Clone Name	bah62j05
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	dbj|AK068562.1| Oryza sativa (japonica cultivar-group) cDNA clon...	543	e-151
2	gb|AC157500.1| Oryza sativa (japonica cultivar-group) BAC clone ...	155	2e-34
3	ref|NM_102387.1| Arabidopsis thaliana ATP binding / protein bind...	58	3e-05
4	dbj|AK221637.1| Arabidopsis thaliana mRNA for chaperonin precurs...	58	3e-05
5	gb|AC079829.6|AC079829 Arabidopsis thaliana chromosome 1 BAC F28...	54	5e-04
6	dbj|AK108892.1| Oryza sativa (japonica cultivar-group) cDNA clon...	44	0.52
7	gb|DQ151549.1| Agrobacterium tumefaciens arsenite oxidase regula...	44	0.52
8	gb|AY738210.1| Mycobacterium interjectum strain KKA 176Seq 65 kD...	42	2.1
9	gb|AY337276.1| Mycobacterium parascrofulaceum strain U02532 65 k...	42	2.1
10	gb|AY550234.1| Mycobacterium kansasii strain variant MS266 65 kD...	42	2.1
11	gb|AY438088.1| Mycobacterium kansasii 65 kDa heat shock protein ...	42	2.1
12	gb|AY438087.1| Mycobacterium kansasii 65 kDa heat shock protein ...	42	2.1
13	gb|AY438086.1| Mycobacterium kansasii 65 kDa heat shock protein ...	42	2.1
14	gb|AY438085.1| Mycobacterium kansasii 65 kDa heat shock protein ...	42	2.1
15	emb|CR735141.14| Zebrafish DNA sequence from clone CH211-128E9 i...	42	2.1
16	gb|AC005165.1| Homo sapiens BAC clone CTA-242H14 from 7, complet...	42	2.1
17	dbj|AB232365.1| Mycobacterium kansasii hsp65 gene for 65 kDa hea...	42	2.1
18	dbj|AB232364.1| Mycobacterium kansasii hsp65 gene for 65 kDa hea...	42	2.1
19	dbj|AB232363.1| Mycobacterium kansasii hsp65 gene for 65 kDa hea...	42	2.1
20	gb|AF434739.1|AF434739 Mycobacterium kansasii strain ATCC 12478 ...	42	2.1
21	emb|BX823782.1|CNS0A5D5 Arabidopsis thaliana Full-length cDNA Co...	42	2.1
22	gb|AF547849.1| Mycobacterium kansasii strain CIP 104589 65 kDa h...	42	2.1
23	gb|AF547846.1| Mycobacterium interjectum strain DSM 44064 65 kDa...	42	2.1
24	gb|AF547836.1| Mycobacterium gastri strain CIP 104530 65 kDa hea...	42	2.1
25	gb|AY103778.1| Zea mays PCO063180 mRNA sequence	42	2.1
26	ref|NM_202718.1| Arabidopsis thaliana alpha-galactosidase/ hydro...	40	8.2
27	ref|NM_115489.4| Arabidopsis thaliana alpha-galactosidase/ hydro...	40	8.2
28	gb|AY669726.1| HIV-1 isolate JRCSFclone from USA envelope glycop...	40	8.2
29	gb|AY669709.1| HIV-1 isolate PAVO from Italy envelope glycoprote...	40	8.2
30	gb|AY669708.1| HIV-1 isolate 6101 from USA envelope glycoprotein...	40	8.2
31	gb|DQ127541.1| HIV-1 isolate AC-38_64_Days_3'_Seq2.fa envelope g...	40	8.2
32	gb|DQ127540.1| HIV-1 isolate AC-38_64_Days_3'_Seq1.fa rev protei...	40	8.2
33	gb|AY535518.1| HIV-1 isolate 153 clone 15 from France envelope g...	40	8.2
34	gb|AY535516.1| HIV-1 isolate 153 clone 13 from France envelope g...	40	8.2
35	gb|AY535509.1| HIV-1 isolate 153 clone 6 from France envelope gl...	40	8.2
36	gb|AY535506.1| HIV-1 isolate 153 clone 3 from France envelope gl...	40	8.2
37	gb|AY535505.1| HIV-1 isolate 153 clone 2 from France envelope gl...	40	8.2
38	gb|AY779564.1| HIV-1 isolate CANA1FULL from Canada, complete genome	40	8.2
39	gb|AY779554.1| HIV-1 isolate CANB4FULL from Canada, complete genome	40	8.2
40	gb|AY779553.1| HIV-1 isolate CANB3FULL from Canada, complete genome	40	8.2
41	gb|AY779552.1| HIV-1 isolate CANA6FULL from Canada, complete genome	40	8.2
42	gb|AY779551.1| HIV-1 isolate CANA5FULL from Canada, complete genome	40	8.2
43	gb|AY779550.1| HIV-1 isolate CANA3FULL from Canada, complete genome	40	8.2
44	gb|AY522734.1| HIV-1 isolate 99ZALT45 from South Africa envelope...	40	8.2
45	gb|AY522731.1| HIV-1 isolate 99ZALT39 from South Africa envelope...	40	8.2
46	gb|AY522723.1| HIV-1 isolate 99ZALT15 from South Africa envelope...	40	8.2
47	gb|AY426127.1| HIV-1 clone JRCSF-2 isolate JRCSF from USA envelo...	40	8.2
48	gb|AY426126.1| HIV-1 clone JRCSF-1 isolate JRCSF from USA envelo...	40	8.2
49	gb|AY426125.1| HIV-1 isolate JRCSF from USA envelope glycoprotei...	40	8.2
50	gb|DQ410649.1| HIV-1 isolate 154v38Penv_fe5.2 from USA envelope ...	40	8.2
51	gb|DQ410648.1| HIV-1 isolate 154v38Penv_fe5.1 from USA envelope ...	40	8.2
52	gb|DQ410646.1| HIV-1 isolate 154v38Penv_fe4.1 from USA nonfuncti...	40	8.2
53	gb|DQ410645.1| HIV-1 isolate 154v38Penv_fe3.1 from USA envelope ...	40	8.2
54	gb|DQ410644.1| HIV-1 isolate 154v38Penv_fe1.1 from USA envelope ...	40	8.2
55	gb|DQ410642.1| HIV-1 isolate 154v38Renv_re20 from USA nonfunctio...	40	8.2
56	gb|DQ410633.1| HIV-1 isolate 154v38Renv_re28 from USA envelope g...	40	8.2
57	gb|DQ410628.1| HIV-1 isolate 154v38Renv_re24 from USA envelope g...	40	8.2
58	gb|DQ410275.1| HIV-1 isolate H22v2ed21 from USA envelope glycopr...	40	8.2
59	gb|DQ410267.1| HIV-1 isolate H22v2ed9 from USA envelope glycopro...	40	8.2
60	gb|DQ410250.1| HIV-1 isolate H22v1ed10.2 from USA envelope glyco...	40	8.2
61	gb|DQ410247.1| HIV-1 isolate H22v1ed2.1 from USA envelope glycop...	40	8.2
62	gb|AY358072.1| HIV-1 02TH.OUR846I from Thailand gag protein (gag...	40	8.2
63	gb|AY358071.1| HIV-1 01TH.OUR033I from Thailand gag protein (gag...	40	8.2
64	gb|AY612855.1| HIV-1 isolate 6101 from USA envelope glycoprotein...	40	8.2
65	gb|CP000358.1| Deinococcus geothermalis DSM 11300 plasmid 1, com...	40	8.2
66	gb|DQ396385.1| HIV-1 isolate 03ZAPS051MB1 from South Africa, com...	40	8.2
67	gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3	40	8.2
68	ref|NM_001032734.1| Takifugu rubripes alpha-6-fucosyltransferase...	40	8.2
69	gb|AY945709.1| HIV-1 isolate HS123 from Tanzania, complete genome	40	8.2
70	gb|AY887515.1| HIV-1 clone 67 from Tanzania envelope glycoprotei...	40	8.2
71	gb|AY887514.1| HIV-1 clone 20 from Tanzania envelope glycoprotei...	40	8.2
72	gb|AY887513.1| HIV-1 clone 26 from Tanzania envelope glycoprotei...	40	8.2
73	gb|AY887512.1| HIV-1 clone 39 from Tanzania env gene, complete s...	40	8.2
74	gb|AY887511.1| HIV-1 clone 41 from Tanzania env gene, complete s...	40	8.2
75	gb|AY887510.1| HIV-1 clone 73 from Tanzania env gene, complete s...	40	8.2
76	gb|AY887509.1| HIV-1 clone 76 from Tanzania envelope glycoprotei...	40	8.2
77	gb|AY887508.1| HIV-1 clone 68 from Tanzania envelope glycoprotei...	40	8.2
78	gb|AY887507.1| HIV-1 clone 64 from Tanzania envelope glycoprotei...	40	8.2
79	gb|AY887506.1| HIV-1 clone 77 from Tanzania envelope glycoprotei...	40	8.2
80	gb|AY887505.1| HIV-1 clone 57 from Tanzania envelope glycoprotei...	40	8.2
81	gb|AY887504.1| HIV-1 clone 81 from Tanzania env gene, complete s...	40	8.2
82	gb|AY887503.1| HIV-1 clone 74 from Tanzania envelope glycoprotei...	40	8.2
83	gb|AY887502.1| HIV-1 clone 71 from Tanzania envelope glycoprotei...	40	8.2
84	gb|AY887501.1| HIV-1 clone 70 from Tanzania envelope glycoprotei...	40	8.2
85	gb|AY887499.1| HIV-1 isolate 01TZ_HS123.3e18r from Tanzania enve...	40	8.2
86	gb|AY887498.1| HIV-1 isolate 01TZ_HS123.3e6r from Tanzania envel...	40	8.2
87	gb|AY887497.1| HIV-1 isolate 01TZ_HS123.3e5r from Tanzania envel...	40	8.2
88	gb|AY887496.1| HIV-1 isolate 01TZ_HS123.3e4r from Tanzania envel...	40	8.2
89	gb|AY887495.1| HIV-1 isolate 01TZ_HS123.3e12r from Tanzania enve...	40	8.2
90	gb|AY887493.1| HIV-1 isolate 01TZ_HS123.3e7r from Tanzania envel...	40	8.2
91	gb|AY887492.1| HIV-1 isolate 01TZ_HS123.3e22r from Tanzania enve...	40	8.2
92	gb|AY887491.1| HIV-1 isolate 01TZ_HS123.3e9r from Tanzania envel...	40	8.2
93	gb|AY887490.1| HIV-1 isolate 01TZ_HS123.3e8r from Tanzania envel...	40	8.2
94	gb|AY887489.1| HIV-1 isolate 01TZ_HS123.3e21r from Tanzania enve...	40	8.2
95	gb|AY887488.1| HIV-1 isolate 01TZ_HS123.3e13r from Tanzania enve...	40	8.2
96	gb|AY887486.1| HIV-1 isolate 01TZ_HS123.3e14r from Tanzania enve...	40	8.2
97	gb|AY887485.1| HIV-1 isolate 01TZ_HS123.3e20r from Tanzania enve...	40	8.2
98	gb|AY887484.1| HIV-1 isolate 01TZ_HS123.3e17r from Tanzania enve...	40	8.2
99	gb|AY887483.1| HIV-1 isolate 03TZ_HS123.10e22 from Tanzania enve...	40	8.2
100	gb|AY887482.1| HIV-1 isolate 03TZ_HS123.10e24 from Tanzania enve...	40	8.2
101	gb|AY887481.1| HIV-1 isolate 03TZ_HS123.10e3 from Tanzania envel...	40	8.2
102	gb|AY887480.1| HIV-1 isolate 03TZ_HS123.10e2 from Tanzania envel...	40	8.2
103	gb|AY887479.1| HIV-1 isolate 03TZ_HS123.10e12 from Tanzania enve...	40	8.2
104	gb|AY887478.1| HIV-1 isolate 02TZ_HS123.7e36 from Tanzania envel...	40	8.2
105	gb|AY887477.1| HIV-1 isolate 02TZ_HS123.7e35 from Tanzania envel...	40	8.2
106	gb|AY887476.1| HIV-1 isolate 02TZ_HS123.7e33 from Tanzania envel...	40	8.2
107	gb|AY887475.1| HIV-1 isolate 02TZ_HS123.7e32 from Tanzania envel...	40	8.2
108	gb|AY887472.1| HIV-1 isolate 02TZ_HS123.7e28 from Tanzania envel...	40	8.2
109	gb|AY887471.1| HIV-1 isolate 02TZ_HS123.7e23 from Tanzania envel...	40	8.2
110	gb|AY887470.1| HIV-1 isolate 02TZ_HS123.7e2 from Tanzania envelo...	40	8.2
111	gb|AY887468.1| HIV-1 isolate 02TZ_HS123.7e10 from Tanzania envel...	40	8.2
112	gb|AY887467.1| HIV-1 isolate 02TZ_HS123.7e3 from Tanzania envelo...	40	8.2
113	gb|AY887466.1| HIV-1 isolate 02TZ_HS123.7e1 from Tanzania envelo...	40	8.2
114	gb|AY887465.1| HIV-1 isolate 02TZ_HS123.7e5 from Tanzania envelo...	40	8.2
115	gb|AY887464.1| HIV-1 isolate 02TZ_HS123.7e21 from Tanzania envel...	40	8.2
116	gb|AY887463.1| HIV-1 isolate 02TZ_HS123.7e4 from Tanzania envelo...	40	8.2
117	gb|AY887462.1| HIV-1 isolate 02TZ_HS123.7e24 from Tanzania envel...	40	8.2
118	gb|AY887459.1| HIV-1 isolate 01TZ_HS123.4e18 from Tanzania envel...	40	8.2
119	gb|AY887458.1| HIV-1 isolate 01TZ_HS123.4e16 from Tanzania envel...	40	8.2
120	gb|AY887457.1| HIV-1 isolate 01TZ_HS123.3e8s from Tanzania envel...	40	8.2
121	gb|AY887456.1| HIV-1 isolate 01TZ_HS123.3e7s from Tanzania envel...	40	8.2
122	gb|AY887455.1| HIV-1 isolate 01TZ_HS123.3e6s from Tanzania envel...	40	8.2
123	gb|AY887454.1| HIV-1 isolate 01TZ_HS123.3e3s from Tanzania envel...	40	8.2
124	gb|AY887453.1| HIV-1 isolate 01TZ_HS123.3e13s from Tanzania enve...	40	8.2
125	gb|AY887452.1| HIV-1 isolate 01TZ_HS123.3e11s from Tanzania enve...	40	8.2
126	gb|AY887451.1| HIV-1 isolate 01TZ_HS123.3e16s from Tanzania enve...	40	8.2
127	gb|AY887450.1| HIV-1 isolate 01TZ_HS123.3e10s from Tanzania enve...	40	8.2
128	gb|AY887449.1| HIV-1 isolate 01TZ_HS123.3e20s from Tanzania enve...	40	8.2
129	gb|AY887448.1| HIV-1 isolate 01TZ_HS123.3e1s from Tanzania envel...	40	8.2
130	gb|AY887447.1| HIV-1 isolate 01TZ_HS123.3e23s from Tanzania enve...	40	8.2
131	gb|AY887446.1| HIV-1 isolate 01TZ_HS123.3e6 from Tanzania envelo...	40	8.2
132	gb|AY887445.1| HIV-1 isolate 01TZ_HS123.3e59 from Tanzania envel...	40	8.2
133	gb|AY887444.1| HIV-1 isolate 01TZ_HS123.3e11 from Tanzania envel...	40	8.2
134	gb|AY887443.1| HIV-1 isolate 01TZ_HS123.3e9 from Tanzania envelo...	40	8.2
135	gb|AY887442.1| HIV-1 isolate 01TZ_HS123.3e58 from Tanzania envel...	40	8.2
136	gb|AY887441.1| HIV-1 isolate 01TZ_HS123.3e17 from Tanzania envel...	40	8.2
137	gb|AY887440.1| HIV-1 isolate 01TZ_HS123.3e50 from Tanzania envel...	40	8.2
138	gb|AY887439.1| HIV-1 isolate 01TZ_HS123.3e53 from Tanzania envel...	40	8.2
139	gb|AY887438.1| HIV-1 isolate 01TZ_HS123.3e54 from Tanzania envel...	40	8.2
140	gb|AY887437.1| HIV-1 isolate 01TZ_HS123.3e51 from Tanzania envel...	40	8.2
141	gb|AY887436.1| HIV-1 isolate 01TZ_HS123.3e12 from Tanzania nonfu...	40	8.2
142	gb|AY887435.1| HIV-1 isolate 01TZ_HS123.3e23r from Tanzania enve...	40	8.2
143	gb|AY887434.1| HIV-1 isolate 01TZ_HS123.3e4 from Tanzania envelo...	40	8.2
144	gb|AY887379.1| HIV-1 isolate 01TZ_HS123.2e23r from Tanzania enve...	40	8.2
145	gb|AY887378.1| HIV-1 isolate 01TZ_HS123.2e19r from Tanzania enve...	40	8.2
146	gb|AY887377.1| HIV-1 isolate 01TZ_HS123.2e21r from Tanzania nonf...	40	8.2
147	gb|AY887376.1| HIV-1 isolate 01TZ_HS123.2e17r from Tanzania enve...	40	8.2
148	gb|AY887375.1| HIV-1 isolate 01TZ_HS123.2e16r from Tanzania enve...	40	8.2
149	gb|AY887374.1| HIV-1 isolate 01TZ_HS123.2e12r from Tanzania enve...	40	8.2
150	gb|AY887373.1| HIV-1 isolate 01TZ_HS123.2e3r from Tanzania envel...	40	8.2
151	gb|AY887372.1| HIV-1 isolate 01TZ_HS123.2e11r from Tanzania enve...	40	8.2
152	gb|AY887371.1| HIV-1 isolate 01TZ_HS123.2e8r from Tanzania envel...	40	8.2
153	gb|AY887370.1| HIV-1 isolate 01TZ_HS123.2e7r from Tanzania envel...	40	8.2
154	gb|AY887369.1| HIV-1 isolate 01TZ_HS123.2e4r from Tanzania nonfu...	40	8.2
155	gb|AY887368.1| HIV-1 isolate 01TZ_HS123.2e6r from Tanzania nonfu...	40	8.2
156	gb|AY887367.1| HIV-1 isolate 01TZ_HS123.2e5r from Tanzania envel...	40	8.2
157	gb|AY887366.1| HIV-1 isolate 01TZ_HS123.2e2r from Tanzania envel...	40	8.2
158	gb|AY887365.1| HIV-1 isolate 01TZ_HS123.2e15r from Tanzania enve...	40	8.2
159	gb|AY887364.1| HIV-1 isolate 01TZ_HS123.2e13r from Tanzania enve...	40	8.2
160	gb|AY887363.1| HIV-1 isolate 01TZ_HS123.1e24r from Tanzania enve...	40	8.2
161	gb|AY887362.1| HIV-1 isolate 01TZ_HS123.1e23r from Tanzania enve...	40	8.2
162	gb|AY887361.1| HIV-1 isolate 01TZ_HS123.1e21r from Tanzania enve...	40	8.2
163	gb|AY887360.1| HIV-1 isolate 01TZ_HS123.1e18r from Tanzania enve...	40	8.2
164	gb|AY887359.1| HIV-1 isolate 01TZ_HS123.1e20r from Tanzania enve...	40	8.2
165	gb|AY887358.1| HIV-1 isolate 01TZ_HS123.1e5r from Tanzania envel...	40	8.2
166	gb|AY887357.1| HIV-1 isolate 01TZ_HS123.1e4r from Tanzania envel...	40	8.2
167	gb|AY887356.1| HIV-1 isolate 01TZ_HS123.1e8r from Tanzania envel...	40	8.2
168	gb|AY887355.1| HIV-1 isolate 01TZ_HS123.1e7r from Tanzania envel...	40	8.2
169	gb|AY887353.1| HIV-1 isolate 01TZ_HS123.1e3r from Tanzania envel...	40	8.2
170	gb|AY887352.1| HIV-1 isolate 01TZ_HS123.1e22r from Tanzania enve...	40	8.2
171	gb|AY887351.1| HIV-1 isolate 01TZ_HS123.1e17r from Tanzania enve...	40	8.2
172	gb|AY887350.1| HIV-1 isolate 01TZ_HS123.1e11r from Tanzania nonf...	40	8.2
173	gb|AY887349.1| HIV-1 isolate 01TZ_HS123.1e10r from Tanzania enve...	40	8.2
174	gb|AY887348.1| HIV-1 isolate 01TZ_HS123.1e16r from Tanzania enve...	40	8.2
175	gb|AY887347.1| HIV-1 isolate 01TZ_HS123.1e14r from Tanzania enve...	40	8.2
176	gb|AY887346.1| HIV-1 isolate 01TZ_HS123.1e13r from Tanzania enve...	40	8.2
177	gb|AY887345.1| HIV-1 isolate 00TZ_HS123.0e2r from Tanzania envel...	40	8.2
178	gb|AY887344.1| HIV-1 isolate 00TZ_HS123.0e17r from Tanzania enve...	40	8.2
179	gb|AY887343.1| HIV-1 isolate 00TZ_HS123.0e4r from Tanzania envel...	40	8.2
180	gb|AY887342.1| HIV-1 isolate 00TZ_HS123.0e21r from Tanzania enve...	40	8.2
181	gb|AY887341.1| HIV-1 isolate 00TZ_HS123.0e15r from Tanzania enve...	40	8.2
182	gb|AY887340.1| HIV-1 isolate 00TZ_HS123.0e8r from Tanzania envel...	40	8.2
183	gb|AY887339.1| HIV-1 isolate 00TZ_HS123.0e13r from Tanzania enve...	40	8.2
184	gb|AY887338.1| HIV-1 isolate 00TZ_HS123.0e3r from Tanzania envel...	40	8.2
185	gb|AY887337.1| HIV-1 isolate 00TZ_HS123.0e24r from Tanzania enve...	40	8.2
186	gb|AY887336.1| HIV-1 isolate 00TZ_HS123.0e10r from Tanzania enve...	40	8.2
187	gb|AY887335.1| HIV-1 isolate 00TZ_HS123.0e1r from Tanzania nonfu...	40	8.2
188	gb|AY887334.1| HIV-1 isolate 00TZ_HS123.0e16r from Tanzania enve...	40	8.2
189	gb|AY887333.1| HIV-1 isolate 00TZ_HS123.0e14r from Tanzania enve...	40	8.2
190	gb|AY887332.1| HIV-1 isolate 00TZ_HS123.0e22r from Tanzania enve...	40	8.2
191	gb|AY887331.1| HIV-1 isolate 00TZ_HS123.0e18r from Tanzania enve...	40	8.2
192	gb|AY887330.1| HIV-1 isolate 03TZ_HS123.10e4 from Tanzania envel...	40	8.2
193	gb|AY887329.1| HIV-1 isolate 03TZ_HS123.10e1 from Tanzania envel...	40	8.2
194	gb|AY887328.1| HIV-1 isolate 01TZ_HS123.4e9 from Tanzania envelo...	40	8.2
195	gb|AY887327.1| HIV-1 isolate 01TZ_HS123.3e9s from Tanzania envel...	40	8.2
196	gb|AY887326.1| HIV-1 isolate 01TZ_HS123.2e26 from Tanzania envel...	40	8.2
197	gb|AY887325.1| HIV-1 isolate 01TZ_HS123.2e25 from Tanzania envel...	40	8.2
198	gb|AY887324.1| HIV-1 isolate 01TZ_HS123.2e23 from Tanzania envel...	40	8.2
199	gb|AY887323.1| HIV-1 isolate 01TZ_HS123.2e22 from Tanzania envel...	40	8.2
200	gb|AY887322.1| HIV-1 isolate 01TZ_HS123.2e21 from Tanzania envel...	40	8.2
201	gb|AY887321.1| HIV-1 isolate 01TZ_HS123.2e20 from Tanzania envel...	40	8.2
202	gb|AY887320.1| HIV-1 isolate 01TZ_HS123.2e17 from Tanzania envel...	40	8.2
203	gb|AY887319.1| HIV-1 isolate 01TZ_HS123.2e13 from Tanzania envel...	40	8.2
204	gb|AY887318.1| HIV-1 isolate 01TZ_HS123.2e5 from Tanzania envelo...	40	8.2
205	gb|AY887317.1| HIV-1 isolate 01TZ_HS123.2e19 from Tanzania envel...	40	8.2
206	gb|AY887316.1| HIV-1 isolate 01TZ_HS123.2e18 from Tanzania envel...	40	8.2
207	gb|AY887315.1| HIV-1 isolate 01TZ_HS123.2e16 from Tanzania envel...	40	8.2
208	gb|AY887314.1| HIV-1 isolate 01TZ_HS123.2e14 from Tanzania envel...	40	8.2
209	gb|AY887313.1| HIV-1 isolate 01TZ_HS123.2e9 from Tanzania envelo...	40	8.2
210	gb|AY887311.1| HIV-1 isolate 01TZ_HS123.2e3 from Tanzania envelo...	40	8.2
211	gb|AY887310.1| HIV-1 isolate 01TZ_HS123.2e29 from Tanzania envel...	40	8.2
212	gb|AY887309.1| HIV-1 isolate 01TZ_HS123.2e28 from Tanzania envel...	40	8.2
213	gb|AY887308.1| HIV-1 isolate 01TZ_HS123.2e27 from Tanzania nonfu...	40	8.2
214	gb|AY887307.1| HIV-1 isolate 01TZ_HS123.2e12 from Tanzania envel...	40	8.2
215	gb|AY887306.1| HIV-1 isolate 01TZ_HS123.1e67 from Tanzania envel...	40	8.2
216	gb|AY887305.1| HIV-1 isolate 01TZ_HS123.1e60 from Tanzania envel...	40	8.2
217	gb|AY887304.1| HIV-1 isolate 01TZ_HS123.1e59 from Tanzania envel...	40	8.2
218	gb|AY887303.1| HIV-1 isolate 01TZ_HS123.1e58 from Tanzania envel...	40	8.2
219	gb|AY887302.1| HIV-1 isolate 01TZ_HS123.1e57 from Tanzania envel...	40	8.2
220	gb|AY887301.1| HIV-1 isolate 01TZ_HS123.1e56 from Tanzania envel...	40	8.2
221	gb|AY887300.1| HIV-1 isolate 01TZ_HS123.1e55 from Tanzania envel...	40	8.2
222	gb|AY887299.1| HIV-1 isolate 01TZ_HS123.1e54 from Tanzania envel...	40	8.2
223	gb|AY887298.1| HIV-1 isolate 01TZ_HS123.1e52 from Tanzania envel...	40	8.2
224	gb|AY887297.1| HIV-1 isolate 01TZ_HS123.1e50 from Tanzania envel...	40	8.2
225	gb|AY887296.1| HIV-1 isolate 01TZ_HS123.1e49 from Tanzania envel...	40	8.2
226	gb|AY887295.1| HIV-1 isolate 01TZ_HS123.1e48 from Tanzania envel...	40	8.2
227	gb|AY887294.1| HIV-1 isolate 01TZ_HS123.1e44 from Tanzania envel...	40	8.2
228	gb|AY887293.1| HIV-1 isolate 01TZ_HS123.1e36 from Tanzania envel...	40	8.2
229	gb|AY887292.1| HIV-1 isolate 01TZ_HS123.1e28 from Tanzania envel...	40	8.2
230	gb|AY887291.1| HIV-1 isolate 01TZ_HS123.1e22 from Tanzania envel...	40	8.2
231	gb|AY887290.1| HIV-1 isolate 01TZ_HS123.1e31 from Tanzania envel...	40	8.2
232	gb|AY887289.1| HIV-1 isolate 01TZ_HS123.1e12 from Tanzania envel...	40	8.2
233	gb|AY887288.1| HIV-1 isolate 01TZ_HS123.1e9 from Tanzania envelo...	40	8.2
234	gb|AY887287.1| HIV-1 isolate 01TZ_HS123.1e1 from Tanzania envelo...	40	8.2
235	gb|AY334445.1| Candidatus Blochmannia americanus isolate Camer00...	40	8.2
236	ref|XM_751366.1| Ustilago maydis 521 hypothetical protein (UM003...	40	8.2
237	gb|AY124982.1| HIV-1 isolate dBR07 from USA envelope glycoprotei...	40	8.2
238	gb|AY124981.1| HIV-1 isolate dBR02 from USA envelope glycoprotei...	40	8.2
239	gb|AY159674.1| HIV-1 isolate dBR06 from USA nonfunctional envelo...	40	8.2
240	gb|AY159673.1| HIV-1 isolate dBR01 from USA nonfunctional envelo...	40	8.2
241	gb|AY159665.1| HIV-1 isolate bBR07 from USA nonfunctional envelo...	40	8.2
242	emb|BX069364.1|CNS09POO Single read from an extremity of a full-...	40	8.2
243	emb|BX068529.1|CNS09P1H Single read from an extremity of a full-...	40	8.2
244	emb|BX062859.1|CNS09KNZ Single read from an extremity of a full-...	40	8.2
245	emb|BX062858.1|CNS09KNY Single read from an extremity of a full-...	40	8.2
246	emb|BX061695.1|CNS09JRN Single read from an extremity of a full-...	40	8.2
247	emb|BX061694.1|CNS09JRM Single read from an extremity of a full-...	40	8.2
248	emb|BX061162.1|CNS09JCU Single read from an extremity of a full-...	40	8.2
249	emb|BX061161.1|CNS09JCT Single read from an extremity of a full-...	40	8.2
250	emb|BX060895.1|CNS09J5F Single read from an extremity of a full-...	40	8.2
251	emb|BX060894.1|CNS09J5E Single read from an extremity of a full-...	40	8.2
252	emb|BX060807.1|CNS09J2Z Single read from an extremity of a full-...	40	8.2
253	emb|BX060806.1|CNS09J2Y Single read from an extremity of a full-...	40	8.2
254	emb|BX059960.1|CNS09IFG Single read from an extremity of a full-...	40	8.2
255	emb|BX059959.1|CNS09IFF Single read from an extremity of a full-...	40	8.2
256	emb|BX052429.1|CNS09CM9 Single read from an extremity of a full-...	40	8.2
257	emb|BX052428.1|CNS09CM8 Single read from an extremity of a full-...	40	8.2
258	emb|BX051662.1|CNS09C0Y Single read from an extremity of a full-...	40	8.2
259	emb|BX046573.1|CNS0983L Single read from an extremity of a full-...	40	8.2
260	emb|BX042481.1|CNS094XX Single read from an extremity of a full-...	40	8.2
261	emb|BX042480.1|CNS094XW Single read from an extremity of a full-...	40	8.2
262	emb|BX034897.1|CNS08Z39 Single read from an extremity of a full-...	40	8.2
263	emb|BX034896.1|CNS08Z38 Single read from an extremity of a full-...	40	8.2
264	emb|BX032806.1|CNS08XH6 Single read from an extremity of a full-...	40	8.2
265	emb|BX032805.1|CNS08XH5 Single read from an extremity of a full-...	40	8.2
266	emb|BX027863.1|CNS08TNV Single read from an extremity of a full-...	40	8.2
267	emb|BX027862.1|CNS08TNU Single read from an extremity of a full-...	40	8.2
268	emb|BX027169.1|CNS08T4L Single read from an extremity of a full-...	40	8.2
269	emb|BX027168.1|CNS08T4K Single read from an extremity of a full-...	40	8.2
270	emb|BX026115.1|CNS08SBB Single read from an extremity of a full-...	40	8.2
271	emb|BX025284.1|CNS08RO8 Single read from an extremity of a full-...	40	8.2
272	emb|BX025283.1|CNS08RO7 Single read from an extremity of a full-...	40	8.2
273	emb|BX025216.1|CNS08RMC Single read from an extremity of a full-...	40	8.2
274	emb|BX024125.1|CNS08QS1 Single read from an extremity of a full-...	40	8.2
275	emb|BX022135.1|CNS08P8R Single read from an extremity of a full-...	40	8.2
276	emb|BX022134.1|CNS08P8Q Single read from an extremity of a full-...	40	8.2
277	emb|BX020569.1|CNS08O19 Single read from an extremity of a full-...	40	8.2
278	emb|BX020568.1|CNS08O18 Single read from an extremity of a full-...	40	8.2
279	emb|BX019297.1|CNS08N1X Single read from an extremity of a full-...	40	8.2
280	emb|BX019296.1|CNS08N1W Single read from an extremity of a full-...	40	8.2
281	emb|BX015722.1|CNS08KAM Single read from an extremity of a full-...	40	8.2
282	emb|BX015721.1|CNS08KAL Single read from an extremity of a full-...	40	8.2
283	emb|BX016262.1|CNS08KPM Single read from an extremity of a full-...	40	8.2
284	emb|BX015971.1|CNS08KHJ Single read from an extremity of a full-...	40	8.2
285	emb|BX015970.1|CNS08KHI Single read from an extremity of a full-...	40	8.2
286	emb|BX013828.1|CNS08IU0 Single read from an extremity of a full-...	40	8.2
287	emb|BX013827.1|CNS08ITZ Single read from an extremity of a full-...	40	8.2
288	emb|BX012382.1|CNS08HPU Single read from an extremity of a full-...	40	8.2
289	emb|BX012381.1|CNS08HPT Single read from an extremity of a full-...	40	8.2
290	emb|BX011876.1|CNS08HBS Single read from an extremity of a full-...	40	8.2
291	emb|BX011875.1|CNS08HBR Single read from an extremity of a full-...	40	8.2
292	gb|U08450.1|HIV1U08450 HIV-1 isolate 714 clone 1 from Baltimore,...	40	8.2
293	gb|AY114020.1| Arabidopsis thaliana putative alpha-galactosidase...	40	8.2
294	gb|AY074321.1| Arabidopsis thaliana putative alpha-galactosidase...	40	8.2
295	gb|AY835444.1| HIV-1 isolate PVO clone 4 from Italy envelope gly...	40	8.2
296	gb|AY835437.1| HIV-1 isolate 7165 clone 18 from USA envelope gly...	40	8.2
297	gb|AY835434.1| HIV-1 isolate 6101 clone 10 from USA truncated en...	40	8.2
298	emb|AJ535618.1|HIM535618 Human immunodeficiency virus type 1 pro...	40	8.2
299	emb|AJ535617.1|HIM535617 Human immunodeficiency virus type 1 pro...	40	8.2
300	emb|AJ417431.1|HIM417431 Human immunodeficiency virus type 1 pro...	40	8.2
301	emb|AJ417430.1|HIM417430 Human immunodeficiency virus type 1 pro...	40	8.2
302	emb|AJ417429.1|HIM417429 Human immunodeficiency virus type 1 pro...	40	8.2
303	gb|AY247224.1| HIV-1 isolate 81NY3 from USA envelope glycoprotei...	40	8.2
304	emb|AJ286340.1|HIM286340 Human immunodeficiency virus type 1 pro...	40	8.2
305	emb|AJ286339.1|HIM286339 Human immunodeficiency virus type 1 pro...	40	8.2
306	emb|AJ286336.1|HIM286336 Human immunodeficiency virus type 1 pro...	40	8.2
307	emb|AJ286335.1|HIM286335 Human immunodeficiency virus type 1 pro...	40	8.2
308	emb|AJ276221.1|HIM276221 Human immunodeficiency virus type 1 pro...	40	8.2
309	emb|AL627170.5| Zebrafish DNA sequence from clone XX-KT73 Contai...	40	8.2
310	emb|AL627163.3| Zebrafish DNA sequence from clone XX-KT90 Contai...	40	8.2
311	gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome	40	8.2
312	gb|DQ339419.1| HIV-1 isolate 03KGS1-2158s from South Korea nonfu...	40	8.2
313	emb|BX537356.4| Zebrafish DNA sequence from clone DKEY-46P12 in ...	40	8.2
314	emb|AJ781409.1| Tetraodon nigroviridis mRNA for alpha-6-fucosylt...	40	8.2
315	emb|AJ781408.1| Takifugu rubripes mRNA for alpha-6-fucosyltransf...	40	8.2
316	gb|AC096741.3| Homo sapiens BAC clone RP11-327O17 from 4, comple...	40	8.2
317	gb|DQ388514.1| HIV-1 isolate ZM249M clone PL1 from Zambia trunca...	40	8.2
318	gb|DQ085869.1| HIV-1 isolate BREPM11931 from Brazil, complete ge...	40	8.2
319	gb|DQ275651.1| HIV-1 isolate 03ZAPS088MB1 from South Africa gag ...	40	8.2
320	gb|DQ074959.1| Lactobacillus reuteri lr0140 (lr0140) gene, parti...	40	8.2
321	dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D...	40	8.2
322	emb|BX822543.1|CNS0A7LR Arabidopsis thaliana Full-length cDNA Co...	40	8.2
323	emb|BX822739.1|CNS0A62G Arabidopsis thaliana Full-length cDNA Co...	40	8.2
324	emb|BX822949.1|CNS0A5TS Arabidopsis thaliana Full-length cDNA Co...	40	8.2
325	emb|BX823822.1|CNS0A5CU Arabidopsis thaliana Full-length cDNA Co...	40	8.2
326	emb|BX823606.1|CNS0A5EQ Arabidopsis thaliana Full-length cDNA Co...	40	8.2
327	emb|BX823461.1|CNS0A5D8 Arabidopsis thaliana Full-length cDNA Co...	40	8.2
328	emb|BX823316.1|CNS0A5G0 Arabidopsis thaliana Full-length cDNA Co...	40	8.2
329	emb|BX823260.1|CNS0A5BJ Arabidopsis thaliana Full-length cDNA Co...	40	8.2
330	emb|BX823219.1|CNS0A5DO Arabidopsis thaliana Full-length cDNA Co...	40	8.2
331	emb|BX826044.1|CNS0A543 Arabidopsis thaliana Full-length cDNA Co...	40	8.2
332	emb|BX825512.1|CNS0A4ZE Arabidopsis thaliana Full-length cDNA Co...	40	8.2
333	emb|BX824990.1|CNS0A4O5 Arabidopsis thaliana Full-length cDNA Co...	40	8.2
334	emb|BX824901.1|CNS0A4O4 Arabidopsis thaliana Full-length cDNA Co...	40	8.2
335	gb|AY970948.1| HIV-1 strain H434 clone 42-A1 from Netherlands, c...	40	8.2
336	gb|AY970947.1| HIV-1 strain H434 clone 8-F4 from Netherlands, co...	40	8.2
337	gb|AY970946.1| HIV-1 strain H434 clone 8-A3 from Netherlands, co...	40	8.2
338	gb|AC104321.7| Oryza sativa chromosome 3 BAC OSJNBa0052F07 genom...	40	8.2
339	gb|AY900581.1| HIV-1 isolate CB219 from Cuba gag protein (gag) g...	40	8.2
340	gb|AY857185.2| HIV-1 isolate 9890487 from Australia, partial genome	40	8.2
341	gb|AY857176.2| HIV-1 isolate 9430718 from Australia, partial genome	40	8.2
342	gb|AY857151.2| HIV-1 isolate 8760552 from Australia, partial genome	40	8.2
343	gb|AY857147.2| HIV-1 isolate 8726292 from Australia, partial genome	40	8.2
344	gb|AY857103.1| HIV-1 isolate 6760258 from Australia, partial genome	40	8.2
345	gb|AY857064.2| HIV-1 isolate 5087253 from Australia, partial genome	40	8.2
346	gb|AF547843.2| Mycobacterium heckeshornense strain DSM 44428 65 ...	40	8.2
347	gb|AF547812.1| Mycobacterium botniense strain DSM 44537 65 kDa h...	40	8.2
348	gb|M31451.1|HIVJFL Human immunodeficiency virus type 1 proviral ...	40	8.2
349	gb|AY751063.1| HIV-1 isolate D1-00087285 from Spain envelope gly...	40	8.2
350	gb|AY751057.1| HIV-1 isolate C5-00138455 from Spain envelope gly...	40	8.2
351	gb|AY751056.1| HIV-1 isolate C4-00083692 from Spain envelope gly...	40	8.2
352	gb|AY750998.1| HIV-1 isolate A1-00126672 from Spain envelope gly...	40	8.2
353	ref|XM_321710.2| Anopheles gambiae str. PEST ENSANGP00000015800 ...	40	8.2
354	gb|AY880805.1| HIV-1 isolate if8 from USA envelope glycoprotein ...	40	8.2
355	gb|AY880804.1| HIV-1 isolate if7 from USA envelope glycoprotein ...	40	8.2
356	gb|AY880803.1| HIV-1 isolate if6 from USA envelope glycoprotein ...	40	8.2
357	gb|AY880802.1| HIV-1 isolate if5 from USA envelope glycoprotein ...	40	8.2
358	gb|AY880801.1| HIV-1 isolate if4 from USA envelope glycoprotein ...	40	8.2
359	gb|AY880800.1| HIV-1 isolate if3 from USA envelope glycoprotein ...	40	8.2
360	gb|AY880799.1| HIV-1 isolate if2 from USA envelope glycoprotein ...	40	8.2
361	gb|AY880798.1| HIV-1 isolate if1 from USA nonfunctional envelope...	40	8.2
362	gb|AY880797.1| HIV-1 isolate mf17 from USA envelope glycoprotein...	40	8.2
363	gb|AY880796.1| HIV-1 isolate mf16 from USA envelope glycoprotein...	40	8.2
364	gb|AY880790.1| HIV-1 isolate mf10 from USA envelope glycoprotein...	40	8.2
365	gb|AY880789.1| HIV-1 isolate mf9 from USA envelope glycoprotein ...	40	8.2
366	gb|AY880788.1| HIV-1 isolate mf8 from USA envelope glycoprotein ...	40	8.2
367	gb|AY880787.1| HIV-1 isolate mf7 from USA envelope glycoprotein ...	40	8.2
368	gb|AY835776.1| HIV-1 isolate 5127-93 clone pbf30 from USA, compl...	40	8.2
369	gb|AY835774.1| HIV-1 isolate 5127-86 clone pbf29 from USA, compl...	40	8.2
370	gb|U84840.1|HIVU84840 HIV-1 strain PC13 from USA, envelope glyco...	40	8.2
371	gb|U36878.1|HIV1U36878 Human immunodeficiency virus type 1 envel...	40	8.2
372	gb|U36877.1|HIV1U36877 Human immunodeficiency virus type 1 envel...	40	8.2
373	gb|U36874.1|HIV1U36874 Human immunodeficiency virus type 1 envel...	40	8.2
374	gb|U36873.1|HIV1U36873 Human immunodeficiency virus type 1 envel...	40	8.2
375	gb|U36872.1|HIV1U36872 Human immunodeficiency virus type 1 envel...	40	8.2
376	gb|U36870.1|HIV1U36870 Human immunodeficiency virus type 1 envel...	40	8.2
377	gb|AF025755.1|AF025755 HIV-1 isolate SFMHS7.1 from San Francisco...	40	8.2
378	gb|AF030658.1| HIV-1 clone 14 Zairean 1959 sample, envelope glyc...	40	8.2
379	gb|AF030657.1| HIV-1 clone 13 Zairean 1959 sample, envelope glyc...	40	8.2
380	gb|AF030656.1| HIV-1 clone 9 Zairean 1959 sample, envelope glyco...	40	8.2
381	gb|AF030655.1| HIV-1 clone 7 Zairean 1959 sample, envelope glyco...	40	8.2
382	gb|AF030654.1| HIV-1 clone 6 Zairean 1959 sample, envelope glyco...	40	8.2
383	gb|AF030653.1| HIV-1 clone 5 Zairean 1959 sample, envelope glyco...	40	8.2
384	gb|AF030652.1| HIV-1 clone 3 Zairean 1959 sample, envelope glyco...	40	8.2
385	gb|U45960.1|HIVU45960 Human immunodeficiency virus type 1 isolat...	40	8.2
386	gb|M38429.1|HIVJRCSF Human immunodeficiency virus type 1, isolat...	40	8.2
387	gb|U43108.1|HIVU43108 Human immunodeficiency virus type 1 HIVE90...	40	8.2

---

>dbj|AK068562.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013152E19, full
           insert sequence
          Length = 2339

 Score =  543 bits (274), Expect = e-151
 Identities = 460/522 (88%)
 Strand = Plus / Plus

                                                                       
Query: 80  aagaagacgccgccgatacccgtctacaaggacctgcacttcaacaaggacctctccgcc 139
           |||||| ||||||| || || || |||||||||||||||||||||   ||||||||||||
Sbjct: 156 aagaagccgccgcccatgccggtgtacaaggacctgcacttcaaccgcgacctctccgcc 215

                                                                       
Query: 140 accaagaagttgcaggctggtgtggacttggtggcgcggctggtgggggtgaccctcggt 199
           ||||||||| ||||||| || |||||| ||||||| |||||||| |||||||| || || 
Sbjct: 216 accaagaagctgcaggccggcgtggacctggtggcacggctggtcggggtgacgctgggg 275

                                                                       
Query: 200 cccaaggggaggaatgtggtgctcgccaacaagtatggccctcccaagatcgtcaacgat 259
           |||||||||||||| ||||||||   ||||||||| ||||||||||||||||||||||||
Sbjct: 276 cccaaggggaggaacgtggtgctgagcaacaagtacggccctcccaagatcgtcaacgat 335

                                                                       
Query: 260 ggggagacggtcctcaaggagatcgaattggaggacccgctggaaaatcttggagttaaa 319
           ||||||||||||||||||||||| ||||||||||||||| |||||||||||||||| || 
Sbjct: 336 ggggagacggtcctcaaggagattgaattggaggacccgttggaaaatcttggagtgaag 395

                                                                       
Query: 320 ttagtcagacaggccggcgccaggacgaacgatattgccggtgatgggtgtactacttct 379
            | ||||||||||| || ||||||||||||||| |||| |||||||| ||||| ||||| 
Sbjct: 396 ctggtcagacaggctggtgccaggacgaacgatgttgctggtgatggttgtaccacttcc 455

                                                                       
Query: 380 ataatccttgctcagggcctgattgctgaaggaatgaaggttcttgctgctggaatgaat 439
           |||||||||||||| ||||| || ||||||||||||||||| ||||| |||||||| |||
Sbjct: 456 ataatccttgctcaaggcctcatcgctgaaggaatgaaggtgcttgcagctggaattaat 515

                                                                       
Query: 440 ccggttcaaattgcgcgtggcattgggaggactgctgatgctttggtttctgaactcaag 499
           || || || |||||||| ||||||| || |||||||  ||||||||| ||||||||||  
Sbjct: 516 cctgtccagattgcgcggggcattgagaagactgcttctgctttggtgtctgaactcaga 575

                                                                       
Query: 500 ttgatgtcacgggagattgaagatcatgaaatagcacaagtggctgcagttagtgccgga 559
           |||||||| |||||||| ||||| |||||||| ||||| ||||||||||||||||| |||
Sbjct: 576 ttgatgtcccgggagatagaagaccatgaaattgcacatgtggctgcagttagtgcagga 635

                                                     
Query: 560 aatgattacgctgtcggaaacatgatttctgatgcttttaaa 601
            ||||||| ||||| ||||| |||||||||||||||||||||
Sbjct: 636 gatgattatgctgttggaaatatgatttctgatgcttttaaa 677

---

>gb|AC157500.1| Oryza sativa (japonica cultivar-group) BAC clone OSJNBb0056O04, from
             chromosome 4, complete sequence
          Length = 90825

 Score =  155 bits (78), Expect = 2e-34
 Identities = 126/142 (88%)
 Strand = Plus / Minus

                                                                         
Query: 279   agatcgaattggaggacccgctggaaaatcttggagttaaattagtcagacaggccggcg 338
             |||| ||||||||||||||| |||||||||||||||| ||  | ||||||||||| || |
Sbjct: 21871 agattgaattggaggacccgttggaaaatcttggagtgaagctggtcagacaggctggtg 21812

                                                                         
Query: 339   ccaggacgaacgatattgccggtgatgggtgtactacttctataatccttgctcagggcc 398
             |||||||||||||| |||| |||||||| ||||| ||||| |||||||||||||| ||||
Sbjct: 21811 ccaggacgaacgatgttgctggtgatggttgtaccacttccataatccttgctcaaggcc 21752

                                   
Query: 399   tgattgctgaaggaatgaaggt 420
             | || |||||||||||||||||
Sbjct: 21751 tcatcgctgaaggaatgaaggt 21730



 Score =  151 bits (76), Expect = 3e-33
 Identities = 109/120 (90%)
 Strand = Plus / Minus

                                                                         
Query: 161   gtggacttggtggcgcggctggtgggggtgaccctcggtcccaaggggaggaatgtggtg 220
             |||||| ||||||| |||||||| |||||||| || || |||||||||||||| ||||||
Sbjct: 22354 gtggacctggtggcacggctggtcggggtgacgctggggcccaaggggaggaacgtggtg 22295

                                                                         
Query: 221   ctcgccaacaagtatggccctcccaagatcgtcaacgatggggagacggtcctcaaggag 280
             ||   ||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 22294 ctgagcaacaagtacggccctcccaagatcgtcaacgatggggagacggtcctcaaggag 22235



 Score =  105 bits (53), Expect = 2e-19
 Identities = 80/89 (89%)
 Strand = Plus / Minus

                                                                         
Query: 513   agattgaagatcatgaaatagcacaagtggctgcagttagtgccggaaatgattacgctg 572
             |||| ||||| |||||||| ||||| ||||||||||||||||| ||| ||||||| ||||
Sbjct: 21398 agatagaagaccatgaaattgcacatgtggctgcagttagtgcaggagatgattatgctg 21339

                                          
Query: 573   tcggaaacatgatttctgatgcttttaaa 601
             | ||||| |||||||||||||||||||||
Sbjct: 21338 ttggaaatatgatttctgatgcttttaaa 21310



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 67/76 (88%)
 Strand = Plus / Minus

                                                                         
Query: 80    aagaagacgccgccgatacccgtctacaaggacctgcacttcaacaaggacctctccgcc 139
             |||||| ||||||| || || || |||||||||||||||||||||   ||||||||||||
Sbjct: 22539 aagaagccgccgcccatgccggtgtacaaggacctgcacttcaaccgcgacctctccgcc 22480

                             
Query: 140   accaagaagttgcagg 155
             ||||||||| ||||||
Sbjct: 22479 accaagaagctgcagg 22464

---

>ref|NM_102387.1| Arabidopsis thaliana ATP binding / protein binding AT1G26230 mRNA,
           complete cds
          Length = 1843

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 68/81 (83%)
 Strand = Plus / Plus

                                                                       
Query: 354 ttgccggtgatgggtgtactacttctataatccttgctcagggcctgattgctgaaggaa 413
           ||||||||||||| |  ||||| |||||||| |||||||| ||||| ||| ||||||| |
Sbjct: 375 ttgccggtgatggttccactacatctataattcttgctcatggccttattactgaaggta 434

                                
Query: 414 tgaaggttcttgctgctggaa 434
           | |||||  || |||||||||
Sbjct: 435 ttaaggtgatttctgctggaa 455



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 72/87 (82%)
 Strand = Plus / Plus

                                                                       
Query: 512 gagattgaagatcatgaaatagcacaagtggctgcagttagtgccggaaatgattacgct 571
           |||||||||||||||||  | || || || || ||||||||||| || ||||| ||||  
Sbjct: 533 gagattgaagatcatgagcttgctcatgttgcagcagttagtgcggggaatgactacgaa 592

                                      
Query: 572 gtcggaaacatgatttctgatgctttt 598
           || ||||||||||||||  ||||||||
Sbjct: 593 gtgggaaacatgatttccaatgctttt 619

---

>dbj|AK221637.1| Arabidopsis thaliana mRNA for chaperonin precursor, complete cds,
           clone: RAFL07-98-N18
          Length = 2011

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 68/81 (83%)
 Strand = Plus / Plus

                                                                       
Query: 354 ttgccggtgatgggtgtactacttctataatccttgctcagggcctgattgctgaaggaa 413
           ||||||||||||| |  ||||| |||||||| |||||||| ||||| ||| ||||||| |
Sbjct: 403 ttgccggtgatggttccactacatctataattcttgctcatggccttattactgaaggta 462

                                
Query: 414 tgaaggttcttgctgctggaa 434
           | |||||  || |||||||||
Sbjct: 463 ttaaggtgatttctgctggaa 483



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 72/87 (82%)
 Strand = Plus / Plus

                                                                       
Query: 512 gagattgaagatcatgaaatagcacaagtggctgcagttagtgccggaaatgattacgct 571
           |||||||||||||||||  | || || || || ||||||||||| || ||||| ||||  
Sbjct: 561 gagattgaagatcatgagcttgctcatgttgcagcagttagtgcggggaatgactacgaa 620

                                      
Query: 572 gtcggaaacatgatttctgatgctttt 598
           || ||||||||||||||  ||||||||
Sbjct: 621 gtgggaaacatgatttccaatgctttt 647

---

>gb|AC079829.6|AC079829 Arabidopsis thaliana chromosome 1 BAC F28B23 genomic sequence, complete
             sequence
          Length = 96699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 57/67 (85%)
 Strand = Plus / Plus

                                                                         
Query: 354   ttgccggtgatgggtgtactacttctataatccttgctcagggcctgattgctgaaggaa 413
             ||||||||||||| |  ||||| |||||||| |||||||| ||||| ||| ||||||| |
Sbjct: 42990 ttgccggtgatggttccactacatctataattcttgctcatggccttattactgaaggta 43049

                    
Query: 414   tgaaggt 420
             | |||||
Sbjct: 43050 ttaaggt 43056



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 71/86 (82%)
 Strand = Plus / Plus

                                                                         
Query: 513   agattgaagatcatgaaatagcacaagtggctgcagttagtgccggaaatgattacgctg 572
             ||||||||||||||||  | || || || || ||||||||||| || ||||| ||||  |
Sbjct: 43334 agattgaagatcatgagcttgctcatgttgcagcagttagtgcggggaatgactacgaag 43393

                                       
Query: 573   tcggaaacatgatttctgatgctttt 598
             | ||||||||||||||  ||||||||
Sbjct: 43394 tgggaaacatgatttccaatgctttt 43419

---

>dbj|AK108892.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-152-E06, full
           insert sequence
          Length = 2254

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 106 caaggacctgcacttcaacaag 127
           ||||||||||||||||||||||
Sbjct: 180 caaggacctgcacttcaacaag 201

---

>gb|DQ151549.1| Agrobacterium tumefaciens arsenite oxidase regulatory locus, partial
            sequence
          Length = 7385

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 337  cgccaggacgaacgatattgccggtg 362
            ||||||||||| ||||||||||||||
Sbjct: 5338 cgccaggacgaccgatattgccggtg 5313

---

>gb|AY738210.1| Mycobacterium interjectum strain KKA 176Seq 65 kDa heat shock
           protein (hsp65) gene, partial cds
          Length = 427

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 274 caaggagatcgaattggaggacccg 298
           ||||||||||||| |||||||||||
Sbjct: 411 caaggagatcgaactggaggacccg 387

---

>gb|AY337276.1| Mycobacterium parascrofulaceum strain U02532 65 kDa heat shock
           protein (hsp65) gene, partial cds
          Length = 441

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 274 caaggagatcgaattggaggacccg 298
           |||||||||||| ||||||||||||
Sbjct: 24  caaggagatcgagttggaggacccg 48

---

>gb|AY550234.1| Mycobacterium kansasii strain variant MS266 65 kDa heat shock
           protein (hsp65) gene, partial cds
          Length = 401

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 274 caaggagatcgaattggaggacccg 298
           ||||||||||||| |||||||||||
Sbjct: 4   caaggagatcgaactggaggacccg 28

---

>gb|AY438088.1| Mycobacterium kansasii 65 kDa heat shock protein (hsp65) gene,
           partial cds
          Length = 424

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 274 caaggagatcgaattggaggacccg 298
           ||||||||||||| |||||||||||
Sbjct: 17  caaggagatcgaactggaggacccg 41

---

>gb|AY438087.1| Mycobacterium kansasii 65 kDa heat shock protein (hsp65) gene,
           partial cds
          Length = 424

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 274 caaggagatcgaattggaggacccg 298
           ||||||||||||| |||||||||||
Sbjct: 17  caaggagatcgaactggaggacccg 41

---

>gb|AY438086.1| Mycobacterium kansasii 65 kDa heat shock protein (hsp65) gene,
           partial cds
          Length = 424

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 274 caaggagatcgaattggaggacccg 298
           ||||||||||||| |||||||||||
Sbjct: 17  caaggagatcgaactggaggacccg 41

---

>gb|AY438085.1| Mycobacterium kansasii 65 kDa heat shock protein (hsp65) gene,
           partial cds
          Length = 424

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 274 caaggagatcgaattggaggacccg 298
           ||||||||||||| |||||||||||
Sbjct: 17  caaggagatcgaactggaggacccg 41

---

>emb|CR735141.14| Zebrafish DNA sequence from clone CH211-128E9 in linkage group 15,
             complete sequence
          Length = 108767

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 580   catgatttctgatgcttttaa 600
             |||||||||||||||||||||
Sbjct: 41822 catgatttctgatgcttttaa 41802

---

>gb|AC005165.1| Homo sapiens BAC clone CTA-242H14 from 7, complete sequence
          Length = 155164

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 203    aaggggaggaatgtggtgctc 223
              |||||||||||||||||||||
Sbjct: 117967 aaggggaggaatgtggtgctc 117947

---

>dbj|AB232365.1| Mycobacterium kansasii hsp65 gene for 65 kDa heat shock protein,
           partial cds, strain:KM-7
          Length = 440

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 274 caaggagatcgaattggaggacccg 298
           ||||||||||||| |||||||||||
Sbjct: 24  caaggagatcgaactggaggacccg 48

---

>dbj|AB232364.1| Mycobacterium kansasii hsp65 gene for 65 kDa heat shock protein,
           partial cds, strain:UN-28
          Length = 440

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 274 caaggagatcgaattggaggacccg 298
           ||||||||||||| |||||||||||
Sbjct: 24  caaggagatcgaactggaggacccg 48

---

>dbj|AB232363.1| Mycobacterium kansasii hsp65 gene for 65 kDa heat shock protein,
           partial cds, strain:MY-1
          Length = 440

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 274 caaggagatcgaattggaggacccg 298
           ||||||||||||| |||||||||||
Sbjct: 24  caaggagatcgaactggaggacccg 48

---

>gb|AF434739.1|AF434739 Mycobacterium kansasii strain ATCC 12478 65 kDa heat shock protein
           (hsp65) gene, partial cds
          Length = 401

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 274 caaggagatcgaattggaggacccg 298
           ||||||||||||| |||||||||||
Sbjct: 4   caaggagatcgaactggaggacccg 28

---

>emb|BX823782.1|CNS0A5D5 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS75ZB02 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1482

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 469 gactgctgatgctttggtttc 489
           |||||||||||||||||||||
Sbjct: 365 gactgctgatgctttggtttc 385

---

>gb|AF547849.1| Mycobacterium kansasii strain CIP 104589 65 kDa heat shock protein
           (hsp65) gene, partial cds
          Length = 424

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 274 caaggagatcgaattggaggacccg 298
           ||||||||||||| |||||||||||
Sbjct: 17  caaggagatcgaactggaggacccg 41

---

>gb|AF547846.1| Mycobacterium interjectum strain DSM 44064 65 kDa heat shock
           protein (hsp65) gene, partial cds
          Length = 424

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 274 caaggagatcgaattggaggacccg 298
           ||||||||||||| |||||||||||
Sbjct: 17  caaggagatcgaactggaggacccg 41

---

>gb|AF547836.1| Mycobacterium gastri strain CIP 104530 65 kDa heat shock protein
           (hsp65) gene, partial cds
          Length = 424

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 274 caaggagatcgaattggaggacccg 298
           ||||||||||||| |||||||||||
Sbjct: 17  caaggagatcgaactggaggacccg 41

---

>gb|AY103778.1| Zea mays PCO063180 mRNA sequence
          Length = 2338

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 384 tccttgctcagggcctgattgctga 408
           ||||||||||||| |||||||||||
Sbjct: 678 tccttgctcaggggctgattgctga 702

---

>ref|NM_202718.1| Arabidopsis thaliana alpha-galactosidase/ hydrolase, hydrolyzing
           O-glycosyl compounds AT3G56310 transcript variant
           AT3G56310.2 mRNA, complete cds
          Length = 1879

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 470 actgctgatgctttggtttc 489
           ||||||||||||||||||||
Sbjct: 342 actgctgatgctttggtttc 361

---

>ref|NM_115489.4| Arabidopsis thaliana alpha-galactosidase/ hydrolase, hydrolyzing
           O-glycosyl compounds AT3G56310 transcript variant
           AT3G56310.1 mRNA, complete cds
          Length = 1975

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 470 actgctgatgctttggtttc 489
           ||||||||||||||||||||
Sbjct: 366 actgctgatgctttggtttc 385

---

>gb|AY669726.1| HIV-1 isolate JRCSFclone from USA envelope glycoprotein (env) gene,
            partial cds
          Length = 2544

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 2477 tgtactacttctataatcct 2458

---

>gb|AY669709.1| HIV-1 isolate PAVO from Italy envelope glycoprotein (env) gene,
            partial cds
          Length = 2598

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 2531 tgtactacttctataatcct 2512

---

>gb|AY669708.1| HIV-1 isolate 6101 from USA envelope glycoprotein (env) gene, partial
            cds
          Length = 2562

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 2495 tgtactacttctataatcct 2476

---

>gb|DQ127541.1| HIV-1 isolate AC-38_64_Days_3'_Seq2.fa envelope glycoprotein (env)
           and rev protein (rev) genes, partial cds; and nef
           protein (nef) gene, complete cds
          Length = 1085

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 348 tgtactacttctataatcct 329

---

>gb|DQ127540.1| HIV-1 isolate AC-38_64_Days_3'_Seq1.fa rev protein (env) gene,
           partial cds; and nef protein (nef) gene, complete cds
          Length = 1085

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 348 tgtactacttctataatcct 329

---

>gb|AY535518.1| HIV-1 isolate 153 clone 15 from France envelope glycoprotein (env)
            gene, complete cds
          Length = 2493

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 2483 tgtactacttctataatcct 2464

---

>gb|AY535516.1| HIV-1 isolate 153 clone 13 from France envelope glycoprotein (env)
            gene, complete cds
          Length = 2493

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 2483 tgtactacttctataatcct 2464

---

>gb|AY535509.1| HIV-1 isolate 153 clone 6 from France envelope glycoprotein (env)
            gene, complete cds
          Length = 2523

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 2513 tgtactacttctataatcct 2494

---

>gb|AY535506.1| HIV-1 isolate 153 clone 3 from France envelope glycoprotein (env)
            gene, complete cds
          Length = 2493

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 2483 tgtactacttctataatcct 2464

---

>gb|AY535505.1| HIV-1 isolate 153 clone 2 from France envelope glycoprotein (env)
            gene, complete cds
          Length = 2493

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 2483 tgtactacttctataatcct 2464

---

>gb|AY779564.1| HIV-1 isolate CANA1FULL from Canada, complete genome
          Length = 8720

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 8028 tgtactacttctataatcct 8009

---

>gb|AY779554.1| HIV-1 isolate CANB4FULL from Canada, complete genome
          Length = 8693

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 8004 tgtactacttctataatcct 7985

---

>gb|AY779553.1| HIV-1 isolate CANB3FULL from Canada, complete genome
          Length = 8687

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 7998 tgtactacttctataatcct 7979

---

>gb|AY779552.1| HIV-1 isolate CANA6FULL from Canada, complete genome
          Length = 8780

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 8037 tgtactacttctataatcct 8018

---

>gb|AY779551.1| HIV-1 isolate CANA5FULL from Canada, complete genome
          Length = 8765

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 8037 tgtactacttctataatcct 8018

---

>gb|AY779550.1| HIV-1 isolate CANA3FULL from Canada, complete genome
          Length = 8765

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 8037 tgtactacttctataatcct 8018

---

>gb|AY522734.1| HIV-1 isolate 99ZALT45 from South Africa envelope glycoprotein (env)
            gene, complete cds
          Length = 2568

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 2498 tgtactacttctataatcct 2479

---

>gb|AY522731.1| HIV-1 isolate 99ZALT39 from South Africa envelope glycoprotein (env)
            gene, complete cds
          Length = 2574

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 2504 tgtactacttctataatcct 2485

---

>gb|AY522723.1| HIV-1 isolate 99ZALT15 from South Africa envelope glycoprotein (env)
            gene, complete cds
          Length = 2616

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 2546 tgtactacttctataatcct 2527

---

>gb|AY426127.1| HIV-1 clone JRCSF-2 isolate JRCSF from USA envelope glycoprotein
            (env) gene, complete cds
          Length = 2547

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 2477 tgtactacttctataatcct 2458

---

>gb|AY426126.1| HIV-1 clone JRCSF-1 isolate JRCSF from USA envelope glycoprotein
            (env) gene, complete cds
          Length = 2547

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 2477 tgtactacttctataatcct 2458

---

>gb|AY426125.1| HIV-1 isolate JRCSF from USA envelope glycoprotein (env) gene,
            complete cds
          Length = 2547

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 2477 tgtactacttctataatcct 2458

---

>gb|DQ410649.1| HIV-1 isolate 154v38Penv_fe5.2 from USA envelope glycoprotein (env)
            gene, complete cds
          Length = 2565

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 2495 tgtactacttctataatcct 2476

---

>gb|DQ410648.1| HIV-1 isolate 154v38Penv_fe5.1 from USA envelope glycoprotein (env)
            gene, complete cds
          Length = 2565

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 2495 tgtactacttctataatcct 2476

---

>gb|DQ410646.1| HIV-1 isolate 154v38Penv_fe4.1 from USA nonfunctional envelope
            glycoprotein (env) gene, complete sequence
          Length = 2564

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 2494 tgtactacttctataatcct 2475

---

>gb|DQ410645.1| HIV-1 isolate 154v38Penv_fe3.1 from USA envelope glycoprotein (env)
            gene, complete cds
          Length = 2565

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 2495 tgtactacttctataatcct 2476

---

>gb|DQ410644.1| HIV-1 isolate 154v38Penv_fe1.1 from USA envelope glycoprotein (env)
            gene, complete cds
          Length = 2565

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 2495 tgtactacttctataatcct 2476

---

>gb|DQ410642.1| HIV-1 isolate 154v38Renv_re20 from USA nonfunctional envelope
            glycoprotein (env) gene, complete sequence
          Length = 2631

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 2561 tgtactacttctataatcct 2542

---

>gb|DQ410633.1| HIV-1 isolate 154v38Renv_re28 from USA envelope glycoprotein (env)
            gene, complete cds
          Length = 2628

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 2558 tgtactacttctataatcct 2539

---

>gb|DQ410628.1| HIV-1 isolate 154v38Renv_re24 from USA envelope glycoprotein (env)
            gene, complete cds
          Length = 2622

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 2552 tgtactacttctataatcct 2533

---

>gb|DQ410275.1| HIV-1 isolate H22v2ed21 from USA envelope glycoprotein (env) gene,
            complete cds
          Length = 2595

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 2525 tgtactacttctataatcct 2506

---

>gb|DQ410267.1| HIV-1 isolate H22v2ed9 from USA envelope glycoprotein (env) gene,
            complete cds
          Length = 2607

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 2537 tgtactacttctataatcct 2518

---

>gb|DQ410250.1| HIV-1 isolate H22v1ed10.2 from USA envelope glycoprotein (env) gene,
            complete cds
          Length = 2601

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 2531 tgtactacttctataatcct 2512

---

>gb|DQ410247.1| HIV-1 isolate H22v1ed2.1 from USA envelope glycoprotein (env) gene,
            complete cds
          Length = 2577

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 2507 tgtactacttctataatcct 2488

---

>gb|AY358072.1| HIV-1 02TH.OUR846I from Thailand gag protein (gag) and pol protein
            (pol) genes, partial cds; vif protein (vif), vpr protein
            (vpr), tat protein (tat), rev protein (rev), vpu protein
            (vpu), and env protein (env) genes, complete cds; and nef
            protein (nef) gene, partial cds
          Length = 8386

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 7924 tgtactacttctataatcct 7905

---

>gb|AY358071.1| HIV-1 01TH.OUR033I from Thailand gag protein (gag) and pol protein
            (pol) genes, partial cds; vif protein (vif), vpr protein
            (vpr), tat protein (tat), rev protein (rev), vpu protein
            (vpu), and env protein (env) genes, complete cds; and nef
            protein (nef) gene, partial cds
          Length = 8386

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 7924 tgtactacttctataatcct 7905

---

>gb|AY612855.1| HIV-1 isolate 6101 from USA envelope glycoprotein (env) gene,
            complete cds
          Length = 2565

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 2495 tgtactacttctataatcct 2476

---

>gb|CP000358.1| Deinococcus geothermalis DSM 11300 plasmid 1, complete sequence
          Length = 574126

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 415    gaaggttcttgctgctggaa 434
              ||||||||||||||||||||
Sbjct: 341490 gaaggttcttgctgctggaa 341509

---

>gb|DQ396385.1| HIV-1 isolate 03ZAPS051MB1 from South Africa, complete genome
          Length = 9012

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 8119 tgtactacttctataatcct 8100

---

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 416      aaggttcttgctgctggaat 435
                ||||||||||||||||||||
Sbjct: 33085302 aaggttcttgctgctggaat 33085321

---

>ref|NM_001032734.1| Takifugu rubripes alpha-6-fucosyltransferase (fut8), mRNA
          Length = 1749

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 170  gtggcgcggctggtgggggt 189
            ||||||||||||||||||||
Sbjct: 1554 gtggcgcggctggtgggggt 1535

---

>gb|AY945709.1| HIV-1 isolate HS123 from Tanzania, complete genome
          Length = 8809

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 7928 tgtactacttctataatcct 7909

---

>gb|AY887515.1| HIV-1 clone 67 from Tanzania envelope glycoprotein (env) gene,
            complete cds
          Length = 2547

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 2477 tgtactacttctataatcct 2458

---

>gb|AY887514.1| HIV-1 clone 20 from Tanzania envelope glycoprotein (env) gene,
            complete cds
          Length = 2553

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 2483 tgtactacttctataatcct 2464

---

>gb|AY887513.1| HIV-1 clone 26 from Tanzania envelope glycoprotein (env) gene,
            complete cds
          Length = 2553

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 2483 tgtactacttctataatcct 2464

---

>gb|AY887512.1| HIV-1 clone 39 from Tanzania env gene, complete sequence
          Length = 2543

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 2473 tgtactacttctataatcct 2454

---

>gb|AY887511.1| HIV-1 clone 41 from Tanzania env gene, complete sequence
          Length = 2545

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 2475 tgtactacttctataatcct 2456

---

>gb|AY887510.1| HIV-1 clone 73 from Tanzania env gene, complete sequence
          Length = 2542

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 2472 tgtactacttctataatcct 2453

---

>gb|AY887509.1| HIV-1 clone 76 from Tanzania envelope glycoprotein (env) gene,
            complete cds
          Length = 2553

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 2483 tgtactacttctataatcct 2464

---

>gb|AY887508.1| HIV-1 clone 68 from Tanzania envelope glycoprotein (env) gene,
            complete cds
          Length = 2556

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 2486 tgtactacttctataatcct 2467

---

>gb|AY887507.1| HIV-1 clone 64 from Tanzania envelope glycoprotein (env) gene,
            complete cds
          Length = 2553

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 2483 tgtactacttctataatcct 2464

---

>gb|AY887506.1| HIV-1 clone 77 from Tanzania envelope glycoprotein (env) gene,
            complete cds
          Length = 2553

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 2483 tgtactacttctataatcct 2464

---

>gb|AY887505.1| HIV-1 clone 57 from Tanzania envelope glycoprotein (env) gene,
            complete cds
          Length = 2553

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 2483 tgtactacttctataatcct 2464

---

>gb|AY887504.1| HIV-1 clone 81 from Tanzania env gene, complete sequence
          Length = 2552

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 2482 tgtactacttctataatcct 2463

---

>gb|AY887503.1| HIV-1 clone 74 from Tanzania envelope glycoprotein (env) gene,
            complete cds
          Length = 2553

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 2483 tgtactacttctataatcct 2464

---

>gb|AY887502.1| HIV-1 clone 71 from Tanzania envelope glycoprotein (env) gene,
            complete cds
          Length = 2553

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 2483 tgtactacttctataatcct 2464

---

>gb|AY887501.1| HIV-1 clone 70 from Tanzania envelope glycoprotein (env) gene,
            complete cds
          Length = 2553

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 2483 tgtactacttctataatcct 2464

---

>gb|AY887499.1| HIV-1 isolate 01TZ_HS123.3e18r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887498.1| HIV-1 isolate 01TZ_HS123.3e6r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887497.1| HIV-1 isolate 01TZ_HS123.3e5r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887496.1| HIV-1 isolate 01TZ_HS123.3e4r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887495.1| HIV-1 isolate 01TZ_HS123.3e12r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887493.1| HIV-1 isolate 01TZ_HS123.3e7r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887492.1| HIV-1 isolate 01TZ_HS123.3e22r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887491.1| HIV-1 isolate 01TZ_HS123.3e9r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887490.1| HIV-1 isolate 01TZ_HS123.3e8r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887489.1| HIV-1 isolate 01TZ_HS123.3e21r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887488.1| HIV-1 isolate 01TZ_HS123.3e13r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887486.1| HIV-1 isolate 01TZ_HS123.3e14r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887485.1| HIV-1 isolate 01TZ_HS123.3e20r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887484.1| HIV-1 isolate 01TZ_HS123.3e17r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887483.1| HIV-1 isolate 03TZ_HS123.10e22 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887482.1| HIV-1 isolate 03TZ_HS123.10e24 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887481.1| HIV-1 isolate 03TZ_HS123.10e3 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887480.1| HIV-1 isolate 03TZ_HS123.10e2 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887479.1| HIV-1 isolate 03TZ_HS123.10e12 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887478.1| HIV-1 isolate 02TZ_HS123.7e36 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887477.1| HIV-1 isolate 02TZ_HS123.7e35 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887476.1| HIV-1 isolate 02TZ_HS123.7e33 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887475.1| HIV-1 isolate 02TZ_HS123.7e32 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887472.1| HIV-1 isolate 02TZ_HS123.7e28 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887471.1| HIV-1 isolate 02TZ_HS123.7e23 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887470.1| HIV-1 isolate 02TZ_HS123.7e2 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887468.1| HIV-1 isolate 02TZ_HS123.7e10 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887467.1| HIV-1 isolate 02TZ_HS123.7e3 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887466.1| HIV-1 isolate 02TZ_HS123.7e1 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887465.1| HIV-1 isolate 02TZ_HS123.7e5 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887464.1| HIV-1 isolate 02TZ_HS123.7e21 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887463.1| HIV-1 isolate 02TZ_HS123.7e4 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887462.1| HIV-1 isolate 02TZ_HS123.7e24 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887459.1| HIV-1 isolate 01TZ_HS123.4e18 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887458.1| HIV-1 isolate 01TZ_HS123.4e16 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887457.1| HIV-1 isolate 01TZ_HS123.3e8s from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887456.1| HIV-1 isolate 01TZ_HS123.3e7s from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887455.1| HIV-1 isolate 01TZ_HS123.3e6s from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887454.1| HIV-1 isolate 01TZ_HS123.3e3s from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887453.1| HIV-1 isolate 01TZ_HS123.3e13s from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887452.1| HIV-1 isolate 01TZ_HS123.3e11s from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887451.1| HIV-1 isolate 01TZ_HS123.3e16s from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887450.1| HIV-1 isolate 01TZ_HS123.3e10s from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887449.1| HIV-1 isolate 01TZ_HS123.3e20s from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887448.1| HIV-1 isolate 01TZ_HS123.3e1s from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887447.1| HIV-1 isolate 01TZ_HS123.3e23s from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887446.1| HIV-1 isolate 01TZ_HS123.3e6 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887445.1| HIV-1 isolate 01TZ_HS123.3e59 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887444.1| HIV-1 isolate 01TZ_HS123.3e11 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887443.1| HIV-1 isolate 01TZ_HS123.3e9 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887442.1| HIV-1 isolate 01TZ_HS123.3e58 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887441.1| HIV-1 isolate 01TZ_HS123.3e17 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887440.1| HIV-1 isolate 01TZ_HS123.3e50 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887439.1| HIV-1 isolate 01TZ_HS123.3e53 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887438.1| HIV-1 isolate 01TZ_HS123.3e54 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887437.1| HIV-1 isolate 01TZ_HS123.3e51 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887436.1| HIV-1 isolate 01TZ_HS123.3e12 from Tanzania nonfunctional envelope
           glycoprotein (env) gene, partial sequence; and nef
           protein (nef) gene, partial cds
          Length = 1155

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 936 tgtactacttctataatcct 917

---

>gb|AY887435.1| HIV-1 isolate 01TZ_HS123.3e23r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887434.1| HIV-1 isolate 01TZ_HS123.3e4 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887379.1| HIV-1 isolate 01TZ_HS123.2e23r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887378.1| HIV-1 isolate 01TZ_HS123.2e19r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887377.1| HIV-1 isolate 01TZ_HS123.2e21r from Tanzania nonfunctional envelope
           glycoprotein (env) gene, partial sequence; and nef
           protein (nef) gene, partial cds
          Length = 1156

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 937 tgtactacttctataatcct 918

---

>gb|AY887376.1| HIV-1 isolate 01TZ_HS123.2e17r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887375.1| HIV-1 isolate 01TZ_HS123.2e16r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887374.1| HIV-1 isolate 01TZ_HS123.2e12r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887373.1| HIV-1 isolate 01TZ_HS123.2e3r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887372.1| HIV-1 isolate 01TZ_HS123.2e11r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887371.1| HIV-1 isolate 01TZ_HS123.2e8r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887370.1| HIV-1 isolate 01TZ_HS123.2e7r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887369.1| HIV-1 isolate 01TZ_HS123.2e4r from Tanzania nonfunctional envelope
           glycoprotein (env) gene, partial sequence; and nef
           protein (nef) gene, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887368.1| HIV-1 isolate 01TZ_HS123.2e6r from Tanzania nonfunctional envelope
           glycoprotein (env) gene, partial sequence; and nef
           protein (nef) gene, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887367.1| HIV-1 isolate 01TZ_HS123.2e5r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887366.1| HIV-1 isolate 01TZ_HS123.2e2r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887365.1| HIV-1 isolate 01TZ_HS123.2e15r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887364.1| HIV-1 isolate 01TZ_HS123.2e13r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887363.1| HIV-1 isolate 01TZ_HS123.1e24r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887362.1| HIV-1 isolate 01TZ_HS123.1e23r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887361.1| HIV-1 isolate 01TZ_HS123.1e21r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887360.1| HIV-1 isolate 01TZ_HS123.1e18r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887359.1| HIV-1 isolate 01TZ_HS123.1e20r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887358.1| HIV-1 isolate 01TZ_HS123.1e5r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887357.1| HIV-1 isolate 01TZ_HS123.1e4r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887356.1| HIV-1 isolate 01TZ_HS123.1e8r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887355.1| HIV-1 isolate 01TZ_HS123.1e7r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887353.1| HIV-1 isolate 01TZ_HS123.1e3r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887352.1| HIV-1 isolate 01TZ_HS123.1e22r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887351.1| HIV-1 isolate 01TZ_HS123.1e17r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887350.1| HIV-1 isolate 01TZ_HS123.1e11r from Tanzania nonfunctional envelope
           glycoprotein (env) gene, partial sequence; and nef
           protein (nef) gene, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887349.1| HIV-1 isolate 01TZ_HS123.1e10r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887348.1| HIV-1 isolate 01TZ_HS123.1e16r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887347.1| HIV-1 isolate 01TZ_HS123.1e14r from Tanzania envelope glycoprotein
           (env) gene, partial cds; and nonfunctional nef protein
           (nef) gene, partial sequence
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887346.1| HIV-1 isolate 01TZ_HS123.1e13r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887345.1| HIV-1 isolate 00TZ_HS123.0e2r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887344.1| HIV-1 isolate 00TZ_HS123.0e17r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887343.1| HIV-1 isolate 00TZ_HS123.0e4r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887342.1| HIV-1 isolate 00TZ_HS123.0e21r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887341.1| HIV-1 isolate 00TZ_HS123.0e15r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887340.1| HIV-1 isolate 00TZ_HS123.0e8r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887339.1| HIV-1 isolate 00TZ_HS123.0e13r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887338.1| HIV-1 isolate 00TZ_HS123.0e3r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887337.1| HIV-1 isolate 00TZ_HS123.0e24r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887336.1| HIV-1 isolate 00TZ_HS123.0e10r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887335.1| HIV-1 isolate 00TZ_HS123.0e1r from Tanzania nonfunctional envelope
           glycoprotein (env) gene, partial sequence; and nef
           protein (nef) gene, partial cds
          Length = 1156

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 937 tgtactacttctataatcct 918

---

>gb|AY887334.1| HIV-1 isolate 00TZ_HS123.0e16r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887333.1| HIV-1 isolate 00TZ_HS123.0e14r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887332.1| HIV-1 isolate 00TZ_HS123.0e22r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887331.1| HIV-1 isolate 00TZ_HS123.0e18r from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887330.1| HIV-1 isolate 03TZ_HS123.10e4 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887329.1| HIV-1 isolate 03TZ_HS123.10e1 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887328.1| HIV-1 isolate 01TZ_HS123.4e9 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887327.1| HIV-1 isolate 01TZ_HS123.3e9s from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887326.1| HIV-1 isolate 01TZ_HS123.2e26 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887325.1| HIV-1 isolate 01TZ_HS123.2e25 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887324.1| HIV-1 isolate 01TZ_HS123.2e23 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887323.1| HIV-1 isolate 01TZ_HS123.2e22 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887322.1| HIV-1 isolate 01TZ_HS123.2e21 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887321.1| HIV-1 isolate 01TZ_HS123.2e20 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887320.1| HIV-1 isolate 01TZ_HS123.2e17 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887319.1| HIV-1 isolate 01TZ_HS123.2e13 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887318.1| HIV-1 isolate 01TZ_HS123.2e5 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887317.1| HIV-1 isolate 01TZ_HS123.2e19 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887316.1| HIV-1 isolate 01TZ_HS123.2e18 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887315.1| HIV-1 isolate 01TZ_HS123.2e16 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887314.1| HIV-1 isolate 01TZ_HS123.2e14 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887313.1| HIV-1 isolate 01TZ_HS123.2e9 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887311.1| HIV-1 isolate 01TZ_HS123.2e3 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887310.1| HIV-1 isolate 01TZ_HS123.2e29 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887309.1| HIV-1 isolate 01TZ_HS123.2e28 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887308.1| HIV-1 isolate 01TZ_HS123.2e27 from Tanzania nonfunctional envelope
           glycoprotein (env) gene, partial sequence; and nef
           protein (nef) gene, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887307.1| HIV-1 isolate 01TZ_HS123.2e12 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887306.1| HIV-1 isolate 01TZ_HS123.1e67 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887305.1| HIV-1 isolate 01TZ_HS123.1e60 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887304.1| HIV-1 isolate 01TZ_HS123.1e59 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887303.1| HIV-1 isolate 01TZ_HS123.1e58 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1156

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 937 tgtactacttctataatcct 918

---

>gb|AY887302.1| HIV-1 isolate 01TZ_HS123.1e57 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887301.1| HIV-1 isolate 01TZ_HS123.1e56 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887300.1| HIV-1 isolate 01TZ_HS123.1e55 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887299.1| HIV-1 isolate 01TZ_HS123.1e54 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887298.1| HIV-1 isolate 01TZ_HS123.1e52 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887297.1| HIV-1 isolate 01TZ_HS123.1e50 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887296.1| HIV-1 isolate 01TZ_HS123.1e49 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887295.1| HIV-1 isolate 01TZ_HS123.1e48 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887294.1| HIV-1 isolate 01TZ_HS123.1e44 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887293.1| HIV-1 isolate 01TZ_HS123.1e36 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887292.1| HIV-1 isolate 01TZ_HS123.1e28 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887291.1| HIV-1 isolate 01TZ_HS123.1e22 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887290.1| HIV-1 isolate 01TZ_HS123.1e31 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887289.1| HIV-1 isolate 01TZ_HS123.1e12 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887288.1| HIV-1 isolate 01TZ_HS123.1e9 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY887287.1| HIV-1 isolate 01TZ_HS123.1e1 from Tanzania envelope glycoprotein
           (env) and nef protein (nef) genes, partial cds
          Length = 1157

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 368 tgtactacttctataatcct 387
           ||||||||||||||||||||
Sbjct: 938 tgtactacttctataatcct 919

---

>gb|AY334445.1| Candidatus Blochmannia americanus isolate Camer00 heat shock
           protein (groEL) gene, partial cds
          Length = 1589

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 406 tgaaggaatgaaggttcttgctgctggaatgaatcc 441
           ||||||| |||||| | | |||||||||||||||||
Sbjct: 337 tgaaggactgaaggctgtggctgctggaatgaatcc 372

---

>ref|XM_751366.1| Ustilago maydis 521 hypothetical protein (UM00312.1) partial mRNA
          Length = 2142

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 226 caacaagtatggccctccca 245
           ||||||||||||||||||||
Sbjct: 123 caacaagtatggccctccca 142

---

>gb|AY124982.1| HIV-1 isolate dBR07 from USA envelope glycoprotein (env) gene,
            partial cds
          Length = 2547

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 2480 tgtactacttctataatcct 2461

---

>gb|AY124981.1| HIV-1 isolate dBR02 from USA envelope glycoprotein (env) gene,
            partial cds
          Length = 2547

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 2480 tgtactacttctataatcct 2461

---

>gb|AY159674.1| HIV-1 isolate dBR06 from USA nonfunctional envelope glycoprotein
            (env) gene, partial sequence
          Length = 2530

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 2463 tgtactacttctataatcct 2444

---

>gb|AY159673.1| HIV-1 isolate dBR01 from USA nonfunctional envelope glycoprotein
            (env) gene, partial sequence
          Length = 2530

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 2463 tgtactacttctataatcct 2444

---

>gb|AY159665.1| HIV-1 isolate bBR07 from USA nonfunctional envelope glycoprotein
            (env) gene, partial sequence
          Length = 2571

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tgtactacttctataatcct 387
            ||||||||||||||||||||
Sbjct: 2504 tgtactacttctataatcct 2485

---

>emb|BX069364.1|CNS09POO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6AA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 972

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 256 cgatggggagacggtcctcaaggagatcgaat 287
           ||||| ||||||||||| ||||| ||||||||
Sbjct: 815 cgatgaggagacggtccgcaaggcgatcgaat 846

---

>emb|BX068529.1|CNS09P1H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52DD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 426

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 256 cgatggggagacggtcctcaaggagatcgaat 287
           ||||| ||||||||||| ||||| ||||||||
Sbjct: 258 cgatgaggagacggtccgcaaggcgatcgaat 227

---

>emb|BX062859.1|CNS09KNZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44BD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 961

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 256 cgatggggagacggtcctcaaggagatcgaat 287
           ||||| ||||||||||| ||||| ||||||||
Sbjct: 412 cgatgaggagacggtccgcaaggcgatcgaat 381

---

>emb|BX062858.1|CNS09KNY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44BD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 914

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 256 cgatggggagacggtcctcaaggagatcgaat 287
           ||||| ||||||||||| ||||| ||||||||
Sbjct: 773 cgatgaggagacggtccgcaaggcgatcgaat 804

---

>emb|BX061695.1|CNS09JRN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42CF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 939

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 256 cgatggggagacggtcctcaaggagatcgaat 287
           ||||| ||||||||||| ||||| ||||||||
Sbjct: 415 cgatgaggagacggtccgcaaggcgatcgaat 384

---

>emb|BX061694.1|CNS09JRM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42CF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 938

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 256 cgatggggagacggtcctcaaggagatcgaat 287
           ||||| ||||||||||| ||||| ||||||||
Sbjct: 805 cgatgaggagacggtccgcaaggcgatcgaat 836

---

>emb|BX061162.1|CNS09JCU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41DC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 881

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 256 cgatggggagacggtcctcaaggagatcgaat 287
           ||||| ||||||||||| ||||| ||||||||
Sbjct: 426 cgatgaggagacggtccgcaaggcgatcgaat 395

---

>emb|BX061161.1|CNS09JCT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41DC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 913

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 256 cgatggggagacggtcctcaaggagatcgaat 287
           ||||| ||||||||||| ||||| ||||||||
Sbjct: 802 cgatgaggagacggtccgcaaggcgatcgaat 833

---

>emb|BX060895.1|CNS09J5F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 904

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 256 cgatggggagacggtcctcaaggagatcgaat 287
           ||||| ||||||||||| ||||| ||||||||
Sbjct: 390 cgatgaggagacggtccgcaaggcgatcgaat 359


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,042,577
Number of Sequences: 3902068
Number of extensions: 4042577
Number of successful extensions: 82631
Number of sequences better than 10.0: 387
Number of HSP's better than 10.0 without gapping: 387
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 82110
Number of HSP's gapped (non-prelim): 518
length of query: 601
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 578
effective length of database: 17,143,297,704
effective search space: 9908826072912
effective search space used: 9908826072912
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---