaggggaccaagattgcatctgagggtcttaagc 251
           ||||||| ||||| ||  ||||||| ||||| ||||||||||| || ||||| || || |
Sbjct: 214 tcggcaaaacccttgttaccaggactcagggtaccaagattgcttcagagggcctaaaac 273

                                                                       
Query: 252 acagagtttttgaggtttccttggcagacctccagggtgatgaggaccaggctttcagga 311
           ||||||| ||||| |||  | |||| || || |||   |||||||| |||||||||||||
Sbjct: 274 acagagtatttgaagttagcctggctgatcttcagaaggatgaggatcaggctttcagga 333

                                                                       
Query: 312 agatcagacttcgtgcagaggatgtgcaaggaaagaatgttctcacaaacttttggggta 371
           | ||| |  |  | ||||| ||||||||||| | ||||||||||||||||||    || |
Sbjct: 334 aaatccgtttgagagcagaagatgtgcaagggaggaatgttctcacaaacttccatggaa 393

                                                                       
Query: 372 tggatttcaccaccgacaagcttagatcacttgtaaggaagtggcagacactaattgagg 431
           |||||||||| || || ||| | || || || ||  | || ||||||||  | |||||||
Sbjct: 394 tggatttcacaacagataagttgaggtctctggtccgcaaatggcagactttgattgagg 453

                              
Query: 432 cccatgttgatgttaagac 450
           ||||||||||||| |||||
Sbjct: 454 cccatgttgatgtcaagac 472



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 551 cagattcgccggaagatggttgagatta 578
           ||||| ||| ||||||||||||||||||
Sbjct: 573 cagatccgcaggaagatggttgagatta 600



to top

>gb|AC146852.15| Medicago truncatula clone mth2-58k21, complete sequence
          Length = 145314

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 78/90 (86%)
 Strand = Plus / Plus

                                                                         
Query: 367   gggtatggatttcaccaccgacaagcttagatcacttgtaaggaagtggcagacactaat 426
             |||||||||||| ||||||||||||||||| ||| | ||  | ||||||||||| || ||
Sbjct: 48499 gggtatggattttaccaccgacaagcttaggtcattggtgcgtaagtggcagactctcat 48558

                                           
Query: 427   tgaggcccatgttgatgttaagaccactga 456
             ||| || ||||| |||||||||||||||||
Sbjct: 48559 tgaagctcatgtggatgttaagaccactga 48588



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                     
Query: 260   tttgaggtttccttggcagacctccagggtgatgaggaccaggctttcaggaagat 315
             ||||||||||| ||||| || || || || ||||||||| | || |||||||||||
Sbjct: 48308 tttgaggtttcattggctgatcttcaaggagatgaggacaatgcattcaggaagat 48363



to top

>gb|AC135320.6| Medicago truncatula clone mth2-28e9, complete sequence
          Length = 108644

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 78/90 (86%)
 Strand = Plus / Minus

                                                                         
Query: 367   gggtatggatttcaccaccgacaagcttagatcacttgtaaggaagtggcagacactaat 426
             |||||||||||| ||||||||||||||||| ||| | ||  | ||||||||||| || ||
Sbjct: 42412 gggtatggattttaccaccgacaagcttaggtcattggtgcgtaagtggcagactctcat 42353

                                           
Query: 427   tgaggcccatgttgatgttaagaccactga 456
             ||| || ||||| |||||||||||||||||
Sbjct: 42352 tgaagctcatgtggatgttaagaccactga 42323



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                     
Query: 260   tttgaggtttccttggcagacctccagggtgatgaggaccaggctttcaggaagat 315
             ||||||||||| ||||| || || || || ||||||||| | || |||||||||||
Sbjct: 42603 tttgaggtttcattggctgatcttcaaggagatgaggacaatgcattcaggaagat 42548



to top

>dbj|AB116637.1| Lentinula edodes Le. cyc07 mRNA for putative S-phase specific
           ribosomal protein cyc07, complete cds
          Length = 980

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 75/87 (86%)
 Strand = Plus / Plus

                                                                       
Query: 371 atggatttcaccaccgacaagcttagatcacttgtaaggaagtggcagacactaattgag 430
           |||||||||||| ||||||||||  |||| || ||| |||| |||||||| || ||||| 
Sbjct: 367 atggatttcacctccgacaagctgcgatctctcgtacggaaatggcagactctcattgaa 426

                                      
Query: 431 gcccatgttgatgttaagaccactgac 457
           |||||||| ||||| ||||||||||||
Sbjct: 427 gcccatgtcgatgtgaagaccactgac 453



to top

>gb|AF093109.1| Tortula ruralis ribosomal protein S3 (rps3) mRNA, complete cds
          Length = 899

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 92/110 (83%)
 Strand = Plus / Plus

                                                                       
Query: 59  gcagccatggcggtcggcaagaacaagcgcatctcgaaaggtcggaagggaagcaaaaag 118
           ||||||||||| ||||| ||| | |||||||| || || ||   ||||||  |||| |||
Sbjct: 16  gcagccatggccgtcggaaaggataagcgcatttccaagggcaagaagggcggcaagaag 75

                                                             
Query: 119 aaaacggtcgatcccttcaccaagaaggactggtatgacataaaggcgcc 168
           ||||  |||||||| ||| |||||||||||||||||||||| ||||||||
Sbjct: 76  aaaattgtcgatccgttctccaagaaggactggtatgacatcaaggcgcc 125



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 87/104 (83%)
 Strand = Plus / Plus

                                                                       
Query: 290 gatgaggaccaggctttcaggaagatcagacttcgtgcagaggatgtgcaaggaaagaat 349
           |||||||||||||||||| | |||||||  ||  | || ||||||||||| || ||||| 
Sbjct: 244 gatgaggaccaggctttccgcaagatcaagctgagggcggaggatgtgcagggcaagaac 303

                                                       
Query: 350 gttctcacaaacttttggggtatggatttcaccaccgacaagct 393
           || ||||| ||||| ||||| ||||| |||||||| ||||||||
Sbjct: 304 gtgctcaccaacttctggggcatggacttcaccacggacaagct 347



to top

>ref|NM_119633.2| Arabidopsis thaliana structural constituent of ribosome AT4G34670
           mRNA, complete cds
          Length = 1093

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 123/152 (80%)
 Strand = Plus / Plus

                                                                       
Query: 365 tggggtatggatttcaccaccgacaagcttagatcacttgtaaggaagtggcagacacta 424
           ||||||||||||||||| ||||||||||| || ||| | || | ||||||||||||  | 
Sbjct: 379 tggggtatggatttcacaaccgacaagctaaggtcattggtgaagaagtggcagactttg 438

                                                                       
Query: 425 attgaggcccatgttgatgttaagaccactgacaattacatgctccggctgttctgcatt 484
           ||||| |||||||| ||||| || ||||| |||   ||||   |  || |||||||||| 
Sbjct: 439 attgaagcccatgtcgatgtgaaaaccacagacggctacaccttgaggatgttctgcatc 498

                                           
Query: 485 ggcttcactaagagacgtcccaaccaagtgaa 516
           | |||||| ||||||||| | |||||||||||
Sbjct: 499 gccttcacaaagagacgtgctaaccaagtgaa 530



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 209 tccaggacacaggggaccaagattgcatctgagggtcttaagcacagagtttttgaggtt 268
           |||||||| ||||| ||||||||||| |||||||| || || ||||| || |||||||||
Sbjct: 223 tccaggactcagggtaccaagattgcctctgagggactgaaacacagggtgtttgaggtt 282

             
Query: 269 tc 270
           ||
Sbjct: 283 tc 284



to top

>gb|BT000122.1| Arabidopsis thaliana Putative S-phase-specific ribosomal protein
           (At4g34670) mRNA, complete cds
          Length = 581

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 123/152 (80%)
 Strand = Plus / Minus

                                                                       
Query: 365 tggggtatggatttcaccaccgacaagcttagatcacttgtaaggaagtggcagacacta 424
           ||||||||||||||||| ||||||||||| || ||| | || | ||||||||||||  | 
Sbjct: 278 tggggtatggatttcacaaccgacaagctaaggtcattggtgaagaagtggcagactttg 219

                                                                       
Query: 425 attgaggcccatgttgatgttaagaccactgacaattacatgctccggctgttctgcatt 484
           ||||| |||||||| ||||| || ||||| |||   ||||   |  || |||||||||| 
Sbjct: 218 attgaagcccatgtcgatgtgaaaaccacagacggctacaccttgaggatgttctgcatc 159

                                           
Query: 485 ggcttcactaagagacgtcccaaccaagtgaa 516
           | |||||| ||||||||| | |||||||||||
Sbjct: 158 gccttcacaaagagacgtgctaaccaagtgaa 127



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                       
Query: 209 tccaggacacaggggaccaagattgcatctgagggtcttaagcacagagtttttgaggtt 268
           |||||||| ||||| ||||||||||| |||||||| || || ||||| || |||||||||
Sbjct: 434 tccaggactcagggtaccaagattgcctctgagggactgaaacacagggtgtttgaggtt 375

             
Query: 269 tc 270
           ||
Sbjct: 374 tc 373



to top

>gb|AY062500.1| Arabidopsis thaliana Putative S-phase-specific ribosomal protein
           (At4g34670; T4L20.250) mRNA, complete cds
          Length = 1094

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 123/152 (80%)
 Strand = Plus / Plus

                                                                       
Query: 365 tggggtatggatttcaccaccgacaagcttagatcacttgtaaggaagtggcagacacta 424
           ||||||||||||||||| ||||||||||| || ||| | || | ||||||||||||  | 
Sbjct: 379 tggggtatggatttcacaaccgacaagctaaggtcattggtgaagaagtggcagactttg 438

                                                                       
Query: 425 attgaggcccatgttgatgttaagaccactgacaattacatgctccggctgttctgcatt 484
           ||||| |||||||| ||||| || ||||| |||   ||||   |  || |||||||||| 
Sbjct: 439 attgaagcccatgtcgatgtgaaaaccacagacggctacaccttgaggatgttctgcatc 498

                                           
Query: 485 ggcttcactaagagacgtcccaaccaagtgaa 516
           | |||||| ||||||||| | |||||||||||
Sbjct: 499 gccttcacaaagagacgtgctaaccaagtgaa 530



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 209 tccaggacacaggggaccaagattgcatctgagggtcttaagcacagagtttttgaggtt 268
           |||||||| ||||| ||||||||||| |||||||| || || ||||| || |||||||||
Sbjct: 223 tccaggactcagggtaccaagattgcctctgagggactgaaacacagggtgtttgaggtt 282

             
Query: 269 tc 270
           ||
Sbjct: 283 tc 284



to top

>emb|BX826401.1|CNS0A38P Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB21ZE07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 836

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 123/152 (80%)
 Strand = Plus / Plus

                                                                       
Query: 365 tggggtatggatttcaccaccgacaagcttagatcacttgtaaggaagtggcagacacta 424
           ||||||||||||||||| ||||||||||| || ||| | || | ||||||||||||  | 
Sbjct: 208 tggggtatggatttcacaaccgacaagctaaggtcattggtgaagaagtggcagactttg 267

                                                                       
Query: 425 attgaggcccatgttgatgttaagaccactgacaattacatgctccggctgttctgcatt 484
           ||||| |||||||| ||||| || ||||| |||   ||||   |  || |||||||||| 
Sbjct: 268 attgaagcccatgtcgatgtgaaaaccacagacggctacaccttgaggatgttctgcatc 327

                                           
Query: 485 ggcttcactaagagacgtcccaaccaagtgaa 516
           | |||||| ||||||||| | |||||||||||
Sbjct: 328 gccttcacaaagagacgtgctaaccaagtgaa 359



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 209 tccaggacacaggggaccaagattgcatctgagggtcttaagcacagagtttttgaggtt 268
           |||||||| ||||| ||||||||||| |||||||| || || ||||| || |||||||||
Sbjct: 52  tccaggactcagggtaccaagattgcctctgagggactgaaacacagggtgtttgaggtt 111

             
Query: 269 tc 270
           ||
Sbjct: 112 tc 113



to top

>emb|BX828268.1|CNS0A2YE Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH6ZD12 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1008

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 123/152 (80%)
 Strand = Plus / Plus

                                                                       
Query: 365 tggggtatggatttcaccaccgacaagcttagatcacttgtaaggaagtggcagacacta 424
           ||||||||||||||||| ||||||||||| || ||| | || | ||||||||||||  | 
Sbjct: 364 tggggtatggatttcacaaccgacaagctaaggtcattggtgaagaagtggcagactttg 423

                                                                       
Query: 425 attgaggcccatgttgatgttaagaccactgacaattacatgctccggctgttctgcatt 484
           ||||| |||||||| ||||| || ||||| |||   ||||   |  || |||||||||| 
Sbjct: 424 attgaagcccatgtcgatgtgaaaaccacagacggctacaccttgaggatgttctgcatc 483

                                           
Query: 485 ggcttcactaagagacgtcccaaccaagtgaa 516
           | |||||| ||||||||| | |||||||||||
Sbjct: 484 gccttcacaaagagacgtgctaaccaagtgaa 515



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 209 tccaggacacaggggaccaagattgcatctgagggtcttaagcacagagtttttgaggtt 268
           |||||||| ||||| ||||||||||| |||||||| || || ||||| || |||||||||
Sbjct: 208 tccaggactcagggtaccaagattgcctctgagggactgaaacacagggtgtttgaggtt 267

             
Query: 269 tc 270
           ||
Sbjct: 268 tc 269



to top

>emb|AJ001342.1|ATCYC07 Arabidopsis thaliana mRNA for S-phase-specific ribosomal protein
          Length = 906

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 123/152 (80%)
 Strand = Plus / Plus

                                                                       
Query: 365 tggggtatggatttcaccaccgacaagcttagatcacttgtaaggaagtggcagacacta 424
           ||||||||||||||||| ||||||||||| || ||| | || | ||||||||||||  | 
Sbjct: 301 tggggtatggatttcacaaccgacaagctaaggtcattggtgaagaagtggcagactttg 360

                                                                       
Query: 425 attgaggcccatgttgatgttaagaccactgacaattacatgctccggctgttctgcatt 484
           ||||| |||||||| ||||| || ||||| |||   ||||   |  || |||||||||| 
Sbjct: 361 attgaagcccatgtcgatgtgaaaaccacagacggctacaccttgaggatgttctgcatc 420

                                           
Query: 485 ggcttcactaagagacgtcccaaccaagtgaa 516
           | |||||| ||||||||| | |||||||||||
Sbjct: 421 gccttcacaaagagacgtgctaaccaagtgaa 452



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 209 tccaggacacaggggaccaagattgcatctgagggtcttaagcacagagtttttgaggtt 268
           |||||||| ||||| ||||||||||| |||||||| || || ||||| || |||||||||
Sbjct: 145 tccaggactcagggtaccaagattgcctctgagggactgaaacacagggtgtttgaggtt 204

             
Query: 269 tc 270
           ||
Sbjct: 205 tc 206



to top

>emb|AL161586.2|ATCHRIV82 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 82
          Length = 195165

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 121/150 (80%)
 Strand = Plus / Plus

                                                                        
Query: 367  gggtatggatttcaccaccgacaagcttagatcacttgtaaggaagtggcagacactaat 426
            ||||||||||||||| ||||||||||| || ||| | || | ||||||||||||  | ||
Sbjct: 4326 gggtatggatttcacaaccgacaagctaaggtcattggtgaagaagtggcagactttgat 4385

                                                                        
Query: 427  tgaggcccatgttgatgttaagaccactgacaattacatgctccggctgttctgcattgg 486
            ||| |||||||| ||||| || ||||| |||   ||||   |  || |||||||||| | 
Sbjct: 4386 tgaagcccatgtcgatgtgaaaaccacagacggctacaccttgaggatgttctgcatcgc 4445

                                          
Query: 487  cttcactaagagacgtcccaaccaagtgaa 516
            |||||| ||||||||| | |||||||||||
Sbjct: 4446 cttcacaaagagacgtgctaaccaagtgaa 4475



to top

>emb|AL161585.2|ATCHRIV81 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 81
          Length = 195921

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 121/150 (80%)
 Strand = Plus / Plus

                                                                          
Query: 367    gggtatggatttcaccaccgacaagcttagatcacttgtaaggaagtggcagacactaat 426
              ||||||||||||||| ||||||||||| || ||| | || | ||||||||||||  | ||
Sbjct: 195247 gggtatggatttcacaaccgacaagctaaggtcattggtgaagaagtggcagactttgat 195306

                                                                          
Query: 427    tgaggcccatgttgatgttaagaccactgacaattacatgctccggctgttctgcattgg 486
              ||| |||||||| ||||| || ||||| |||   ||||   |  || |||||||||| | 
Sbjct: 195307 tgaagcccatgtcgatgtgaaaaccacagacggctacaccttgaggatgttctgcatcgc 195366

                                            
Query: 487    cttcactaagagacgtcccaaccaagtgaa 516
              |||||| ||||||||| | |||||||||||
Sbjct: 195367 cttcacaaagagacgtgctaaccaagtgaa 195396



to top

>emb|AL023094.2|ATT4L20 Arabidopsis thaliana DNA chromosome 4, BAC clone T4L20 (ESSA project)
          Length = 125502

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 121/150 (80%)
 Strand = Plus / Plus

                                                                         
Query: 367   gggtatggatttcaccaccgacaagcttagatcacttgtaaggaagtggcagacactaat 426
             ||||||||||||||| ||||||||||| || ||| | || | ||||||||||||  | ||
Sbjct: 85558 gggtatggatttcacaaccgacaagctaaggtcattggtgaagaagtggcagactttgat 85617

                                                                         
Query: 427   tgaggcccatgttgatgttaagaccactgacaattacatgctccggctgttctgcattgg 486
             ||| |||||||| ||||| || ||||| |||   ||||   |  || |||||||||| | 
Sbjct: 85618 tgaagcccatgtcgatgtgaaaaccacagacggctacaccttgaggatgttctgcatcgc 85677

                                           
Query: 487   cttcactaagagacgtcccaaccaagtgaa 516
             |||||| ||||||||| | |||||||||||
Sbjct: 85678 cttcacaaagagacgtgctaaccaagtgaa 85707



to top

>ref|XM_774945.1| PREDICTED: Strongylocentrotus purpuratus similar to ribosomal
           protein S3a, transcript variant 1 (LOC575056), mRNA
          Length = 1003

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 45/49 (91%)
 Strand = Plus / Plus

                                                            
Query: 174 tgttcaacacccgcaacatcggcaagaccctcgtctccaggacacaggg 222
           ||||||||| |||||||||||||||||| |||||  |||||||||||||
Sbjct: 120 tgttcaacatccgcaacatcggcaagactctcgtaaccaggacacaggg 168



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 473 ctgttctgcattggcttcac 492
           ||||||||||||||||||||
Sbjct: 416 ctgttctgcattggcttcac 435



to top

>ref|XM_796644.1| PREDICTED: Strongylocentrotus purpuratus similar to ribosomal
           protein S3a, transcript variant 2 (LOC575056), mRNA
          Length = 749

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 45/49 (91%)
 Strand = Plus / Plus

                                                            
Query: 174 tgttcaacacccgcaacatcggcaagaccctcgtctccaggacacaggg 222
           ||||||||| |||||||||||||||||| |||||  |||||||||||||
Sbjct: 120 tgttcaacatccgcaacatcggcaagactctcgtaaccaggacacaggg 168



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 473 ctgttctgcattggcttcac 492
           ||||||||||||||||||||
Sbjct: 416 ctgttctgcattggcttcac 435



to top

>ref|XM_785062.1| PREDICTED: Strongylocentrotus purpuratus similar to 40S ribosomal
           protein S3a (V-fos transformation effector protein)
           (LOC585229), partial mRNA
          Length = 327

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 45/49 (91%)
 Strand = Plus / Plus

                                                            
Query: 174 tgttcaacacccgcaacatcggcaagaccctcgtctccaggacacaggg 222
           ||||||||| |||||||||||||||||| |||||  |||||||||||||
Sbjct: 86  tgttcaacatccgcaacatcggcaagactctcgtaaccaggacacaggg 134



to top

>gb|AY661558.1| Hordeum vulgare subsp. vulgare eIF4E gene locus, complete sequence
          Length = 439641

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                         
Query: 425   attgaggcccatgttgatgttaagaccactgacaattacatgctccggctgttctgcatt 484
             |||||||| ||||| ||||| ||||| ||||||||||||||||||||  ||||   ||||
Sbjct: 46703 attgaggctcatgtggatgtgaagacaactgacaattacatgctccgcatgtttgccatt 46644

                          
Query: 485   ggcttcactaaga 497
             |||||||| ||||
Sbjct: 46643 ggcttcaccaaga 46631



to top

>gb|BT019079.1| Zea mays clone Contig661.F mRNA sequence
          Length = 1229

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 101/124 (81%)
 Strand = Plus / Minus

                                                                       
Query: 455 gacaattacatgctccggctgttctgcattggcttcactaagagacgtcccaaccaagtg 514
           ||||| |||||||| ||  ||||||||||||| || || ||||| || || ||||| || 
Sbjct: 629 gacaactacatgctgcgtttgttctgcattggttttaccaagaggcgcccaaaccaggtc 570

                                                                       
Query: 515 aaacggacttgctatgctcaggcgagccagatcagacagattcgccggaagatggttgag 574
           ||  | || ||||||||||||||   ||||||  | ||||||||||| ||||||||||||
Sbjct: 569 aagagaacctgctatgctcaggcatcccagattcggcagattcgccgcaagatggttgag 510

               
Query: 575 atta 578
           ||||
Sbjct: 509 atta 506



to top

>gb|AF479043.1| Triticum aestivum 40S ribosomal protein mRNA, partial cds
          Length = 342

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 521 acttgctatgctcaggcgagccagatcagacagattcgccggaagatggttgagat 576
           ||||||||||| || || || |||||||||||||| ||||| ||||||||||||||
Sbjct: 7   acttgctatgcccaagcaagtcagatcagacagatccgccgcaagatggttgagat 62



to top

>gb|AY648734.1| Danio rerio 40S ribosomal protein S3a mRNA, complete cds
          Length = 864

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 97/119 (81%)
 Strand = Plus / Plus

                                                                       
Query: 128 gatcccttcaccaagaaggactggtatgacataaaggcgccgacgttgttcaacacccgc 187
           ||||| ||| |||||||||||||||||||  | ||||| ||  |  ||||||||| ||||
Sbjct: 73  gatcctttctccaagaaggactggtatgatgtcaaggcaccagccatgttcaacatccgc 132

                                                                      
Query: 188 aacatcggcaagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
           ||| | ||||||||| | ||| ||||||| ||||| ||||  ||||| ||||| |||||
Sbjct: 133 aacctgggcaagaccttggtcaccaggactcagggaaccagaattgcctctgatggtct 191



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                           
Query: 409 gaagtggcagacactaattgaggcccatgttgatgttaagaccactga 456
           ||||||||||||| | ||||||||||| ||||| || |||||||||||
Sbjct: 351 gaagtggcagacaatgattgaggcccacgttgacgtaaagaccactga 398



to top

>gb|BC059543.1| Danio rerio ribosomal protein S3A, mRNA (cDNA clone MGC:73195
           IMAGE:4788990), complete cds
          Length = 872

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 97/119 (81%)
 Strand = Plus / Plus

                                                                       
Query: 128 gatcccttcaccaagaaggactggtatgacataaaggcgccgacgttgttcaacacccgc 187
           ||||| ||| |||||||||||||||||||  | ||||| ||  |  ||||||||| ||||
Sbjct: 71  gatcctttctccaagaaggactggtatgatgtcaaggcaccagccatgttcaacatccgc 130

                                                                      
Query: 188 aacatcggcaagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
           ||| | ||||||||| | ||| ||||||| ||||| ||||  ||||| ||||| |||||
Sbjct: 131 aacctgggcaagaccttggtcaccaggactcagggaaccagaattgcctctgatggtct 189



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                           
Query: 409 gaagtggcagacactaattgaggcccatgttgatgttaagaccactga 456
           ||||||||||||| | ||||||||||| ||||| || |||||||||||
Sbjct: 349 gaagtggcagacaatgattgaggcccacgttgacgtaaagaccactga 396



to top

>ref|NM_200059.1| Danio rerio ribosomal protein S3A (rps3a), mRNA
          Length = 872

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 97/119 (81%)
 Strand = Plus / Plus

                                                                       
Query: 128 gatcccttcaccaagaaggactggtatgacataaaggcgccgacgttgttcaacacccgc 187
           ||||| ||| |||||||||||||||||||  | ||||| ||  |  ||||||||| ||||
Sbjct: 71  gatcctttctccaagaaggactggtatgatgtcaaggcaccagccatgttcaacatccgc 130

                                                                      
Query: 188 aacatcggcaagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
           ||| | ||||||||| | ||| ||||||| ||||| ||||  ||||| ||||| |||||
Sbjct: 131 aacctgggcaagaccttggtcaccaggactcagggaaccagaattgcctctgatggtct 189



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                           
Query: 409 gaagtggcagacactaattgaggcccatgttgatgttaagaccactga 456
           ||||||||||||| | ||||||||||| ||||| || |||||||||||
Sbjct: 349 gaagtggcagacaatgattgaggcccacgttgacgtaaagaccactga 396



to top

>gb|BC078649.1| Danio rerio ribosomal protein S3A, mRNA (cDNA clone MGC:86672
           IMAGE:6894801), complete cds
          Length = 904

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 97/119 (81%)
 Strand = Plus / Plus

                                                                       
Query: 128 gatcccttcaccaagaaggactggtatgacataaaggcgccgacgttgttcaacacccgc 187
           ||||| ||| |||||||||||||||||||  | ||||| ||  |  ||||||||| ||||
Sbjct: 92  gatcctttctccaagaaggactggtatgatgtcaaggcaccagccatgttcaacatccgc 151

                                                                      
Query: 188 aacatcggcaagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
           ||| | ||||||||| | ||| ||||||| ||||| ||||  ||||| ||||| |||||
Sbjct: 152 aacctgggcaagaccttggtcaccaggactcagggaaccagaattgcctctgatggtct 210



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                           
Query: 409 gaagtggcagacactaattgaggcccatgttgatgttaagaccactga 456
           ||||||||||||| | ||||||||||| ||||| || |||||||||||
Sbjct: 370 gaagtggcagacaatgattgaggcccacgttgacgtaaagaccactga 417



to top

>gb|DQ268856.1| Solanum tuberosum clone 174A02 cyc07-like protein mRNA, complete
           cds
          Length = 1045

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 202/259 (77%)
 Strand = Plus / Plus

                                                                       
Query: 192 tcggcaagaccctcgtctccaggacacaggggaccaagattgcatctgagggtcttaagc 251
           ||||||| ||||| ||  ||||||| ||||| ||||||||||| || || || || || |
Sbjct: 201 tcggcaaaacccttgttaccaggactcagggtaccaagattgcttcagatggcctaaaac 260

                                                                       
Query: 252 acagagtttttgaggtttccttggcagacctccagggtgatgaggaccaggctttcagga 311
           ||||||| ||||| |||  | |||| || || |||   |||||||| |||||||||||||
Sbjct: 261 acagagtatttgaagttagcctggctgatcttcagaaggatgaggatcaggctttcagga 320

                                                                       
Query: 312 agatcagacttcgtgcagaggatgtgcaaggaaagaatgttctcacaaacttttggggta 371
           | ||| |  |  | ||||| ||||||||||| |  |||||||||||||| ||    || |
Sbjct: 321 aaatccgtttgagagcagaagatgtgcaagggagaaatgttctcacaaatttccatggaa 380

                                                                       
Query: 372 tggatttcaccaccgacaagcttagatcacttgtaaggaagtggcagacactaattgagg 431
           |||||||||| || || ||| | || || || ||  | || ||||||||  | |||||||
Sbjct: 381 tggatttcacaacagataagttgaggtctctggtccgcaaatggcagactttgattgagg 440

                              
Query: 432 cccatgttgatgttaagac 450
           ||||||||||||| |||||
Sbjct: 441 cccatgttgatgtaaagac 459



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 551 cagattcgccggaagatggttgagatta 578
           ||||| ||| ||||||||||||||||||
Sbjct: 560 cagatccgcaggaagatggttgagatta 587



to top

>gb|DQ268849.1| Solanum tuberosum clone 155F06 cyc07-like protein mRNA, complete
           cds
          Length = 1038

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 202/259 (77%)
 Strand = Plus / Plus

                                                                       
Query: 192 tcggcaagaccctcgtctccaggacacaggggaccaagattgcatctgagggtcttaagc 251
           ||||||| ||||| ||  ||||||| ||||| ||||||||||| || || || || || |
Sbjct: 185 tcggcaaaacccttgttaccaggactcagggtaccaagattgcttcagatggcctaaaac 244

                                                                       
Query: 252 acagagtttttgaggtttccttggcagacctccagggtgatgaggaccaggctttcagga 311
           ||||||| ||||| |||  | |||| || || |||   |||||||| |||||||||||||
Sbjct: 245 acagagtatttgaagttagcctggctgatcttcagaaggatgaggatcaggctttcagga 304

                                                                       
Query: 312 agatcagacttcgtgcagaggatgtgcaaggaaagaatgttctcacaaacttttggggta 371
           | ||| |  |  | ||||| ||||||||||| |  |||||||||||||| ||    || |
Sbjct: 305 aaatccgtttgagagcagaagatgtgcaagggagaaatgttctcacaaatttccatggaa 364

                                                                       
Query: 372 tggatttcaccaccgacaagcttagatcacttgtaaggaagtggcagacactaattgagg 431
           |||||||||| || || ||| | || || || ||  | || ||||||||  | |||||||
Sbjct: 365 tggatttcacaacagataagttgaggtctctggtccgcaaatggcagactttgattgagg 424

                              
Query: 432 cccatgttgatgttaagac 450
           ||||||||||||| |||||
Sbjct: 425 cccatgttgatgtaaagac 443



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 551 cagattcgccggaagatggttgagatta 578
           ||||| ||| ||||||||||||||||||
Sbjct: 544 cagatccgcaggaagatggttgagatta 571



to top

>gb|DQ252485.1| Solanum tuberosum clone 048H05 cyc07-like mRNA, complete cds
          Length = 998

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 202/259 (77%)
 Strand = Plus / Plus

                                                                       
Query: 192 tcggcaagaccctcgtctccaggacacaggggaccaagattgcatctgagggtcttaagc 251
           ||||||| ||||| ||  ||||||| ||||| ||||||||||| || || || || || |
Sbjct: 161 tcggcaaaacccttgttaccaggactcagggtaccaagattgcttcagatggcctaaaac 220

                                                                       
Query: 252 acagagtttttgaggtttccttggcagacctccagggtgatgaggaccaggctttcagga 311
           ||||||| ||||| |||  | |||| || || |||   |||||||| |||||||||||||
Sbjct: 221 acagagtatttgaagttagcctggctgatcttcagaaggatgaggatcaggctttcagga 280

                                                                       
Query: 312 agatcagacttcgtgcagaggatgtgcaaggaaagaatgttctcacaaacttttggggta 371
           | ||| |  |  | ||||| ||||||||||| |  |||||||||||||| ||    || |
Sbjct: 281 aaatccgtttgagagcagaagatgtgcaagggagaaatgttctcacaaatttccatggaa 340

                                                                       
Query: 372 tggatttcaccaccgacaagcttagatcacttgtaaggaagtggcagacactaattgagg 431
           |||||||||| || || ||| | || || || ||  | || ||||||||  | |||||||
Sbjct: 341 tggatttcacaacagataagttgaggtctctggtccgcaaatggcagactttgattgagg 400

                              
Query: 432 cccatgttgatgttaagac 450
           ||||||||||||| |||||
Sbjct: 401 cccatgttgatgtaaagac 419



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 551 cagattcgccggaagatggttgagatta 578
           ||||| ||| ||||||||||||||||||
Sbjct: 520 cagatccgcaggaagatggttgagatta 547



to top

>gb|DQ268842.1| Solanum tuberosum clone 135C12 40S ribosomal protein S3a-like
           protein mRNA, complete cds
          Length = 1059

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 74/89 (83%)
 Strand = Plus / Plus

                                                                       
Query: 368 ggtatggatttcaccaccgacaagcttagatcacttgtaaggaagtggcagacactaatt 427
           |||||||| |||||||| || ||  | || |||||||||| ||| |||||  || | |||
Sbjct: 335 ggtatggacttcaccacagataaattgaggtcacttgtaaagaaatggcaatcattgatt 394

                                        
Query: 428 gaggcccatgttgatgttaagaccactga 456
           ||||| ||||||||||||||||| |||||
Sbjct: 395 gaggctcatgttgatgttaagacaactga 423



to top

>dbj|D26058.1|CTRCYC07A Catharanthus roseus cyc07 gene, exon1-7, complete cds
          Length = 4798

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 74/89 (83%)
 Strand = Plus / Plus

                                                                        
Query: 228  agattgcatctgagggtcttaagcacagagtttttgaggtttccttggcagacctccagg 287
            ||||||| || |||||||| ||||| |||||||| ||| ||||  | || || || ||||
Sbjct: 3200 agattgcttccgagggtctcaagcatagagttttcgagatttctcttgctgatcttcagg 3259

                                         
Query: 288  gtgatgaggaccaggctttcaggaagatc 316
            |||||||||||||  | ||||||||||||
Sbjct: 3260 gtgatgaggaccactcattcaggaagatc 3288



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                       
Query: 434  catgttgatgttaagaccactgacaattacatgctccggctgttctgcattggcttcac 492
            ||||||||||||||||| |||||||  ||||   |  || |||||||||||||||||||
Sbjct: 3497 catgttgatgttaagacaactgacagctacacattgaggatgttctgcattggcttcac 3555



to top

>emb|CR354380.7| Zebrafish DNA sequence from clone CH211-182L2 in linkage group 1,
              complete sequence
          Length = 165344

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 82/100 (82%)
 Strand = Plus / Plus

                                                                          
Query: 128    gatcccttcaccaagaaggactggtatgacataaaggcgccgacgttgttcaacacccgc 187
              ||||| ||| |||||||||||||||||||  | ||||| ||  |  ||||||||| ||||
Sbjct: 103190 gatcctttctccaagaaggactggtatgatgtcaaggcaccagccatgttcaacatccgc 103249

                                                      
Query: 188    aacatcggcaagaccctcgtctccaggacacaggggacca 227
              ||| | ||||||||| | ||| ||||||| ||||| ||||
Sbjct: 103250 aacctgggcaagaccttggtcaccaggactcagggaacca 103289



 Score = 48.1 bits (24), Expect = 0.032
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                              
Query: 425    attgaggcccatgttgatgttaagaccactga 456
              ||||||||||||||||| || |||||||||||
Sbjct: 104986 attgaggcccatgttgacgtaaagaccactga 105017



to top

>emb|BX005068.13| Zebrafish DNA sequence from clone DKEY-40H17 in linkage group 1, complete
              sequence
          Length = 215007

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 82/100 (82%)
 Strand = Plus / Minus

                                                                          
Query: 128    gatcccttcaccaagaaggactggtatgacataaaggcgccgacgttgttcaacacccgc 187
              ||||| ||| |||||||||||||||||||  | ||||| ||  |  ||||||||| ||||
Sbjct: 120538 gatcctttctccaagaaggactggtatgatgtcaaggcaccagccatgttcaacatccgc 120479

                                                      
Query: 188    aacatcggcaagaccctcgtctccaggacacaggggacca 227
              ||| | ||||||||| | ||| ||||||| ||||| ||||
Sbjct: 120478 aacctgggcaagaccttggtcaccaggactcagggaacca 120439



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 425    attgaggcccatgttgatgttaagaccactga 456
              ||||||||||| ||||| || |||||||||||
Sbjct: 118732 attgaggcccacgttgacgtaaagaccactga 118701



to top

>ref|XM_862563.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript
          variant 13 (RPS3A), mRNA
          Length = 1051

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                     
Query: 62 gccatggcggtcggcaagaacaagcgc 88
          |||||||||||||||||||||||||||
Sbjct: 6  gccatggcggtcggcaagaacaagcgc 32



to top

>ref|XM_862552.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript
          variant 12 (RPS3A), mRNA
          Length = 1051

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                     
Query: 62 gccatggcggtcggcaagaacaagcgc 88
          |||||||||||||||||||||||||||
Sbjct: 6  gccatggcggtcggcaagaacaagcgc 32



to top

>ref|XM_862541.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript
          variant 11 (RPS3A), mRNA
          Length = 852

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                     
Query: 62 gccatggcggtcggcaagaacaagcgc 88
          |||||||||||||||||||||||||||
Sbjct: 50 gccatggcggtcggcaagaacaagcgc 76



to top

>ref|XM_862533.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript
          variant 10 (RPS3A), mRNA
          Length = 1065

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                     
Query: 62 gccatggcggtcggcaagaacaagcgc 88
          |||||||||||||||||||||||||||
Sbjct: 18 gccatggcggtcggcaagaacaagcgc 44



to top

>ref|XM_862525.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript
          variant 9 (RPS3A), mRNA
          Length = 1056

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                     
Query: 62 gccatggcggtcggcaagaacaagcgc 88
          |||||||||||||||||||||||||||
Sbjct: 49 gccatggcggtcggcaagaacaagcgc 75



to top

>ref|XM_862515.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript
          variant 8 (RPS3A), mRNA
          Length = 982

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                     
Query: 62 gccatggcggtcggcaagaacaagcgc 88
          |||||||||||||||||||||||||||
Sbjct: 17 gccatggcggtcggcaagaacaagcgc 43



to top

>ref|XM_862504.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript
          variant 7 (RPS3A), mRNA
          Length = 912

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                     
Query: 62 gccatggcggtcggcaagaacaagcgc 88
          |||||||||||||||||||||||||||
Sbjct: 17 gccatggcggtcggcaagaacaagcgc 43



to top

>ref|XM_862496.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript
          variant 6 (RPS3A), mRNA
          Length = 876

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                     
Query: 62 gccatggcggtcggcaagaacaagcgc 88
          |||||||||||||||||||||||||||
Sbjct: 19 gccatggcggtcggcaagaacaagcgc 45



to top

>ref|XM_534275.2| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript
          variant 1 (RPS3A), mRNA
          Length = 1106

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                     
Query: 62 gccatggcggtcggcaagaacaagcgc 88
          |||||||||||||||||||||||||||
Sbjct: 61 gccatggcggtcggcaagaacaagcgc 87



to top

>ref|XM_862466.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript
          variant 4 (RPS3A), mRNA
          Length = 769

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                     
Query: 62 gccatggcggtcggcaagaacaagcgc 88
          |||||||||||||||||||||||||||
Sbjct: 16 gccatggcggtcggcaagaacaagcgc 42



to top

>ref|XM_862454.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript
          variant 3 (RPS3A), mRNA
          Length = 774

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                     
Query: 62 gccatggcggtcggcaagaacaagcgc 88
          |||||||||||||||||||||||||||
Sbjct: 49 gccatggcggtcggcaagaacaagcgc 75



to top

>ref|XM_862446.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript
          variant 2 (RPS3A), mRNA
          Length = 553

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                     
Query: 62 gccatggcggtcggcaagaacaagcgc 88
          |||||||||||||||||||||||||||
Sbjct: 18 gccatggcggtcggcaagaacaagcgc 44



to top

>ref|XM_860742.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
          transcript variant 7 (LOC609500), mRNA
          Length = 875

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                     
Query: 62 gccatggcggtcggcaagaacaagcgc 88
          |||||||||||||||||||||||||||
Sbjct: 20 gccatggcggtcggcaagaacaagcgc 46



to top

>ref|XM_860726.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
          transcript variant 6 (LOC609500), mRNA
          Length = 857

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                     
Query: 62 gccatggcggtcggcaagaacaagcgc 88
          |||||||||||||||||||||||||||
Sbjct: 20 gccatggcggtcggcaagaacaagcgc 46



to top

>ref|XM_860710.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
          transcript variant 5 (LOC609500), mRNA
          Length = 866

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                     
Query: 62 gccatggcggtcggcaagaacaagcgc 88
          |||||||||||||||||||||||||||
Sbjct: 17 gccatggcggtcggcaagaacaagcgc 43



to top

>ref|XM_860701.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
          transcript variant 4 (LOC609500), mRNA
          Length = 1072

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                     
Query: 62 gccatggcggtcggcaagaacaagcgc 88
          |||||||||||||||||||||||||||
Sbjct: 20 gccatggcggtcggcaagaacaagcgc 46



to top

>ref|XM_860686.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
          transcript variant 3 (LOC609500), mRNA
          Length = 879

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                     
Query: 62 gccatggcggtcggcaagaacaagcgc 88
          |||||||||||||||||||||||||||
Sbjct: 20 gccatggcggtcggcaagaacaagcgc 46



to top

>ref|XM_847366.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
          transcript variant 1 (LOC609500), mRNA
          Length = 1069

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                     
Query: 62 gccatggcggtcggcaagaacaagcgc 88
          |||||||||||||||||||||||||||
Sbjct: 17 gccatggcggtcggcaagaacaagcgc 43



to top

>ref|XM_860652.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
          transcript variant 2 (LOC609500), mRNA
          Length = 760

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                     
Query: 62 gccatggcggtcggcaagaacaagcgc 88
          |||||||||||||||||||||||||||
Sbjct: 15 gccatggcggtcggcaagaacaagcgc 41



to top

>ref|XM_856691.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
          transcript variant 12 (LOC608454), mRNA
          Length = 874

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                     
Query: 62 gccatggcggtcggcaagaacaagcgc 88
          |||||||||||||||||||||||||||
Sbjct: 32 gccatggcggtcggcaagaacaagcgc 58



to top

>ref|XM_856663.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
          transcript variant 11 (LOC608454), mRNA
          Length = 875

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                     
Query: 62 gccatggcggtcggcaagaacaagcgc 88
          |||||||||||||||||||||||||||
Sbjct: 32 gccatggcggtcggcaagaacaagcgc 58



to top

>ref|XM_856635.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
          transcript variant 10 (LOC608454), mRNA
          Length = 879

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                     
Query: 62 gccatggcggtcggcaagaacaagcgc 88
          |||||||||||||||||||||||||||
Sbjct: 32 gccatggcggtcggcaagaacaagcgc 58



to top

>ref|XM_856605.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
          transcript variant 9 (LOC608454), mRNA
          Length = 883

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                     
Query: 62 gccatggcggtcggcaagaacaagcgc 88
          |||||||||||||||||||||||||||
Sbjct: 32 gccatggcggtcggcaagaacaagcgc 58



to top

>ref|XM_856573.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
          transcript variant 8 (LOC608454), mRNA
          Length = 883

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                     
Query: 62 gccatggcggtcggcaagaacaagcgc 88
          |||||||||||||||||||||||||||
Sbjct: 32 gccatggcggtcggcaagaacaagcgc 58



to top

>ref|XM_856546.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
          transcript variant 7 (LOC608454), mRNA
          Length = 882

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                     
Query: 62 gccatggcggtcggcaagaacaagcgc 88
          |||||||||||||||||||||||||||
Sbjct: 32 gccatggcggtcggcaagaacaagcgc 58



to top

>ref|XM_856515.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
          transcript variant 6 (LOC608454), mRNA
          Length = 1042

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                     
Query: 62 gccatggcggtcggcaagaacaagcgc 88
          |||||||||||||||||||||||||||
Sbjct: 9  gccatggcggtcggcaagaacaagcgc 35



to top

>ref|XM_856484.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
          transcript variant 5 (LOC608454), mRNA
          Length = 1047

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                     
Query: 62 gccatggcggtcggcaagaacaagcgc 88
          |||||||||||||||||||||||||||
Sbjct: 14 gccatggcggtcggcaagaacaagcgc 40



to top

>ref|XM_856455.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
          transcript variant 4 (LOC608454), mRNA
          Length = 1080

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                     
Query: 62 gccatggcggtcggcaagaacaagcgc 88
          |||||||||||||||||||||||||||
Sbjct: 32 gccatggcggtcggcaagaacaagcgc 58



to top

>ref|XM_845382.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
          transcript variant 2 (LOC608454), mRNA
          Length = 1058

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                     
Query: 62 gccatggcggtcggcaagaacaagcgc 88
          |||||||||||||||||||||||||||
Sbjct: 25 gccatggcggtcggcaagaacaagcgc 51



to top

>ref|XM_856398.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
          transcript variant 3 (LOC608454), mRNA
          Length = 901

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                     
Query: 62 gccatggcggtcggcaagaacaagcgc 88
          |||||||||||||||||||||||||||
Sbjct: 18 gccatggcggtcggcaagaacaagcgc 44



to top

>ref|XM_535263.2| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
          transcript variant 1 (LOC608454), mRNA
          Length = 759

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                     
Query: 62 gccatggcggtcggcaagaacaagcgc 88
          |||||||||||||||||||||||||||
Sbjct: 17 gccatggcggtcggcaagaacaagcgc 43



to top

>gb|BC106115.1| Mus musculus ribosomal protein S3a, mRNA (cDNA clone MGC:117914
          IMAGE:2599128), complete cds
          Length = 870

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          ||||||||||||||||||||||||||
Sbjct: 13 ccatggcggtcggcaagaacaagcgc 38



to top

>gb|AY643844.1|AY643842S3 Hordeum vulgare subsp. vulgare clones BAC 799C8 and 122A5 hardness locus
              region
          Length = 160897

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                        
Query: 425    attgaggcccatgttgatgttaagaccactgacaattacatg 466
              |||||||| ||||| ||||| ||||| |||||||||||||||
Sbjct: 128692 attgaggctcatgtagatgtcaagacaactgacaattacatg 128651



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                          
Query: 427    tgaggcccatgttgatgttaagaccactgacaattacatgctccggctgttctgcattgg 486
              |||||| ||||  ||||| ||||| ||||||||||||||||| ||  ||||   ||||||
Sbjct: 128519 tgaggctcatgcagatgtcaagacaactgacaattacatgcttcgcatgtttgccattgg 128460

                         
Query: 487    cttcactaaga 497
              |||||| ||||
Sbjct: 128459 cttcacaaaga 128449



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                        
Query: 425    attgaggcccatgttgatgttaagaccactgacaattacatg 466
              ||||| || ||||| ||||| ||||| |||||||||||||||
Sbjct: 128804 attgaagctcatgtagatgtcaagacaactgacaattacatg 128763



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                        
Query: 425    attgaggcccatgttgatgttaagaccactgacaattacatg 466
              |||||| | ||||| ||||| ||||| |||||||||||||||
Sbjct: 128748 attgagactcatgtagatgtcaagacaactgacaattacatg 128707



to top

>gb|AC156571.3| Mus musculus BAC clone RP23-264I19 from chromosome 13, complete
             sequence
          Length = 196911

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                       
Query: 63    ccatggcggtcggcaagaacaagcgc 88
             ||||||||||||||||||||||||||
Sbjct: 22653 ccatggcggtcggcaagaacaagcgc 22628



to top

>gb|AC104414.8| Mus musculus chromosome 3, clone RP23-99I7, complete sequence
          Length = 212613

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                       
Query: 63    ccatggcggtcggcaagaacaagcgc 88
             ||||||||||||||||||||||||||
Sbjct: 81044 ccatggcggtcggcaagaacaagcgc 81019



to top

>gb|BC084675.1| Mus musculus ribosomal protein S3a, mRNA (cDNA clone MGC:102469
          IMAGE:5319512), complete cds
          Length = 869

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          ||||||||||||||||||||||||||
Sbjct: 15 ccatggcggtcggcaagaacaagcgc 40



to top

>gb|BC083338.1| Mus musculus ribosomal protein S3a, mRNA (cDNA clone MGC:102070
          IMAGE:6820218), complete cds
          Length = 861

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          ||||||||||||||||||||||||||
Sbjct: 4  ccatggcggtcggcaagaacaagcgc 29



to top

>ref|XM_871858.1| PREDICTED: Bos taurus similar to ribosomal protein S3a,
          transcript variant 4 (LOC613340), mRNA
          Length = 872

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          ||||||||||||||||||||||||||
Sbjct: 32 ccatggcggtcggcaagaacaagcgc 57



to top

>ref|XM_863937.1| PREDICTED: Bos taurus similar to ribosomal protein S3a,
          transcript variant 1 (LOC613340), mRNA
          Length = 910

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          ||||||||||||||||||||||||||
Sbjct: 33 ccatggcggtcggcaagaacaagcgc 58



to top

>ref|XM_871665.1| PREDICTED: Bos taurus similar to ribosomal protein S3a,
          transcript variant 3 (LOC613340), mRNA
          Length = 587

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          ||||||||||||||||||||||||||
Sbjct: 18 ccatggcggtcggcaagaacaagcgc 43



to top

>ref|XM_871576.1| PREDICTED: Bos taurus similar to ribosomal protein S3a,
          transcript variant 2 (LOC613340), mRNA
          Length = 717

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          ||||||||||||||||||||||||||
Sbjct: 7  ccatggcggtcggcaagaacaagcgc 32



to top

>ref|XM_872846.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos
          transformation effector protein), transcript variant 6
          (LOC613460), mRNA
          Length = 918

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          ||||||||||||||||||||||||||
Sbjct: 34 ccatggcggtcggcaagaacaagcgc 59



to top

>ref|XM_872754.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos
          transformation effector protein), transcript variant 5
          (LOC613460), mRNA
          Length = 862

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          ||||||||||||||||||||||||||
Sbjct: 18 ccatggcggtcggcaagaacaagcgc 43



to top

>ref|XM_593124.2| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos
          transformation effector protein), transcript variant 2
          (LOC613460), mRNA
          Length = 876

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          ||||||||||||||||||||||||||
Sbjct: 34 ccatggcggtcggcaagaacaagcgc 59



to top

>ref|XM_872539.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos
          transformation effector protein), transcript variant 4
          (LOC613460), mRNA
          Length = 584

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          ||||||||||||||||||||||||||
Sbjct: 18 ccatggcggtcggcaagaacaagcgc 43



to top

>ref|XM_872447.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos
          transformation effector protein), transcript variant 3
          (LOC613460), mRNA
          Length = 714

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          ||||||||||||||||||||||||||
Sbjct: 7  ccatggcggtcggcaagaacaagcgc 32



to top

>ref|XM_420443.1| PREDICTED: Gallus gallus similar to 40S ribosomal protein S3a
           (V-fos transformation effector protein) (LOC422477),
           mRNA
          Length = 1423

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 63  ccatggcggtcggcaagaacaagcgc 88
           ||||||||||||||||||||||||||
Sbjct: 662 ccatggcggtcggcaagaacaagcgc 687



to top

>gb|AC133508.3| Mus musculus BAC clone RP23-383K24 from chromosome 3, complete sequence
          Length = 192136

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                       
Query: 63    ccatggcggtcggcaagaacaagcgc 88
             ||||||||||||||||||||||||||
Sbjct: 21194 ccatggcggtcggcaagaacaagcgc 21219



to top

>ref|NM_016959.2| Mus musculus ribosomal protein S3a (Rps3a), mRNA
          Length = 863

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          ||||||||||||||||||||||||||
Sbjct: 24 ccatggcggtcggcaagaacaagcgc 49



to top

>ref|XM_974769.1| PREDICTED: Mus musculus similar to 40S ribosomal protein S3a
          (LOC674452), mRNA
          Length = 889

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          ||||||||||||||||||||||||||
Sbjct: 22 ccatggcggtcggcaagaacaagcgc 47



to top

>ref|XM_994545.1| PREDICTED: Mus musculus similar to 40S ribosomal protein S3a
          (LOC668144), mRNA
          Length = 889

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          ||||||||||||||||||||||||||
Sbjct: 22 ccatggcggtcggcaagaacaagcgc 47



to top

>ref|XR_002919.1| PREDICTED: Mus musculus similar to 40S ribosomal protein S3a
          (LOC544977), mRNA
          Length = 895

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          ||||||||||||||||||||||||||
Sbjct: 22 ccatggcggtcggcaagaacaagcgc 47



to top

>ref|XR_002253.1| PREDICTED: Mus musculus similar to 40S ribosomal protein S3a
          (V-fos transformation effector protein) (LOC668799),
          mRNA
          Length = 847

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          ||||||||||||||||||||||||||
Sbjct: 9  ccatggcggtcggcaagaacaagcgc 34



to top

>ref|XR_005031.1| PREDICTED: Mus musculus similar to 40S ribosomal protein S3a
          (V-fos transformation effector protein) (LOC677290),
          mRNA
          Length = 853

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          ||||||||||||||||||||||||||
Sbjct: 9  ccatggcggtcggcaagaacaagcgc 34



to top

>emb|Z83368.1|MMRPS3A M.musculus RPS3a gene
          Length = 5695

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 63  ccatggcggtcggcaagaacaagcgc 88
           ||||||||||||||||||||||||||
Sbjct: 843 ccatggcggtcggcaagaacaagcgc 868



to top

>emb|AJ720257.1| Gallus gallus partial mRNA for hypothetical protein, clone 13j13
          Length = 107

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          ||||||||||||||||||||||||||
Sbjct: 24 ccatggcggtcggcaagaacaagcgc 49



to top

>gb|BC081451.1| Mus musculus ribosomal protein S3a, mRNA (cDNA clone MGC:102071
          IMAGE:6824188), complete cds
          Length = 872

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          ||||||||||||||||||||||||||
Sbjct: 11 ccatggcggtcggcaagaacaagcgc 36



to top

>gb|AF402811.1| Ictalurus punctatus 40S ribosomal protein S3a mRNA, partial cds
          Length = 842

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 98/122 (80%)
 Strand = Plus / Plus

                                                                       
Query: 125 gtcgatcccttcaccaagaaggactggtatgacataaaggcgccgacgttgttcaacacc 184
           |||||||| ||| |||||||||||||||| ||  | || || ||| |  ||||||| | |
Sbjct: 60  gtcgatcctttctccaagaaggactggtacgatgttaaagccccggccatgttcaatatc 119

                                                                       
Query: 185 cgcaacatcggcaagaccctcgtctccaggacacaggggaccaagattgcatctgagggt 244
           |||||| | |||||||| || ||| ||||||| ||||| |||| ||| || ||||| |||
Sbjct: 120 cgcaacctgggcaagactctggtcaccaggactcagggaaccaggatcgcctctgacggt 179

             
Query: 245 ct 246
           ||
Sbjct: 180 ct 181



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 73/89 (82%)
 Strand = Plus / Plus

                                                                       
Query: 409 gaagtggcagacactaattgaggcccatgttgatgttaagaccactgacaattacatgct 468
           ||||||||||||| | |||||||| || || || || |||||||| |||  |||| ||||
Sbjct: 341 gaagtggcagacaatgattgaggcgcacgtggacgtgaagaccacggacggttacctgct 400

                                        
Query: 469 ccggctgttctgcattggcttcactaaga 497
            || ||||||||| | |||||||| ||||
Sbjct: 401 gcgcctgttctgcgtgggcttcaccaaga 429



to top

>dbj|AK146304.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched
          library, clone:I730048K19 product:ribosomal protein
          S3a, full insert sequence
          Length = 871

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          ||||||||||||||||||||||||||
Sbjct: 32 ccatggcggtcggcaagaacaagcgc 57



to top

>dbj|AK135318.1| Mus musculus 12 days embryo male wolffian duct includes
          surrounding region cDNA, RIKEN full-length enriched
          library, clone:6720473N01 product:ribosomal protein
          S3a, full insert sequence
          Length = 864

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          ||||||||||||||||||||||||||
Sbjct: 25 ccatggcggtcggcaagaacaagcgc 50



to top

>dbj|AK151982.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
          enriched library, clone:I830044H24 product:ribosomal
          protein S3a, full insert sequence
          Length = 873

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          ||||||||||||||||||||||||||
Sbjct: 34 ccatggcggtcggcaagaacaagcgc 59



to top

>dbj|AK150814.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
          enriched library, clone:I830015K17 product:ribosomal
          protein S3a, full insert sequence
          Length = 863

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          ||||||||||||||||||||||||||
Sbjct: 24 ccatggcggtcggcaagaacaagcgc 49



to top

>dbj|AK150796.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
          enriched library, clone:I830015H22 product:ribosomal
          protein S3a, full insert sequence
          Length = 873

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          ||||||||||||||||||||||||||
Sbjct: 34 ccatggcggtcggcaagaacaagcgc 59



to top

>dbj|AK148513.1| Mus musculus adult pancreas islet cells cDNA, RIKEN full-length
          enriched library, clone:C820015M15 product:ribosomal
          protein S3a, full insert sequence
          Length = 863

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          ||||||||||||||||||||||||||
Sbjct: 24 ccatggcggtcggcaagaacaagcgc 49



to top

>dbj|AK151429.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
          enriched library, clone:I830030B03 product:ribosomal
          protein S3a, full insert sequence
          Length = 864

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          ||||||||||||||||||||||||||
Sbjct: 25 ccatggcggtcggcaagaacaagcgc 50



to top

>dbj|AK150441.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
          enriched library, clone:I830007K16 product:ribosomal
          protein S3a, full insert sequence
          Length = 862

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          ||||||||||||||||||||||||||
Sbjct: 24 ccatggcggtcggcaagaacaagcgc 49



to top

>dbj|AK166713.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length
          enriched library, clone:I1C0005O17 product:40S
          ribosomal protein S3a homolog [Mus musculus], full
          insert sequence
          Length = 865

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          ||||||||||||||||||||||||||
Sbjct: 22 ccatggcggtcggcaagaacaagcgc 47



to top

>dbj|AK153480.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
          enriched library, clone:I830165N20 product:ribosomal
          protein S3a, full insert sequence
          Length = 863

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          ||||||||||||||||||||||||||
Sbjct: 24 ccatggcggtcggcaagaacaagcgc 49



to top

>dbj|AK167562.1| Mus musculus 11 days pregnant adult female placenta cDNA, RIKEN
          full-length enriched library, clone:I530022H01
          product:ribosomal protein S3a, full insert sequence
          Length = 862

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          ||||||||||||||||||||||||||
Sbjct: 23 ccatggcggtcggcaagaacaagcgc 48



to top

>dbj|AK167512.1| Mus musculus 11 days pregnant adult female placenta cDNA, RIKEN
          full-length enriched library, clone:I530018C11
          product:ribosomal protein S3a, full insert sequence
          Length = 870

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          ||||||||||||||||||||||||||
Sbjct: 25 ccatggcggtcggcaagaacaagcgc 50



to top

>dbj|AK159777.1| Mus musculus osteoclast-like cell cDNA, RIKEN full-length
          enriched library, clone:I420030N20 product:ribosomal
          protein S3a, full insert sequence
          Length = 869

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          ||||||||||||||||||||||||||
Sbjct: 24 ccatggcggtcggcaagaacaagcgc 49



to top

>dbj|AK168240.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched
          library, clone:I730070G06 product:ribosomal protein
          S3a, full insert sequence
          Length = 868

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          ||||||||||||||||||||||||||
Sbjct: 22 ccatggcggtcggcaagaacaagcgc 47



to top

>dbj|AK010605.1| Mus musculus ES cells cDNA, RIKEN full-length enriched library,
          clone:2410029J05 product:ribosomal protein S3a, full
          insert sequence
          Length = 860

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          ||||||||||||||||||||||||||
Sbjct: 21 ccatggcggtcggcaagaacaagcgc 46



to top

>dbj|AK003158.1| Mus musculus 18-day embryo whole body cDNA, RIKEN full-length
          enriched library, clone:1100001E09 product:ribosomal
          protein S3a, full insert sequence
          Length = 863

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          ||||||||||||||||||||||||||
Sbjct: 24 ccatggcggtcggcaagaacaagcgc 49



to top

>dbj|AK088113.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
          full-length enriched library, clone:E430004H05
          product:ribosomal protein S3a, full insert sequence
          Length = 860

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          ||||||||||||||||||||||||||
Sbjct: 21 ccatggcggtcggcaagaacaagcgc 46



to top

>dbj|AK050610.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
          full-length enriched library, clone:C920016J02
          product:ribosomal protein S3a, full insert sequence
          Length = 862

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          ||||||||||||||||||||||||||
Sbjct: 24 ccatggcggtcggcaagaacaagcgc 49



to top

>gb|BC039659.1| Mus musculus ribosomal protein S3a, mRNA (cDNA clone MGC:49186
          IMAGE:5025347), complete cds
          Length = 877

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          ||||||||||||||||||||||||||
Sbjct: 23 ccatggcggtcggcaagaacaagcgc 48



to top

>dbj|AK012345.1| Mus musculus 11 days embryo whole body cDNA, RIKEN full-length
          enriched library, clone:2700038N16 product:ribosomal
          protein S3a, full insert sequence
          Length = 860

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          ||||||||||||||||||||||||||
Sbjct: 21 ccatggcggtcggcaagaacaagcgc 46



to top

>gb|AC112969.12| Mus musculus chromosome 8, clone RP24-331K7, complete sequence
          Length = 164201

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                       
Query: 63    ccatggcggtcggcaagaacaagcgc 88
             ||||||||||||||||||||||||||
Sbjct: 92494 ccatggcggtcggcaagaacaagcgc 92469



to top

>dbj|AK196258.1| Mus musculus cDNA, clone:Y1G0121E15, strand:minus,
          reference:ENSEMBL:Mouse-Transcript-
          ENST:ENSMUST00000029722, based on BLAT search
          Length = 282

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          ||||||||||||||||||||||||||
Sbjct: 10 ccatggcggtcggcaagaacaagcgc 35



to top

>emb|CT571277.10| Mouse DNA sequence from clone RP24-327L5 on chromosome 14, complete
             sequence
          Length = 142749

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                       
Query: 63    ccatggcggtcggcaagaacaagcgc 88
             ||||||||||||||||||||||||||
Sbjct: 34611 ccatggcggtcggcaagaacaagcgc 34586



to top

>gb|AF042107.1|AF042107 Eimeria tenella ribosomal protein S3a mRNA, complete cds
          Length = 858

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          ||||||||||||||||||||||||||
Sbjct: 5  ccatggcggtcggcaagaacaagcgc 30



to top

>emb|X68555.1|ACKRPA A.californica KRP-A gene
          Length = 849

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 409 gaagtggcagacactaattgaggcccatgttgatgttaagac 450
           |||||||||||| || ||||||||| |||||||||| |||||
Sbjct: 354 gaagtggcagactcttattgaggccaatgttgatgtgaagac 395



to top

>emb|AL691416.9| Mouse DNA sequence from clone RP23-110I8 on chromosome 2, complete
              sequence
          Length = 208363

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                        
Query: 63     ccatggcggtcggcaagaacaagcgc 88
              ||||||||||||||||||||||||||
Sbjct: 155042 ccatggcggtcggcaagaacaagcgc 155017



to top

>gb|DQ268835.1| Solanum tuberosum clone 115A11 cyc07-like protein mRNA, complete
           cds
          Length = 1020

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 62/74 (83%)
 Strand = Plus / Plus

                                                                       
Query: 290 gatgaggaccaggctttcaggaagatcagacttcgtgcagaggatgtgcaaggaaagaat 349
           |||||||| ||||||| |||||||||| |  |  | ||||| ||||||||||| | ||||
Sbjct: 269 gatgaggatcaggcttacaggaagatccgcttgagagcagaagatgtgcaagggaggaat 328

                         
Query: 350 gttctcacaaactt 363
           || |||||||||||
Sbjct: 329 gtcctcacaaactt 342



to top

>gb|DQ252490.1| Solanum tuberosum clone 059D09 cyc07-like mRNA, complete cds
          Length = 996

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 62/74 (83%)
 Strand = Plus / Plus

                                                                       
Query: 290 gatgaggaccaggctttcaggaagatcagacttcgtgcagaggatgtgcaaggaaagaat 349
           |||||||| ||||||| |||||||||| |  |  | ||||| ||||||||||| | ||||
Sbjct: 247 gatgaggatcaggcttacaggaagatccgcttgagagcagaagatgtgcaagggaggaat 306

                         
Query: 350 gttctcacaaactt 363
           || |||||||||||
Sbjct: 307 gtcctcacaaactt 320



to top

>dbj|AB023436.1| Hordeum vulgare DNA, down stream region of HvNAS1 gene
          Length = 10603

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                      
Query: 425  attgaggcccatgttgatgttaagaccactgacaattacatg 466
            |||||||| ||||| ||||| ||||| |||||||||||||||
Sbjct: 5117 attgaggctcatgtagatgtcaagacaactgacaattacatg 5076



to top

>gb|AY643842.1|AY643842S1 Hordeum vulgare subsp. vulgare clone BAC 519K7 hardness locus region
          Length = 12998

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                     
Query: 415  gcagacactaattgaggcccatgttgatgttaagaccactgacaattacatgctccg 471
            |||||| || |||||||| ||||  ||||| ||||| |||||||| |||||||||||
Sbjct: 3401 gcagaccctcattgaggctcatgcagatgtcaagacaactgacaactacatgctccg 3457



to top

>gb|BT012853.1| Lycopersicon esculentum clone 113933F, mRNA sequence
          Length = 1053

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 73/89 (82%)
 Strand = Plus / Plus

                                                                       
Query: 368 ggtatggatttcaccaccgacaagcttagatcacttgtaaggaagtggcagacactaatt 427
           ||||||||||||||||| || ||  | || ||||| |||| ||| |||||  || | |||
Sbjct: 375 ggtatggatttcaccacagataaattgaggtcactggtaaagaaatggcaatcattgatt 434

                                        
Query: 428 gaggcccatgttgatgttaagaccactga 456
           ||||| |||||||| |||||||| |||||
Sbjct: 435 gaggctcatgttgacgttaagacaactga 463



to top

>ref|XM_505043.1| Yarrowia lipolytica CLIB122, YALI0F05676g predicted mRNA
          Length = 744

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 125 gtcgatcccttcaccaagaaggactggta 153
           ||||| |||||||||||||||||||||||
Sbjct: 37  gtcgaccccttcaccaagaaggactggta 65



to top

>emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB122 of Yarrowia lipolytica
          Length = 4003362

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                           
Query: 125    gtcgatcccttcaccaagaaggactggta 153
              ||||| |||||||||||||||||||||||
Sbjct: 843077 gtcgaccccttcaccaagaaggactggta 843049



to top

>ref|XM_875949.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos
          transformation effector protein), transcript variant 8
          (LOC613769), mRNA
          Length = 900

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                 
Query: 63 ccatggcggtcggcaagaacaag 85
          |||||||||||||||||||||||
Sbjct: 50 ccatggcggtcggcaagaacaag 72



to top

>ref|XM_875867.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos
          transformation effector protein), transcript variant 7
          (LOC613769), mRNA
          Length = 879

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                 
Query: 63 ccatggcggtcggcaagaacaag 85
          |||||||||||||||||||||||
Sbjct: 40 ccatggcggtcggcaagaacaag 62



to top

>ref|XM_875801.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos
          transformation effector protein), transcript variant 6
          (LOC613769), mRNA
          Length = 884

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                 
Query: 63 ccatggcggtcggcaagaacaag 85
          |||||||||||||||||||||||
Sbjct: 40 ccatggcggtcggcaagaacaag 62



to top

>ref|XM_875730.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos
          transformation effector protein), transcript variant 5
          (LOC613769), mRNA
          Length = 871

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                 
Query: 63 ccatggcggtcggcaagaacaag 85
          |||||||||||||||||||||||
Sbjct: 21 ccatggcggtcggcaagaacaag 43



to top

>ref|XM_875654.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos
          transformation effector protein), transcript variant 4
          (LOC613769), mRNA
          Length = 890

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                 
Query: 63 ccatggcggtcggcaagaacaag 85
          |||||||||||||||||||||||
Sbjct: 40 ccatggcggtcggcaagaacaag 62



to top

>ref|XM_875583.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos
          transformation effector protein), transcript variant 3
          (LOC613769), mRNA
          Length = 878

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                 
Query: 63 ccatggcggtcggcaagaacaag 85
          |||||||||||||||||||||||
Sbjct: 40 ccatggcggtcggcaagaacaag 62



to top

>ref|XM_865235.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos
          transformation effector protein), transcript variant 2
          (LOC613769), mRNA
          Length = 876

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                 
Query: 63 ccatggcggtcggcaagaacaag 85
          |||||||||||||||||||||||
Sbjct: 40 ccatggcggtcggcaagaacaag 62



to top

>ref|XM_855573.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
          transcript variant 4 (LOC608684), mRNA
          Length = 875

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                     
Query: 62 gccatggcggtcggcaagaacaagcgc 88
          ||||||| |||||||||||||||||||
Sbjct: 9  gccatggtggtcggcaagaacaagcgc 35



to top

>ref|XM_844989.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
          transcript variant 1 (LOC608684), mRNA
          Length = 886

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                     
Query: 62 gccatggcggtcggcaagaacaagcgc 88
          ||||||| |||||||||||||||||||
Sbjct: 20 gccatggtggtcggcaagaacaagcgc 46



to top

>ref|XM_855510.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
          transcript variant 3 (LOC608684), mRNA
          Length = 717

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                     
Query: 62 gccatggcggtcggcaagaacaagcgc 88
          ||||||| |||||||||||||||||||
Sbjct: 6  gccatggtggtcggcaagaacaagcgc 32



to top

>ref|XM_855476.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
          transcript variant 2 (LOC608684), mRNA
          Length = 579

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                     
Query: 62 gccatggcggtcggcaagaacaagcgc 88
          ||||||| |||||||||||||||||||
Sbjct: 9  gccatggtggtcggcaagaacaagcgc 35



to top

>ref|XM_844705.1| PREDICTED: Canis familiaris similar to 40S ribosomal protein S3a
          (V-fos transformation effector protein) (LOC607868),
          mRNA
          Length = 1106

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                 
Query: 66 tggcggtcggcaagaacaagcgc 88
          |||||||||||||||||||||||
Sbjct: 75 tggcggtcggcaagaacaagcgc 97



to top

>ref|XM_851147.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
          transcript variant 5 (LOC607193), mRNA
          Length = 857

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                     
Query: 62 gccatggcggtcggcaagaacaagcgc 88
          ||||||| |||||||||||||||||||
Sbjct: 9  gccatggtggtcggcaagaacaagcgc 35



to top

>ref|XM_851102.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
          transcript variant 4 (LOC607193), mRNA
          Length = 866

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                     
Query: 62 gccatggcggtcggcaagaacaagcgc 88
          ||||||| |||||||||||||||||||
Sbjct: 9  gccatggtggtcggcaagaacaagcgc 35



to top

>ref|XM_851056.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
          transcript variant 3 (LOC607193), mRNA
          Length = 718

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                     
Query: 62 gccatggcggtcggcaagaacaagcgc 88
          ||||||| |||||||||||||||||||
Sbjct: 7  gccatggtggtcggcaagaacaagcgc 33



to top

>ref|XM_843347.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
          transcript variant 2 (LOC607193), mRNA
          Length = 579

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                     
Query: 62 gccatggcggtcggcaagaacaagcgc 88
          ||||||| |||||||||||||||||||
Sbjct: 9  gccatggtggtcggcaagaacaagcgc 35



to top

>ref|XM_843648.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
          transcript variant 2 (LOC478437), mRNA
          Length = 891

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                     
Query: 62 gccatggcggtcggcaagaacaagcgc 88
          ||||||||||||||||| |||||||||
Sbjct: 5  gccatggcggtcggcaaaaacaagcgc 31



to top

>ref|XM_535614.2| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
          transcript variant 1 (LOC478437), mRNA
          Length = 755

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                     
Query: 62 gccatggcggtcggcaagaacaagcgc 88
          ||||||||||||||||| |||||||||
Sbjct: 10 gccatggcggtcggcaaaaacaagcgc 36



to top

>ref|XM_534831.2| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
          transcript variant 1 (LOC608748), mRNA
          Length = 886

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                     
Query: 62 gccatggcggtcggcaagaacaagcgc 88
          ||||||||||| |||||||||||||||
Sbjct: 26 gccatggcggtaggcaagaacaagcgc 52



to top

>ref|XM_859165.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
          transcript variant 4 (LOC608748), mRNA
          Length = 720

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                     
Query: 62 gccatggcggtcggcaagaacaagcgc 88
          ||||||||||| |||||||||||||||
Sbjct: 21 gccatggcggtaggcaagaacaagcgc 47



to top

>ref|XM_859142.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
          transcript variant 3 (LOC608748), mRNA
          Length = 573

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                     
Query: 62 gccatggcggtcggcaagaacaagcgc 88
          ||||||||||| |||||||||||||||
Sbjct: 15 gccatggcggtaggcaagaacaagcgc 41



to top

>ref|XM_534259.2| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
          transcript variant 1 (LOC477063), mRNA
          Length = 579

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                     
Query: 62 gccatggcggtcggcaagaacaagcgc 88
          ||||||||||||| |||||||||||||
Sbjct: 15 gccatggcggtcgacaagaacaagcgc 41



to top

>ref|XM_846199.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
          transcript variant 2 (LOC477063), mRNA
          Length = 772

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                     
Query: 62 gccatggcggtcggcaagaacaagcgc 88
          ||||||||||||| |||||||||||||
Sbjct: 2  gccatggcggtcgacaagaacaagcgc 28



to top

>ref|XM_519223.1| PREDICTED: Pan troglodytes similar to ribosomal protein S3a; 40S
           ribosomal protein S3a; v-fos transformation effector
           protein 1 (LOC463560), mRNA
          Length = 649

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 197 aagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
           ||||| |||||| ||||||| || || ||||| ||||||||||| |||||
Sbjct: 143 aagacgctcgtcaccaggacccaaggaaccaaaattgcatctgatggtct 192



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          |||||||||| |||||||||||||||
Sbjct: 6  ccatggcggttggcaagaacaagcgc 31



to top

>ref|XM_526720.1| PREDICTED: Pan troglodytes similar to Rps3a-prov protein
           (LOC471338), mRNA
          Length = 579

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 197 aagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
           ||||| |||||| ||||||| || || ||||| ||||||||||| |||||
Sbjct: 136 aagacgctcgtcaccaggacccaaggaaccaaaattgcatctgatggtct 185



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                  
Query: 65 atggcggtcggcaagaacaagcgc 88
          |||||||| |||||||||||||||
Sbjct: 1  atggcggttggcaagaacaagcgc 24



to top

>ref|NM_001034038.1| Bos taurus ribosomal protein S3A (RPS3A), mRNA
          Length = 865

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          ||||||||||||||||||| ||||||
Sbjct: 25 ccatggcggtcggcaagaataagcgc 50



to top

>ref|XM_868916.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos
          transformation effector protein) (LOC515006), mRNA
          Length = 531

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                
Query: 65 atggcggtcggcaagaacaagc 86
          ||||||||||||||||||||||
Sbjct: 1  atggcggtcggcaagaacaagc 22



to top

>gb|BC058483.1| Rattus norvegicus ribosomal protein S3a, mRNA (cDNA clone
          MGC:72868 IMAGE:6887884), complete cds
          Length = 896

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          ||||||||||||| ||||||||||||
Sbjct: 28 ccatggcggtcgggaagaacaagcgc 53



to top

>gb|AC093799.2| Homo sapiens BAC clone RP11-307C18 from 7, complete sequence
          Length = 156195

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 63    ccatggcggtcggcaagaacaagcgc 88
             |||||||||| |||||||||||||||
Sbjct: 74342 ccatggcggttggcaagaacaagcgc 74317



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                               
Query: 197   aagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
             ||||| |||||| ||||||| || || ||||| ||||||||||| |||||
Sbjct: 74205 aagacgctcgtcaccaggacccaaggaaccaaaattgcatctgatggtct 74156



to top

>ref|XR_003814.1| PREDICTED: Mus musculus similar to 40S ribosomal protein S3a
          (LOC670633), mRNA
          Length = 893

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          |||||||||| |||||||||||||||
Sbjct: 34 ccatggcggttggcaagaacaagcgc 59



to top

>gb|BC045105.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone IMAGE:3160242),
            **** WARNING: chimeric clone ****
          Length = 2436

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                              
Query: 197  aagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
            ||||| |||||| ||||||| || || ||||| ||||||||||| |||||
Sbjct: 1716 aagacgctcgtcaccaggacccaaggaaccaaaattgcatctgatggtct 1765



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 63   ccatggcggtcggcaagaacaagcgc 88
            |||||||||| |||||||||||||||
Sbjct: 1579 ccatggcggttggcaagaacaagcgc 1604



to top

>gb|BC023666.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone
           IMAGE:5022252), **** WARNING: chimeric clone ****
          Length = 1551

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 197 aagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
           ||||| |||||| ||||||| || || ||||| ||||||||||| |||||
Sbjct: 808 aagacgctcgtcaccaggacccaaggaaccaaaattgcatctgatggtct 857



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 63  ccatggcggtcggcaagaacaagcgc 88
           |||||||||| |||||||||||||||
Sbjct: 671 ccatggcggttggcaagaacaagcgc 696



to top

>emb|CR701956.2|CNS0G4KW Tetraodon nigroviridis full-length cDNA
          Length = 861

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 131 cccttcaccaagaaggactggtatga 156
           |||||| |||||||||||||||||||
Sbjct: 91  cccttctccaagaaggactggtatga 116



to top

>emb|CR655410.2|CNS0F4OO Tetraodon nigroviridis full-length cDNA
          Length = 862

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 131 cccttcaccaagaaggactggtatga 156
           |||||| |||||||||||||||||||
Sbjct: 92  cccttctccaagaaggactggtatga 117



to top

>gb|BC094829.1| Homo sapiens cDNA clone IMAGE:4647813, **** WARNING: chimeric clone
           ****
          Length = 1415

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 197 aagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
           ||||| |||||| ||||||| || || ||||| ||||||||||| |||||
Sbjct: 693 aagacgctcgtcaccaggacccaaggaaccaaaattgcatctgatggtct 742



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 63  ccatggcggtcggcaagaacaagcgc 88
           |||||||||| |||||||||||||||
Sbjct: 556 ccatggcggttggcaagaacaagcgc 581



to top

>gb|BC099924.1| Homo sapiens cDNA clone IMAGE:6371780, **** WARNING: chimeric clone
            ****
          Length = 2186

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                              
Query: 197  aagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
            ||||| |||||| ||||||| || || ||||| ||||||||||| |||||
Sbjct: 1463 aagacgctcgtcaccaggacccaaggaaccaaaattgcatctgatggtct 1512



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 63   ccatggcggtcggcaagaacaagcgc 88
            |||||||||| |||||||||||||||
Sbjct: 1326 ccatggcggttggcaagaacaagcgc 1351



to top

>gb|BC011660.1| Homo sapiens cDNA clone IMAGE:4120690, **** WARNING: chimeric clone
            ****
          Length = 2268

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                              
Query: 197  aagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
            ||||| |||||| ||||||| || || ||||| ||||||||||| |||||
Sbjct: 1545 aagacgctcgtcaccaggacccaaggaaccaaaattgcatctgatggtct 1594



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 63   ccatggcggtcggcaagaacaagcgc 88
            |||||||||| |||||||||||||||
Sbjct: 1408 ccatggcggttggcaagaacaagcgc 1433



to top

>gb|BC021075.1| Homo sapiens cDNA clone IMAGE:3530401, **** WARNING: chimeric clone
           ****
          Length = 1553

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 197 aagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
           ||||| |||||| ||||||| || || ||||| ||||||||||| |||||
Sbjct: 808 aagacgctcgtcaccaggacccaaggaaccaaaattgcatctgatggtct 857



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 63  ccatggcggtcggcaagaacaagcgc 88
           |||||||||| |||||||||||||||
Sbjct: 671 ccatggcggttggcaagaacaagcgc 696



to top

>gb|BC066926.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone MGC:87201
           IMAGE:4826149), complete cds
          Length = 881

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 197 aagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
           ||||| |||||| ||||||| || || ||||| ||||||||||| |||||
Sbjct: 160 aagacgctcgtcaccaggacccaaggaaccaaaattgcatctgatggtct 209



to top

>gb|BC004981.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone MGC:3883
           IMAGE:2906117), complete cds
          Length = 891

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 197 aagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
           ||||| |||||| ||||||| || || ||||| ||||||||||| |||||
Sbjct: 148 aagacgctcgtcaccaggacccaaggaaccaaaattgcatctgatggtct 197



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          |||||||||| |||||||||||||||
Sbjct: 11 ccatggcggttggcaagaacaagcgc 36



to top

>emb|CR860858.1| Pongo pygmaeus mRNA; cDNA DKFZp469E172 (from clone DKFZp469E172)
          Length = 923

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 197 aagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
           ||||| |||||| ||||||| || || ||||| ||||||||||| |||||
Sbjct: 176 aagacgctcgtcaccaggacccaaggaaccaaaattgcatctgatggtct 225



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          |||||||||| |||||||||||||||
Sbjct: 39 ccatggcggttggcaagaacaagcgc 64



to top

>gb|AC095055.3| Homo sapiens BAC clone RP11-372K14 from 4, complete sequence
          Length = 183478

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 63    ccatggcggtcggcaagaacaagcgc 88
             |||||||||| |||||||||||||||
Sbjct: 36382 ccatggcggttggcaagaacaagcgc 36407



to top

>gb|AC090771.4| Homo sapiens chromosome 18, clone RP11-795H16, complete sequence
          Length = 186031

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                               
Query: 197   aagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
             ||||| ||| || ||||||| ||||| ||||| ||||||||||| |||||
Sbjct: 90361 aagacgctcatcaccaggacccagggaaccaaaattgcatctgatggtct 90410



to top

>gb|BC102789.1| Bos taurus ribosomal protein S3A, mRNA (cDNA clone MGC:127088
          IMAGE:7943245), complete cds
          Length = 899

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          ||||||||||||||||||| ||||||
Sbjct: 21 ccatggcggtcggcaagaataagcgc 46



to top

>ref|XM_944491.1| PREDICTED: Homo sapiens similar to 40S ribosomal protein S3a,
           transcript variant 10 (LOC400652), mRNA
          Length = 870

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 197 aagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
           ||||| ||| || ||||||| ||||| ||||| ||||||||||| |||||
Sbjct: 162 aagacgctcatcaccaggacccagggaaccaaaattgcatctgatggtct 211



to top

>ref|XM_944488.1| PREDICTED: Homo sapiens similar to 40S ribosomal protein S3a,
           transcript variant 9 (LOC400652), mRNA
          Length = 861

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 197 aagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
           ||||| ||| || ||||||| ||||| ||||| ||||||||||| |||||
Sbjct: 162 aagacgctcatcaccaggacccagggaaccaaaattgcatctgatggtct 211



to top

>ref|XM_944486.1| PREDICTED: Homo sapiens similar to 40S ribosomal protein S3a,
           transcript variant 8 (LOC400652), mRNA
          Length = 900

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 197 aagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
           ||||| ||| || ||||||| ||||| ||||| ||||||||||| |||||
Sbjct: 172 aagacgctcatcaccaggacccagggaaccaaaattgcatctgatggtct 221



to top

>ref|XM_940167.1| PREDICTED: Homo sapiens similar to 40S ribosomal protein S3a,
           transcript variant 6 (LOC400652), mRNA
          Length = 734

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 197 aagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
           ||||| ||| || ||||||| ||||| ||||| ||||||||||| |||||
Sbjct: 156 aagacgctcatcaccaggacccagggaaccaaaattgcatctgatggtct 205



to top

>ref|XM_931855.1| PREDICTED: Homo sapiens similar to 40S ribosomal protein S3a,
           transcript variant 5 (LOC400652), mRNA
          Length = 871

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 197 aagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
           ||||| ||| || ||||||| ||||| ||||| ||||||||||| |||||
Sbjct: 172 aagacgctcatcaccaggacccagggaaccaaaattgcatctgatggtct 221



to top

>ref|XM_931846.1| PREDICTED: Homo sapiens similar to 40S ribosomal protein S3a,
           transcript variant 4 (LOC400652), mRNA
          Length = 880

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 197 aagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
           ||||| ||| || ||||||| ||||| ||||| ||||||||||| |||||
Sbjct: 172 aagacgctcatcaccaggacccagggaaccaaaattgcatctgatggtct 221



to top

>ref|XM_931841.1| PREDICTED: Homo sapiens similar to 40S ribosomal protein S3a,
           transcript variant 3 (LOC400652), mRNA
          Length = 900

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 197 aagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
           ||||| ||| || ||||||| ||||| ||||| ||||||||||| |||||
Sbjct: 172 aagacgctcatcaccaggacccagggaaccaaaattgcatctgatggtct 221



to top

>ref|XM_927103.1| PREDICTED: Homo sapiens similar to 40S ribosomal protein S3a,
           transcript variant 2 (LOC400652), mRNA
          Length = 734

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 197 aagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
           ||||| ||| || ||||||| ||||| ||||| ||||||||||| |||||
Sbjct: 156 aagacgctcatcaccaggacccagggaaccaaaattgcatctgatggtct 205



to top

>ref|XR_001455.1| PREDICTED: Homo sapiens similar to 40S ribosomal protein S3a (V-fos
           transformation effector protein) (LOC641829), mRNA
          Length = 731

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 197 aagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
           ||||| |||||| ||||||| || || ||||| ||||||||||| |||||
Sbjct: 153 aagacgctcgtcaccaggacccaaggaaccaaaattgcatctgatggtct 202



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          |||||||||| |||||||||||||||
Sbjct: 16 ccatggcggttggcaagaacaagcgc 41



to top

>ref|XR_001456.1| PREDICTED: Homo sapiens similar to ribosomal protein S3a
           (LOC649582), mRNA
          Length = 731

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 197 aagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
           ||||| |||||| ||||||| || || ||||| ||||||||||| |||||
Sbjct: 153 aagacgctcgtcaccaggacccaaggaaccaaaattgcatctgatggtct 202



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          |||||||||| |||||||||||||||
Sbjct: 16 ccatggcggttggcaagaacaagcgc 41



to top

>ref|XR_001449.1| PREDICTED: Homo sapiens similar to ribosomal protein S3a
           (LOC644972), mRNA
          Length = 731

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 197 aagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
           ||||| |||||| ||||||| || || ||||| ||||||||||| |||||
Sbjct: 153 aagacgctcgtcaccaggacccaaggaaccaaaattgcatctgatggtct 202



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          |||||||||| |||||||||||||||
Sbjct: 16 ccatggcggttggcaagaacaagcgc 41



to top

>ref|XM_943063.1| PREDICTED: Homo sapiens similar to 40S ribosomal protein S3a (V-fos
           transformation effector protein), transcript variant 6
           (LOC402677), mRNA
          Length = 878

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 197 aagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
           ||||| |||||| ||||||| || || ||||| ||||||||||| |||||
Sbjct: 170 aagacgctcgtcaccaggacccaaggaaccaaaattgcatctgatggtct 219



to top

>ref|XM_943058.1| PREDICTED: Homo sapiens similar to 40S ribosomal protein S3a (V-fos
           transformation effector protein), transcript variant 5
           (LOC402677), mRNA
          Length = 850

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 197 aagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
           ||||| |||||| ||||||| || || ||||| ||||||||||| |||||
Sbjct: 157 aagacgctcgtcaccaggacccaaggaaccaaaattgcatctgatggtct 206



to top

>ref|XM_943052.1| PREDICTED: Homo sapiens similar to 40S ribosomal protein S3a (V-fos
           transformation effector protein), transcript variant 4
           (LOC402677), mRNA
          Length = 867

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 197 aagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
           ||||| |||||| ||||||| || || ||||| ||||||||||| |||||
Sbjct: 157 aagacgctcgtcaccaggacccaaggaaccaaaattgcatctgatggtct 206



to top

>ref|XM_380021.2| PREDICTED: Homo sapiens similar to 40S ribosomal protein S3a (V-fos
           transformation effector protein), transcript variant 1
           (LOC402677), mRNA
          Length = 815

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 197 aagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
           ||||| |||||| ||||||| || || ||||| ||||||||||| |||||
Sbjct: 157 aagacgctcgtcaccaggacccaaggaaccaaaattgcatctgatggtct 206



to top

>ref|XM_936883.1| PREDICTED: Homo sapiens similar to 40S ribosomal protein S3a (V-fos
           transformation effector protein), transcript variant 2
           (LOC402677), mRNA
          Length = 761

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 197 aagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
           ||||| |||||| ||||||| || || ||||| ||||||||||| |||||
Sbjct: 157 aagacgctcgtcaccaggacccaaggaaccaaaattgcatctgatggtct 206



to top

>ref|XM_943039.1| PREDICTED: Homo sapiens similar to 40S ribosomal protein S3a (V-fos
           transformation effector protein), transcript variant 3
           (LOC402677), mRNA
          Length = 708

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 197 aagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
           ||||| |||||| ||||||| || || ||||| ||||||||||| |||||
Sbjct: 154 aagacgctcgtcaccaggacccaaggaaccaaaattgcatctgatggtct 203



to top

>dbj|AB169748.1| Macaca fascicularis brain cDNA, clone: QnpA-15704, similar to human
           ribosomal protein S3A (RPS3A), mRNA, RefSeq: NM_001006.2
          Length = 915

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 197 aagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
           ||||| |||||| ||||||| || || ||||| ||||||||||| |||||
Sbjct: 193 aagacgctcgtcaccaggacccaaggaaccaaaattgcatctgatggtct 242



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          |||||||||| |||||||||||||||
Sbjct: 56 ccatggcggttggcaagaacaagcgc 81



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 410 aagtggcagacactaattgaggcccatgttgatgttaagac 450
           |||||||||||| | ||||| || ||||||||||| |||||
Sbjct: 403 aagtggcagacaatgattgaagctcatgttgatgtcaagac 443



to top

>gb|AC090621.10| Homo sapiens chromosome 18, clone RP11-396N11, complete sequence
          Length = 188858

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                                
Query: 197    aagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
              ||||| ||| || ||||||| ||||| ||||| ||||||||||| |||||
Sbjct: 183685 aagacgctcatcaccaggacccagggaaccaaaattgcatctgatggtct 183636



to top

>gb|AC020925.8| Homo sapiens chromosome 5 clone CTD-2134K2, complete sequence
          Length = 161452

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                                
Query: 197    aagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
              ||||| |||||| ||||||| || || ||||| ||||||||||| |||||
Sbjct: 116658 aagacgctcgtcaccaggacccaaggaaccaaaattgcatctgatggtct 116609



to top

>gb|AY550961.1| Sparus aurata V-Fos transformation effector-like protein mRNA,
           partial cds
          Length = 758

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 73/90 (81%)
 Strand = Plus / Plus

                                                                       
Query: 138 ccaagaaggactggtatgacataaaggcgccgacgttgttcaacacccgcaacatcggca 197
           |||||||||||||||||||  | ||||| ||  |  ||||||||| ||||||  | ||||
Sbjct: 92  ccaagaaggactggtatgatgtcaaggcaccagccatgttcaacatccgcaatcttggca 151

                                         
Query: 198 agaccctcgtctccaggacacaggggacca 227
           ||||| | ||| ||||||| ||||| ||||
Sbjct: 152 agaccttggtcaccaggacccagggaacca 181



to top

>gb|AC010468.5|AC010468 Homo sapiens chromosome 5 clone CTD-2290C20, complete sequence
          Length = 122102

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                               
Query: 197   aagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
             ||||| |||||| ||||||| || || ||||| ||||||||||| |||||
Sbjct: 75195 aagacgctcgtcaccaggacccaaggaaccaaaattgcatctgatggtct 75244



to top

>ref|NM_017153.1| Rattus norvegicus ribosomal protein S3a (Rps3a), mRNA
          Length = 880

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          ||||||||||||| ||||||||||||
Sbjct: 23 ccatggcggtcgggaagaacaagcgc 48



to top

>gb|AY911372.1| Bos taurus clone IMAGE:7961511 ribosomal protein S3a mRNA,
          complete cds
          Length = 865

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          ||||||||||||||||||| ||||||
Sbjct: 25 ccatggcggtcggcaagaataagcgc 50



to top

>gb|BC001708.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone MGC:1626
           IMAGE:3544072), complete cds
          Length = 906

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 197 aagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
           ||||| |||||| ||||||| || || ||||| ||||||||||| |||||
Sbjct: 178 aagacgctcgtcaccaggacccaaggaaccaaaattgcatctgatggtct 227



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          |||||||||| |||||||||||||||
Sbjct: 41 ccatggcggttggcaagaacaagcgc 66



to top

>gb|BC071916.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone MGC:88598
           IMAGE:6285242), complete cds
          Length = 868

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 197 aagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
           ||||| |||||| ||||||| || || ||||| ||||||||||| |||||
Sbjct: 148 aagacgctcgtcaccaggacccaaggaaccaaaattgcatctgatggtct 197



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          |||||||||| |||||||||||||||
Sbjct: 11 ccatggcggttggcaagaacaagcgc 36



to top

>gb|BC017123.2| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone MGC:18002
           IMAGE:3922810), complete cds
          Length = 869

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 197 aagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
           ||||| |||||| ||||||| || || ||||| ||||||||||| |||||
Sbjct: 148 aagacgctcgtcaccaggacccaaggaaccaaaattgcatctgatggtct 197



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          |||||||||| |||||||||||||||
Sbjct: 11 ccatggcggttggcaagaacaagcgc 36



to top

>gb|BC030161.2| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone MGC:29710
           IMAGE:5020904), complete cds
          Length = 921

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 197 aagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
           ||||| |||||| ||||||| || || ||||| ||||||||||| |||||
Sbjct: 199 aagacgctcgtcaccaggacccaaggaaccaaaattgcatctgatggtct 248



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          |||||||||| |||||||||||||||
Sbjct: 62 ccatggcggttggcaagaacaagcgc 87



to top

>gb|BC019072.2| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone MGC:29668
           IMAGE:5020581), complete cds
          Length = 925

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 197 aagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
           ||||| |||||| ||||||| || || ||||| ||||||||||| |||||
Sbjct: 199 aagacgctcgtcaccaggacccaaggaaccaaaattgcatctgatggtct 248



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          |||||||||| |||||||||||||||
Sbjct: 62 ccatggcggttggcaagaacaagcgc 87



to top

>gb|BC000204.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone MGC:3109
           IMAGE:3350750), complete cds
          Length = 866

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 197 aagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
           ||||| |||||| ||||||| || || ||||| ||||||||||| |||||
Sbjct: 148 aagacgctcgtcaccaggacccaaggaaccaaaattgcatctgatggtct 197



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          |||||||||| |||||||||||||||
Sbjct: 11 ccatggcggttggcaagaacaagcgc 36



to top

>gb|BC009219.2| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone MGC:16359
           IMAGE:3927639), complete cds
          Length = 869

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 197 aagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
           ||||| |||||| ||||||| || || ||||| ||||||||||| |||||
Sbjct: 148 aagacgctcgtcaccaggacccaaggaaccaaaattgcatctgatggtct 197



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          |||||||||| |||||||||||||||
Sbjct: 11 ccatggcggttggcaagaacaagcgc 36



to top

>gb|BC009404.2| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone MGC:15425
           IMAGE:4308955), complete cds
          Length = 873

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 197 aagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
           ||||| |||||| ||||||| || || ||||| ||||||||||| |||||
Sbjct: 150 aagacgctcgtcaccaggacccaaggaaccaaaattgcatctgatggtct 199



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          |||||||||| |||||||||||||||
Sbjct: 13 ccatggcggttggcaagaacaagcgc 38



to top

>dbj|AK129825.1| Homo sapiens cDNA FLJ26315 fis, clone DMC09112, highly similar to
           40S ribosomal protein S3A
          Length = 861

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 197 aagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
           ||||| |||||| ||||||| || || ||||| ||||||||||| |||||
Sbjct: 159 aagacgctcgtcaccaggacccaaggaaccaaaattgcatctgatggtct 208



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          |||||||||| |||||||||||||||
Sbjct: 22 ccatggcggttggcaagaacaagcgc 47



to top

>gb|AC004841.2|AC004841 Homo sapiens PAC clone RP4-607J23 from 7q21.2-q31.1, complete sequence
          Length = 132072

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 63    ccatggcggtcggcaagaacaagcgc 88
             |||||||||| |||||||||||||||
Sbjct: 85735 ccatggcggttggcaagaacaagcgc 85710



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                               
Query: 197   aagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
             ||||| |||||| ||||||| || || ||||| ||||||||||| |||||
Sbjct: 85598 aagacgctcgtcaccaggacccaaggaaccaaaattgcatctgatggtct 85549



to top

>ref|NM_001006.3| Homo sapiens ribosomal protein S3A (RPS3A), mRNA
          Length = 930

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 197 aagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
           ||||| |||||| ||||||| || || ||||| ||||||||||| |||||
Sbjct: 187 aagacgctcgtcaccaggacccaaggaaccaaaattgcatctgatggtct 236



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          |||||||||| |||||||||||||||
Sbjct: 50 ccatggcggttggcaagaacaagcgc 75



to top

>emb|X75161.1|RNRNAS3A R.norvegicus (Sprague-Dawley) mRNA for ribosomal protein S3a
          Length = 880

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          ||||||||||||| ||||||||||||
Sbjct: 23 ccatggcggtcgggaagaacaagcgc 48



to top

>emb|Z83334.1|HSZ83334 H.sapiens RPS3a gene
          Length = 5107

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 63  ccatggcggtcggcaagaacaagcgc 88
           |||||||||| |||||||||||||||
Sbjct: 119 ccatggcggttggcaagaacaagcgc 144



to top

>dbj|AB099017.1| Bos taurus mRNA for similar to ribosomal protein S3a, partial
          cds, clone: ORCS12387
          Length = 644

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          ||||||||||||||||||| ||||||
Sbjct: 5  ccatggcggtcggcaagaataagcgc 30



to top

>gb|AC129329.3| Mus musculus BAC clone RP23-43M12 from 10, complete sequence
          Length = 176092

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 63    ccatggcggtcggcaagaacaagcgc 88
             |||||||||| |||||||||||||||
Sbjct: 48108 ccatggcggttggcaagaacaagcgc 48133



to top

>gb|BC070211.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone MGC:88192
           IMAGE:5809691), complete cds
          Length = 892

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 197 aagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
           ||||| |||||| ||||||| || || ||||| ||||||||||| |||||
Sbjct: 161 aagacgctcgtcaccaggacccaaggaaccaaaattgcatctgatggtct 210



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          |||||||||| |||||||||||||||
Sbjct: 24 ccatggcggttggcaagaacaagcgc 49



to top

>gb|BC018954.2| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone IMAGE:4136755)
          Length = 890

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 197 aagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
           ||||| |||||| ||||||| || || ||||| ||||||||||| |||||
Sbjct: 150 aagacgctcgtcaccaggacccaaggaaccaaaattgcatctgatggtct 199



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          |||||||||| |||||||||||||||
Sbjct: 13 ccatggcggttggcaagaacaagcgc 38



to top

>gb|BC006298.2| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone MGC:13266
           IMAGE:4079651), complete cds
          Length = 871

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 197 aagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
           ||||| |||||| ||||||| || || ||||| ||||||||||| |||||
Sbjct: 141 aagacgctcgtcaccaggacccaaggaaccaaaattgcatctgatggtct 190



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          |||||||||| |||||||||||||||
Sbjct: 4  ccatggcggttggcaagaacaagcgc 29



to top

>emb|AL845262.3| Mouse DNA sequence from clone RP23-14N22 on chromosome 2, complete
             sequence
          Length = 207718

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 63    ccatggcggtcggcaagaacaagcgc 88
             |||||||||| |||||||||||||||
Sbjct: 62195 ccatggcggttggcaagaacaagcgc 62220



to top

>gb|M77234.1|HUMRPSA3A Human ribosomal protein S3a mRNA, complete cds
          Length = 857

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 197 aagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
           ||||| |||||| ||||||| || || ||||| ||||||||||| |||||
Sbjct: 153 aagacgctcgtcaccaggacccaaggaaccaaaattgcatctgatggtct 202



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 64 catggcggtcggcaagaacaagcgc 88
          ||||||||| |||||||||||||||
Sbjct: 17 catggcggttggcaagaacaagcgc 41



to top

>gb|M84711.1|HUMFTE1A Human v-fos transformation effector protein (Fte-1), mRNA complete
           cds
          Length = 874

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 197 aagaccctcgtctccaggacacaggggaccaagattgcatctgagggtct 246
           ||||| |||||| ||||||| || || ||||| ||||||||||| |||||
Sbjct: 172 aagacgctcgtcaccaggacccaaggaaccaaaattgcatctgatggtct 221



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                    
Query: 63 ccatggcggtcggcaagaacaagcgc 88
          |||||||||| |||||||||||||||
Sbjct: 35 ccatggcggttggcaagaacaagcgc 60


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,288,377
Number of Sequences: 3902068
Number of extensions: 4288377
Number of successful extensions: 78745
Number of sequences better than 10.0: 309
Number of HSP's better than 10.0 without gapping: 304
Number of HSP's successfully gapped in prelim test: 5
Number of HSP's that attempted gapping in prelim test: 77869
Number of HSP's gapped (non-prelim): 830
length of query: 578
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 555
effective length of database: 17,143,297,704
effective search space: 9514530225720
effective search space used: 9514530225720
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top