Clone Name	bah62j03
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|AF024589.1| X Tritordeum sp. glycine decarboxylase P subunit ...	1049	0.0
2	gb|U11693.1|ASU11693 Avena sativa victorin binding protein mRNA,...	936	0.0
3	ref|NM_191707.1| Oryza sativa (japonica cultivar-group), predic...	624	e-176
4	gb|AY346327.1| Oryza sativa (japonica cultivar-group) glycine de...	624	e-176
5	gb|AY495085.1| Oryza sativa (indica cultivar-group) glycine dehy...	617	e-173
6	dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D...	339	7e-90
7	dbj|AP003626.3| Oryza sativa (japonica cultivar-group) genomic D...	339	7e-90
8	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	331	2e-87
9	dbj|AP003410.4| Oryza sativa (japonica cultivar-group) genomic D...	331	2e-87
10	dbj|AP002901.2| Oryza sativa (japonica cultivar-group) genomic D...	331	2e-87
11	gb|AF439729.1|AF439729 Zea mays glycine cleavage complex P-prote...	289	6e-75
12	gb|AY103920.1| Zea mays PCO082698 mRNA sequence	109	1e-20
13	emb|AL939108.1|SCO939108 Streptomyces coelicolor A3(2) complete ...	101	3e-18
14	ref|XM_314216.2| Anopheles gambiae str. PEST ENSANGP00000014378 ...	101	3e-18
15	gb|CP000359.1| Deinococcus geothermalis DSM 11300, complete genome	98	4e-17
16	gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete ...	96	2e-16
17	ref|XM_741470.1| Aspergillus fumigatus Af293 glycine dehydrogena...	92	3e-15
18	emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,comp...	90	1e-14
19	gb|AE015451.1| Pseudomonas putida KT2440 complete genome	90	1e-14
20	gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete...	90	1e-14
21	gb|CP000240.1| Synechococcus sp. JA-2-3B'a(2-13), complete genome	88	4e-14
22	ref|XM_219785.3| PREDICTED: Rattus norvegicus glycine dehydrogen...	88	4e-14
23	emb|BX572101.1| Prochlorococcus marinus MIT9313 complete genome;...	86	2e-13
24	gb|CP000239.1| Synechococcus sp. JA-3-3Ab, complete genome	86	2e-13
25	gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. ...	86	2e-13
26	gb|AE004672.1| Pseudomonas aeruginosa PAO1, section 233 of 529 o...	84	6e-13
27	gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome	82	3e-12
28	gb|CP000319.1| Nitrobacter hamburgensis X14, complete genome	82	3e-12
29	emb|BX569695.1| Synechococcus sp. WH8102 complete genome; segmen...	82	3e-12
30	gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome	82	3e-12
31	emb|Z99770.1|STZ99770 Solanum tuberosum cv. Desire mRNA for P-pr...	82	3e-12
32	ref|XM_755229.1| Ustilago maydis 521 hypothetical protein (UM041...	80	1e-11
33	dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome	80	1e-11
34	dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome	80	1e-11
35	ref|NM_199554.1| Danio rerio zgc:66198 (zgc:66198), mRNA	74	6e-10
36	emb|BX572605.1| Rhodopseudomonas palustris CGA009 complete genom...	74	6e-10
37	emb|X59773.1|PSGDPP Pisum sativum mRNA for P protein, a part of ...	74	6e-10
38	gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome	74	6e-10
39	gb|AE005996.1| Caulobacter crescentus CB15 section 322 of 359 of...	74	6e-10
40	gb|AE004934.1| Pseudomonas aeruginosa PAO1, section 495 of 529 o...	74	6e-10
41	gb|BC057478.1| Danio rerio zgc:66198, mRNA (cDNA clone MGC:66198...	74	6e-10
42	gb|CP000110.1| Synechococcus sp. CC9605, complete genome	72	2e-09
43	gb|AE014292.2| Brucella suis 1330 chromosome II, complete sequence	72	2e-09
44	gb|CP000075.1| Pseudomonas syringae pv. syringae B728a, complete...	72	2e-09
45	gb|AE004367.1| Vibrio cholerae O1 biovar eltor str. N16961 chrom...	72	2e-09
46	emb|BX640439.1| Bordetella bronchiseptica strain RB50, complete ...	72	2e-09
47	emb|BX640425.1| Bordetella parapertussis strain 12822, complete ...	72	2e-09
48	emb|BX640411.1| Bordetella pertussis strain Tohama I, complete g...	72	2e-09
49	gb|CP000264.1| Jannaschia sp. CCS1, complete genome	72	2e-09
50	gb|AF396263.1|AF396262S2 Brucella melitensis biovar Abortus glyc...	72	2e-09
51	gb|AE009691.1| Brucella melitensis 16M chromosome II, section 53...	72	2e-09
52	dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ...	72	2e-09
53	gb|AE017224.1| Brucella abortus biovar 1 str. 9-941 chromosome I...	72	2e-09
54	emb|AM040265.1| Brucella melitensis biovar Abortus chromosome II...	72	2e-09
55	gb|AC008139.9| Drosophila melanogaster clone BACR28B01, complete...	70	1e-08
56	gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome	70	1e-08
57	ref|XM_367016.1| Magnaporthe grisea 70-15 chromosome VII hypothe...	70	1e-08
58	ref|XM_872922.1| PREDICTED: Bos taurus similar to Glycine dehydr...	70	1e-08
59	ref|XM_872820.1| PREDICTED: Bos taurus similar to Glycine dehydr...	70	1e-08
60	ref|XM_872730.1| PREDICTED: Bos taurus similar to Glycine dehydr...	70	1e-08
61	ref|XM_872617.1| PREDICTED: Bos taurus similar to Glycine dehydr...	70	1e-08
62	ref|XM_584346.2| PREDICTED: Bos taurus similar to Glycine dehydr...	70	1e-08
63	ref|XM_872422.1| PREDICTED: Bos taurus similar to Glycine dehydr...	70	1e-08
64	ref|XM_864146.1| PREDICTED: Bos taurus similar to Glycine dehydr...	70	1e-08
65	gb|CP000088.1| Thermobifida fusca YX, complete genome	70	1e-08
66	emb|BX842577.1| Mycobacterium tuberculosis H37Rv complete genome...	70	1e-08
67	emb|BX248340.1| Mycobacterium bovis subsp. bovis AF2122/97 compl...	70	1e-08
68	ref|NM_141732.1| Drosophila melanogaster CG3999-RA (CG3999), mRNA	70	1e-08
69	gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome	70	1e-08
70	gb|BT003457.1| Drosophila melanogaster RH34107 full insert cDNA	70	1e-08
71	gb|AE003686.4| Drosophila melanogaster chromosome 3R, section 24...	70	1e-08
72	gb|BC017135.1| Mus musculus glycine decarboxylase, mRNA (cDNA cl...	68	4e-08
73	ref|NM_138595.1| Mus musculus glycine decarboxylase (Gldc), mRNA	68	4e-08
74	dbj|AK139929.1| Mus musculus 2 cells egg cDNA, RIKEN full-length...	68	4e-08
75	dbj|AK080937.1| Mus musculus 4 days neonate male adipose cDNA, R...	68	4e-08
76	dbj|AK080789.1| Mus musculus adult male corpora quadrigemina cDN...	68	4e-08
77	gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete ge...	68	4e-08
78	ref|NM_119455.2| Arabidopsis thaliana glycine dehydrogenase (dec...	66	1e-07
79	gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome	66	1e-07
80	gb|BT000800.1| Arabidopsis thaliana At4g33010 mRNA sequence	66	1e-07
81	gb|AC157986.4| Mus musculus chromosome 19, clone RP23-160F18, co...	66	1e-07
82	gb|BT000446.1| Arabidopsis thaliana P-Protein - like protein (At...	66	1e-07
83	gb|AY091186.1| Arabidopsis thaliana putative P-protein (At4g3301...	66	1e-07
84	gb|AY063903.1| Arabidopsis thaliana putative P-Protein (At4g3301...	66	1e-07
85	gb|AY128922.1| Arabidopsis thaliana P-protein-like protein (At4g...	66	1e-07
86	dbj|AB225688.1| Aspergillus oryzae cDNA, contig sequence: AoEST2543	66	1e-07
87	dbj|AP007171.1| Aspergillus oryzae RIB40 genomic DNA, SC011	66	1e-07
88	gb|AY065004.1| Arabidopsis thaliana AT4g33010/F26P21_130 mRNA, c...	66	1e-07
89	gb|AY058856.1| Arabidopsis thaliana AT4g33010/F26P21_130 mRNA, c...	66	1e-07
90	gb|AY042800.1| Arabidopsis thaliana P-Protein - like protein (F2...	66	1e-07
91	dbj|AK050981.1| Mus musculus 9 days embryo whole body cDNA, RIKE...	66	1e-07
92	gb|AC102722.7| Mus musculus chromosome 19, clone RP24-108O16, co...	66	1e-07
93	gb|BT001132.1| Arabidopsis thaliana At4g33010/F26P21_130 mRNA, c...	66	1e-07
94	gb|AE016853.1| Pseudomonas syringae pv. tomato str. DC3000 compl...	64	6e-07
95	emb|CR931997.1| Corynebacterium jeikeium K411 complete genome	64	6e-07
96	emb|CR555306.1| Azoarcus sp. EbN1 complete genome	64	6e-07
97	gb|DQ056121.1| Coprinellus disseminatus strain TJ-01-05.8 glycin...	64	6e-07
98	gb|DQ056120.1| Coprinellus disseminatus strain TJ-01-15.4 glycin...	64	6e-07
99	emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome comple...	64	6e-07
100	gb|CP000032.1| Silicibacter pomeroyi DSS-3 plasmid megaplasmid, ...	62	2e-06
101	ref|XM_520482.1| PREDICTED: Pan troglodytes glycine dehydrogenas...	62	2e-06
102	ref|NM_000170.1| Homo sapiens glycine dehydrogenase (decarboxyla...	62	2e-06
103	emb|AL353718.10| Human DNA sequence from clone RP11-472F14 on ch...	62	2e-06
104	gb|AE008840.1| Salmonella typhimurium LT2, section 144 of 220 of...	62	2e-06
105	emb|AL583924.1|MLEPRTN8 Mycobacterium leprae strain TN complete ...	62	2e-06
106	emb|AL008609.1|MLCB1788 Mycobacterium leprae cosmid B1788	62	2e-06
107	gb|DQ056141.1| Coprinellus disseminatus strain IFO30972.17 glyci...	62	2e-06
108	gb|DQ056140.1| Coprinellus disseminatus strain IFO30972.16 glyci...	62	2e-06
109	gb|DQ056139.1| Coprinellus disseminatus strain TJ-00-100.3 glyci...	62	2e-06
110	gb|DQ056138.1| Coprinellus disseminatus strain TJ-00-100.1 glyci...	62	2e-06
111	dbj|AP008232.1| Sodalis glossinidius str. 'morsitans' DNA, compl...	62	2e-06
112	gb|AE011751.1| Xanthomonas axonopodis pv. citri str. 306, secti...	62	2e-06
113	gb|CP000133.1| Rhizobium etli CFN 42, complete genome	62	2e-06
114	gb|AF288640.1|AF288639S2 Homo sapiens glycine decarboxylase P-pr...	62	2e-06
115	gb|BC111995.1| Homo sapiens glycine dehydrogenase (decarboxylati...	62	2e-06
116	gb|BC111993.1| Homo sapiens glycine dehydrogenase (decarboxylati...	62	2e-06
117	gb|AE017220.1| Salmonella enterica subsp. enterica serovar Chole...	62	2e-06
118	dbj|D90239.1|HUMGDCMR Homo sapiens mRNA for glycine decarboxylas...	62	2e-06
119	gb|M63635.1|HUMPPROA Human glycine decarboxylase (P-protein) mRNA	62	2e-06
120	gb|M64590.1|HUMPP Human glycine decarboxylase mRNA, complete cds	62	2e-06
121	dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co...	60	9e-06
122	dbj|AP004486.1| Lotus japonicus genomic DNA, chromosome 5, clone...	60	9e-06
123	ref|NM_128167.2| Arabidopsis thaliana glycine dehydrogenase (dec...	58	4e-05
124	ref|XM_388528.1| Gibberella zeae PH-1 chromosome 2 hypothetical ...	58	4e-05
125	gb|CP000089.1| Dechloromonas aromatica RCB, complete genome	58	4e-05
126	gb|DQ056137.1| Coprinellus disseminatus strain TJ-01-12.6 glycin...	58	4e-05
127	gb|DQ056136.1| Coprinellus disseminatus strain TJ-01-06.5 glycin...	58	4e-05
128	gb|DQ056135.1| Coprinellus disseminatus strain TJ-01-16.1 glycin...	58	4e-05
129	gb|DQ056134.1| Coprinellus disseminatus strain TJ-00-91.2 glycin...	58	4e-05
130	gb|DQ056133.1| Coprinellus disseminatus strain TJ-01-19.4 glycin...	58	4e-05
131	gb|DQ056132.1| Coprinellus disseminatus strain TJ-01-17.1 glycin...	58	4e-05
132	gb|DQ056131.1| Coprinellus disseminatus strain TJ-00.94.4 glycin...	58	4e-05
133	gb|DQ056130.1| Coprinellus disseminatus strain TJ-01-10.3 glycin...	58	4e-05
134	gb|DQ056129.1| Coprinellus disseminatus strain TJ-01-14.1 glycin...	58	4e-05
135	gb|DQ056128.1| Coprinellus disseminatus strain TJ-00-99.3 glycin...	58	4e-05
136	gb|DQ056127.1| Coprinellus disseminatus strain TJ-01-02.7 glycin...	58	4e-05
137	gb|DQ056126.1| Coprinellus disseminatus strain TJ-01-11.2 glycin...	58	4e-05
138	gb|DQ056125.1| Coprinellus disseminatus strain TJ-01-18.5 glycin...	58	4e-05
139	gb|DQ056124.1| Coprinellus disseminatus strain TJ-01-19.2 glycin...	58	4e-05
140	gb|DQ056123.1| Coprinellus disseminatus strain TJ-01-08.1 glycin...	58	4e-05
141	gb|DQ056122.1| Coprinellus disseminatus strain TJ-01-14.2 glycin...	58	4e-05
142	gb|DQ056119.1| Coprinellus disseminatus strain TJ-01-13.3 glycin...	58	4e-05
143	gb|DQ056118.1| Coprinellus disseminatus strain TJ-01-13.8 glycin...	58	4e-05
144	gb|DQ056117.1| Coprinellus disseminatus strain TJ-01-09.3 glycin...	58	4e-05
145	gb|DQ056116.1| Coprinellus disseminatus strain TJ-00-38.6 glycin...	58	4e-05
146	gb|DQ056115.1| Coprinellus disseminatus strain TJ-01-12.4 glycin...	58	4e-05
147	gb|DQ056114.1| Coprinellus disseminatus strain TJ-01-07.1 glycin...	58	4e-05
148	gb|DQ056113.1| Coprinellus disseminatus strain TJ-01-06.2 glycin...	58	4e-05
149	gb|DQ056112.1| Coprinellus disseminatus strain TJ-00-89.2 glycin...	58	4e-05
150	gb|DQ056111.1| Coprinellus disseminatus strain TJ-01-15.1 glycin...	58	4e-05
151	gb|DQ056110.1| Coprinellus disseminatus strain TJ-01-07.6 glycin...	58	4e-05
152	gb|DQ056109.1| Coprinellus disseminatus strain TJ-01-09.1 glycin...	58	4e-05
153	gb|DQ056108.1| Coprinellus disseminatus strain TJ-01-11.5 glycin...	58	4e-05
154	gb|DQ056107.1| Coprinellus disseminatus strain TJ-01-10.2 glycin...	58	4e-05
155	gb|DQ056106.1| Coprinellus disseminatus strain TJ-01-16.3 glycin...	58	4e-05
156	gb|DQ056105.1| Coprinellus disseminatus strain TJ-01-18.3 glycin...	58	4e-05
157	gb|DQ056104.1| Coprinellus disseminatus strain TJ-00-38.3 glycin...	58	4e-05
158	gb|DQ056103.1| Coprinellus disseminatus strain TJ-00-94.5 glycin...	58	4e-05
159	gb|DQ056102.1| Coprinellus disseminatus strain TJ-01-17.6 glycin...	58	4e-05
160	gb|DQ056101.1| Coprinellus disseminatus strain TJ-00-89.1 glycin...	58	4e-05
161	gb|DQ056100.1| Coprinellus disseminatus strain TJ-01-20.6 glycin...	58	4e-05
162	gb|DQ056099.1| Coprinellus disseminatus strain TJ-01-20.5 glycin...	58	4e-05
163	gb|DQ056098.1| Coprinellus disseminatus strain TJ-01-05.1 glycin...	58	4e-05
164	gb|DQ056097.1| Coprinellus disseminatus strain TJ-00-99.1 glycin...	58	4e-05
165	gb|DQ056096.1| Coprinellus disseminatus strain TJ-01-08.2 glycin...	58	4e-05
166	gb|DQ056095.1| Coprinellus disseminatus strain TJ-00-91.1 glycin...	58	4e-05
167	gb|DQ056094.1| Coprinellus disseminatus strain TJ-01-04.4 glycin...	58	4e-05
168	gb|DQ056093.1| Coprinellus disseminatus strain TJ-01-04.1 glycin...	58	4e-05
169	gb|DQ056092.1| Coprinellus disseminatus strain TJ-01-02.5 glycin...	58	4e-05
170	gb|AE005674.1| Shigella flexneri 2a str. 301, complete genome	56	1e-04
171	gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, compl...	56	1e-04
172	gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, comp...	56	1e-04
173	gb|AY462111.1| Pleurotus djamor ketopantoate reductase-like prot...	56	1e-04
174	gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, com...	56	1e-04
175	ref|XM_796990.1| PREDICTED: Strongylocentrotus purpuratus simila...	56	1e-04
176	ref|XM_796977.1| PREDICTED: Strongylocentrotus purpuratus simila...	56	1e-04
177	ref|XM_775475.1| PREDICTED: Strongylocentrotus purpuratus simila...	56	1e-04
178	ref|XM_796947.1| PREDICTED: Strongylocentrotus purpuratus simila...	56	1e-04
179	ref|XM_796929.1| PREDICTED: Strongylocentrotus purpuratus simila...	56	1e-04
180	ref|XM_796904.1| PREDICTED: Strongylocentrotus purpuratus simila...	56	1e-04
181	gb|U00096.2| Escherichia coli K-12 MG1655, complete genome	56	1e-04
182	emb|X73958.1|ECGCVOP E.coli gcv operon DNA sequence	56	1e-04
183	emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromos...	56	1e-04
184	emb|AL161582.2|ATCHRIV78 Arabidopsis thaliana DNA chromosome 4, ...	56	1e-04
185	emb|AL031804.1|ATF26P21 Arabidopsis thaliana DNA chromosome 4, B...	56	1e-04
186	emb|AL035525.1|ATF4I10 Arabidopsis thaliana DNA chromosome 4, BA...	56	1e-04
187	dbj|AP009048.1| Escherichia coli W3110 DNA, complete genome	56	1e-04
188	gb|AE014073.1| Shigella flexneri 2a str. 2457T, complete genome	56	1e-04
189	gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, com...	56	1e-04
190	gb|AY544772.1| Brassica napus glycine decarboxylase P-protein-li...	56	1e-04
191	gb|AY544771.1| Moricandia nitens glycine decarboxylase P-protein...	56	1e-04
192	gb|U28377.1|ECU28377 Escherichia coli K-12 genome; approximately...	56	1e-04
193	gb|CP000036.1| Shigella boydii Sb227, complete genome	56	1e-04
194	gb|CP000038.1| Shigella sonnei Ss046, complete genome	56	1e-04
195	gb|L20872.1|ECOGCVHP Escherichia coli gcvH gene, 3' end; gcvP ge...	56	1e-04
196	gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence	54	6e-04
197	ref|XM_517277.1| PREDICTED: Pan troglodytes similar to Glycine d...	54	6e-04
198	gb|AE017283.1| Propionibacterium acnes KPA171202, complete genome	54	6e-04
199	gb|CP000352.1| Ralstonia metallidurans CH34, complete genome	54	6e-04
200	ref|XM_538655.2| PREDICTED: Canis familiaris similar to Glycine ...	54	6e-04
201	ref|XM_859381.1| PREDICTED: Canis familiaris similar to Glycine ...	54	6e-04
202	ref|XM_859367.1| PREDICTED: Canis familiaris similar to Glycine ...	54	6e-04
203	gb|DQ056143.1| Coprinellus disseminatus strain C345.1 mating-typ...	54	6e-04
204	gb|CP000249.1| Frankia sp. CcI3, complete genome	54	6e-04
205	gb|DQ226717.1| Boechera divaricarpa isolate SLW-A-A05 mRNA sequence	52	0.002
206	gb|CP000026.1| Salmonella enterica subsp. enterica serovar Parat...	52	0.002
207	gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome	50	0.009
208	emb|BX571871.1| Photorhabdus luminescens subsp. laumondii TTO1 c...	50	0.009
209	gb|AE002098.2| Neisseria meningitidis MC58, complete genome	50	0.009
210	dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, comp...	50	0.009
211	emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete ...	48	0.035
212	emb|BX950851.1| Erwinia carotovora subsp. atroseptica SCRI1043, ...	48	0.035
213	gb|AE012210.1| Xanthomonas campestris pv. campestris str. ATCC 3...	48	0.035
214	gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, ...	48	0.035
215	dbj|AK110181.1| Oryza sativa (japonica cultivar-group) cDNA clon...	48	0.035
216	gb|AE017343.1| Cryptococcus neoformans var. neoformans JEC21 chr...	46	0.14
217	gb|CP000058.1| Pseudomonas syringae pv. phaseolicola 1448A, comp...	46	0.14
218	ref|XM_569428.1| Cryptococcus neoformans var. neoformans JEC21 g...	46	0.14
219	gb|CP000316.1| Polaromonas sp. JS666, complete genome	46	0.14
220	dbj|AP008231.1| Synechococcus elongatus PCC 6301 DNA, complete g...	46	0.14
221	gb|AE017285.1| Desulfovibrio vulgaris subsp. vulgaris str. Hilde...	46	0.14
222	ref|NM_204322.1| Gallus gallus glycine dehydrogenase (decarboxyl...	46	0.14
223	dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome	46	0.14
224	dbj|D90266.1|CHKGDCMR Gallus gallus mRNA for glycine decarboxyla...	46	0.14
225	gb|M64402.1|CHKPP Chicken glycine decarboxylase mRNA, complete cds	46	0.14
226	gb|CP000100.1| Synechococcus elongatus PCC 7942, complete genome	46	0.14
227	gb|CP000097.1| Synechococcus sp. CC9902, complete genome	44	0.55
228	gb|CP000302.1| Shewanella denitrificans OS217, complete genome	44	0.55
229	emb|AL627277.1| Salmonella enterica serovar Typhi (Salmonella ty...	44	0.55
230	gb|AC124968.36| Medicago truncatula clone mth2-15e21, complete s...	44	0.55
231	gb|AC004747.3| Arabidopsis thaliana chromosome 2 clone T19L18 ma...	44	0.55
232	gb|AE014613.1| Salmonella enterica subsp. enterica serovar Typhi...	44	0.55
233	gb|CP000155.1| Hahella chejuensis KCTC 2396, complete genome	44	0.55
234	gb|AY742967.1| Hepatitis C virus isolate G4MP102 E2 protein gene...	42	2.2
235	gb|AF321274.2| Staphylococcus aureus SA2198 and disulfide bond p...	42	2.2
236	gb|AE017180.1| Geobacter sulfurreducens PCA, complete genome	42	2.2
237	gb|CP000285.1| Chromohalobacter salexigens DSM 3043, complete ge...	42	2.2
238	ref|XM_659648.1| Aspergillus nidulans FGSC A4 hypothetical prote...	42	2.2
239	gb|CP000360.1| Acidobacteria bacterium Ellin345, complete genome	42	2.2
240	gb|DQ506958.1| Hepatitis C virus isolate P1 clone A5894 polyprot...	42	2.2
241	gb|DQ506957.1| Hepatitis C virus isolate P1 clone A5805 polyprot...	42	2.2
242	gb|DQ504505.1| Hepatitis C virus isolate P1 clone B4899 polyprot...	42	2.2
243	gb|DQ504504.1| Hepatitis C virus isolate P1 clone B4898 polyprot...	42	2.2
244	gb|DQ504503.1| Hepatitis C virus isolate P1 clone B4897 polyprot...	42	2.2
245	gb|DQ504502.1| Hepatitis C virus isolate P1 clone B4896 polyprot...	42	2.2
246	gb|DQ504501.1| Hepatitis C virus isolate P1 clone B4895 polyprot...	42	2.2
247	gb|DQ504500.1| Hepatitis C virus isolate P1 clone B4894 polyprot...	42	2.2
248	gb|DQ504499.1| Hepatitis C virus isolate P1 clone B4893 polyprot...	42	2.2
249	gb|DQ504498.1| Hepatitis C virus isolate P1 clone B4891 polyprot...	42	2.2
250	gb|DQ504497.1| Hepatitis C virus isolate P1 clone B4890 polyprot...	42	2.2
251	gb|DQ504496.1| Hepatitis C virus isolate P1 clone B4889 polyprot...	42	2.2
252	gb|DQ504495.1| Hepatitis C virus isolate P1 clone B4887 polyprot...	42	2.2
253	gb|DQ504494.1| Hepatitis C virus isolate P1 clone B4886 polyprot...	42	2.2
254	gb|DQ504493.1| Hepatitis C virus isolate P1 clone B4884 polyprot...	42	2.2
255	gb|DQ504492.1| Hepatitis C virus isolate P1 clone B4883 polyprot...	42	2.2
256	gb|DQ504491.1| Hepatitis C virus isolate P1 clone B4882 polyprot...	42	2.2
257	gb|DQ504490.1| Hepatitis C virus isolate P1 clone B4881 polyprot...	42	2.2
258	gb|DQ504489.1| Hepatitis C virus isolate P1 clone B4880 polyprot...	42	2.2
259	gb|DQ504488.1| Hepatitis C virus isolate P1 clone B4879 polyprot...	42	2.2
260	gb|DQ504487.1| Hepatitis C virus isolate P1 clone B4877 polyprot...	42	2.2
261	gb|DQ504486.1| Hepatitis C virus isolate P1 clone B4876 polyprot...	42	2.2
262	gb|DQ504485.1| Hepatitis C virus isolate P1 clone B4873 polyprot...	42	2.2
263	gb|DQ504484.1| Hepatitis C virus isolate P1 clone B4872 polyprot...	42	2.2
264	gb|DQ504483.1| Hepatitis C virus isolate P1 clone B4871 polyprot...	42	2.2
265	gb|DQ504482.1| Hepatitis C virus isolate P1 clone B4870 polyprot...	42	2.2
266	gb|DQ504481.1| Hepatitis C virus isolate P1 clone B4869 polyprot...	42	2.2
267	gb|DQ504480.1| Hepatitis C virus isolate P1 clone B4868 polyprot...	42	2.2
268	gb|DQ504479.1| Hepatitis C virus isolate P1 clone B4865 polyprot...	42	2.2
269	gb|DQ504478.1| Hepatitis C virus isolate P1 clone B4864 polyprot...	42	2.2
270	gb|DQ504477.1| Hepatitis C virus isolate P1 clone B4863 polyprot...	42	2.2
271	gb|DQ504476.1| Hepatitis C virus isolate P1 clone B4861 polyprot...	42	2.2
272	gb|DQ504475.1| Hepatitis C virus isolate P1 clone B4874 polyprot...	42	2.2
273	gb|DQ504474.1| Hepatitis C virus isolate P1 clone A5983 polyprot...	42	2.2
274	gb|DQ504471.1| Hepatitis C virus isolate P1 clone A5892 polyprot...	42	2.2
275	gb|DQ504469.1| Hepatitis C virus isolate P1 clone A5889 polyprot...	42	2.2
276	gb|DQ504468.1| Hepatitis C virus isolate P1 clone A5887 polyprot...	42	2.2
277	gb|DQ504467.1| Hepatitis C virus isolate P1 clone A5886 polyprot...	42	2.2
278	gb|DQ504466.1| Hepatitis C virus isolate P1 clone A5880 polyprot...	42	2.2
279	gb|DQ504465.1| Hepatitis C virus isolate P1 clone A5881 polyprot...	42	2.2
280	gb|DQ504463.1| Hepatitis C virus isolate P1 clone A5878 polyprot...	42	2.2
281	gb|DQ504462.1| Hepatitis C virus isolate P1 clone A5871 polyprot...	42	2.2
282	gb|DQ504460.1| Hepatitis C virus isolate P1 clone A5869 polyprot...	42	2.2
283	gb|DQ504454.1| Hepatitis C virus isolate P1 clone A5854 polyprot...	42	2.2
284	gb|DQ504449.1| Hepatitis C virus isolate P1 clone A5840 polyprot...	42	2.2
285	gb|DQ504446.1| Hepatitis C virus isolate P1 clone A5834 polyprot...	42	2.2
286	gb|DQ504445.1| Hepatitis C virus isolate P1 clone A5830 polyprot...	42	2.2
287	gb|DQ504444.1| Hepatitis C virus isolate P1 clone A5829 polyprot...	42	2.2
288	gb|DQ504443.1| Hepatitis C virus isolate P1 clone A5825 polyprot...	42	2.2
289	gb|DQ504441.1| Hepatitis C virus isolate P1 clone A5813 polyprot...	42	2.2
290	emb|BX640443.1| Bordetella bronchiseptica strain RB50, complete ...	42	2.2
291	emb|BX640430.1| Bordetella parapertussis strain 12822, complete ...	42	2.2
292	emb|BX640419.1| Bordetella pertussis strain Tohama I, complete g...	42	2.2
293	emb|BX571857.1| Staphylococcus aureus strain MSSA476, complete g...	42	2.2
294	dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, c...	42	2.2
295	dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ...	42	2.2
296	dbj|BA000017.4| Staphylococcus aureus subsp. aureus Mu50 DNA, co...	42	2.2
297	gb|AC090968.14| Staphylococcus aureus strain NCTC 8325 clone sab...	42	2.2
298	gb|CP000248.1| Novosphingobium aromaticivorans DSM 12444, comple...	42	2.2
299	gb|CP000046.1| Staphylococcus aureus subsp. aureus COL, complete...	42	2.2
300	gb|CP000253.1| Staphylococcus aureus subsp. aureus NCTC 8325, co...	42	2.2
301	gb|CP000255.1| Staphylococcus aureus subsp. aureus USA300, compl...	42	2.2
302	dbj|BA000033.2| Staphylococcus aureus subsp. aureus MW2 DNA, com...	42	2.2
303	dbj|BA000018.3| Staphylococcus aureus subsp. aureus N315 genomic...	42	2.2
304	emb|Z34002.1|RNGRHR1 R.norvegicus (Sprague Dawley) gene for grow...	42	2.2
305	emb|BX571856.1| Staphylococcus aureus subsp. aureus strain MRSA2...	42	2.2
306	gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete...	42	2.2
307	gb|AE000666.1| Methanothermobacter thermautotrophicus str. Delta...	42	2.2
308	gb|U10153.1|RNU10153 Rattus norvegicus growth hormone-releasing ...	42	2.2
309	gb|CP000159.1| Salinibacter ruber DSM 13855, complete genome	42	2.2
310	emb|AJ938182.1| Staphylococcus aureus RF122 complete genome	42	2.2
311	dbj|AP006627.1| Bacillus clausii KSM-K16 DNA, complete genome	42	2.2
312	gb|AE009106.1| Agrobacterium tumefaciens str. C58 circular chrom...	40	8.6
313	ref|XM_802921.1| Trypanosoma cruzi strain CL Brener protein kina...	40	8.6
314	ref|XM_814879.1| Trypanosoma cruzi strain CL Brener protein kina...	40	8.6
315	emb|AJ301559.2|RFA301559 Rhodococcus fascians ORF1 (partial), OR...	40	8.6
316	gb|AC138735.3| Gallus gallus clone TAM31-15F7, complete sequence	40	8.6
317	gb|CP000243.1| Escherichia coli UTI89, complete genome	40	8.6
318	emb|AL445492.10| Human DNA sequence from clone RP11-137O18 on ch...	40	8.6
319	emb|AL162757.2|NMA6Z2491 Neisseria meningitidis serogroup A stra...	40	8.6
320	gb|AC104232.5| Homo sapiens chromosome 8, clone RP11-1D12, compl...	40	8.6
321	gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome	40	8.6
322	gb|AE007869.1| Agrobacterium tumefaciens str. C58, complete genome	40	8.6
323	gb|AC160141.2| Gallus gallus BAC clone CH261-182D6 from chromoso...	40	8.6
324	dbj|BA000039.2| Thermosynechococcus elongatus BP-1 DNA, complete...	40	8.6
325	emb|CR936257.1| Natronomonas pharaonis DSM 2160 complete genome	40	8.6
326	gb|AC159212.3| Gallus gallus BAC clone CH261-173O18 from chromos...	40	8.6
327	gb|AE005174.2| Escherichia coli O157:H7 EDL933, complete genome	40	8.6
328	dbj|BA000007.2| Escherichia coli O157:H7 DNA, complete genome	40	8.6
329	gb|CP000034.1| Shigella dysenteriae Sd197, complete genome	40	8.6
330	gb|CP000103.1| Nitrosospira multiformis ATCC 25196, complete genome	40	8.6

---

>gb|AF024589.1| X Tritordeum sp. glycine decarboxylase P subunit mRNA, complete cds
          Length = 3487

 Score = 1049 bits (529), Expect = 0.0
 Identities = 589/609 (96%)
 Strand = Plus / Plus

                                                                        
Query: 14   gctcaccacgctgcgcccgccgggcgagattggcgccgacatcgccgtgggctccgcgca 73
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1009 gctcaccacgctgcgcccgccgggcgagattggcgccgacatcgccgtgggctccgcgca 1068

                                                                        
Query: 74   acgcttcggcgtgcccatggggtacggcggcccgcacgctgccttcctcgccacctccca 133
            ||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 1069 acggttcggcgtgcccatggggtacggcggcccgcacgctgcgttcctcgccacctccca 1128

                                                                        
Query: 134  ggagtacaagaggctgatgcccggccgcatcatcggtgtgagcgtcgactccagcggcaa 193
            |||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 1129 ggagtacaagcggctgatgcccggccgcatcatcggagtgagcgtcgactccagcggcaa 1188

                                                                        
Query: 194  gcccgcgctccgcatggcaatgcagaccagggagcagcacatccggcgagacaaggccac 253
            |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 1189 gcccgcgctccgcatggcgatgcagaccagggagcagcacatccggcgagacaaggccac 1248

                                                                        
Query: 254  cagcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtcta 313
            |||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||
Sbjct: 1249 cagcaacatctgcaccgcgcaggcgttgctcgccaacatggcagcgatgtatgctgtcta 1308

                                                                        
Query: 314  ccatggtccggctggcctgaaggcgatcgccgaccgtgtccatggactggctggtacttt 373
            |||||| || ||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 1309 ccatgggcctgctggcctgaaggcgatcgccgaccgtgtccatggcctggctggtacttt 1368

                                                                        
Query: 374  cgcccatggtttgaagaagctcgggacagtgacagtgcaggagctgccctactttgacac 433
            ||||||||||||||||||||||||||||||||| ||||| |||||||||||||| |||||
Sbjct: 1369 cgcccatggtttgaagaagctcgggacagtgacggtgcaagagctgccctacttcgacac 1428

                                                                        
Query: 434  ggtcaagatcacttgcgccgatgctaatgccattgctgaggaggcccgcaaaaacgagat 493
            |||||||||||||||||| ||||||||||| ||||| |||||||||||||||||||||||
Sbjct: 1429 ggtcaagatcacttgcgctgatgctaatgcgattgccgaggaggcccgcaaaaacgagat 1488

                                                                        
Query: 494  gaaccttcgcgttgttgacgcaaacacgatcaccgttgcctttgatgagaccaccacctt 553
            ||||||||||||||| ||||| |||||||||||||||||||| |||||||||||||||||
Sbjct: 1489 gaaccttcgcgttgtcgacgcgaacacgatcaccgttgccttcgatgagaccaccacctt 1548

                                                                        
Query: 554  ggaggatgttgacaagctgttcaaggttttctctggtggcaagccagtgggcttcacagc 613
            |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 1549 ggaggatgttgacaagctgttcaaggttttctctggtggcaagccagtggacttcacagc 1608

                     
Query: 614  tgaatccat 622
            |||||||||
Sbjct: 1609 tgaatccat 1617

---

>gb|U11693.1|ASU11693 Avena sativa victorin binding protein mRNA, complete cds
          Length = 3408

 Score =  936 bits (472), Expect = 0.0
 Identities = 577/612 (94%)
 Strand = Plus / Plus

                                                                        
Query: 14   gctcaccacgctgcgcccgccgggcgagattggcgccgacatcgccgtgggctccgcgca 73
            ||||||||||||||||||||| |||||||| ||||||||||||||||| |||||||||||
Sbjct: 1003 gctcaccacgctgcgcccgcctggcgagatcggcgccgacatcgccgtcggctccgcgca 1062

                                                                        
Query: 74   acgcttcggcgtgcccatggggtacggcggcccgcacgctgccttcctcgccacctccca 133
              | ||||||||||||||||| |||||||||||||||||||| |||||||||||||||||
Sbjct: 1063 gaggttcggcgtgcccatgggctacggcggcccgcacgctgcgttcctcgccacctccca 1122

                                                                        
Query: 134  ggagtacaagaggctgatgcccggccgcatcatcggtgtgagcgtcgactccagcggcaa 193
            |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 1123 ggagtacaagaggctgatgcccggccgcatcatcggcgtgagcgtcgactccagcggcaa 1182

                                                                        
Query: 194  gcccgcgctccgcatggcaatgcagaccagggagcagcacatccggcgagacaaggccac 253
            ||| |||||||||||||| |||||||||||||||||||||||||| || |||||||||||
Sbjct: 1183 gccagcgctccgcatggcgatgcagaccagggagcagcacatccgccgcgacaaggccac 1242

                                                                        
Query: 254  cagcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtcta 313
            |||||||||||||||||||||||| ||||||||||||||||| || |||||||| |||||
Sbjct: 1243 cagcaacatctgcaccgcgcaggccttgctcgccaacatggcagccatgtatgctgtcta 1302

                                                                        
Query: 314  ccatggtccggctggcctgaaggcgatcgccgaccgtgtccatggactggctggtacttt 373
            ||||||||| ||||| || ||||| |||||||||||||||||||| ||||||||||||||
Sbjct: 1303 ccatggtcctgctgggctcaaggctatcgccgaccgtgtccatggcctggctggtacttt 1362

                                                                        
Query: 374  cgcccatggtttgaagaagctcgggacagtgacagtgcaggagctgccctactttgacac 433
            ||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 1363 cgcccatgggttgaagaagctcgggacagtgaccgtgcaggagctgccctactttgacac 1422

                                                                        
Query: 434  ggtcaagatcacttgcgccgatgctaatgccattgctgaggaggcccgcaaaaacgagat 493
             ||||||||||||||||| ||||| ||||| |||||||||||||| ||||||||||||||
Sbjct: 1423 cgtcaagatcacttgcgctgatgccaatgctattgctgaggaggctcgcaaaaacgagat 1482

                                                                        
Query: 494  gaaccttcgcgttgttgacgcaaacacgatcaccgttgcctttgatgagaccaccacctt 553
            |||||||||||| || ||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 1483 gaaccttcgcgtcgtagacgcaaacacgatcaccgttgcctttgatgagacaaccacctt 1542

                                                                        
Query: 554  ggaggatgttgacaagctgttcaaggttttctctggtggcaagccagtgggcttcacagc 613
            ||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||
Sbjct: 1543 ggaggatgttgacaagctgttcaaggtgttctctggtggcaagccagtggacttcacagc 1602

                        
Query: 614  tgaatccattgc 625
             |||||||||||
Sbjct: 1603 cgaatccattgc 1614

---

>ref|NM_191707.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 3102

 Score =  624 bits (315), Expect = e-176
 Identities = 534/607 (87%)
 Strand = Plus / Plus

                                                                        
Query: 14   gctcaccacgctgcgcccgccgggcgagattggcgccgacatcgccgtgggctccgcgca 73
            ||||||| ||||||||||||| || ||||| ||||||||||||||||| |||||||||||
Sbjct: 936  gctcacctcgctgcgcccgcccggtgagatcggcgccgacatcgccgtcggctccgcgca 995

                                                                        
Query: 74   acgcttcggcgtgcccatggggtacggcggcccgcacgctgccttcctcgccacctccca 133
             || ||||||||||||||||||||||| ||||||||||| || ||||||||||| |||||
Sbjct: 996  gcggttcggcgtgcccatggggtacggaggcccgcacgccgcgttcctcgccacttccca 1055

                                                                        
Query: 134  ggagtacaagaggctgatgcccggccgcatcatcggtgtgagcgtcgactccagcggcaa 193
            |||||||||| | || ||||||||||| |||||||| ||||||||||| |||||||||||
Sbjct: 1056 ggagtacaagcgcctcatgcccggccgtatcatcggcgtgagcgtcgattccagcggcaa 1115

                                                                        
Query: 194  gcccgcgctccgcatggcaatgcagaccagggagcagcacatccggcgagacaaggccac 253
            |||||||||||| ||||| ||||||||| |||||||||||||||| || |||||||||||
Sbjct: 1116 gcccgcgctccggatggcgatgcagacccgggagcagcacatccgccgcgacaaggccac 1175

                                                                        
Query: 254  cagcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtcta 313
            ||||||||||||||| || ||||| ||||||||||||||||| ||||||||||| |||||
Sbjct: 1176 cagcaacatctgcactgcccaggccttgctcgccaacatggcagcgatgtatgctgtcta 1235

                                                                        
Query: 314  ccatggtccggctggcctgaaggcgatcgccgaccgtgtccatggactggctggtacttt 373
            ||||||||| |  || || ||||| || ||||||||||| || || ||||||||||| ||
Sbjct: 1236 ccatggtcccgaggggctaaaggcaattgccgaccgtgtacacggcctggctggtacctt 1295

                                                                        
Query: 374  cgcccatggtttgaagaagctcgggacagtgacagtgcaggagctgccctactttgacac 433
             ||||||||  ||||||||||||| |||||||| |||||||| ||||| | |||||||||
Sbjct: 1296 tgcccatggactgaagaagctcggaacagtgactgtgcaggaactgccgttctttgacac 1355

                                                                        
Query: 434  ggtcaagatcacttgcgccgatgctaatgccattgctgaggaggcccgcaaaaacgagat 493
             |||||| |||    ||| ||||| ||||| |||||  |||||||| |||| ||||||||
Sbjct: 1356 tgtcaaggtcaaggtcgctgatgcgaatgcgattgcccaggaggcctgcaagaacgagat 1415

                                                                        
Query: 494  gaaccttcgcgttgttgacgcaaacacgatcaccgttgcctttgatgagaccaccacctt 553
            ||||||||| |||||||| |||| |||||| ||||| ||||||||||||||||| |||||
Sbjct: 1416 gaaccttcgtgttgttgatgcaaccacgataaccgtggcctttgatgagaccacaacctt 1475

                                                                        
Query: 554  ggaggatgttgacaagctgttcaaggttttctctggtggcaagccagtgggcttcacagc 613
             |||||||| ||||||||||||||||| |||  ||||||||||||||||  |||||| ||
Sbjct: 1476 agaggatgtcgacaagctgttcaaggtgttcaatggtggcaagccagtgaacttcactgc 1535

                   
Query: 614  tgaatcc 620
            |||||||
Sbjct: 1536 tgaatcc 1542

---

>gb|AY346327.1| Oryza sativa (japonica cultivar-group) glycine dehydrogenase P
            protein mRNA, complete cds
          Length = 3102

 Score =  624 bits (315), Expect = e-176
 Identities = 534/607 (87%)
 Strand = Plus / Plus

                                                                        
Query: 14   gctcaccacgctgcgcccgccgggcgagattggcgccgacatcgccgtgggctccgcgca 73
            ||||||| ||||||||||||| || ||||| ||||||||||||||||| |||||||||||
Sbjct: 936  gctcacctcgctgcgcccgcccggtgagatcggcgccgacatcgccgtcggctccgcgca 995

                                                                        
Query: 74   acgcttcggcgtgcccatggggtacggcggcccgcacgctgccttcctcgccacctccca 133
             || ||||||||||||||||||||||| ||||||||||| || ||||||||||| |||||
Sbjct: 996  gcggttcggcgtgcccatggggtacggaggcccgcacgccgcgttcctcgccacttccca 1055

                                                                        
Query: 134  ggagtacaagaggctgatgcccggccgcatcatcggtgtgagcgtcgactccagcggcaa 193
            |||||||||| | || ||||||||||| |||||||| ||||||||||| |||||||||||
Sbjct: 1056 ggagtacaagcgcctcatgcccggccgtatcatcggcgtgagcgtcgattccagcggcaa 1115

                                                                        
Query: 194  gcccgcgctccgcatggcaatgcagaccagggagcagcacatccggcgagacaaggccac 253
            |||||||||||| ||||| ||||||||| |||||||||||||||| || |||||||||||
Sbjct: 1116 gcccgcgctccggatggcgatgcagacccgggagcagcacatccgccgcgacaaggccac 1175

                                                                        
Query: 254  cagcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtcta 313
            ||||||||||||||| || ||||| ||||||||||||||||| ||||||||||| |||||
Sbjct: 1176 cagcaacatctgcactgcccaggccttgctcgccaacatggcagcgatgtatgctgtcta 1235

                                                                        
Query: 314  ccatggtccggctggcctgaaggcgatcgccgaccgtgtccatggactggctggtacttt 373
            ||||||||| |  || || ||||| || ||||||||||| || || ||||||||||| ||
Sbjct: 1236 ccatggtcccgaggggctaaaggcaattgccgaccgtgtacacggcctggctggtacctt 1295

                                                                        
Query: 374  cgcccatggtttgaagaagctcgggacagtgacagtgcaggagctgccctactttgacac 433
             ||||||||  ||||||||||||| |||||||| |||||||| ||||| | |||||||||
Sbjct: 1296 tgcccatggactgaagaagctcggaacagtgactgtgcaggaactgccgttctttgacac 1355

                                                                        
Query: 434  ggtcaagatcacttgcgccgatgctaatgccattgctgaggaggcccgcaaaaacgagat 493
             |||||| |||    ||| ||||| ||||| |||||  |||||||| |||| ||||||||
Sbjct: 1356 tgtcaaggtcaaggtcgctgatgcgaatgcgattgcccaggaggcctgcaagaacgagat 1415

                                                                        
Query: 494  gaaccttcgcgttgttgacgcaaacacgatcaccgttgcctttgatgagaccaccacctt 553
            ||||||||| |||||||| |||| |||||| ||||| ||||||||||||||||| |||||
Sbjct: 1416 gaaccttcgtgttgttgatgcaaccacgataaccgtggcctttgatgagaccacaacctt 1475

                                                                        
Query: 554  ggaggatgttgacaagctgttcaaggttttctctggtggcaagccagtgggcttcacagc 613
             |||||||| ||||||||||||||||| |||  ||||||||||||||||  |||||| ||
Sbjct: 1476 agaggatgtcgacaagctgttcaaggtgttcaatggtggcaagccagtgaacttcactgc 1535

                   
Query: 614  tgaatcc 620
            |||||||
Sbjct: 1536 tgaatcc 1542

---

>gb|AY495085.1| Oryza sativa (indica cultivar-group) glycine dehydrogenase P protein
            (GDC) mRNA, complete cds
          Length = 2679

 Score =  617 bits (311), Expect = e-173
 Identities = 533/607 (87%)
 Strand = Plus / Plus

                                                                        
Query: 14   gctcaccacgctgcgcccgccgggcgagattggcgccgacatcgccgtgggctccgcgca 73
            ||||||| ||||||||||||| |||||||| || |||||||||||||| |||||||||||
Sbjct: 930  gctcacctcgctgcgcccgcccggcgagatcggtgccgacatcgccgtcggctccgcgca 989

                                                                        
Query: 74   acgcttcggcgtgcccatggggtacggcggcccgcacgctgccttcctcgccacctccca 133
             || ||||||||||||||||||||||| ||||||||||| || ||||| ||||| |||||
Sbjct: 990  gcggttcggcgtgcccatggggtacggaggcccgcacgccgcgttcctggccacttccca 1049

                                                                        
Query: 134  ggagtacaagaggctgatgcccggccgcatcatcggtgtgagcgtcgactccagcggcaa 193
            |||||||||| | || ||||||||||| |||||||| ||||||||||| |||||||||||
Sbjct: 1050 ggagtacaagcgcctcatgcccggccgtatcatcggcgtgagcgtcgattccagcggcaa 1109

                                                                        
Query: 194  gcccgcgctccgcatggcaatgcagaccagggagcagcacatccggcgagacaaggccac 253
            |||||||||||| ||||| ||||||||| |||||||||||||||| || |||||||||||
Sbjct: 1110 gcccgcgctccggatggcgatgcagacccgggagcagcacatccgccgcgacaaggccac 1169

                                                                        
Query: 254  cagcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtcta 313
            ||||||||||||||| || ||||| ||||||||||||||||| ||||||||||| |||||
Sbjct: 1170 cagcaacatctgcactgcccaggccttgctcgccaacatggcagcgatgtatgctgtcta 1229

                                                                        
Query: 314  ccatggtccggctggcctgaaggcgatcgccgaccgtgtccatggactggctggtacttt 373
            ||||||||| |  || || ||||| || ||||||||||| || || ||||||||||| ||
Sbjct: 1230 ccatggtcccgaggggctaaaggcaattgccgaccgtgtacacggcctggctggtacctt 1289

                                                                        
Query: 374  cgcccatggtttgaagaagctcgggacagtgacagtgcaggagctgccctactttgacac 433
             ||||||||  ||||||||||||| |||||||| |||||||| ||||| | |||||||||
Sbjct: 1290 tgcccatggactgaagaagctcggaacagtgactgtgcaggaactgccgttctttgacac 1349

                                                                        
Query: 434  ggtcaagatcacttgcgccgatgctaatgccattgctgaggaggcccgcaaaaacgagat 493
             |||||| |||    ||| ||||| ||||| |||||  |||||||| |||| ||||||||
Sbjct: 1350 tgtcaaggtcaaggacgctgatgcgaatgcgattgcccaggaggcctgcaagaacgagat 1409

                                                                        
Query: 494  gaaccttcgcgttgttgacgcaaacacgatcaccgttgcctttgatgagaccaccacctt 553
            ||||||||| |||||||| |||| |||||| ||||| ||||||||||||||||| |||||
Sbjct: 1410 gaaccttcgtgttgttgatgcaaccacgataaccgtggcctttgatgagaccacaacctt 1469

                                                                        
Query: 554  ggaggatgttgacaagctgttcaaggttttctctggtggcaagccagtgggcttcacagc 613
             |||||||| ||||||||||||||||| |||  ||||||||||||||||  |||||| ||
Sbjct: 1470 agaggatgtcgacaagctgttcaaggtgttcaatggtggcaagccagtgaacttcactgc 1529

                   
Query: 614  tgaatcc 620
            |||||||
Sbjct: 1530 tgaatcc 1536

---

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score =  339 bits (171), Expect = 7e-90
 Identities = 234/255 (91%)
 Strand = Plus / Minus

                                                                            
Query: 14       gctcaccacgctgcgcccgccgggcgagattggcgccgacatcgccgtgggctccgcgca 73
                ||||||| ||||||||||||| |||||||| || |||||||||||||| |||||||||||
Sbjct: 24021324 gctcacctcgctgcgcccgcccggcgagatcggtgccgacatcgccgtcggctccgcgca 24021265

                                                                            
Query: 74       acgcttcggcgtgcccatggggtacggcggcccgcacgctgccttcctcgccacctccca 133
                 || ||||||||||||||||||||||||||||||||||| || ||||||||||| |||||
Sbjct: 24021264 gcggttcggcgtgcccatggggtacggcggcccgcacgccgcgttcctcgccacgtccca 24021205

                                                                            
Query: 134      ggagtacaagaggctgatgcccggccgcatcatcggtgtgagcgtcgactccagcggcaa 193
                |||||||||| | || |||||||||||||||||||| || |||||||| |||||||||||
Sbjct: 24021204 ggagtacaagcgcctcatgcccggccgcatcatcggcgtcagcgtcgattccagcggcaa 24021145

                                                                            
Query: 194      gcccgcgctccgcatggcaatgcagaccagggagcagcacatccggcgagacaaggccac 253
                |||||||||||| ||||| ||||||||| |||||||||||||||| || |||||||||||
Sbjct: 24021144 gcccgcgctccggatggcgatgcagacccgggagcagcacatccgccgcgacaaggccac 24021085

                               
Query: 254      cagcaacatctgcac 268
                |||||||||||||||
Sbjct: 24021084 cagcaacatctgcac 24021070



 Score =  198 bits (100), Expect = 2e-47
 Identities = 211/248 (85%)
 Strand = Plus / Minus

                                                                            
Query: 274      aggcgttgctcgccaacatggcggcgatgtatgccgtctaccatggtccggctggcctga 333
                |||| ||||||||||||||||| ||||||||||| |||||||||||||| |  || || |
Sbjct: 24020954 aggccttgctcgccaacatggcagcgatgtatgctgtctaccatggtcccgaggggctaa 24020895

                                                                            
Query: 334      aggcgatcgccgaccgtgtccatggactggctggtactttcgcccatggtttgaagaagc 393
                |||| || ||||||||||| ||||||||||||||||| || ||||| || ||||||||||
Sbjct: 24020894 aggcaattgccgaccgtgtacatggactggctggtacatttgcccaaggattgaagaagc 24020835

                                                                            
Query: 394      tcgggacagtgacagtgcaggagctgccctactttgacacggtcaagatcacttgcgccg 453
                |||| |||||||| |||||||||||||||| ||| ||||| |||||| |||    ||| |
Sbjct: 24020834 tcggaacagtgacggtgcaggagctgcccttcttcgacactgtcaaggtcaaggtcgctg 24020775

                                                                            
Query: 454      atgctaatgccattgctgaggaggcccgcaaaaacgagatgaaccttcgcgttgttgacg 513
                | || ||||| |||||  |||||||| |||| ||||||||||||||||| || ||||| |
Sbjct: 24020774 acgcgaatgcgattgcccaggaggcctgcaagaacgagatgaaccttcgtgtcgttgatg 24020715

                        
Query: 514      caaacacg 521
                ||| ||||
Sbjct: 24020714 caaccacg 24020707



 Score =  113 bits (57), Expect = 7e-22
 Identities = 72/77 (93%)
 Strand = Plus / Minus

                                                                            
Query: 525      accgttgcctttgatgagaccaccaccttggaggatgttgacaagctgttcaaggttttc 584
                ||||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||
Sbjct: 24020607 accgttgcctttgatgagaccacaaccttggaggatgtcgacaagctgttcaaggtgttc 24020548

                                 
Query: 585      tctggtggcaagccagt 601
                  |||||||||||||||
Sbjct: 24020547 aatggtggcaagccagt 24020531

---

>dbj|AP003626.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0429G06
          Length = 158321

 Score =  339 bits (171), Expect = 7e-90
 Identities = 234/255 (91%)
 Strand = Plus / Minus

                                                                         
Query: 14    gctcaccacgctgcgcccgccgggcgagattggcgccgacatcgccgtgggctccgcgca 73
             ||||||| ||||||||||||| |||||||| || |||||||||||||| |||||||||||
Sbjct: 31017 gctcacctcgctgcgcccgcccggcgagatcggtgccgacatcgccgtcggctccgcgca 30958

                                                                         
Query: 74    acgcttcggcgtgcccatggggtacggcggcccgcacgctgccttcctcgccacctccca 133
              || ||||||||||||||||||||||||||||||||||| || ||||||||||| |||||
Sbjct: 30957 gcggttcggcgtgcccatggggtacggcggcccgcacgccgcgttcctcgccacgtccca 30898

                                                                         
Query: 134   ggagtacaagaggctgatgcccggccgcatcatcggtgtgagcgtcgactccagcggcaa 193
             |||||||||| | || |||||||||||||||||||| || |||||||| |||||||||||
Sbjct: 30897 ggagtacaagcgcctcatgcccggccgcatcatcggcgtcagcgtcgattccagcggcaa 30838

                                                                         
Query: 194   gcccgcgctccgcatggcaatgcagaccagggagcagcacatccggcgagacaaggccac 253
             |||||||||||| ||||| ||||||||| |||||||||||||||| || |||||||||||
Sbjct: 30837 gcccgcgctccggatggcgatgcagacccgggagcagcacatccgccgcgacaaggccac 30778

                            
Query: 254   cagcaacatctgcac 268
             |||||||||||||||
Sbjct: 30777 cagcaacatctgcac 30763



 Score =  198 bits (100), Expect = 2e-47
 Identities = 211/248 (85%)
 Strand = Plus / Minus

                                                                         
Query: 274   aggcgttgctcgccaacatggcggcgatgtatgccgtctaccatggtccggctggcctga 333
             |||| ||||||||||||||||| ||||||||||| |||||||||||||| |  || || |
Sbjct: 30647 aggccttgctcgccaacatggcagcgatgtatgctgtctaccatggtcccgaggggctaa 30588

                                                                         
Query: 334   aggcgatcgccgaccgtgtccatggactggctggtactttcgcccatggtttgaagaagc 393
             |||| || ||||||||||| ||||||||||||||||| || ||||| || ||||||||||
Sbjct: 30587 aggcaattgccgaccgtgtacatggactggctggtacatttgcccaaggattgaagaagc 30528

                                                                         
Query: 394   tcgggacagtgacagtgcaggagctgccctactttgacacggtcaagatcacttgcgccg 453
             |||| |||||||| |||||||||||||||| ||| ||||| |||||| |||    ||| |
Sbjct: 30527 tcggaacagtgacggtgcaggagctgcccttcttcgacactgtcaaggtcaaggtcgctg 30468

                                                                         
Query: 454   atgctaatgccattgctgaggaggcccgcaaaaacgagatgaaccttcgcgttgttgacg 513
             | || ||||| |||||  |||||||| |||| ||||||||||||||||| || ||||| |
Sbjct: 30467 acgcgaatgcgattgcccaggaggcctgcaagaacgagatgaaccttcgtgtcgttgatg 30408

                     
Query: 514   caaacacg 521
             ||| ||||
Sbjct: 30407 caaccacg 30400



 Score =  113 bits (57), Expect = 7e-22
 Identities = 72/77 (93%)
 Strand = Plus / Minus

                                                                         
Query: 525   accgttgcctttgatgagaccaccaccttggaggatgttgacaagctgttcaaggttttc 584
             ||||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||
Sbjct: 30300 accgttgcctttgatgagaccacaaccttggaggatgtcgacaagctgttcaaggtgttc 30241

                              
Query: 585   tctggtggcaagccagt 601
               |||||||||||||||
Sbjct: 30240 aatggtggcaagccagt 30224

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  331 bits (167), Expect = 2e-87
 Identities = 233/255 (91%)
 Strand = Plus / Plus

                                                                            
Query: 14       gctcaccacgctgcgcccgccgggcgagattggcgccgacatcgccgtgggctccgcgca 73
                ||||||| ||||||||||||| || ||||| ||||||||||||||||| |||||||||||
Sbjct: 29554644 gctcacctcgctgcgcccgcccggtgagatcggcgccgacatcgccgtcggctccgcgca 29554703

                                                                            
Query: 74       acgcttcggcgtgcccatggggtacggcggcccgcacgctgccttcctcgccacctccca 133
                 || ||||||||||||||||||||||| ||||||||||| || ||||||||||| |||||
Sbjct: 29554704 gcggttcggcgtgcccatggggtacggaggcccgcacgccgcgttcctcgccacttccca 29554763

                                                                            
Query: 134      ggagtacaagaggctgatgcccggccgcatcatcggtgtgagcgtcgactccagcggcaa 193
                |||||||||| | || ||||||||||| |||||||| ||||||||||| |||||||||||
Sbjct: 29554764 ggagtacaagcgcctcatgcccggccgtatcatcggcgtgagcgtcgattccagcggcaa 29554823

                                                                            
Query: 194      gcccgcgctccgcatggcaatgcagaccagggagcagcacatccggcgagacaaggccac 253
                |||||||||||| ||||| ||||||||| |||||||||||||||| || |||||||||||
Sbjct: 29554824 gcccgcgctccggatggcgatgcagacccgggagcagcacatccgccgcgacaaggccac 29554883

                               
Query: 254      cagcaacatctgcac 268
                |||||||||||||||
Sbjct: 29554884 cagcaacatctgcac 29554898



 Score =  190 bits (96), Expect = 4e-45
 Identities = 210/248 (84%)
 Strand = Plus / Plus

                                                                            
Query: 274      aggcgttgctcgccaacatggcggcgatgtatgccgtctaccatggtccggctggcctga 333
                |||| ||||||||||||||||| ||||||||||| |||||||||||||| |  || || |
Sbjct: 29555049 aggccttgctcgccaacatggcagcgatgtatgctgtctaccatggtcccgaggggctaa 29555108

                                                                            
Query: 334      aggcgatcgccgaccgtgtccatggactggctggtactttcgcccatggtttgaagaagc 393
                |||| || ||||||||||| || || ||||||||||| || ||||||||  |||||||||
Sbjct: 29555109 aggcaattgccgaccgtgtacacggcctggctggtacctttgcccatggactgaagaagc 29555168

                                                                            
Query: 394      tcgggacagtgacagtgcaggagctgccctactttgacacggtcaagatcacttgcgccg 453
                |||| |||||||| |||||||| ||||| | ||||||||| |||||| |||    ||| |
Sbjct: 29555169 tcggaacagtgactgtgcaggaactgccgttctttgacactgtcaaggtcaaggtcgctg 29555228

                                                                            
Query: 454      atgctaatgccattgctgaggaggcccgcaaaaacgagatgaaccttcgcgttgttgacg 513
                |||| ||||| |||||  |||||||| |||| ||||||||||||||||| |||||||| |
Sbjct: 29555229 atgcgaatgcgattgcccaggaggcctgcaagaacgagatgaaccttcgtgttgttgatg 29555288

                        
Query: 514      caaacacg 521
                ||| ||||
Sbjct: 29555289 caaccacg 29555296



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 70/77 (90%)
 Strand = Plus / Plus

                                                                            
Query: 525      accgttgcctttgatgagaccaccaccttggaggatgttgacaagctgttcaaggttttc 584
                ||||| ||||||||||||||||| ||||| |||||||| ||||||||||||||||| |||
Sbjct: 29555390 accgtggcctttgatgagaccacaaccttagaggatgtcgacaagctgttcaaggtgttc 29555449

                                 
Query: 585      tctggtggcaagccagt 601
                  |||||||||||||||
Sbjct: 29555450 aatggtggcaagccagt 29555466

---

>dbj|AP003410.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:B1142C05
          Length = 151457

 Score =  331 bits (167), Expect = 2e-87
 Identities = 233/255 (91%)
 Strand = Plus / Plus

                                                                         
Query: 14    gctcaccacgctgcgcccgccgggcgagattggcgccgacatcgccgtgggctccgcgca 73
             ||||||| ||||||||||||| || ||||| ||||||||||||||||| |||||||||||
Sbjct: 24464 gctcacctcgctgcgcccgcccggtgagatcggcgccgacatcgccgtcggctccgcgca 24523

                                                                         
Query: 74    acgcttcggcgtgcccatggggtacggcggcccgcacgctgccttcctcgccacctccca 133
              || ||||||||||||||||||||||| ||||||||||| || ||||||||||| |||||
Sbjct: 24524 gcggttcggcgtgcccatggggtacggaggcccgcacgccgcgttcctcgccacttccca 24583

                                                                         
Query: 134   ggagtacaagaggctgatgcccggccgcatcatcggtgtgagcgtcgactccagcggcaa 193
             |||||||||| | || ||||||||||| |||||||| ||||||||||| |||||||||||
Sbjct: 24584 ggagtacaagcgcctcatgcccggccgtatcatcggcgtgagcgtcgattccagcggcaa 24643

                                                                         
Query: 194   gcccgcgctccgcatggcaatgcagaccagggagcagcacatccggcgagacaaggccac 253
             |||||||||||| ||||| ||||||||| |||||||||||||||| || |||||||||||
Sbjct: 24644 gcccgcgctccggatggcgatgcagacccgggagcagcacatccgccgcgacaaggccac 24703

                            
Query: 254   cagcaacatctgcac 268
             |||||||||||||||
Sbjct: 24704 cagcaacatctgcac 24718



 Score =  190 bits (96), Expect = 4e-45
 Identities = 210/248 (84%)
 Strand = Plus / Plus

                                                                         
Query: 274   aggcgttgctcgccaacatggcggcgatgtatgccgtctaccatggtccggctggcctga 333
             |||| ||||||||||||||||| ||||||||||| |||||||||||||| |  || || |
Sbjct: 24869 aggccttgctcgccaacatggcagcgatgtatgctgtctaccatggtcccgaggggctaa 24928

                                                                         
Query: 334   aggcgatcgccgaccgtgtccatggactggctggtactttcgcccatggtttgaagaagc 393
             |||| || ||||||||||| || || ||||||||||| || ||||||||  |||||||||
Sbjct: 24929 aggcaattgccgaccgtgtacacggcctggctggtacctttgcccatggactgaagaagc 24988

                                                                         
Query: 394   tcgggacagtgacagtgcaggagctgccctactttgacacggtcaagatcacttgcgccg 453
             |||| |||||||| |||||||| ||||| | ||||||||| |||||| |||    ||| |
Sbjct: 24989 tcggaacagtgactgtgcaggaactgccgttctttgacactgtcaaggtcaaggtcgctg 25048

                                                                         
Query: 454   atgctaatgccattgctgaggaggcccgcaaaaacgagatgaaccttcgcgttgttgacg 513
             |||| ||||| |||||  |||||||| |||| ||||||||||||||||| |||||||| |
Sbjct: 25049 atgcgaatgcgattgcccaggaggcctgcaagaacgagatgaaccttcgtgttgttgatg 25108

                     
Query: 514   caaacacg 521
             ||| ||||
Sbjct: 25109 caaccacg 25116



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 70/77 (90%)
 Strand = Plus / Plus

                                                                         
Query: 525   accgttgcctttgatgagaccaccaccttggaggatgttgacaagctgttcaaggttttc 584
             ||||| ||||||||||||||||| ||||| |||||||| ||||||||||||||||| |||
Sbjct: 25210 accgtggcctttgatgagaccacaaccttagaggatgtcgacaagctgttcaaggtgttc 25269

                              
Query: 585   tctggtggcaagccagt 601
               |||||||||||||||
Sbjct: 25270 aatggtggcaagccagt 25286

---

>dbj|AP002901.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0456F08
          Length = 156850

 Score =  331 bits (167), Expect = 2e-87
 Identities = 233/255 (91%)
 Strand = Plus / Plus

                                                                          
Query: 14     gctcaccacgctgcgcccgccgggcgagattggcgccgacatcgccgtgggctccgcgca 73
              ||||||| ||||||||||||| || ||||| ||||||||||||||||| |||||||||||
Sbjct: 120918 gctcacctcgctgcgcccgcccggtgagatcggcgccgacatcgccgtcggctccgcgca 120977

                                                                          
Query: 74     acgcttcggcgtgcccatggggtacggcggcccgcacgctgccttcctcgccacctccca 133
               || ||||||||||||||||||||||| ||||||||||| || ||||||||||| |||||
Sbjct: 120978 gcggttcggcgtgcccatggggtacggaggcccgcacgccgcgttcctcgccacttccca 121037

                                                                          
Query: 134    ggagtacaagaggctgatgcccggccgcatcatcggtgtgagcgtcgactccagcggcaa 193
              |||||||||| | || ||||||||||| |||||||| ||||||||||| |||||||||||
Sbjct: 121038 ggagtacaagcgcctcatgcccggccgtatcatcggcgtgagcgtcgattccagcggcaa 121097

                                                                          
Query: 194    gcccgcgctccgcatggcaatgcagaccagggagcagcacatccggcgagacaaggccac 253
              |||||||||||| ||||| ||||||||| |||||||||||||||| || |||||||||||
Sbjct: 121098 gcccgcgctccggatggcgatgcagacccgggagcagcacatccgccgcgacaaggccac 121157

                             
Query: 254    cagcaacatctgcac 268
              |||||||||||||||
Sbjct: 121158 cagcaacatctgcac 121172



 Score =  190 bits (96), Expect = 4e-45
 Identities = 210/248 (84%)
 Strand = Plus / Plus

                                                                          
Query: 274    aggcgttgctcgccaacatggcggcgatgtatgccgtctaccatggtccggctggcctga 333
              |||| ||||||||||||||||| ||||||||||| |||||||||||||| |  || || |
Sbjct: 121323 aggccttgctcgccaacatggcagcgatgtatgctgtctaccatggtcccgaggggctaa 121382

                                                                          
Query: 334    aggcgatcgccgaccgtgtccatggactggctggtactttcgcccatggtttgaagaagc 393
              |||| || ||||||||||| || || ||||||||||| || ||||||||  |||||||||
Sbjct: 121383 aggcaattgccgaccgtgtacacggcctggctggtacctttgcccatggactgaagaagc 121442

                                                                          
Query: 394    tcgggacagtgacagtgcaggagctgccctactttgacacggtcaagatcacttgcgccg 453
              |||| |||||||| |||||||| ||||| | ||||||||| |||||| |||    ||| |
Sbjct: 121443 tcggaacagtgactgtgcaggaactgccgttctttgacactgtcaaggtcaaggtcgctg 121502

                                                                          
Query: 454    atgctaatgccattgctgaggaggcccgcaaaaacgagatgaaccttcgcgttgttgacg 513
              |||| ||||| |||||  |||||||| |||| ||||||||||||||||| |||||||| |
Sbjct: 121503 atgcgaatgcgattgcccaggaggcctgcaagaacgagatgaaccttcgtgttgttgatg 121562

                      
Query: 514    caaacacg 521
              ||| ||||
Sbjct: 121563 caaccacg 121570



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 70/77 (90%)
 Strand = Plus / Plus

                                                                          
Query: 525    accgttgcctttgatgagaccaccaccttggaggatgttgacaagctgttcaaggttttc 584
              ||||| ||||||||||||||||| ||||| |||||||| ||||||||||||||||| |||
Sbjct: 121664 accgtggcctttgatgagaccacaaccttagaggatgtcgacaagctgttcaaggtgttc 121723

                               
Query: 585    tctggtggcaagccagt 601
                |||||||||||||||
Sbjct: 121724 aatggtggcaagccagt 121740

---

>gb|AF439729.1|AF439729 Zea mays glycine cleavage complex P-protein mRNA, partial cds
          Length = 1109

 Score =  289 bits (146), Expect = 6e-75
 Identities = 317/374 (84%)
 Strand = Plus / Plus

                                                                       
Query: 207 atggcaatgcagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgc 266
           ||||| ||||||||  |||| ||||||||||| || ||||||||||||||||||||||||
Sbjct: 1   atggcgatgcagacgcgggaacagcacatccgtcgcgacaaggccaccagcaacatctgc 60

                                                                       
Query: 267 accgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatggtccggct 326
           || || ||||| ||||||||||||||||| || ||||| || ||||||||||| || || 
Sbjct: 61  actgcccaggccttgctcgccaacatggctgccatgtacgctgtctaccatggcccagcg 120

                                                                       
Query: 327 ggcctgaaggcgatcgccgaccgtgtccatggactggctggtactttcgcccatggtttg 386
           || |||||||||||||| ||||| || ||||| |||||||| || |||||||| ||  | 
Sbjct: 121 gggctgaaggcgatcgctgaccgggttcatggcctggctggcaccttcgcccacggcctc 180

                                                                       
Query: 387 aagaagctcgggacagtgacagtgcaggagctgccctactttgacacggtcaagatcact 446
           |||||||||||||||||||| |||||||| ||||||| ||| |||||||||| | |||| 
Sbjct: 181 aagaagctcgggacagtgacggtgcaggacctgcccttcttcgacacggtcagggtcacg 240

                                                                       
Query: 447 tgcgccgatgctaatgccattgctgaggaggcccgcaaaaacgagatgaaccttcgcgtt 506
           ||| |||||||   ||| || ||  |||| ||   ||| ||||||||||||||||| || 
Sbjct: 241 tgctccgatgcacgtgcaatcgccaaggaagctgtcaagaacgagatgaaccttcgggtc 300

                                                                       
Query: 507 gttgacgcaaacacgatcaccgttgcctttgatgagaccaccaccttggaggatgttgac 566
           || || || ||||||||||| || || |||||||||||| ||||| ||||||||||||||
Sbjct: 301 gtcgatgccaacacgatcactgtagcatttgatgagacctccaccctggaggatgttgac 360

                         
Query: 567 aagctgttcaaggt 580
           ||||||||||||||
Sbjct: 361 aagctgttcaaggt 374

---

>gb|AY103920.1| Zea mays PCO082698 mRNA sequence
          Length = 2092

 Score =  109 bits (55), Expect = 1e-20
 Identities = 85/95 (89%)
 Strand = Plus / Plus

                                                                       
Query: 486 aacgagatgaaccttcgcgttgttgacgcaaacacgatcaccgttgcctttgatgagacc 545
           ||||||||||||||||| || || || || ||||||||||| || || ||||||||||||
Sbjct: 58  aacgagatgaaccttcgggtcgtcgatgccaacacgatcactgtagcatttgatgagacc 117

                                              
Query: 546 accaccttggaggatgttgacaagctgttcaaggt 580
            ||||| ||||||||||||||||||||||||||||
Sbjct: 118 tccaccctggaggatgttgacaagctgttcaaggt 152

---

>emb|AL939108.1|SCO939108 Streptomyces coelicolor A3(2) complete genome; segment 5/29
          Length = 339650

 Score =  101 bits (51), Expect = 3e-18
 Identities = 90/103 (87%)
 Strand = Plus / Minus

                                                                          
Query: 214    tgcagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgc 273
              |||||||| | |||||||||||||| || || ||||||||||||||||||||||||||||
Sbjct: 254295 tgcagacccgcgagcagcacatccgccgcgagaaggccaccagcaacatctgcaccgcgc 254236

                                                         
Query: 274    aggcgttgctcgccaacatggcggcgatgtatgccgtctacca 316
              ||| | ||||||||  |||||| |  ||||| |||||||||||
Sbjct: 254235 aggtgctgctcgccgtcatggccggcatgtacgccgtctacca 254193



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 69/82 (84%)
 Strand = Plus / Minus

                                                                          
Query: 31     cgccgggcgagattggcgccgacatcgccgtgggctccgcgcaacgcttcggcgtgccca 90
              |||| |||||| | ||||| |||||||| |||||| || | || |||||||||||||| |
Sbjct: 254478 cgcccggcgagctgggcgcggacatcgcggtgggcaccacccagcgcttcggcgtgccga 254419

                                    
Query: 91     tggggtacggcggcccgcacgc 112
              |||| | |||||| ||||||||
Sbjct: 254418 tgggcttcggcggaccgcacgc 254397

---

>ref|XM_314216.2| Anopheles gambiae str. PEST ENSANGP00000014378 (ENSANGG00000011889),
            partial mRNA
          Length = 2895

 Score =  101 bits (51), Expect = 3e-18
 Identities = 84/95 (88%)
 Strand = Plus / Plus

                                                                        
Query: 228  cagcacatccggcgagacaaggccaccagcaacatctgcaccgcgcaggcgttgctcgcc 287
            |||||||||||||| || ||||| || ||||||||||||||||| |||||| ||||||||
Sbjct: 967  cagcacatccggcgggataaggcgacgagcaacatctgcaccgcccaggcgctgctcgcc 1026

                                               
Query: 288  aacatggcggcgatgtatgccgtctaccatggtcc 322
            |||||||| |||||||| ||  ||||||| |||||
Sbjct: 1027 aacatggccgcgatgtacgcgatctaccacggtcc 1061

---

>gb|CP000359.1| Deinococcus geothermalis DSM 11300, complete genome
          Length = 2467205

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 94/109 (86%)
 Strand = Plus / Plus

                                                                           
Query: 187     gcggcaagcccgcgctccgcatggcaatgcagaccagggagcagcacatccggcgagaca 246
               |||||||| |||| || |||||||| ||||||||| | |||||||||||||| || || |
Sbjct: 2004512 gcggcaagaccgctctgcgcatggcgatgcagacccgtgagcagcacatccgccgcgaga 2004571

                                                                
Query: 247     aggccaccagcaacatctgcaccgcgcaggcgttgctcgccaacatggc 295
               |||||||||| |||||||| |||||||||||  |||| || ||||||||
Sbjct: 2004572 aggccaccagtaacatctgtaccgcgcaggccctgctggcgaacatggc 2004620

---

>gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete genome
          Length = 2584158

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                           
Query: 225     gagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgcaggcgttgctc 284
               |||||||||||||| || || |||||||||   ||||||||||||||||||| | | |||
Sbjct: 1711672 gagcagcacatccgccgggagaaggccacctcgaacatctgcaccgcgcaggtgctcctc 1711613

                                                               
Query: 285     gccaacatggcggcgatgtatgccgtctaccatggtccggctggcctg 332
               |||  |||||| |||||||| ||||||||||| |||||||| ||||||
Sbjct: 1711612 gccgtcatggccgcgatgtacgccgtctaccacggtccggcgggcctg 1711565

---

>ref|XM_741470.1| Aspergillus fumigatus Af293 glycine dehydrogenase (Afu4g03760)
            partial mRNA
          Length = 3183

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 109/130 (83%)
 Strand = Plus / Plus

                                                                        
Query: 214  tgcagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgc 273
            |||||||| | || ||||||||||| || || |||||||| |||||||| |||||||| |
Sbjct: 1235 tgcagacccgcgaacagcacatccgtcgcgaaaaggccactagcaacatttgcaccgctc 1294

                                                                        
Query: 274  aggcgttgctcgccaacatggcggcgatgtatgccgtctaccatggtccggctggcctga 333
            ||||  |||| |||||||||   || ||||||||||| ||||| |||||||| ||||| |
Sbjct: 1295 aggctctgcttgccaacatgagtgccatgtatgccgtttaccacggtccggccggcctca 1354

                      
Query: 334  aggcgatcgc 343
            || |||||||
Sbjct: 1355 agtcgatcgc 1364

---

>emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,complete sequence
          Length = 5888780

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 75/85 (88%)
 Strand = Plus / Plus

                                                                           
Query: 208     tggcaatgcagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgca 267
               |||| ||||||||| | |||||||||||||| || || ||||||||||||||||||||||
Sbjct: 4747218 tggccatgcagacccgcgagcagcacatccgccgcgagaaggccaccagcaacatctgca 4747277

                                        
Query: 268     ccgcgcaggcgttgctcgccaacat 292
               |||| |||| | |||| ||||||||
Sbjct: 4747278 ccgcccaggtgctgctggccaacat 4747302



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                            
Query: 75      cgcttcggcgtgcccatggggtacggcgg 103
               |||||||||||||||||||| || |||||
Sbjct: 5628515 cgcttcggcgtgcccatgggctatggcgg 5628487



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 150     atgcccggccgcatcatcggtgtg 173
               |||||||| |||||||||||||||
Sbjct: 5628440 atgcccgggcgcatcatcggtgtg 5628417

---

>gb|AE015451.1| Pseudomonas putida KT2440 complete genome
          Length = 6181863

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 75/85 (88%)
 Strand = Plus / Minus

                                                                           
Query: 208     tggcaatgcagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgca 267
               |||| ||||||||| | |||||||||||||| || || ||||||||||||||||||||||
Sbjct: 1128611 tggccatgcagacccgcgagcagcacatccgccgcgaaaaggccaccagcaacatctgca 1128552

                                        
Query: 268     ccgcgcaggcgttgctcgccaacat 292
               |||| |||| | |||| ||||||||
Sbjct: 1128551 ccgcccaggtgctgctggccaacat 1128527

---

>gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete sequence
          Length = 2648638

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 78/89 (87%)
 Strand = Plus / Minus

                                                                           
Query: 207     atggcaatgcagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgc 266
               ||||| ||||||||| | |||||||||||||| || || |||||||||  ||||||||||
Sbjct: 1836588 atggcgatgcagacccgcgagcagcacatccgccgcgagaaggccacctccaacatctgc 1836529

                                            
Query: 267     accgcgcaggcgttgctcgccaacatggc 295
               |||||||||||| |||| || ||||||||
Sbjct: 1836528 accgcgcaggcgctgctggcgaacatggc 1836500



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                           
Query: 45      ggcgccgacatcgccgtgggctccgcgcaacgcttcggcgtgcccatggggtacggcggc 104
               |||||||||||||  ||||||  ||| || |||||||||||||| ||||| | |||||| 
Sbjct: 1836750 ggcgccgacatcgtggtgggcagcgctcagcgcttcggcgtgccgatgggcttcggcggg 1836691

                                
Query: 105     ccgcacgctgccttcct 121
               |||||||| || |||||
Sbjct: 1836690 ccgcacgcggcattcct 1836674

---

>gb|CP000240.1| Synechococcus sp. JA-2-3B'a(2-13), complete genome
          Length = 3046682

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 71/80 (88%)
 Strand = Plus / Plus

                                                                          
Query: 189    ggcaagcccgcgctccgcatggcaatgcagaccagggagcagcacatccggcgagacaag 248
              |||||||| || || ||| ||||  |||||||| | ||||||||||||||||| ||||||
Sbjct: 150928 ggcaagccagccctgcgcttggcgttgcagacccgcgagcagcacatccggcgggacaag 150987

                                  
Query: 249    gccaccagcaacatctgcac 268
              ||||||||||||||||||||
Sbjct: 150988 gccaccagcaacatctgcac 151007

---

>ref|XM_219785.3| PREDICTED: Rattus norvegicus glycine dehydrogenase (decarboxylating;
            glycine decarboxylase, glycine cleavage system protein P)
            (predicted) (Gldc_predicted), mRNA
          Length = 3087

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 89/104 (85%)
 Strand = Plus / Plus

                                                                        
Query: 216  cagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgcag 275
            |||||||| || || ||||||||| ||||||| ||||||||||||||||||||||| |||
Sbjct: 1120 cagaccagagaacaacacatccggagagacaaagccaccagcaacatctgcaccgctcag 1179

                                                        
Query: 276  gcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 319
            ||  || | ||||||||||| || |||| |||| | ||||||||
Sbjct: 1180 gccctgttagccaacatggccgccatgtttgccatttaccatgg 1223

---

>emb|BX572101.1| Prochlorococcus marinus MIT9313 complete genome; segment 7/7
          Length = 318136

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 58/63 (92%)
 Strand = Plus / Minus

                                                                          
Query: 214    tgcagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgc 273
              |||||||| ||||||| |||||||| |||||||||||||||||||| |||||||| ||||
Sbjct: 203287 tgcagacccgggagcaacacatccgccgagacaaggccaccagcaatatctgcacggcgc 203228

                 
Query: 274    agg 276
              |||
Sbjct: 203227 agg 203225

---

>gb|CP000239.1| Synechococcus sp. JA-3-3Ab, complete genome
          Length = 2932766

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 58/63 (92%)
 Strand = Plus / Plus

                                                                           
Query: 214     tgcagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgc 273
               |||| ||| |||||||||||||||| || ||||||||||||||||||||||||||||| |
Sbjct: 2114520 tgcaaacccgggagcagcacatccgccgcgacaaggccaccagcaacatctgcaccgccc 2114579

                  
Query: 274     agg 276
               |||
Sbjct: 2114580 agg 2114582

---

>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome
          Length = 4829781

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 58/63 (92%)
 Strand = Plus / Plus

                                                                           
Query: 214     tgcagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgc 273
               |||||||| | |||||||||||||| || |||||||| ||||||||||||||||||||||
Sbjct: 1694589 tgcagacccgcgagcagcacatccgccgcgacaaggcgaccagcaacatctgcaccgcgc 1694648

                  
Query: 274     agg 276
               |||
Sbjct: 1694649 agg 1694651



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                           
Query: 29      cccgccgggcgagattggcgccgacatcgccgtgggctccgcgcaacgcttcggcgtgcc 88
               |||||| |||||||| ||||||||| | ||| | ||| || | ||| | ||||| |||||
Sbjct: 1694404 cccgcccggcgagatcggcgccgacgtggccttcggcaccacccaaagattcggtgtgcc 1694463

                                       
Query: 89      catggggtacggcggcccgcacgc 112
                ||||| | |||||||||||||||
Sbjct: 1694464 aatgggattcggcggcccgcacgc 1694487

---

>gb|AE004672.1| Pseudomonas aeruginosa PAO1, section 233 of 529 of the complete
            genome
          Length = 10855

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 78/90 (86%)
 Strand = Plus / Minus

                                                                        
Query: 203  ccgcatggcaatgcagaccagggagcagcacatccggcgagacaaggccaccagcaacat 262
            |||| |||| ||||||||| | |||||||||||||| || || || ||||||||||||||
Sbjct: 2028 ccgcctggccatgcagacccgcgagcagcacatccgccgcgagaaagccaccagcaacat 1969

                                          
Query: 263  ctgcaccgcgcaggcgttgctcgccaacat 292
            ||||||||| |||| | |||| ||||||||
Sbjct: 1968 ctgcaccgcccaggtgctgctggccaacat 1939



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 73/89 (82%)
 Strand = Plus / Minus

                                                                        
Query: 29   cccgccgggcgagattggcgccgacatcgccgtgggctccgcgcaacgcttcggcgtgcc 88
            ||||||||||||| | ||||||||| | ||| | |||  ||| || ||||||||||||||
Sbjct: 2202 cccgccgggcgagttcggcgccgacgtggccatcggcagcgcccagcgcttcggcgtgcc 2143

                                         
Query: 89   catggggtacggcggcccgcacgctgcct 117
              | || | ||||||||||||||| ||||
Sbjct: 2142 gctcggcttcggcggcccgcacgcggcct 2114

---

>gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome
          Length = 3402093

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 65/73 (89%)
 Strand = Plus / Minus

                                                                           
Query: 45      ggcgccgacatcgccgtgggctccgcgcaacgcttcggcgtgcccatggggtacggcggc 104
               ||||||||||||||| | ||||||||||| |||||||||||||| ||||| || ||||| 
Sbjct: 1417419 ggcgccgacatcgccatcggctccgcgcagcgcttcggcgtgccgatgggctatggcggt 1417360

                            
Query: 105     ccgcacgctgcct 117
               |||||||| ||||
Sbjct: 1417359 ccgcacgccgcct 1417347



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 257     caacatctgcaccgcgcagg 276
               ||||||||||||||||||||
Sbjct: 1417207 caacatctgcaccgcgcagg 1417188

---

>gb|CP000319.1| Nitrobacter hamburgensis X14, complete genome
          Length = 4406967

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 65/73 (89%)
 Strand = Plus / Minus

                                                                           
Query: 45      ggcgccgacatcgccgtgggctccgcgcaacgcttcggcgtgcccatggggtacggcggc 104
               |||||||||||||| || || || |||||||||||||||||||| ||||| || ||||||
Sbjct: 1818307 ggcgccgacatcgcagttggatcggcgcaacgcttcggcgtgccgatgggctatggcggc 1818248

                            
Query: 105     ccgcacgctgcct 117
               |||||||| ||||
Sbjct: 1818247 ccgcacgcggcct 1818235



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 257     caacatctgcaccgcgcagg 276
               ||||||||||||||||||||
Sbjct: 1818095 caacatctgcaccgcgcagg 1818076

---

>emb|BX569695.1| Synechococcus sp. WH8102 complete genome; segment 7/7
          Length = 344615

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 56/61 (91%)
 Strand = Plus / Minus

                                                                          
Query: 208    tggcaatgcagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgca 267
              ||||| |||||||| | |||||||||||||| || |||||||||||||||||||||||||
Sbjct: 193488 tggcattgcagacccgtgagcagcacatccgccgcgacaaggccaccagcaacatctgca 193429

               
Query: 268    c 268
              |
Sbjct: 193428 c 193428

---

>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome
          Length = 7074893

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 77/89 (86%)
 Strand = Plus / Plus

                                                                           
Query: 188     cggcaagcccgcgctccgcatggcaatgcagaccagggagcagcacatccggcgagacaa 247
               ||||||||| || || ||| |||| ||||||||| | |||||||| ||||| || || ||
Sbjct: 5356595 cggcaagccggccctgcgcctggccatgcagacccgcgagcagcatatccgccgcgagaa 5356654

                                            
Query: 248     ggccaccagcaacatctgcaccgcgcagg 276
               |||||||||||||||||||||||| ||||
Sbjct: 5356655 ggccaccagcaacatctgcaccgcccagg 5356683



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                               
Query: 75      cgcttcggcgtgcccatggggtacggcggccc 106
               |||||||||||||||||||| |||||||||||
Sbjct: 6774842 cgcttcggcgtgcccatgggctacggcggccc 6774811

---

>emb|Z99770.1|STZ99770 Solanum tuberosum cv. Desire mRNA for P-protein
          Length = 3381

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 95/113 (84%)
 Strand = Plus / Plus

                                                                        
Query: 207  atggcaatgcagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgc 266
            |||||||||||||| ||||| || ||||||||  | |||||||| || || ||||| |||
Sbjct: 1182 atggcaatgcagactagggaacaacacatccgcagggacaaggctacgagtaacatttgc 1241

                                                                 
Query: 267  accgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 319
            || || ||||| ||||| ||||||||||| || |||||||| ||||| |||||
Sbjct: 1242 acagcacaggctttgcttgccaacatggctgccatgtatgctgtctatcatgg 1294

---

>ref|XM_755229.1| Ustilago maydis 521 hypothetical protein (UM04175.1) partial mRNA
          Length = 3240

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 79/92 (85%)
 Strand = Plus / Plus

                                                                        
Query: 225  gagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgcaggcgttgctc 284
            ||||||||||| || || || |||||||||  |||||||||||| || |||||| | |||
Sbjct: 1201 gagcagcacattcgccgtgagaaggccacctccaacatctgcactgcccaggcgcttctc 1260

                                            
Query: 285  gccaacatggcggcgatgtatgccgtctacca 316
            ||||||||| |||| ||||| |||||||||||
Sbjct: 1261 gccaacatgtcggccatgtacgccgtctacca 1292

---

>dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome
          Length = 4659019

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 85/100 (85%)
 Strand = Plus / Plus

                                                                          
Query: 225    gagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgcaggcgttgctc 284
              |||||||||||||| || ||||| ||||||||||||||||||||||| |||| | |||||
Sbjct: 252718 gagcagcacatccgccgcgacaaagccaccagcaacatctgcaccgcccaggtgctgctc 252777

                                                      
Query: 285    gccaacatggcggcgatgtatgccgtctaccatggtccgg 324
              ||    ||||| |  |||||||| |||||||| |||||||
Sbjct: 252778 gcggtgatggccggcatgtatgcggtctaccacggtccgg 252817



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 62/73 (84%)
 Strand = Plus / Plus

                                                                          
Query: 45     ggcgccgacatcgccgtgggctccgcgcaacgcttcggcgtgcccatggggtacggcggc 104
              |||||||||||||||||||||  | | || |||||||| ||||| ||||| |||||||| 
Sbjct: 252538 ggcgccgacatcgccgtgggcaacacccagcgcttcggggtgccgatgggctacggcggt 252597

                           
Query: 105    ccgcacgctgcct 117
              || ||||| ||||
Sbjct: 252598 ccccacgccgcct 252610

---

>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome
          Length = 7036071

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 61/68 (89%)
 Strand = Plus / Plus

                                                                          
Query: 228    cagcacatccggcgagacaaggccaccagcaacatctgcaccgcgcaggcgttgctcgcc 287
              ||||| ||||| || |||||||| |||  |||||||||||||||||||||| ||||||||
Sbjct: 710347 cagcatatccgccgcgacaaggcgacctccaacatctgcaccgcgcaggcgctgctcgcc 710406

                      
Query: 288    aacatggc 295
              ||||||||
Sbjct: 710407 aacatggc 710414



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 60/73 (82%)
 Strand = Plus / Plus

                                                                          
Query: 45     ggcgccgacatcgccgtgggctccgcgcaacgcttcggcgtgcccatggggtacggcggc 104
              ||||||||||||||||| ||  |   ||| ||||| |||||||| ||||| |  ||||||
Sbjct: 710164 ggcgccgacatcgccgtcgggccgatgcagcgctttggcgtgccgatgggctttggcggc 710223

                           
Query: 105    ccgcacgctgcct 117
              |||||||| ||||
Sbjct: 710224 ccgcacgccgcct 710236

---

>ref|NM_199554.1| Danio rerio zgc:66198 (zgc:66198), mRNA
          Length = 3391

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 76/89 (85%)
 Strand = Plus / Plus

                                                                        
Query: 216  cagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgcag 275
            |||||| | ||||||||||||||  ||||||| |||||||||||||||||||| || |||
Sbjct: 1199 cagacccgagagcagcacatccgcagagacaaagccaccagcaacatctgcacagctcag 1258

                                         
Query: 276  gcgttgctcgccaacatggcggcgatgta 304
            ||  | || ||||||||||| || |||||
Sbjct: 1259 gctcttcttgccaacatggctgccatgta 1287

---

>emb|BX572605.1| Rhodopseudomonas palustris CGA009 complete genome; segment 13/16
          Length = 349746

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 70/81 (86%)
 Strand = Plus / Plus

                                                                          
Query: 29     cccgccgggcgagattggcgccgacatcgccgtgggctccgcgcaacgcttcggcgtgcc 88
              ||||||||||||  | ||||||||||| ||  | ||||| ||||| ||||||||||||||
Sbjct: 163346 cccgccgggcgaactcggcgccgacattgcgatcggctcggcgcagcgcttcggcgtgcc 163405

                                   
Query: 89     catggggtacggcggcccgca 109
               |||||||| |||||||||||
Sbjct: 163406 gatggggtatggcggcccgca 163426

---

>emb|X59773.1|PSGDPP Pisum sativum mRNA for P protein, a part of glycine cleavage complex
          Length = 3404

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 85/101 (84%)
 Strand = Plus / Plus

                                                                        
Query: 207  atggcaatgcagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgc 266
            ||||| ||||| || ||||||||||| |||||  | |||||||||||||||||||| |||
Sbjct: 1283 atggctatgcaaactagggagcagcatatccgtagggacaaggccaccagcaacatttgc 1342

                                                     
Query: 267  accgcgcaggcgttgctcgccaacatggcggcgatgtatgc 307
            || || |||||  |||| || |||||||| || ||||||||
Sbjct: 1343 actgctcaggcactgcttgcaaacatggctgctatgtatgc 1383



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 72/84 (85%)
 Strand = Plus / Plus

                                                                        
Query: 515  aaacacgatcaccgttgcctttgatgagaccaccaccttggaggatgttgacaagctgtt 574
            |||||| ||||||| ||| ||||| || || ||||| || ||||||||||| ||||| ||
Sbjct: 1588 aaacactatcaccgctgcttttgacgaaacaaccacgttagaggatgttgataagctttt 1647

                                    
Query: 575  caaggttttctctggtggcaagcc 598
            ||| |||||| |||||||||||||
Sbjct: 1648 caaagttttcgctggtggcaagcc 1671

---

>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome
          Length = 5513844

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 76/89 (85%)
 Strand = Plus / Minus

                                                                           
Query: 31      cgccgggcgagattggcgccgacatcgccgtgggctccgcgcaacgcttcggcgtgccca 90
               ||||||||||  | ||||||||||||||  | || || ||||| |||||||||||||| |
Sbjct: 1701514 cgccgggcgatctcggcgccgacatcgcgatcggttcggcgcagcgcttcggcgtgccga 1701455

                                            
Query: 91      tggggtacggcggcccgcacgctgccttc 119
               |||| |||||||| |||||||| ||||||
Sbjct: 1701454 tgggctacggcgggccgcacgccgccttc 1701426



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                           
Query: 214     tgcagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgc 273
               |||||||| | |||||||||||||| || || |||||||||  |||||||||||||||||
Sbjct: 1701331 tgcagacccgcgagcagcacatccgccgcgagaaggccacctccaacatctgcaccgcgc 1701272

                  
Query: 274     agg 276
               |||
Sbjct: 1701271 agg 1701269

---

>gb|AE005996.1| Caulobacter crescentus CB15 section 322 of 359 of the complete genome
          Length = 11980

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 43/45 (95%)
 Strand = Plus / Minus

                                                          
Query: 225   gagcagcacatccggcgagacaaggccaccagcaacatctgcacc 269
             |||||||||||||| || |||||||||||||||||||||||||||
Sbjct: 10955 gagcagcacatccgccgcgacaaggccaccagcaacatctgcacc 10911



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                              
Query: 31    cgccgggcgagattggcgccgacatcgccgtgg 63
             |||| |||||||| |||||||||||||||||||
Sbjct: 11149 cgcccggcgagatgggcgccgacatcgccgtgg 11117

---

>gb|AE004934.1| Pseudomonas aeruginosa PAO1, section 495 of 529 of the complete
            genome
          Length = 12908

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 109/133 (81%)
 Strand = Plus / Minus

                                                                        
Query: 187  gcggcaagcccgcgctccgcatggcaatgcagaccagggagcagcacatccggcgagaca 246
            ||||||| || ||| | ||||||||  |||| ||| | |||||||||||||| || || |
Sbjct: 6395 gcggcaacccggcgttgcgcatggccctgcaaacccgcgagcagcacatccgtcgggaaa 6336

                                                                        
Query: 247  aggccaccagcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatg 306
            |||||| |   |||||||||||||| |||| | |||| |||||||| ||  || ||||||
Sbjct: 6335 aggccaactcgaacatctgcaccgcccaggtgctgctggccaacattgcttcgctgtatg 6276

                         
Query: 307  ccgtctaccatgg 319
            |||||||||||||
Sbjct: 6275 ccgtctaccatgg 6263

---

>gb|BC057478.1| Danio rerio zgc:66198, mRNA (cDNA clone MGC:66198 IMAGE:5913768),
            complete cds
          Length = 3391

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 76/89 (85%)
 Strand = Plus / Plus

                                                                        
Query: 216  cagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgcag 275
            |||||| | ||||||||||||||  ||||||| |||||||||||||||||||| || |||
Sbjct: 1199 cagacccgagagcagcacatccgcagagacaaagccaccagcaacatctgcacagctcag 1258

                                         
Query: 276  gcgttgctcgccaacatggcggcgatgta 304
            ||  | || ||||||||||| || |||||
Sbjct: 1259 gctcttcttgccaacatggctgccatgta 1287

---

>gb|CP000110.1| Synechococcus sp. CC9605, complete genome
          Length = 2510659

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 42/44 (95%)
 Strand = Plus / Minus

                                                           
Query: 225     gagcagcacatccggcgagacaaggccaccagcaacatctgcac 268
               |||||||||||||| || ||||||||||||||||||||||||||
Sbjct: 2355939 gagcagcacatccgtcgcgacaaggccaccagcaacatctgcac 2355896

---

>gb|AE014292.2| Brucella suis 1330 chromosome II, complete sequence
          Length = 1207381

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                          
Query: 216    cagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgcag 275
              |||||| | |||||||||||||| || |||||||| |||  ||| |||||||||||||||
Sbjct: 710771 cagacccgcgagcagcacatccgccgcgacaaggcgacctccaatatctgcaccgcgcag 710712

                                  
Query: 276    gcgttgctcgccaacatggc 295
              ||| | || |||||||||||
Sbjct: 710711 gcgcttctggccaacatggc 710692



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 56/68 (82%)
 Strand = Plus / Minus

                                                                          
Query: 45     ggcgccgacatcgccgtgggctccgcgcaacgcttcggcgtgcccatggggtacggcggc 104
              ||||| ||||| ||||| ||||||  ||| ||||  |||||||| ||||| |  ||||||
Sbjct: 710942 ggcgcggacatggccgtcggctccatgcagcgctatggcgtgccgatgggctttggcggc 710883

                      
Query: 105    ccgcacgc 112
              ||||||||
Sbjct: 710882 ccgcacgc 710875

---

>gb|CP000075.1| Pseudomonas syringae pv. syringae B728a, complete genome
          Length = 6093698

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 96/116 (82%)
 Strand = Plus / Minus

                                                                           
Query: 208     tggcaatgcagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgca 267
               |||| ||||||||| | || ||||| || || || || ||||||||||||||||||||||
Sbjct: 1240521 tggccatgcagacccgcgaacagcatattcgtcgcgaaaaggccaccagcaacatctgca 1240462

                                                                       
Query: 268     ccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatggtccg 323
               |||| |||| | | || |||||||| ||    ||||| ||||||||||||||||||
Sbjct: 1240461 ccgcacaggtgctactggccaacatcgccagcatgtacgccgtctaccatggtccg 1240406

---

>gb|AE004367.1| Vibrio cholerae O1 biovar eltor str. N16961 chromosome II, section 24
            of 93 of the complete chromosome
          Length = 10069

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 96/116 (82%)
 Strand = Plus / Minus

                                                                        
Query: 207  atggcaatgcagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgc 266
            ||||||||||| ||| | ||||||||||| || || || || || |||  ||||||||| 
Sbjct: 6101 atggcaatgcaaacccgtgagcagcacattcgccgtgaaaaagcgacctccaacatctgt 6042

                                                                    
Query: 267  accgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatggtcc 322
            |||||||| ||| |||| ||||||||||| ||| | ||||| || |||||||||||
Sbjct: 6041 accgcgcaagcgctgctggccaacatggctgcgttttatgcggtgtaccatggtcc 5986

---

>emb|BX640439.1| Bordetella bronchiseptica strain RB50, complete genome; segment 3/16
          Length = 346362

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Plus

                                                                          
Query: 45     ggcgccgacatcgccgtgggctccgcgcaacgcttcggcgtgcccatggggtacggcggc 104
              |||||||||||||||||||| || ||||| ||||||||||||||  | || | |||||||
Sbjct: 209138 ggcgccgacatcgccgtgggttcggcgcagcgcttcggcgtgccgttcggcttcggcggc 209197

                      
Query: 105    ccgcacgc 112
              ||||||||
Sbjct: 209198 ccgcacgc 209205



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                                  
Query: 225    gagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgcagg 276
              |||||||||||||| || || || || |||  ||||||||||||||| ||||
Sbjct: 209318 gagcagcacatccgccgcgagaaagcgacctccaacatctgcaccgcccagg 209369

---

>emb|BX640425.1| Bordetella parapertussis strain 12822, complete genome; segment 3/14
          Length = 348257

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Plus

                                                                          
Query: 45     ggcgccgacatcgccgtgggctccgcgcaacgcttcggcgtgcccatggggtacggcggc 104
              |||||||||||||||||||| || ||||| ||||||||||||||  | || | |||||||
Sbjct: 122942 ggcgccgacatcgccgtgggttcggcgcagcgcttcggcgtgccgttcggcttcggcggc 123001

                      
Query: 105    ccgcacgc 112
              ||||||||
Sbjct: 123002 ccgcacgc 123009



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                                  
Query: 225    gagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgcagg 276
              |||||||||||||| || || || || |||  ||||||||||||||| ||||
Sbjct: 123122 gagcagcacatccgccgcgagaaagcgacctccaacatctgcaccgcccagg 123173

---

>emb|BX640411.1| Bordetella pertussis strain Tohama I, complete genome; segment 1/12
          Length = 346359

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Plus

                                                                          
Query: 45     ggcgccgacatcgccgtgggctccgcgcaacgcttcggcgtgcccatggggtacggcggc 104
              |||||||||||||||||||| || ||||| ||||||||||||||  | || | |||||||
Sbjct: 199783 ggcgccgacatcgccgtgggttcggcgcagcgcttcggcgtgccgttcggcttcggcggc 199842

                      
Query: 105    ccgcacgc 112
              ||||||||
Sbjct: 199843 ccgcacgc 199850



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                                  
Query: 225    gagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgcagg 276
              |||||||||||||| || || ||||| |||  ||||||||||||||| ||||
Sbjct: 199963 gagcagcacatccgccgcgagaaggcgacctccaacatctgcaccgcccagg 200014

---

>gb|CP000264.1| Jannaschia sp. CCS1, complete genome
          Length = 4317977

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Plus

                                                                           
Query: 45      ggcgccgacatcgccgtgggctccgcgcaacgcttcggcgtgcccatggggtacggcggc 104
               ||||| || ||||||||||| |||||||||||||||||||||||  |||| || ||||||
Sbjct: 3694589 ggcgcggatatcgccgtgggatccgcgcaacgcttcggcgtgcctttgggatatggcggc 3694648

                       
Query: 105     ccgcacgc 112
               || |||||
Sbjct: 3694649 ccccacgc 3694656

---

>gb|AF396263.1|AF396262S2 Brucella melitensis biovar Abortus glycine cleavage system P
           protein (gcvP) gene, complete cds
          Length = 2800

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Plus

                                                                       
Query: 216 cagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgcag 275
           |||||| | |||||||||||||| || |||||||| |||  ||| |||||||||||||||
Sbjct: 920 cagacccgcgagcagcacatccgccgcgacaaggcgacctccaatatctgcaccgcgcag 979

                               
Query: 276 gcgttgctcgccaacatggc 295
           ||| | || |||||||||||
Sbjct: 980 gcgcttctggccaacatggc 999



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 56/68 (82%)
 Strand = Plus / Plus

                                                                       
Query: 45  ggcgccgacatcgccgtgggctccgcgcaacgcttcggcgtgcccatggggtacggcggc 104
           ||||| ||||| ||||| ||||||  ||| ||||  |||||||| ||||| |  ||||||
Sbjct: 749 ggcgcggacatggccgtcggctccatgcagcgctatggcgtgccgatgggctttggcggc 808

                   
Query: 105 ccgcacgc 112
           ||||||||
Sbjct: 809 ccgcacgc 816

---

>gb|AE009691.1| Brucella melitensis 16M chromosome II, section 53 of 107 of the
             complete sequence
          Length = 12340

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Plus

                                                                         
Query: 216   cagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgcag 275
             |||||| | |||||||||||||| || |||||||| |||  ||| |||||||||||||||
Sbjct: 10037 cagacccgcgagcagcacatccgccgcgacaaggcgacctccaatatctgcaccgcgcag 10096

                                 
Query: 276   gcgttgctcgccaacatggc 295
             ||| | || |||||||||||
Sbjct: 10097 gcgcttctggccaacatggc 10116



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 56/68 (82%)
 Strand = Plus / Plus

                                                                        
Query: 45   ggcgccgacatcgccgtgggctccgcgcaacgcttcggcgtgcccatggggtacggcggc 104
            ||||| ||||| ||||| ||||||  ||| ||||  |||||||| ||||| |  ||||||
Sbjct: 9866 ggcgcggacatggccgtcggctccatgcagcgctatggcgtgccgatgggctttggcggc 9925

                    
Query: 105  ccgcacgc 112
            ||||||||
Sbjct: 9926 ccgcacgc 9933

---

>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 84/100 (84%)
 Strand = Plus / Plus

                                                                           
Query: 214     tgcagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgc 273
               |||||||| | |||||||||||||| || || ||||| |||  |||||||||||||||||
Sbjct: 6321515 tgcagacccgcgagcagcacatccgccgcgagaaggcgacctccaacatctgcaccgcgc 6321574

                                                       
Query: 274     aggcgttgctcgccaacatggcggcgatgtatgccgtcta 313
               ||| | ||||||||   || || ||||||||||| |||||
Sbjct: 6321575 aggtgctgctcgccgtgatcgccgcgatgtatgcggtcta 6321614



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 73/87 (83%)
 Strand = Plus / Plus

                                                                           
Query: 31      cgccgggcgagattggcgccgacatcgccgtgggctccgcgcaacgcttcggcgtgccca 90
               |||| |||||| | || |||||||||||| | || || ||||| |||||||||||||| |
Sbjct: 6321332 cgcccggcgagctcggtgccgacatcgccatcggttcggcgcagcgcttcggcgtgccga 6321391

                                          
Query: 91      tggggtacggcggcccgcacgctgcct 117
               |||| || ||||| |||||||| ||||
Sbjct: 6321392 tgggctatggcggaccgcacgcggcct 6321418

---

>gb|AE017224.1| Brucella abortus biovar 1 str. 9-941 chromosome II, complete sequence
          Length = 1162204

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Plus

                                                                          
Query: 216    cagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgcag 275
              |||||| | |||||||||||||| || |||||||| |||  ||| |||||||||||||||
Sbjct: 506372 cagacccgcgagcagcacatccgccgcgacaaggcgacctccaatatctgcaccgcgcag 506431

                                  
Query: 276    gcgttgctcgccaacatggc 295
              ||| | || |||||||||||
Sbjct: 506432 gcgcttctggccaacatggc 506451



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 56/68 (82%)
 Strand = Plus / Plus

                                                                          
Query: 45     ggcgccgacatcgccgtgggctccgcgcaacgcttcggcgtgcccatggggtacggcggc 104
              ||||| ||||| ||||| ||||||  ||| ||||  |||||||| ||||| |  ||||||
Sbjct: 506201 ggcgcggacatggccgtcggctccatgcagcgctatggcgtgccgatgggctttggcggc 506260

                      
Query: 105    ccgcacgc 112
              ||||||||
Sbjct: 506261 ccgcacgc 506268

---

>emb|AM040265.1| Brucella melitensis biovar Abortus chromosome II, complete sequence,
              strain 2308
          Length = 1156948

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Plus

                                                                          
Query: 216    cagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgcag 275
              |||||| | |||||||||||||| || |||||||| |||  ||| |||||||||||||||
Sbjct: 506360 cagacccgcgagcagcacatccgccgcgacaaggcgacctccaatatctgcaccgcgcag 506419

                                  
Query: 276    gcgttgctcgccaacatggc 295
              ||| | || |||||||||||
Sbjct: 506420 gcgcttctggccaacatggc 506439



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 56/68 (82%)
 Strand = Plus / Plus

                                                                          
Query: 45     ggcgccgacatcgccgtgggctccgcgcaacgcttcggcgtgcccatggggtacggcggc 104
              ||||| ||||| ||||| ||||||  ||| ||||  |||||||| ||||| |  ||||||
Sbjct: 506189 ggcgcggacatggccgtcggctccatgcagcgctatggcgtgccgatgggctttggcggc 506248

                      
Query: 105    ccgcacgc 112
              ||||||||
Sbjct: 506249 ccgcacgc 506256

---

>gb|AC008139.9| Drosophila melanogaster clone BACR28B01, complete sequence
          Length = 170675

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 92/111 (82%)
 Strand = Plus / Plus

                                                                          
Query: 214    tgcagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgc 273
              |||| |||||||||||||| |||||||| || ||||| || || ||||| ||||| || |
Sbjct: 124131 tgcaaaccagggagcagcatatccggcgggataaggcaacaagtaacatttgcacggcac 124190

                                                                 
Query: 274    aggcgttgctcgccaacatggcggcgatgtatgccgtctaccatggtccgg 324
              ||||  | || ||||||||| |||| ||||| ||| ||||||| |||||||
Sbjct: 124191 aggctcttctggccaacatgtcggccatgtacgccatctaccacggtccgg 124241

---

>gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome
          Length = 4403837

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 44/47 (93%)
 Strand = Plus / Plus

                                                              
Query: 225     gagcagcacatccggcgagacaaggccaccagcaacatctgcaccgc 271
               ||||| |||||||| || |||||||||||||||||||||||||||||
Sbjct: 2074065 gagcaacacatccgccgcgacaaggccaccagcaacatctgcaccgc 2074111



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 65/80 (81%)
 Strand = Plus / Plus

                                                                           
Query: 30      ccgccgggcgagattggcgccgacatcgccgtgggctccgcgcaacgcttcggcgtgccc 89
               ||||| || ||||| ||||| ||| ||||| | ||| || | ||||| ||||| ||||| 
Sbjct: 2073870 ccgcccggagagatcggcgctgacgtcgcctttggcaccacacaacggttcggagtgccg 2073929

                                   
Query: 90      atggggtacggcggcccgca 109
               |||||||  |||||||||||
Sbjct: 2073930 atggggtttggcggcccgca 2073949

---

>ref|XM_367016.1| Magnaporthe grisea 70-15 chromosome VII hypothetical protein
            (MG03092.4) partial mRNA
          Length = 3255

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 86/103 (83%)
 Strand = Plus / Plus

                                                                        
Query: 214  tgcagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgc 273
            |||||||| | ||||||||||||||| |||| ||||| || |||||| ||||||| || |
Sbjct: 1229 tgcagacccgtgagcagcacatccggagagaaaaggcgacgagcaacgtctgcactgctc 1288

                                                       
Query: 274  aggcgttgctcgccaacatggcggcgatgtatgccgtctacca 316
            ||||  ||| ||||||| |||| || ||||| || ||||||||
Sbjct: 1289 aggccctgcccgccaacgtggccgccatgtacgctgtctacca 1331



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 99   ggcggcccgcacgctgccttc 119
            |||||||||||||||||||||
Sbjct: 1114 ggcggcccgcacgctgccttc 1134

---

>ref|XM_872922.1| PREDICTED: Bos taurus similar to Glycine dehydrogenase
            [decarboxylating], mitochondrial precursor (Glycine
            decarboxylase) (Glycine cleavage system P-protein),
            transcript variant 7 (LOC507688), mRNA
          Length = 3935

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 44/47 (93%)
 Strand = Plus / Plus

                                                           
Query: 219  accagggagcagcacatccggcgagacaaggccaccagcaacatctg 265
            ||||||||||| ||||||||| |||||||||| ||||||||||||||
Sbjct: 1238 accagggagcaacacatccggagagacaaggctaccagcaacatctg 1284

---

>ref|XM_872820.1| PREDICTED: Bos taurus similar to Glycine dehydrogenase
            [decarboxylating], mitochondrial precursor (Glycine
            decarboxylase) (Glycine cleavage system P-protein),
            transcript variant 6 (LOC507688), mRNA
          Length = 3956

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 44/47 (93%)
 Strand = Plus / Plus

                                                           
Query: 219  accagggagcagcacatccggcgagacaaggccaccagcaacatctg 265
            ||||||||||| ||||||||| |||||||||| ||||||||||||||
Sbjct: 1256 accagggagcaacacatccggagagacaaggctaccagcaacatctg 1302

---

>ref|XM_872730.1| PREDICTED: Bos taurus similar to Glycine dehydrogenase
            [decarboxylating], mitochondrial precursor (Glycine
            decarboxylase) (Glycine cleavage system P-protein),
            transcript variant 5 (LOC507688), mRNA
          Length = 3827

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 44/47 (93%)
 Strand = Plus / Plus

                                                           
Query: 219  accagggagcagcacatccggcgagacaaggccaccagcaacatctg 265
            ||||||||||| ||||||||| |||||||||| ||||||||||||||
Sbjct: 1256 accagggagcaacacatccggagagacaaggctaccagcaacatctg 1302

---

>ref|XM_872617.1| PREDICTED: Bos taurus similar to Glycine dehydrogenase
            [decarboxylating], mitochondrial precursor (Glycine
            decarboxylase) (Glycine cleavage system P-protein),
            transcript variant 4 (LOC507688), mRNA
          Length = 3974

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 44/47 (93%)
 Strand = Plus / Plus

                                                           
Query: 219  accagggagcagcacatccggcgagacaaggccaccagcaacatctg 265
            ||||||||||| ||||||||| |||||||||| ||||||||||||||
Sbjct: 1277 accagggagcaacacatccggagagacaaggctaccagcaacatctg 1323

---

>ref|XM_584346.2| PREDICTED: Bos taurus similar to Glycine dehydrogenase
           [decarboxylating], mitochondrial precursor (Glycine
           decarboxylase) (Glycine cleavage system P-protein),
           transcript variant 1 (LOC507688), mRNA
          Length = 2874

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 44/47 (93%)
 Strand = Plus / Plus

                                                          
Query: 219 accagggagcagcacatccggcgagacaaggccaccagcaacatctg 265
           ||||||||||| ||||||||| |||||||||| ||||||||||||||
Sbjct: 177 accagggagcaacacatccggagagacaaggctaccagcaacatctg 223

---

>ref|XM_872422.1| PREDICTED: Bos taurus similar to Glycine dehydrogenase
            [decarboxylating], mitochondrial precursor (Glycine
            decarboxylase) (Glycine cleavage system P-protein),
            transcript variant 3 (LOC507688), mRNA
          Length = 3998

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 44/47 (93%)
 Strand = Plus / Plus

                                                           
Query: 219  accagggagcagcacatccggcgagacaaggccaccagcaacatctg 265
            ||||||||||| ||||||||| |||||||||| ||||||||||||||
Sbjct: 1256 accagggagcaacacatccggagagacaaggctaccagcaacatctg 1302

---

>ref|XM_864146.1| PREDICTED: Bos taurus similar to Glycine dehydrogenase
            [decarboxylating], mitochondrial precursor (Glycine
            decarboxylase) (Glycine cleavage system P-protein),
            transcript variant 2 (LOC507688), mRNA
          Length = 3953

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 44/47 (93%)
 Strand = Plus / Plus

                                                           
Query: 219  accagggagcagcacatccggcgagacaaggccaccagcaacatctg 265
            ||||||||||| ||||||||| |||||||||| ||||||||||||||
Sbjct: 1256 accagggagcaacacatccggagagacaaggctaccagcaacatctg 1302

---

>gb|CP000088.1| Thermobifida fusca YX, complete genome
          Length = 3642249

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 86/103 (83%)
 Strand = Plus / Plus

                                                                           
Query: 214     tgcagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgc 273
               |||| ||| |||| ||||||||||| || || || |||||||||||||| |||||||| |
Sbjct: 1621069 tgcaaacccgggaacagcacatccgccgcgagaaagccaccagcaacatttgcaccgccc 1621128

                                                          
Query: 274     aggcgttgctcgccaacatggcggcgatgtatgccgtctacca 316
               ||| | ||||||||   |||||||  ||||| |||||||||||
Sbjct: 1621129 aggtgctgctcgccgtgatggcgggcatgtacgccgtctacca 1621171



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 51/58 (87%)
 Strand = Plus / Plus

                                                                         
Query: 60      gtgggctccgcgcaacgcttcggcgtgcccatggggtacggcggcccgcacgctgcct 117
               ||||||||| | || || ||||| ||||||||||||| ||||||||||||||| ||||
Sbjct: 1620915 gtgggctccacccagcggttcggggtgcccatggggttcggcggcccgcacgccgcct 1620972

---

>emb|BX842577.1| Mycobacterium tuberculosis H37Rv complete genome; segment 6/13
          Length = 347496

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 44/47 (93%)
 Strand = Plus / Plus

                                                             
Query: 225    gagcagcacatccggcgagacaaggccaccagcaacatctgcaccgc 271
              ||||| |||||||| || |||||||||||||||||||||||||||||
Sbjct: 345583 gagcaacacatccgccgcgacaaggccaccagcaacatctgcaccgc 345629



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 65/80 (81%)
 Strand = Plus / Plus

                                                                          
Query: 30     ccgccgggcgagattggcgccgacatcgccgtgggctccgcgcaacgcttcggcgtgccc 89
              ||||| || ||||| ||||| ||| ||||| | ||| || | ||||| ||||| ||||| 
Sbjct: 345388 ccgcccggagagatcggcgctgacgtcgcctttggcaccacacaacggttcggagtgccg 345447

                                  
Query: 90     atggggtacggcggcccgca 109
              |||||||  |||||||||||
Sbjct: 345448 atggggtttggcggcccgca 345467

---

>emb|BX248340.1| Mycobacterium bovis subsp. bovis AF2122/97 complete genome; segment 7/14
          Length = 291050

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 44/47 (93%)
 Strand = Plus / Plus

                                                             
Query: 225    gagcagcacatccggcgagacaaggccaccagcaacatctgcaccgc 271
              ||||| |||||||| || |||||||||||||||||||||||||||||
Sbjct: 153192 gagcaacacatccgccgcgacaaggccaccagcaacatctgcaccgc 153238



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 65/80 (81%)
 Strand = Plus / Plus

                                                                          
Query: 30     ccgccgggcgagattggcgccgacatcgccgtgggctccgcgcaacgcttcggcgtgccc 89
              ||||| || ||||| ||||| ||| ||||| | ||| || | ||||| ||||| ||||| 
Sbjct: 152997 ccgcccggagagatcggcgctgacgtcgcctttggcaccacacaacggttcggagtgccg 153056

                                  
Query: 90     atggggtacggcggcccgca 109
              |||||||  |||||||||||
Sbjct: 153057 atggggtttggcggcccgca 153076

---

>ref|NM_141732.1| Drosophila melanogaster CG3999-RA (CG3999), mRNA
          Length = 3209

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 92/111 (82%)
 Strand = Plus / Plus

                                                                        
Query: 214  tgcagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgc 273
            |||| |||||||||||||| |||||||| || ||||| || || ||||| ||||| || |
Sbjct: 1078 tgcaaaccagggagcagcatatccggcgggataaggcaacaagtaacatttgcacggcac 1137

                                                               
Query: 274  aggcgttgctcgccaacatggcggcgatgtatgccgtctaccatggtccgg 324
            ||||  | || ||||||||| |||| ||||| ||| ||||||| |||||||
Sbjct: 1138 aggctcttctggccaacatgtcggccatgtacgccatctaccacggtccgg 1188

---

>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome
          Length = 5331656

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 68/79 (86%)
 Strand = Plus / Plus

                                                                           
Query: 31      cgccgggcgagattggcgccgacatcgccgtgggctccgcgcaacgcttcggcgtgccca 90
               ||||||||||  | ||||||||||||||  | ||||| ||||| |||||||||||||| |
Sbjct: 4279175 cgccgggcgaactcggcgccgacatcgcgatcggctcggcgcagcgcttcggcgtgccga 4279234

                                  
Query: 91      tggggtacggcggcccgca 109
               |||| || |||||||||||
Sbjct: 4279235 tgggctatggcggcccgca 4279253



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 62/73 (84%)
 Strand = Plus / Plus

                                                                           
Query: 214     tgcagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgc 273
               |||||||| | || ||||||||||| || || ||||| |||  |||||||||||||||||
Sbjct: 4279358 tgcagacccgcgaacagcacatccgccgcgagaaggcgacctccaacatctgcaccgcgc 4279417

                            
Query: 274     aggcgttgctcgc 286
               ||| | |||||||
Sbjct: 4279418 aggtgctgctcgc 4279430

---

>gb|BT003457.1| Drosophila melanogaster RH34107 full insert cDNA
          Length = 3210

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 92/111 (82%)
 Strand = Plus / Plus

                                                                        
Query: 214  tgcagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgc 273
            |||| |||||||||||||| |||||||| || ||||| || || ||||| ||||| || |
Sbjct: 1078 tgcaaaccagggagcagcatatccggcgggataaggcaacaagtaacatttgcacggcac 1137

                                                               
Query: 274  aggcgttgctcgccaacatggcggcgatgtatgccgtctaccatggtccgg 324
            ||||  | || ||||||||| |||| ||||| ||| ||||||| |||||||
Sbjct: 1138 aggctcttctggccaacatgtcggccatgtacgccatctaccacggtccgg 1188

---

>gb|AE003686.4| Drosophila melanogaster chromosome 3R, section 24 of 118 of the
             complete sequence
          Length = 223505

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 92/111 (82%)
 Strand = Plus / Plus

                                                                         
Query: 214   tgcagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgc 273
             |||| |||||||||||||| |||||||| || ||||| || || ||||| ||||| || |
Sbjct: 91667 tgcaaaccagggagcagcatatccggcgggataaggcaacaagtaacatttgcacggcac 91726

                                                                
Query: 274   aggcgttgctcgccaacatggcggcgatgtatgccgtctaccatggtccgg 324
             ||||  | || ||||||||| |||| ||||| ||| ||||||| |||||||
Sbjct: 91727 aggctcttctggccaacatgtcggccatgtacgccatctaccacggtccgg 91777

---

>gb|BC017135.1| Mus musculus glycine decarboxylase, mRNA (cDNA clone MGC:27650
            IMAGE:4511573), complete cds
          Length = 3769

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                        
Query: 216  cagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgcag 275
            |||||||| || || ||||||||| ||||||| |||||||||||||||||||| || |||
Sbjct: 1269 cagaccagagaacaacacatccggagagacaaagccaccagcaacatctgcacggctcag 1328

              
Query: 276  gc 277
            ||
Sbjct: 1329 gc 1330

---

>ref|NM_138595.1| Mus musculus glycine decarboxylase (Gldc), mRNA
          Length = 3769

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                        
Query: 216  cagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgcag 275
            |||||||| || || ||||||||| ||||||| |||||||||||||||||||| || |||
Sbjct: 1269 cagaccagagaacaacacatccggagagacaaagccaccagcaacatctgcacggctcag 1328

              
Query: 276  gc 277
            ||
Sbjct: 1329 gc 1330

---

>dbj|AK139929.1| Mus musculus 2 cells egg cDNA, RIKEN full-length enriched library,
            clone:B020039B21 product:glycine decarboxylase, full
            insert sequence
          Length = 2871

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                        
Query: 216  cagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgcag 275
            |||||||| || || ||||||||| ||||||| |||||||||||||||||||| || |||
Sbjct: 1283 cagaccagagaacaacacatccggagagacaaagccaccagcaacatctgcacggctcag 1342

              
Query: 276  gc 277
            ||
Sbjct: 1343 gc 1344

---

>dbj|AK080937.1| Mus musculus 4 days neonate male adipose cDNA, RIKEN full-length
            enriched library, clone:B430214E13 product:GLYCINE
            DEHYDROGENASE [DECARBOXYLATING], MITOCHONDRIAL PRECURSOR
            (EC 1.4.4.2) (GLYCINE DECARBOXYLASE) (GLYCINE CLEAVAGE
            SYSTEM P- PROTEIN) homolog [Homo sapiens], full insert
            sequence
          Length = 3764

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                        
Query: 216  cagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgcag 275
            |||||||| || || ||||||||| ||||||| |||||||||||||||||||| || |||
Sbjct: 1281 cagaccagagaacaacacatccggagagacaaagccaccagcaacatctgcacggctcag 1340

              
Query: 276  gc 277
            ||
Sbjct: 1341 gc 1342

---

>dbj|AK080789.1| Mus musculus adult male corpora quadrigemina cDNA, RIKEN full-length
            enriched library, clone:B230104C02 product:GLYCINE
            DEHYDROGENASE [DECARBOXYLATING], MITOCHONDRIAL PRECURSOR
            (EC 1.4.4.2) (GLYCINE DECARBOXYLASE) (GLYCINE CLEAVAGE
            SYSTEM P-PROTEIN) homolog [Homo sapiens], full insert
            sequence
          Length = 3746

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                        
Query: 216  cagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgcag 275
            |||||||| || || ||||||||| ||||||| |||||||||||||||||||| || |||
Sbjct: 1264 cagaccagagaacaacacatccggagagacaaagccaccagcaacatctgcacggctcag 1323

              
Query: 276  gc 277
            ||
Sbjct: 1324 gc 1325

---

>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome
          Length = 4751080

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 94/114 (82%)
 Strand = Plus / Minus

                                                                           
Query: 156     ggccgcatcatcggtgtgagcgtcgactccagcggcaagcccgcgctccgcatggcaatg 215
               |||||||||||||| |||  | ||||| |||  |||||| ||||||| ||||||||  ||
Sbjct: 3725611 ggccgcatcatcggcgtgtccatcgacgccaagggcaagaccgcgctgcgcatggcgctg 3725552

                                                                     
Query: 216     cagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcacc 269
               || ||| | |||||||||||||| || || ||||||| |  |||||||||||||
Sbjct: 3725551 caaacccgcgagcagcacatccgccgcgagaaggccaactccaacatctgcacc 3725498



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 68/80 (85%)
 Strand = Plus / Minus

                                                                           
Query: 33      ccgggcgagattggcgccgacatcgccgtgggctccgcgcaacgcttcggcgtgcccatg 92
               |||| |||||| ||||||||||||||  |||||  | | || |||||||||||||| |||
Sbjct: 3725734 ccggccgagatgggcgccgacatcgcgctgggcaacacccagcgcttcggcgtgccgatg 3725675

                                   
Query: 93      gggtacggcggcccgcacgc 112
               || | |||||||||||||||
Sbjct: 3725674 ggcttcggcggcccgcacgc 3725655

---

>ref|NM_119455.2| Arabidopsis thaliana glycine dehydrogenase (decarboxylating)
            AT4G33010 mRNA, complete cds
          Length = 3478

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Plus

                                                                        
Query: 243  gacaaggccaccagcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatg 302
            ||||| ||||| ||||||||||| || || || |||||||| ||||||||||| || |||
Sbjct: 1365 gacaaagccactagcaacatctgtactgctcaagcgttgcttgccaacatggctgccatg 1424

                             
Query: 303  tatgccgtctaccatgg 319
            ||||| || ||||||||
Sbjct: 1425 tatgctgtttaccatgg 1441

---

>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome
          Length = 4892717

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                           
Query: 45      ggcgccgacatcgccgtgggctccgcgcaacgcttcggcgtgcccatggggtacggcggc 104
               |||||||| |||||  | ||||| |||||||||||||||||||| ||||| || ||||||
Sbjct: 1943926 ggcgccgatatcgcgatcggctcggcgcaacgcttcggcgtgccgatgggctatggcggc 1943867

                    
Query: 105     ccgca 109
               |||||
Sbjct: 1943866 ccgca 1943862



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 59/69 (85%)
 Strand = Plus / Minus

                                                                           
Query: 208     tggcaatgcagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgca 267
               |||| ||||||||| | |||||||||||||| || || ||||| |||   ||||||||||
Sbjct: 1943763 tggcgatgcagacccgcgagcagcacatccgccgcgagaaggcgacctcgaacatctgca 1943704

                        
Query: 268     ccgcgcagg 276
               |||||||||
Sbjct: 1943703 ccgcgcagg 1943695

---

>gb|BT000800.1| Arabidopsis thaliana At4g33010 mRNA sequence
          Length = 3377

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Plus

                                                                        
Query: 243  gacaaggccaccagcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatg 302
            ||||| ||||| ||||||||||| || || || |||||||| ||||||||||| || |||
Sbjct: 1280 gacaaagccactagcaacatctgtactgctcaagcgttgcttgccaacatggctgccatg 1339

                             
Query: 303  tatgccgtctaccatgg 319
            ||||| || ||||||||
Sbjct: 1340 tatgctgtttaccatgg 1356

---

>gb|AC157986.4| Mus musculus chromosome 19, clone RP23-160F18, complete sequence
          Length = 207504

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                  
Query: 216   cagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcac 268
             |||||||| || || ||||||||| ||||||| ||||||||||||||||||||
Sbjct: 22766 cagaccagagaacaacacatccggagagacaaagccaccagcaacatctgcac 22714

---

>gb|BT000446.1| Arabidopsis thaliana P-Protein - like protein (At4g33010) mRNA,
            complete cds
          Length = 3344

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Plus

                                                                        
Query: 243  gacaaggccaccagcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatg 302
            ||||| ||||| ||||||||||| || || || |||||||| ||||||||||| || |||
Sbjct: 1266 gacaaagccactagcaacatctgtactgctcaagcgttgcttgccaacatggctgccatg 1325

                             
Query: 303  tatgccgtctaccatgg 319
            ||||| || ||||||||
Sbjct: 1326 tatgctgtttaccatgg 1342

---

>gb|AY091186.1| Arabidopsis thaliana putative P-protein (At4g33010) mRNA, complete
            cds
          Length = 3145

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Plus

                                                                        
Query: 243  gacaaggccaccagcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatg 302
            ||||| ||||| ||||||||||| || || || |||||||| ||||||||||| || |||
Sbjct: 1183 gacaaagccactagcaacatctgtactgctcaagcgttgcttgccaacatggctgccatg 1242

                             
Query: 303  tatgccgtctaccatgg 319
            ||||| || ||||||||
Sbjct: 1243 tatgctgtttaccatgg 1259

---

>gb|AY063903.1| Arabidopsis thaliana putative P-Protein (At4g33010) mRNA, complete
            cds
          Length = 3420

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Plus

                                                                        
Query: 243  gacaaggccaccagcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatg 302
            ||||| ||||| ||||||||||| || || || |||||||| ||||||||||| || |||
Sbjct: 1333 gacaaagccactagcaacatctgtactgctcaagcgttgcttgccaacatggctgccatg 1392

                             
Query: 303  tatgccgtctaccatgg 319
            ||||| || ||||||||
Sbjct: 1393 tatgctgtttaccatgg 1409

---

>gb|AY128922.1| Arabidopsis thaliana P-protein-like protein (At4g33010) mRNA,
            complete cds
          Length = 3153

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Plus

                                                                        
Query: 243  gacaaggccaccagcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatg 302
            ||||| ||||| ||||||||||| || || || |||||||| ||||||||||| || |||
Sbjct: 1183 gacaaagccactagcaacatctgtactgctcaagcgttgcttgccaacatggctgccatg 1242

                             
Query: 303  tatgccgtctaccatgg 319
            ||||| || ||||||||
Sbjct: 1243 tatgctgtttaccatgg 1259

---

>dbj|AB225688.1| Aspergillus oryzae cDNA, contig sequence: AoEST2543
          Length = 2253

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 99/121 (81%)
 Strand = Plus / Plus

                                                                        
Query: 214  tgcagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgc 273
            |||||||| | |||||||| ||||| || || || ||||| |||||||||||||| || |
Sbjct: 881  tgcagacccgagagcagcatatccgccgtgagaaagccactagcaacatctgcactgcac 940

                                                                        
Query: 274  aggcgttgctcgccaacatggcggcgatgtatgccgtctaccatggtccggctggcctga 333
            ||||  | ||||||||||||   || |||||||| || ||||| || ||| |||||||||
Sbjct: 941  aggcccttctcgccaacatgagcgccatgtatgctgtttaccacggcccgactggcctga 1000

             
Query: 334  a 334
            |
Sbjct: 1001 a 1001

---

>dbj|AP007171.1| Aspergillus oryzae RIB40 genomic DNA, SC011
          Length = 2505489

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 99/121 (81%)
 Strand = Plus / Minus

                                                                          
Query: 214    tgcagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgc 273
              |||||||| | |||||||| ||||| || || || ||||| |||||||||||||| || |
Sbjct: 901125 tgcagacccgagagcagcatatccgccgtgagaaagccactagcaacatctgcactgcac 901066

                                                                          
Query: 274    aggcgttgctcgccaacatggcggcgatgtatgccgtctaccatggtccggctggcctga 333
              ||||  | ||||||||||||   || |||||||| || ||||| || ||| |||||||||
Sbjct: 901065 aggcccttctcgccaacatgagcgccatgtatgctgtttaccacggcccgactggcctga 901006

               
Query: 334    a 334
              |
Sbjct: 901005 a 901005

---

>gb|AY065004.1| Arabidopsis thaliana AT4g33010/F26P21_130 mRNA, complete cds
          Length = 3429

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Plus

                                                                        
Query: 243  gacaaggccaccagcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatg 302
            ||||| ||||| ||||||||||| || || || |||||||| ||||||||||| || |||
Sbjct: 1365 gacaaagccactagcaacatctgtactgctcaagcgttgcttgccaacatggctgccatg 1424

                             
Query: 303  tatgccgtctaccatgg 319
            ||||| || ||||||||
Sbjct: 1425 tatgctgtttaccatgg 1441

---

>gb|AY058856.1| Arabidopsis thaliana AT4g33010/F26P21_130 mRNA, complete cds
          Length = 2249

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Plus

                                                                       
Query: 243 gacaaggccaccagcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatg 302
           ||||| ||||| ||||||||||| || || || |||||||| ||||||||||| || |||
Sbjct: 171 gacaaagccactagcaacatctgtactgctcaagcgttgcttgccaacatggctgccatg 230

                            
Query: 303 tatgccgtctaccatgg 319
           ||||| || ||||||||
Sbjct: 231 tatgctgtttaccatgg 247

---

>gb|AY042800.1| Arabidopsis thaliana P-Protein - like protein (F26P21.130) mRNA,
            complete cds
          Length = 3423

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Plus

                                                                        
Query: 243  gacaaggccaccagcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatg 302
            ||||| ||||| ||||||||||| || || || |||||||| ||||||||||| || |||
Sbjct: 1359 gacaaagccactagcaacatctgtactgctcaagcgttgcttgccaacatggctgccatg 1418

                             
Query: 303  tatgccgtctaccatgg 319
            ||||| || ||||||||
Sbjct: 1419 tatgctgtttaccatgg 1435

---

>dbj|AK050981.1| Mus musculus 9 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:D030049L12
           product:unclassifiable, full insert sequence
          Length = 2139

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                
Query: 216 cagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcac 268
           |||||||| || || ||||||||| ||||||| ||||||||||||||||||||
Sbjct: 123 cagaccagagaacaacacatccggagagacaaagccaccagcaacatctgcac 175

---

>gb|AC102722.7| Mus musculus chromosome 19, clone RP24-108O16, complete sequence
          Length = 141681

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                   
Query: 216    cagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcac 268
              |||||||| || || ||||||||| ||||||| ||||||||||||||||||||
Sbjct: 117455 cagaccagagaacaacacatccggagagacaaagccaccagcaacatctgcac 117507

---

>gb|BT001132.1| Arabidopsis thaliana At4g33010/F26P21_130 mRNA, complete cds
          Length = 3114

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Plus

                                                                        
Query: 243  gacaaggccaccagcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatg 302
            ||||| ||||| ||||||||||| || || || |||||||| ||||||||||| || |||
Sbjct: 1183 gacaaagccactagcaacatctgtactgctcaagcgttgcttgccaacatggctgccatg 1242

                             
Query: 303  tatgccgtctaccatgg 319
            ||||| || ||||||||
Sbjct: 1243 tatgctgtttaccatgg 1259

---

>gb|AE016853.1| Pseudomonas syringae pv. tomato str. DC3000 complete genome
          Length = 6397126

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 68/80 (85%)
 Strand = Plus / Minus

                                                                           
Query: 213     atgcagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcg 272
               ||||||||| | || || ||||| || || || |||||||||||||||||||||||||||
Sbjct: 1401336 atgcagacccgcgaacaacacattcgtcgcgaaaaggccaccagcaacatctgcaccgcg 1401277

                                   
Query: 273     caggcgttgctcgccaacat 292
               || | | |||| ||||||||
Sbjct: 1401276 caagtgctgctggccaacat 1401257

---

>emb|CR931997.1| Corynebacterium jeikeium K411 complete genome
          Length = 2462499

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 56/64 (87%)
 Strand = Plus / Plus

                                                                          
Query: 214    tgcagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgc 273
              |||||||| | ||||||||||| || || |||||||||||||| |||||||| ||||| |
Sbjct: 260519 tgcagacccgtgagcagcacattcgccgcgacaaggccaccagtaacatctgtaccgctc 260578

                  
Query: 274    aggc 277
              ||||
Sbjct: 260579 aggc 260582



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                       
Query: 48     gccgacatcgccgtgggctccgcgcaacgcttcggcgtgcc 88
              |||||||| || || |||||||| || ||||||||||||||
Sbjct: 260353 gccgacattgctgtcggctccgcccagcgcttcggcgtgcc 260393

---

>emb|CR555306.1| Azoarcus sp. EbN1 complete genome
          Length = 4296230

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                           
Query: 45      ggcgccgacatcgccgtgggctccgcgcaacgcttcggcgtgcccatggggtacggcggc 104
               ||||| ||||||||  | ||||| ||||| |||||||||||||| ||||| | |||||||
Sbjct: 3628502 ggcgcggacatcgcgctcggctcggcgcagcgcttcggcgtgccgatgggcttcggcggc 3628443

                       
Query: 105     ccgcacgc 112
               ||||||||
Sbjct: 3628442 ccgcacgc 3628435

---

>gb|DQ056121.1| Coprinellus disseminatus strain TJ-01-05.8 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 59/68 (86%)
 Strand = Plus / Plus

                                                                       
Query: 252 accagcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtc 311
           ||||||||||| |||||||| || || ||||||||||||||||| || ||||| || || 
Sbjct: 84  accagcaacatttgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtg 143

                   
Query: 312 taccatgg 319
           ||||||||
Sbjct: 144 taccatgg 151

---

>gb|DQ056120.1| Coprinellus disseminatus strain TJ-01-15.4 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 59/68 (86%)
 Strand = Plus / Plus

                                                                       
Query: 252 accagcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtc 311
           ||||||||||| |||||||| || || ||||||||||||||||| || ||||| || || 
Sbjct: 84  accagcaacatttgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtg 143

                   
Query: 312 taccatgg 319
           ||||||||
Sbjct: 144 taccatgg 151

---

>emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome complete sequence
          Length = 3716413

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 77/92 (83%)
 Strand = Plus / Plus

                                                                           
Query: 225     gagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgcaggcgttgctc 284
               |||||||||||||| || || |||||||||  ||| |||||||||||||||| | |||| 
Sbjct: 3548586 gagcagcacatccgccgcgagaaggccacctccaatatctgcaccgcgcaggtgctgctg 3548645

                                               
Query: 285     gccaacatggcggcgatgtatgccgtctacca 316
               | |   |||||| ||||||| |||||||||||
Sbjct: 3548646 ggcgtgatggcgtcgatgtacgccgtctacca 3548677

---

>gb|CP000032.1| Silicibacter pomeroyi DSS-3 plasmid megaplasmid, complete sequence
          Length = 491611

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 73/87 (83%)
 Strand = Plus / Plus

                                                                         
Query: 31    cgccgggcgagattggcgccgacatcgccgtgggctccgcgcaacgcttcggcgtgccca 90
             |||| |||||||| |||||||| |||||| | |||||  | || ||||| |||||||| |
Sbjct: 54325 cgcccggcgagatgggcgccgatatcgccatcggctcgacccagcgctttggcgtgccga 54384

                                        
Query: 91    tggggtacggcggcccgcacgctgcct 117
             |||| || |||||||||||||| ||||
Sbjct: 54385 tgggctatggcggcccgcacgcggcct 54411

---

>ref|XM_520482.1| PREDICTED: Pan troglodytes glycine dehydrogenase (decarboxylating;
           glycine decarboxylase, glycine cleavage system protein
           P) (LOC464987), mRNA
          Length = 2864

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 219 accagggagcagcacatccggcgagacaaggccaccagcaacatctg 265
           ||||||||||| ||||| ||| |||||||||| ||||||||||||||
Sbjct: 829 accagggagcaacacattcggagagacaaggctaccagcaacatctg 875

---

>ref|NM_000170.1| Homo sapiens glycine dehydrogenase (decarboxylating; glycine
            decarboxylase, glycine cleavage system protein P) (GLDC),
            mRNA
          Length = 3783

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                           
Query: 219  accagggagcagcacatccggcgagacaaggccaccagcaacatctg 265
            ||||||||||| ||||| ||| |||||||||| ||||||||||||||
Sbjct: 1249 accagggagcaacacattcggagagacaaggctaccagcaacatctg 1295

---

>emb|AL353718.10| Human DNA sequence from clone RP11-472F14 on chromosome 9 Cotains the 3'
              end of the gene for ubiquitin-like, containing PHD and RING
              finger domains 2 (URF2), a novel gene (PROO365), the 3' end
              of the GLDC gene for glycine dehydrogenase
              (decarboxylating; glycine decarboxylase, glycine cleavage
              system protein P) and a pseudogene similar to part of RP42
              homolog, complete sequence
          Length = 146746

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                             
Query: 219    accagggagcagcacatccggcgagacaaggccaccagcaacatctg 265
              ||||||||||| ||||| ||| |||||||||| ||||||||||||||
Sbjct: 137185 accagggagcaacacattcggagagacaaggctaccagcaacatctg 137139

---

>gb|AE008840.1| Salmonella typhimurium LT2, section 144 of 220 of the complete genome
          Length = 20468

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                            
Query: 63    ggctccgcgcaacgcttcggcgtgcccatggggtacggcggcccgca 109
             ||||| ||||||||||||||||| || ||||||||||| ||||||||
Sbjct: 12452 ggctctgcgcaacgcttcggcgtaccgatggggtacggtggcccgca 12406

---

>emb|AL583924.1|MLEPRTN8 Mycobacterium leprae strain TN complete genome; segment 8/10
          Length = 342300

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 55/63 (87%)
 Strand = Plus / Minus

                                                                          
Query: 214    tgcagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgc 273
              |||||||| | ||||| || ||||| ||||||||||| || ||||||||||||||||| |
Sbjct: 117457 tgcagacccgcgagcaacatatccgccgagacaaggcgacaagcaacatctgcaccgcac 117398

                 
Query: 274    agg 276
              |||
Sbjct: 117397 agg 117395

---

>emb|AL008609.1|MLCB1788 Mycobacterium leprae cosmid B1788
          Length = 39228

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 55/63 (87%)
 Strand = Plus / Minus

                                                                         
Query: 214   tgcagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgc 273
             |||||||| | ||||| || ||||| ||||||||||| || ||||||||||||||||| |
Sbjct: 22059 tgcagacccgcgagcaacatatccgccgagacaaggcgacaagcaacatctgcaccgcac 22000

                
Query: 274   agg 276
             |||
Sbjct: 21999 agg 21997

---

>gb|DQ056141.1| Coprinellus disseminatus strain IFO30972.17 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 79/95 (83%)
 Strand = Plus / Plus

                                                                       
Query: 225 gagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgcaggcgttgctc 284
           |||||||| || || || || ||||| || |||||||| ||||| || || || ||||||
Sbjct: 57  gagcagcatattcgtcgcgagaaggctactagcaacatttgcactgctcaagctttgctc 116

                                              
Query: 285 gccaacatggcggcgatgtatgccgtctaccatgg 319
           ||||||||||| || |||||||| || ||||||||
Sbjct: 117 gccaacatggctgctatgtatgcggtataccatgg 151

---

>gb|DQ056140.1| Coprinellus disseminatus strain IFO30972.16 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 79/95 (83%)
 Strand = Plus / Plus

                                                                       
Query: 225 gagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgcaggcgttgctc 284
           |||||||| || || || || ||||| || |||||||| ||||| || || || ||||||
Sbjct: 57  gagcagcatattcgtcgcgagaaggctactagcaacatttgcactgctcaagctttgctc 116

                                              
Query: 285 gccaacatggcggcgatgtatgccgtctaccatgg 319
           ||||||||||| || |||||||| || ||||||||
Sbjct: 117 gccaacatggctgctatgtatgcagtataccatgg 151

---

>gb|DQ056139.1| Coprinellus disseminatus strain TJ-00-100.3 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 79/95 (83%)
 Strand = Plus / Plus

                                                                       
Query: 225 gagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgcaggcgttgctc 284
           |||||||| || || || || ||||| || |||||||| |||||||| || || ||||||
Sbjct: 57  gagcagcatattcgtcgcgagaaggctactagcaacatttgcaccgcccaagctttgctc 116

                                              
Query: 285 gccaacatggcggcgatgtatgccgtctaccatgg 319
           ||||||||||| || ||||| || || ||||||||
Sbjct: 117 gccaacatggctgccatgtacgcagtgtaccatgg 151

---

>gb|DQ056138.1| Coprinellus disseminatus strain TJ-00-100.1 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 79/95 (83%)
 Strand = Plus / Plus

                                                                       
Query: 225 gagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgcaggcgttgctc 284
           |||||||| || || || || ||||| || |||||||| |||||||| || || ||||||
Sbjct: 57  gagcagcatattcgtcgcgagaaggctactagcaacatttgcaccgcccaagctttgctc 116

                                              
Query: 285 gccaacatggcggcgatgtatgccgtctaccatgg 319
           ||||||||||| || ||||| || || ||||||||
Sbjct: 117 gccaacatggctgccatgtacgcagtgtaccatgg 151

---

>dbj|AP008232.1| Sodalis glossinidius str. 'morsitans' DNA, complete genome
          Length = 4171146

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 40/43 (93%)
 Strand = Plus / Minus

                                                          
Query: 70      cgcaacgcttcggcgtgcccatggggtacggcggcccgcacgc 112
               ||||||||||||| ||||| ||||||||||| |||||||||||
Sbjct: 3456835 cgcaacgcttcggggtgccgatggggtacggtggcccgcacgc 3456793

---

>gb|AE011751.1| Xanthomonas axonopodis pv. citri str. 306,  section 129 of 469 of the
            complete genome
          Length = 13546

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 85/103 (82%)
 Strand = Plus / Minus

                                                                        
Query: 214  tgcagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgc 273
            |||||||| | ||||| || ||||| || || |||||||||  |||||||||||||||||
Sbjct: 8292 tgcagacccgcgagcaacatatccgccgcgaaaaggccacctccaacatctgcaccgcgc 8233

                                                       
Query: 274  aggcgttgctcgccaacatggcggcgatgtatgccgtctacca 316
            ||| | |||| ||    |||||| |||||||||| ||||||||
Sbjct: 8232 aggtgctgctggcggtgatggcgtcgatgtatgcggtctacca 8190

---

>gb|CP000133.1| Rhizobium etli CFN 42, complete genome
          Length = 4381608

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                      
Query: 31      cgccgggcgagattggcgccgacatcgccgtgggctccgcgcaacgcttcggcgt 85
               |||| ||||| || ||||||||||||||||| |||||| |||| |||||||||||
Sbjct: 2343358 cgcccggcgaaatgggcgccgacatcgccgtcggctcctcgcagcgcttcggcgt 2343412

---

>gb|AF288640.1|AF288639S2 Homo sapiens glycine decarboxylase P-protein gene, exon 8
          Length = 137

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 219 accagggagcagcacatccggcgagacaaggccaccagcaacatctg 265
           ||||||||||| ||||| ||| |||||||||| ||||||||||||||
Sbjct: 63  accagggagcaacacattcggagagacaaggctaccagcaacatctg 109

---

>gb|BC111995.1| Homo sapiens glycine dehydrogenase (decarboxylating; glycine
            decarboxylase, glycine cleavage system protein P), mRNA
            (cDNA clone MGC:138200 IMAGE:8327463), complete cds
          Length = 3218

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                           
Query: 219  accagggagcagcacatccggcgagacaaggccaccagcaacatctg 265
            ||||||||||| ||||| ||| |||||||||| ||||||||||||||
Sbjct: 1165 accagggagcaacacattcggagagacaaggctaccagcaacatctg 1211

---

>gb|BC111993.1| Homo sapiens glycine dehydrogenase (decarboxylating; glycine
            decarboxylase, glycine cleavage system protein P), mRNA
            (cDNA clone MGC:138198 IMAGE:8327461), complete cds
          Length = 3214

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                           
Query: 219  accagggagcagcacatccggcgagacaaggccaccagcaacatctg 265
            ||||||||||| ||||| ||| |||||||||| ||||||||||||||
Sbjct: 1165 accagggagcaacacattcggagagacaaggctaccagcaacatctg 1211

---

>gb|AE017220.1| Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67,
               complete genome
          Length = 4755700

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                              
Query: 63      ggctccgcgcaacgcttcggcgtgcccatggggtacggcggcccgca 109
               ||||| ||||||||||||||||| || ||||||||||| ||||||||
Sbjct: 3172380 ggctctgcgcaacgcttcggcgtaccgatggggtacggtggcccgca 3172334

---

>dbj|D90239.1|HUMGDCMR Homo sapiens mRNA for glycine decarboxylase, complete cds
          Length = 3783

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                           
Query: 219  accagggagcagcacatccggcgagacaaggccaccagcaacatctg 265
            ||||||||||| ||||| ||| |||||||||| ||||||||||||||
Sbjct: 1249 accagggagcaacacattcggagagacaaggctaccagcaacatctg 1295

---

>gb|M63635.1|HUMPPROA Human glycine decarboxylase (P-protein) mRNA
          Length = 3693

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                           
Query: 219  accagggagcagcacatccggcgagacaaggccaccagcaacatctg 265
            ||||||||||| ||||| ||| |||||||||| ||||||||||||||
Sbjct: 1180 accagggagcaacacattcggagagacaaggctaccagcaacatctg 1226

---

>gb|M64590.1|HUMPP Human glycine decarboxylase mRNA, complete cds
          Length = 3762

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                           
Query: 219  accagggagcagcacatccggcgagacaaggccaccagcaacatctg 265
            ||||||||||| ||||| ||| |||||||||| ||||||||||||||
Sbjct: 1249 accagggagcaacacattcggagagacaaggctaccagcaacatctg 1295

---

>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                           
Query: 214     tgcagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgc 273
               |||||||  |||||||||||||||| || || ||||| |||||||||||||| || || |
Sbjct: 8346202 tgcagacgcgggagcagcacatccgccgcgagaaggcgaccagcaacatctgtacggccc 8346261

                             
Query: 274     aggcgttgctcgcc 287
               ||| | ||||||||
Sbjct: 8346262 aggtgctgctcgcc 8346275

---

>dbj|AP004486.1| Lotus japonicus genomic DNA, chromosome 5, clone:LjT05B20, TM0019a,
            complete sequence
          Length = 73833

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                        
Query: 207  atggcaatgcagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgc 266
            ||||||||||| || ||||||||||| |||||  | |||||||| ||||||||||| |||
Sbjct: 8586 atggcaatgcaaactagggagcagcatatccgtagggacaaggctaccagcaacatttgc 8527

              
Query: 267  ac 268
            ||
Sbjct: 8526 ac 8525



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                        
Query: 528  gttgcctttgatgagaccaccaccttggaggatgttgacaagctgttcaaggttttctct 587
            ||||| |||||||| || | ||| || ||||||||||||||||| ||| | || ||  ||
Sbjct: 7773 gttgcttttgatgaaacaatcacattagaggatgttgacaagcttttccaagtgtttgct 7714

                       
Query: 588  ggtggcaagcc 598
            |||||||||||
Sbjct: 7713 ggtggcaagcc 7703



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 123  gccacctcccaggagtacaagaggctgatgcc 154
            ||||| || ||||||||||||||| |||||||
Sbjct: 8670 gccacatcacaggagtacaagaggatgatgcc 8639

---

>ref|NM_128167.2| Arabidopsis thaliana glycine dehydrogenase (decarboxylating)
            AT2G26080 mRNA, complete cds
          Length = 3487

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 92/113 (81%)
 Strand = Plus / Plus

                                                                        
Query: 207  atggcaatgcagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgc 266
            ||||| |||||||| ||||| ||||| |||||  | || || || |||||||||||||| 
Sbjct: 1207 atggctatgcagactagggaacagcatatccgcagggataaagctaccagcaacatctgt 1266

                                                                 
Query: 267  accgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 319
            ||||| ||||| ||||| || || ||| | || |||||||| || ||||||||
Sbjct: 1267 accgctcaggccttgcttgcaaatatgactgctatgtatgctgtttaccatgg 1319

---

>ref|XM_388528.1| Gibberella zeae PH-1 chromosome 2 hypothetical protein (FG08352.1)
            partial mRNA
          Length = 3162

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 59/69 (85%)
 Strand = Plus / Plus

                                                                        
Query: 225  gagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgcaggcgttgctc 284
            ||||||||||| || || || ||||| ||||||||||||||||| || |||||  | |||
Sbjct: 1189 gagcagcacattcgacgtgaaaaggctaccagcaacatctgcactgcccaggctcttctc 1248

                     
Query: 285  gccaacatg 293
            |||||||||
Sbjct: 1249 gccaacatg 1257

---

>gb|CP000089.1| Dechloromonas aromatica RCB, complete genome
          Length = 4501104

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 77/93 (82%)
 Strand = Plus / Plus

                                                                           
Query: 203     ccgcatggcaatgcagaccagggagcagcacatccggcgagacaaggccaccagcaacat 262
               |||||||||| |||||||  | || ||||||||||| || || ||||||| |  ||||||
Sbjct: 2665471 ccgcatggcattgcagactcgcgaacagcacatccgccgcgaaaaggccaactccaacat 2665530

                                                
Query: 263     ctgcaccgcgcaggcgttgctcgccaacatggc 295
               ||| ||| ||||||   ||||||||||||||||
Sbjct: 2665531 ctgtacctcgcaggtactgctcgccaacatggc 2665563



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 149     gatgcccggccgcatcatcgg 169
               |||||||||||||||||||||
Sbjct: 2665417 gatgcccggccgcatcatcgg 2665437

---

>gb|DQ056137.1| Coprinellus disseminatus strain TJ-01-12.6 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 255 agcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctac 314
           |||||||| |||||||| || || ||||||||||||||||| || ||||| || || |||
Sbjct: 87  agcaacatttgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtac 146

                
Query: 315 catgg 319
           |||||
Sbjct: 147 catgg 151

---

>gb|DQ056136.1| Coprinellus disseminatus strain TJ-01-06.5 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 615

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 255 agcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctac 314
           |||||||| |||||||| || || ||||||||||||||||| || ||||| || || |||
Sbjct: 85  agcaacatttgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtac 144

                
Query: 315 catgg 319
           |||||
Sbjct: 145 catgg 149

---

>gb|DQ056135.1| Coprinellus disseminatus strain TJ-01-16.1 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 255 agcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctac 314
           |||||||| |||||||| || || ||||||||||||||||| || ||||| || || |||
Sbjct: 87  agcaacatttgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtac 146

                
Query: 315 catgg 319
           |||||
Sbjct: 147 catgg 151

---

>gb|DQ056134.1| Coprinellus disseminatus strain TJ-00-91.2 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 255 agcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctac 314
           |||||||| |||||||| || || ||||||||||||||||| || ||||| || || |||
Sbjct: 87  agcaacatttgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtac 146

                
Query: 315 catgg 319
           |||||
Sbjct: 147 catgg 151

---

>gb|DQ056133.1| Coprinellus disseminatus strain TJ-01-19.4 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 255 agcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctac 314
           |||||||| |||||||| || || ||||||||||||||||| || ||||| || || |||
Sbjct: 87  agcaacatttgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtac 146

                
Query: 315 catgg 319
           |||||
Sbjct: 147 catgg 151

---

>gb|DQ056132.1| Coprinellus disseminatus strain TJ-01-17.1 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 255 agcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctac 314
           |||||||| |||||||| || || ||||||||||||||||| || ||||| || || |||
Sbjct: 87  agcaacatttgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtac 146

                
Query: 315 catgg 319
           |||||
Sbjct: 147 catgg 151

---

>gb|DQ056131.1| Coprinellus disseminatus strain TJ-00.94.4 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 255 agcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctac 314
           |||||||| |||||||| || || ||||||||||||||||| || ||||| || || |||
Sbjct: 87  agcaacatttgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtac 146

                
Query: 315 catgg 319
           |||||
Sbjct: 147 catgg 151

---

>gb|DQ056130.1| Coprinellus disseminatus strain TJ-01-10.3 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 255 agcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctac 314
           |||||||| |||||||| || || ||||||||||||||||| || ||||| || || |||
Sbjct: 87  agcaacatttgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtac 146

                
Query: 315 catgg 319
           |||||
Sbjct: 147 catgg 151

---

>gb|DQ056129.1| Coprinellus disseminatus strain TJ-01-14.1 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 255 agcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctac 314
           |||||||| |||||||| || || ||||||||||||||||| || ||||| || || |||
Sbjct: 87  agcaacatttgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtac 146

                
Query: 315 catgg 319
           |||||
Sbjct: 147 catgg 151

---

>gb|DQ056128.1| Coprinellus disseminatus strain TJ-00-99.3 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 255 agcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctac 314
           |||||||| |||||||| || || ||||||||||||||||| || ||||| || || |||
Sbjct: 87  agcaacatttgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtac 146

                
Query: 315 catgg 319
           |||||
Sbjct: 147 catgg 151

---

>gb|DQ056127.1| Coprinellus disseminatus strain TJ-01-02.7 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 255 agcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctac 314
           |||||||| |||||||| || || ||||||||||||||||| || ||||| || || |||
Sbjct: 87  agcaacatttgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtac 146

                
Query: 315 catgg 319
           |||||
Sbjct: 147 catgg 151

---

>gb|DQ056126.1| Coprinellus disseminatus strain TJ-01-11.2 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 255 agcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctac 314
           |||||||| |||||||| || || ||||||||||||||||| || ||||| || || |||
Sbjct: 87  agcaacatttgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtac 146

                
Query: 315 catgg 319
           |||||
Sbjct: 147 catgg 151

---

>gb|DQ056125.1| Coprinellus disseminatus strain TJ-01-18.5 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 615

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 255 agcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctac 314
           |||||||| |||||||| || || ||||||||||||||||| || ||||| || || |||
Sbjct: 85  agcaacatttgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtac 144

                
Query: 315 catgg 319
           |||||
Sbjct: 145 catgg 149

---

>gb|DQ056124.1| Coprinellus disseminatus strain TJ-01-19.2 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 615

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 255 agcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctac 314
           |||||||| |||||||| || || ||||||||||||||||| || ||||| || || |||
Sbjct: 85  agcaacatttgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtac 144

                
Query: 315 catgg 319
           |||||
Sbjct: 145 catgg 149

---

>gb|DQ056123.1| Coprinellus disseminatus strain TJ-01-08.1 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 615

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 255 agcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctac 314
           |||||||| |||||||| || || ||||||||||||||||| || ||||| || || |||
Sbjct: 85  agcaacatttgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtac 144

                
Query: 315 catgg 319
           |||||
Sbjct: 145 catgg 149

---

>gb|DQ056122.1| Coprinellus disseminatus strain TJ-01-14.2 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 615

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 255 agcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctac 314
           |||||||| |||||||| || || ||||||||||||||||| || ||||| || || |||
Sbjct: 85  agcaacatttgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtac 144

                
Query: 315 catgg 319
           |||||
Sbjct: 145 catgg 149

---

>gb|DQ056119.1| Coprinellus disseminatus strain TJ-01-13.3 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 255 agcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctac 314
           |||||||| |||||||| || || ||||||||||||||||| || ||||| || || |||
Sbjct: 87  agcaacatttgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtac 146

                
Query: 315 catgg 319
           |||||
Sbjct: 147 catgg 151

---

>gb|DQ056118.1| Coprinellus disseminatus strain TJ-01-13.8 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 255 agcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctac 314
           |||||||| |||||||| || || ||||||||||||||||| || ||||| || || |||
Sbjct: 87  agcaacatttgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtac 146

                
Query: 315 catgg 319
           |||||
Sbjct: 147 catgg 151

---

>gb|DQ056117.1| Coprinellus disseminatus strain TJ-01-09.3 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 255 agcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctac 314
           |||||||| |||||||| || || ||||||||||||||||| || ||||| || || |||
Sbjct: 87  agcaacatttgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtac 146

                
Query: 315 catgg 319
           |||||
Sbjct: 147 catgg 151

---

>gb|DQ056116.1| Coprinellus disseminatus strain TJ-00-38.6 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 255 agcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctac 314
           |||||||| |||||||| || || ||||||||||||||||| || ||||| || || |||
Sbjct: 87  agcaacatttgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtac 146

                
Query: 315 catgg 319
           |||||
Sbjct: 147 catgg 151

---

>gb|DQ056115.1| Coprinellus disseminatus strain TJ-01-12.4 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 255 agcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctac 314
           |||||||| |||||||| || || ||||||||||||||||| || ||||| || || |||
Sbjct: 87  agcaacatttgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtac 146

                
Query: 315 catgg 319
           |||||
Sbjct: 147 catgg 151

---

>gb|DQ056114.1| Coprinellus disseminatus strain TJ-01-07.1 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 255 agcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctac 314
           |||||||| |||||||| || || ||||||||||||||||| || ||||| || || |||
Sbjct: 87  agcaacatttgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtac 146

                
Query: 315 catgg 319
           |||||
Sbjct: 147 catgg 151

---

>gb|DQ056113.1| Coprinellus disseminatus strain TJ-01-06.2 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 255 agcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctac 314
           |||||||| |||||||| || || ||||||||||||||||| || ||||| || || |||
Sbjct: 87  agcaacatttgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtac 146

                
Query: 315 catgg 319
           |||||
Sbjct: 147 catgg 151

---

>gb|DQ056112.1| Coprinellus disseminatus strain TJ-00-89.2 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 255 agcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctac 314
           |||||||| |||||||| || || ||||||||||||||||| || ||||| || || |||
Sbjct: 87  agcaacatttgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtac 146

                
Query: 315 catgg 319
           |||||
Sbjct: 147 catgg 151

---

>gb|DQ056111.1| Coprinellus disseminatus strain TJ-01-15.1 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 255 agcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctac 314
           |||||||| |||||||| || || ||||||||||||||||| || ||||| || || |||
Sbjct: 87  agcaacatttgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtac 146

                
Query: 315 catgg 319
           |||||
Sbjct: 147 catgg 151

---

>gb|DQ056110.1| Coprinellus disseminatus strain TJ-01-07.6 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 255 agcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctac 314
           |||||||| |||||||| || || ||||||||||||||||| || ||||| || || |||
Sbjct: 87  agcaacatttgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtac 146

                
Query: 315 catgg 319
           |||||
Sbjct: 147 catgg 151

---

>gb|DQ056109.1| Coprinellus disseminatus strain TJ-01-09.1 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 255 agcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctac 314
           |||||||| |||||||| || || ||||||||||||||||| || ||||| || || |||
Sbjct: 87  agcaacatttgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtac 146

                
Query: 315 catgg 319
           |||||
Sbjct: 147 catgg 151

---

>gb|DQ056108.1| Coprinellus disseminatus strain TJ-01-11.5 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 255 agcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctac 314
           |||||||| |||||||| || || ||||||||||||||||| || ||||| || || |||
Sbjct: 87  agcaacatttgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtac 146

                
Query: 315 catgg 319
           |||||
Sbjct: 147 catgg 151

---

>gb|DQ056107.1| Coprinellus disseminatus strain TJ-01-10.2 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 255 agcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctac 314
           |||||||| |||||||| || || ||||||||||||||||| || ||||| || || |||
Sbjct: 87  agcaacatttgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtac 146

                
Query: 315 catgg 319
           |||||
Sbjct: 147 catgg 151

---

>gb|DQ056106.1| Coprinellus disseminatus strain TJ-01-16.3 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 255 agcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctac 314
           |||||||| |||||||| || || ||||||||||||||||| || ||||| || || |||
Sbjct: 87  agcaacatttgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtac 146

                
Query: 315 catgg 319
           |||||
Sbjct: 147 catgg 151

---

>gb|DQ056105.1| Coprinellus disseminatus strain TJ-01-18.3 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 255 agcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctac 314
           |||||||| |||||||| || || ||||||||||||||||| || ||||| || || |||
Sbjct: 87  agcaacatttgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtac 146

                
Query: 315 catgg 319
           |||||
Sbjct: 147 catgg 151

---

>gb|DQ056104.1| Coprinellus disseminatus strain TJ-00-38.3 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 255 agcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctac 314
           |||||||| |||||||| || || ||||||||||||||||| || ||||| || || |||
Sbjct: 87  agcaacatttgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtac 146

                
Query: 315 catgg 319
           |||||
Sbjct: 147 catgg 151

---

>gb|DQ056103.1| Coprinellus disseminatus strain TJ-00-94.5 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 255 agcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctac 314
           |||||||| |||||||| || || ||||||||||||||||| || ||||| || || |||
Sbjct: 87  agcaacatttgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtac 146

                
Query: 315 catgg 319
           |||||
Sbjct: 147 catgg 151

---

>gb|DQ056102.1| Coprinellus disseminatus strain TJ-01-17.6 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 255 agcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctac 314
           |||||||| |||||||| || || ||||||||||||||||| || ||||| || || |||
Sbjct: 87  agcaacatttgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtac 146

                
Query: 315 catgg 319
           |||||
Sbjct: 147 catgg 151

---

>gb|DQ056101.1| Coprinellus disseminatus strain TJ-00-89.1 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 255 agcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctac 314
           |||||||| |||||||| || || ||||||||||||||||| || ||||| || || |||
Sbjct: 87  agcaacatttgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtac 146

                
Query: 315 catgg 319
           |||||
Sbjct: 147 catgg 151

---

>gb|DQ056100.1| Coprinellus disseminatus strain TJ-01-20.6 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 255 agcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctac 314
           |||||||| |||||||| || || ||||||||||||||||| || ||||| || || |||
Sbjct: 87  agcaacatttgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtac 146

                
Query: 315 catgg 319
           |||||
Sbjct: 147 catgg 151

---

>gb|DQ056099.1| Coprinellus disseminatus strain TJ-01-20.5 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 255 agcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctac 314
           |||||||| |||||||| || || ||||||||||||||||| || ||||| || || |||
Sbjct: 87  agcaacatttgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtac 146

                
Query: 315 catgg 319
           |||||
Sbjct: 147 catgg 151

---

>gb|DQ056098.1| Coprinellus disseminatus strain TJ-01-05.1 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 255 agcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctac 314
           |||||||| |||||||| || || ||||||||||||||||| || ||||| || || |||
Sbjct: 87  agcaacatttgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtac 146

                
Query: 315 catgg 319
           |||||
Sbjct: 147 catgg 151

---

>gb|DQ056097.1| Coprinellus disseminatus strain TJ-00-99.1 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 255 agcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctac 314
           |||||||| |||||||| || || ||||||||||||||||| || ||||| || || |||
Sbjct: 87  agcaacatttgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtac 146

                
Query: 315 catgg 319
           |||||
Sbjct: 147 catgg 151

---

>gb|DQ056096.1| Coprinellus disseminatus strain TJ-01-08.2 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 255 agcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctac 314
           |||||||| |||||||| || || ||||||||||||||||| || ||||| || || |||
Sbjct: 87  agcaacatttgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtac 146

                
Query: 315 catgg 319
           |||||
Sbjct: 147 catgg 151

---

>gb|DQ056095.1| Coprinellus disseminatus strain TJ-00-91.1 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 255 agcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctac 314
           |||||||| |||||||| || || ||||||||||||||||| || ||||| || || |||
Sbjct: 87  agcaacatttgcaccgcccaagccttgctcgccaacatggctgccatgtacgcagtgtac 146

                
Query: 315 catgg 319
           |||||
Sbjct: 147 catgg 151

---

>gb|DQ056094.1| Coprinellus disseminatus strain TJ-01-04.4 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 615

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 255 agcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctac 314
           |||||||| |||||||| || || ||||||||||||||||| || ||||| || || |||
Sbjct: 85  agcaacatttgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtac 144

                
Query: 315 catgg 319
           |||||
Sbjct: 145 catgg 149

---

>gb|DQ056093.1| Coprinellus disseminatus strain TJ-01-04.1 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 255 agcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctac 314
           |||||||| |||||||| || || ||||||||||||||||| || ||||| || || |||
Sbjct: 87  agcaacatttgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtac 146

                
Query: 315 catgg 319
           |||||
Sbjct: 147 catgg 151

---

>gb|DQ056092.1| Coprinellus disseminatus strain TJ-01-02.5 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 255 agcaacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctac 314
           |||||||| |||||||| || || ||||||||||||||||| || ||||| || || |||
Sbjct: 87  agcaacatttgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtac 146

                
Query: 315 catgg 319
           |||||
Sbjct: 147 catgg 151

---

>gb|AE005674.1| Shigella flexneri 2a str. 301, complete genome
          Length = 4607203

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                           
Query: 69      gcgcaacgcttcggcgtgcccatggggtacggcggcccgcacgc 112
               |||||||||||||||||||| ||||| ||||| ||||| |||||
Sbjct: 2982148 gcgcaacgcttcggcgtgccgatgggctacggtggcccacacgc 2982105

---

>gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, complete genome
          Length = 3188609

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 73/88 (82%)
 Strand = Plus / Plus

                                                                          
Query: 32     gccgggcgagattggcgccgacatcgccgtgggctccgcgcaacgcttcggcgtgcccat 91
              |||||||| ||| ||||||||||||||| | |||||    || || ||||||||||| ||
Sbjct: 807088 gccgggcgcgatgggcgccgacatcgccatcggctcgagccagcggttcggcgtgccgat 807147

                                          
Query: 92     ggggtacggcggcccgcacgctgccttc 119
              ||| |||||||| ||||| || ||||||
Sbjct: 807148 gggctacggcggtccgcatgcggccttc 807175



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                          
Query: 216    cagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgcag 275
              |||||| | |||||||| ||||| || || |||||||||   ||| ||||||||||||||
Sbjct: 807272 cagacccgcgagcagcatatccgccgcgagaaggccacctcgaacgtctgcaccgcgcag 807331

                 
Query: 276    gcg 278
              |||
Sbjct: 807332 gcg 807334

---

>gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, complete sequence
          Length = 3510148

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                           
Query: 45      ggcgccgacatcgccgtgggctccgcgcaacgcttcggcgtgcccatggggtacggcggc 104
               ||||| ||| ||||||| |||  | |||| |||||||||||||| ||||| | |||||||
Sbjct: 3098314 ggcgcggacgtcgccgtcggcaacacgcagcgcttcggcgtgccgatgggcttcggcggc 3098255

                       
Query: 105     ccgcacgc 112
               ||||||||
Sbjct: 3098254 ccgcacgc 3098247



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 68/82 (82%)
 Strand = Plus / Minus

                                                                           
Query: 262     tctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatggtc 321
               ||||||||||||||||| ||||||| | |||||||   ||||| || |||||||| || |
Sbjct: 3098097 tctgcaccgcgcaggcgctgctcgcgatcatggcgagcatgtacgcggtctaccacggcc 3098038

                                     
Query: 322     cggctggcctgaaggcgatcgc 343
               ||   ||||||||| |||||||
Sbjct: 3098037 cgcgcggcctgaagacgatcgc 3098016

---

>gb|AY462111.1| Pleurotus djamor ketopantoate reductase-like protein (KPAR), GDP-fucose
             transporter-like protein (GDPF), glycine
             dehydrogenase-like protein (GLYDH), hypothetical protein
             PDUPA1 (PDUPA1) genes, complete cds; HD2 homeodomain
             mating-type protein (a2) gene, a2-A7 allele, complete cds;
             HD1 homeodomain mating-type protein (a1) gene, a1-A7
             allele, complete cds; mitochondrial intermediate peptidase
             (MIP) gene, complete cds, nuclear gene for mitochondrial
             protein; hypothetical protein PDUPA2 (UPA2), hypothetical
             protein PDUPA3 (UPA3), putative glycogenin protein
             (GLGEN), putative NADH:flavin oxidoreductase 1 (FMNOR1),
             putative NADH:flavin oxidoreductase 2 (FMNOR2), and
             hypothetical protein PDUPA4 (UPA4) genes, complete cds
          Length = 75294

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                     
Query: 285   gccaacatggcggcgatgtatgccgtctaccatggtccgg 324
             ||||||||||| ||||||||||| ||||| ||||||||||
Sbjct: 21385 gccaacatggctgcgatgtatgctgtctatcatggtccgg 21424

---

>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence
          Length = 4126292

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Plus

                                                                          
Query: 45     ggcgccgacatcgccgtgggctccgcgcaacgcttcggcgtgcccatggggtacggcggc 104
              ||||| ||| ||||||| |||  | |||| |||||||||||||| ||||| | |||||||
Sbjct: 135770 ggcgcggacgtcgccgtcggcaacacgcagcgcttcggcgtgccgatgggcttcggcggc 135829

                      
Query: 105    ccgcacgc 112
              ||||||||
Sbjct: 135830 ccgcacgc 135837



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 68/82 (82%)
 Strand = Plus / Plus

                                                                          
Query: 262    tctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatggtc 321
              ||||||||||||||||| ||||||| | |||||||   ||||| || |||||||| || |
Sbjct: 135987 tctgcaccgcgcaggcgctgctcgcgatcatggcgagcatgtacgcggtctaccacggcc 136046

                                    
Query: 322    cggctggcctgaaggcgatcgc 343
              ||   ||||||||| |||||||
Sbjct: 136047 cgcgcggcctgaagacgatcgc 136068

---

>ref|XM_796990.1| PREDICTED: Strongylocentrotus purpuratus similar to glycine
            decarboxylase, transcript variant 6 (LOC578453), mRNA
          Length = 4954

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 85/104 (81%)
 Strand = Plus / Plus

                                                                        
Query: 216  cagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgcag 275
            ||||||||||| ||||||||| || | || ||||| || ||||||||||||||  | |||
Sbjct: 1321 cagaccagggaacagcacatcaggagggagaaggcaacaagcaacatctgcacatctcag 1380

                                                        
Query: 276  gcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 319
            ||  | ||||| ||| || | || |||||||||||||| |||||
Sbjct: 1381 gctctcctcgctaacctgtcagccatgtatgccgtctatcatgg 1424

---

>ref|XM_796977.1| PREDICTED: Strongylocentrotus purpuratus similar to glycine
            decarboxylase, transcript variant 5 (LOC578453), mRNA
          Length = 4930

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 85/104 (81%)
 Strand = Plus / Plus

                                                                        
Query: 216  cagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgcag 275
            ||||||||||| ||||||||| || | || ||||| || ||||||||||||||  | |||
Sbjct: 1297 cagaccagggaacagcacatcaggagggagaaggcaacaagcaacatctgcacatctcag 1356

                                                        
Query: 276  gcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 319
            ||  | ||||| ||| || | || |||||||||||||| |||||
Sbjct: 1357 gctctcctcgctaacctgtcagccatgtatgccgtctatcatgg 1400

---

>ref|XM_775475.1| PREDICTED: Strongylocentrotus purpuratus similar to glycine
            decarboxylase, transcript variant 1 (LOC578453), mRNA
          Length = 4957

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 85/104 (81%)
 Strand = Plus / Plus

                                                                        
Query: 216  cagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgcag 275
            ||||||||||| ||||||||| || | || ||||| || ||||||||||||||  | |||
Sbjct: 1324 cagaccagggaacagcacatcaggagggagaaggcaacaagcaacatctgcacatctcag 1383

                                                        
Query: 276  gcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 319
            ||  | ||||| ||| || | || |||||||||||||| |||||
Sbjct: 1384 gctctcctcgctaacctgtcagccatgtatgccgtctatcatgg 1427

---

>ref|XM_796947.1| PREDICTED: Strongylocentrotus purpuratus similar to glycine
           decarboxylase, transcript variant 4 (LOC578453), mRNA
          Length = 4307

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 85/104 (81%)
 Strand = Plus / Plus

                                                                       
Query: 216 cagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgcag 275
           ||||||||||| ||||||||| || | || ||||| || ||||||||||||||  | |||
Sbjct: 674 cagaccagggaacagcacatcaggagggagaaggcaacaagcaacatctgcacatctcag 733

                                                       
Query: 276 gcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 319
           ||  | ||||| ||| || | || |||||||||||||| |||||
Sbjct: 734 gctctcctcgctaacctgtcagccatgtatgccgtctatcatgg 777

---

>ref|XM_796929.1| PREDICTED: Strongylocentrotus purpuratus similar to glycine
           decarboxylase, transcript variant 3 (LOC578453), mRNA
          Length = 4390

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 85/104 (81%)
 Strand = Plus / Plus

                                                                       
Query: 216 cagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgcag 275
           ||||||||||| ||||||||| || | || ||||| || ||||||||||||||  | |||
Sbjct: 766 cagaccagggaacagcacatcaggagggagaaggcaacaagcaacatctgcacatctcag 825

                                                       
Query: 276 gcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 319
           ||  | ||||| ||| || | || |||||||||||||| |||||
Sbjct: 826 gctctcctcgctaacctgtcagccatgtatgccgtctatcatgg 869

---

>ref|XM_796904.1| PREDICTED: Strongylocentrotus purpuratus similar to glycine
           decarboxylase, transcript variant 2 (LOC578453), mRNA
          Length = 4378

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 85/104 (81%)
 Strand = Plus / Plus

                                                                       
Query: 216 cagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgcag 275
           ||||||||||| ||||||||| || | || ||||| || ||||||||||||||  | |||
Sbjct: 751 cagaccagggaacagcacatcaggagggagaaggcaacaagcaacatctgcacatctcag 810

                                                       
Query: 276 gcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 319
           ||  | ||||| ||| || | || |||||||||||||| |||||
Sbjct: 811 gctctcctcgctaacctgtcagccatgtatgccgtctatcatgg 854

---

>gb|U00096.2| Escherichia coli K-12 MG1655, complete genome
          Length = 4639675

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                           
Query: 69      gcgcaacgcttcggcgtgcccatggggtacggcggcccgcacgc 112
               |||||||||||||||||||| ||||| ||||| ||||| |||||
Sbjct: 3046256 gcgcaacgcttcggcgtgccgatgggctacggtggcccacacgc 3046213

---

>emb|X73958.1|ECGCVOP E.coli gcv operon DNA sequence
          Length = 5582

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                        
Query: 69   gcgcaacgcttcggcgtgcccatggggtacggcggcccgcacgc 112
            |||||||||||||||||||| ||||| ||||| ||||| |||||
Sbjct: 2711 gcgcaacgcttcggcgtgccgatgggctacggtggcccacacgc 2754

---

>emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromosome 1, complete sequence
          Length = 4074542

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Plus

                                                                           
Query: 45      ggcgccgacatcgccgtgggctccgcgcaacgcttcggcgtgcccatggggtacggcggc 104
               ||||| ||| ||||||| |||  | |||| |||||||||||||| ||||| | |||||||
Sbjct: 3987389 ggcgcggacgtcgccgtcggcaacacgcagcgcttcggcgtgccgatgggcttcggcggc 3987448

                       
Query: 105     ccgcacgc 112
               ||||||||
Sbjct: 3987449 ccgcacgc 3987456



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 68/82 (82%)
 Strand = Plus / Plus

                                                                           
Query: 262     tctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatggtc 321
               ||||||||||||||||| ||||||| | |||||||   ||||| || |||||||| || |
Sbjct: 3987606 tctgcaccgcgcaggcgctgctcgcgatcatggcgagcatgtacgcggtctaccacggcc 3987665

                                     
Query: 322     cggctggcctgaaggcgatcgc 343
               ||   ||||||||| |||||||
Sbjct: 3987666 cgcgcggcctgaagacgatcgc 3987687

---

>emb|AL161582.2|ATCHRIV78 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 78
          Length = 198669

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                              
Query: 272    gcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 319
              |||||||||||| ||||||||||| || |||||||| || ||||||||
Sbjct: 151576 gcaggcgttgcttgccaacatggctgccatgtatgctgtttaccatgg 151529

---

>emb|AL031804.1|ATF26P21 Arabidopsis thaliana DNA chromosome 4, BAC clone F26P21 (ESSA project)
          Length = 94482

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                             
Query: 272   gcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 319
             |||||||||||| ||||||||||| || |||||||| || ||||||||
Sbjct: 60880 gcaggcgttgcttgccaacatggctgccatgtatgctgtttaccatgg 60833

---

>emb|AL035525.1|ATF4I10 Arabidopsis thaliana DNA chromosome 4, BAC clone F4I10 (ESSA project)
          Length = 111876

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                            
Query: 272  gcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 319
            |||||||||||| ||||||||||| || |||||||| || ||||||||
Sbjct: 4116 gcaggcgttgcttgccaacatggctgccatgtatgctgtttaccatgg 4069

---

>dbj|AP009048.1| Escherichia coli W3110 DNA, complete genome
          Length = 4646332

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                           
Query: 69      gcgcaacgcttcggcgtgcccatggggtacggcggcccgcacgc 112
               |||||||||||||||||||| ||||| ||||| ||||| |||||
Sbjct: 3046890 gcgcaacgcttcggcgtgccgatgggctacggtggcccacacgc 3046847

---

>gb|AE014073.1| Shigella flexneri 2a str. 2457T, complete genome
          Length = 4599354

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                           
Query: 69      gcgcaacgcttcggcgtgcccatggggtacggcggcccgcacgc 112
               |||||||||||||||||||| ||||| ||||| ||||| |||||
Sbjct: 2974237 gcgcaacgcttcggcgtgccgatgggctacggtggcccacacgc 2974194

---

>gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, complete sequence
          Length = 3809201

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                               
Query: 70      cgcaacgcttcggcgtgcccatggggtacggcggcccgcacgctgcct 117
               |||| |||||||||||||| ||||| | ||||||||||||||| ||||
Sbjct: 3712278 cgcagcgcttcggcgtgccgatgggcttcggcggcccgcacgccgcct 3712231

---

>gb|AY544772.1| Brassica napus glycine decarboxylase P-protein-like gene, partial
            sequence
          Length = 3254

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                            
Query: 272  gcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 319
            |||||||||||| ||||||||||| || |||||||| || ||||||||
Sbjct: 2921 gcaggcgttgcttgccaacatggctgccatgtatgctgtttaccatgg 2968



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                       
Query: 207  atggcaatgcagaccagggagcagcacatccggcgagacaaggccaccagcaacatctg 265
            ||||| |||||||| ||||| ||||| ||| || | ||||| ||||| |||||||||||
Sbjct: 2777 atggcgatgcagactagggaacagcatatcaggagggacaaagccactagcaacatctg 2835

---

>gb|AY544771.1| Moricandia nitens glycine decarboxylase P-protein gene, partial cds
          Length = 2966

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                            
Query: 272  gcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 319
            |||||||||||| ||||||||||| || |||||||| || ||||||||
Sbjct: 2632 gcaggcgttgcttgccaacatggctgccatgtatgctgtttaccatgg 2679



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                       
Query: 207  atggcaatgcagaccagggagcagcacatccggcgagacaaggccaccagcaacatctg 265
            ||||| |||||||| ||||| ||||| ||| || | ||||| ||||| |||||||||||
Sbjct: 2488 atggcgatgcagactagggaacagcatatcaggagggacaaagccactagcaacatctg 2546

---

>gb|U28377.1|ECU28377 Escherichia coli K-12 genome; approximately 65 to 68 minutes
          Length = 141744

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                        
Query: 69   gcgcaacgcttcggcgtgcccatggggtacggcggcccgcacgc 112
            |||||||||||||||||||| ||||| ||||| ||||| |||||
Sbjct: 2625 gcgcaacgcttcggcgtgccgatgggctacggtggcccacacgc 2582

---

>gb|CP000036.1| Shigella boydii Sb227, complete genome
          Length = 4519823

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                           
Query: 69      gcgcaacgcttcggcgtgcccatggggtacggcggcccgcacgc 112
               |||||||||||||||||||| ||||| ||||| ||||| |||||
Sbjct: 3090240 gcgcaacgcttcggcgtgccgatgggctacggtggcccacacgc 3090283

---

>gb|CP000038.1| Shigella sonnei Ss046, complete genome
          Length = 4825265

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                           
Query: 69      gcgcaacgcttcggcgtgcccatggggtacggcggcccgcacgc 112
               |||||||||||||||||||| ||||| ||||| ||||| |||||
Sbjct: 3218039 gcgcaacgcttcggcgtgccgatgggctacggtggcccacacgc 3217996

---

>gb|L20872.1|ECOGCVHP Escherichia coli gcvH gene, 3' end; gcvP gene, complete cds
          Length = 3438

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                        
Query: 69   gcgcaacgcttcggcgtgcccatggggtacggcggcccgcacgc 112
            |||||||||||||||||||| ||||| ||||| ||||| |||||
Sbjct: 1010 gcgcaacgcttcggcgtgccgatgggctacggtggcccacacgc 1053

---

>gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence
          Length = 3694126

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                         
Query: 70     cgcaacgcttcggcgtgcccatggggtacggcggcccgcacgc 112
              |||| |||||||||||||| ||||| | |||||||||||||||
Sbjct: 170895 cgcagcgcttcggcgtgccgatgggcttcggcggcccgcacgc 170853

---

>ref|XM_517277.1| PREDICTED: Pan troglodytes similar to Glycine decarboxylase
           (LOC461307), mRNA
          Length = 2349

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 219 accagggagcagcacatccggcgagacaaggccaccagcaacatctg 265
           ||||||||||| ||||| | | |||||||||| ||||||||||||||
Sbjct: 183 accagggagcaacacattcagagagacaaggctaccagcaacatctg 229

---

>gb|AE017283.1| Propionibacterium acnes KPA171202, complete genome
          Length = 2560265

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 54/63 (85%)
 Strand = Plus / Minus

                                                                          
Query: 214    tgcagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgc 273
              |||||||| | || ||||||||||| || ||||||||||| ||||| ||||| ||||| |
Sbjct: 815232 tgcagacccgtgaacagcacatccgccgtgacaaggccacgagcaatatctgtaccgctc 815173

                 
Query: 274    agg 276
              |||
Sbjct: 815172 agg 815170



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 68/83 (81%)
 Strand = Plus / Minus

                                                                          
Query: 30     ccgccgggcgagattggcgccgacatcgccgtgggctccgcgcaacgcttcggcgtgccc 89
              |||||||| ||| | || || ||| ||||||| |||||  |||||||||||||||| || 
Sbjct: 815416 ccgccgggtgagctaggtgctgacgtcgccgtcggctcgtcgcaacgcttcggcgtcccg 815357

                                     
Query: 90     atggggtacggcggcccgcacgc 112
              |||||  | ||||| ||||||||
Sbjct: 815356 atgggtaatggcggaccgcacgc 815334

---

>gb|CP000352.1| Ralstonia metallidurans CH34, complete genome
          Length = 3928089

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 78/95 (82%)
 Strand = Plus / Plus

                                                                           
Query: 228     cagcacatccggcgagacaaggccaccagcaacatctgcaccgcgcaggcgttgctcgcc 287
               ||||||||||| || || ||||||||    ||||||||||| |||||||  ||||| |||
Sbjct: 3764339 cagcacatccgccgcgagaaggccacgtcgaacatctgcacggcgcaggtcttgctggcc 3764398

                                                  
Query: 288     aacatggcggcgatgtatgccgtctaccatggtcc 322
                  |||||| ||||||| || ||||||||||||||
Sbjct: 3764399 gtgatggcgtcgatgtacgcggtctaccatggtcc 3764433

---

>ref|XM_538655.2| PREDICTED: Canis familiaris similar to Glycine dehydrogenase
            [decarboxylating], mitochondrial precursor (Glycine
            decarboxylase) (Glycine cleavage system P-protein),
            transcript variant 1 (LOC481534), mRNA
          Length = 3614

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                           
Query: 219  accagggagcagcacatccggcgagacaaggccaccagcaacatctg 265
            |||||||| || ||||||||| |||||||||| || |||||||||||
Sbjct: 1108 accagggaacaacacatccggagagacaaggctactagcaacatctg 1154

---

>ref|XM_859381.1| PREDICTED: Canis familiaris similar to Glycine dehydrogenase
            [decarboxylating], mitochondrial precursor (Glycine
            decarboxylase) (Glycine cleavage system P-protein),
            transcript variant 3 (LOC481534), mRNA
          Length = 3665

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                           
Query: 219  accagggagcagcacatccggcgagacaaggccaccagcaacatctg 265
            |||||||| || ||||||||| |||||||||| || |||||||||||
Sbjct: 1108 accagggaacaacacatccggagagacaaggctactagcaacatctg 1154

---

>ref|XM_859367.1| PREDICTED: Canis familiaris similar to Glycine dehydrogenase
           [decarboxylating], mitochondrial precursor (Glycine
           decarboxylase) (Glycine cleavage system P-protein),
           transcript variant 2 (LOC481534), mRNA
          Length = 2683

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 219 accagggagcagcacatccggcgagacaaggccaccagcaacatctg 265
           |||||||| || ||||||||| |||||||||| || |||||||||||
Sbjct: 177 accagggaacaacacatccggagagacaaggctactagcaacatctg 223

---

>gb|DQ056143.1| Coprinellus disseminatus strain C345.1 mating-type gene locus, complete
             sequence, and flanking genomic region
          Length = 75497

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                         
Query: 225   gagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgcaggcgttgctc 284
             |||||||| || || || || ||||| || |||||||| |||||||| || || ||||||
Sbjct: 16181 gagcagcatattcgtcgcgagaaggctactagcaacatttgcaccgcccaagctttgctc 16240

                        
Query: 285   gccaacatggc 295
             |||||||||||
Sbjct: 16241 gccaacatggc 16251

---

>gb|CP000249.1| Frankia sp. CcI3, complete genome
          Length = 5433628

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                      
Query: 214     tgcagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcac 268
               |||||||| | |||||||||||||| || || ||||| || ||||||||||||||
Sbjct: 4866882 tgcagacccgtgagcagcacatccgacgggagaaggcgacgagcaacatctgcac 4866828

---

>gb|DQ226717.1| Boechera divaricarpa isolate SLW-A-A05 mRNA sequence
          Length = 436

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 273 caggcgttgctcgccaacatggcggcgatgtatgccgtctaccatggtcc 322
           ||||||||||| || |||||| | ||||||||||| || |||||||||||
Sbjct: 7   caggcgttgcttgcaaacatgactgcgatgtatgctgtttaccatggtcc 56

---

>gb|CP000026.1| Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150
          Length = 4585229

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                                 
Query: 63      ggctccgcgcaacgcttcggcgtgcccatggggtacggcggcccgcacgc 112
               ||||| |||||||| || ||||| || ||||||||||| |||||||||||
Sbjct: 3031830 ggctctgcgcaacgttttggcgtaccgatggggtacggtggcccgcacgc 3031781

---

>gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome
          Length = 6438405

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                            
Query: 68      cgcgcaacgcttcggcgtgcccatggggtacggcggcccgcacgc 112
               |||||||||||||||||||||  |||| | ||| |||||||||||
Sbjct: 4952158 cgcgcaacgcttcggcgtgccgctgggcttcggtggcccgcacgc 4952202

---

>emb|BX571871.1| Photorhabdus luminescens subsp. laumondii TTO1 complete genome; segment
             13/17
          Length = 349944

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 94/117 (80%)
 Strand = Plus / Minus

                                                                         
Query: 204   cgcatggcaatgcagaccagggagcagcacatccggcgagacaaggccaccagcaacatc 263
             |||||||||||||||||| | |||||||| ||||| || || || || |    |||||||
Sbjct: 77672 cgcatggcaatgcagacccgtgagcagcatatccgtcgtgagaaagcgaattccaacatc 77613

                                                                      
Query: 264   tgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatggt 320
             || || || |||| |||||| || || || |||||||||||||| || || ||||||
Sbjct: 77612 tgtacggctcaggtgttgctggcaaatatcgcggcgatgtatgcggtatatcatggt 77556

---

>gb|AE002098.2| Neisseria meningitidis MC58, complete genome
          Length = 2272360

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                        
Query: 72      caacgcttcggcgtgcccatggggtacggcggcccgcacgc 112
               ||||||||||||||||| ||||| | |||||| ||||||||
Sbjct: 1749965 caacgcttcggcgtgccgatgggcttcggcgggccgcacgc 1750005

---

>dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, complete genome
          Length = 3566135

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                            
Query: 225     gagcagcacatccggcgagacaaggccaccagcaacatctgcacc 269
               ||||||||||||||||| || ||||||||   |||||||||||||
Sbjct: 2064166 gagcagcacatccggcgtgagaaggccacgtccaacatctgcacc 2064122

---

>emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete genome
          Length = 5178466

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 51/60 (85%)
 Strand = Plus / Minus

                                                                           
Query: 257     caacatctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctacca 316
               |||||||||||||||||||| | |||| ||    |||||| |||||||||| ||||||||
Sbjct: 1398268 caacatctgcaccgcgcaggtgctgctggcggtgatggcgtcgatgtatgcggtctacca 1398209

---

>emb|BX950851.1| Erwinia carotovora subsp. atroseptica SCRI1043, complete genome
          Length = 5064019

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                              
Query: 78     ttcggcgtgcccatggggtacggcggcccgcacgctgccttcctcgcc 125
              ||||||||||| ||||| ||||||||||| ||||| || ||| |||||
Sbjct: 815472 ttcggcgtgccgatgggctacggcggcccacacgcggcgttcttcgcc 815519

---

>gb|AE012210.1| Xanthomonas campestris pv. campestris str. ATCC 33913,  section 118
            of 460 of the complete genome
          Length = 10029

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                                
Query: 225  gagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgcagg 276
            ||||| ||||| || || || |||||||||  ||||||||||||||||||||
Sbjct: 4793 gagcaacacattcgtcgcgaaaaggccacctccaacatctgcaccgcgcagg 4742

---

>gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, complete genome
          Length = 5148708

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                                   
Query: 225     gagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgcagg 276
               ||||| ||||| || || || |||||||||  ||||||||||||||||||||
Sbjct: 3746476 gagcaacacattcgtcgcgaaaaggccacctccaacatctgcaccgcgcagg 3746527

---

>dbj|AK110181.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-161-H05, full
            insert sequence
          Length = 3429

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                            
Query: 222  agggagcagcacatccggcgagacaaggccac 253
            ||||| ||||||||||| ||||||||||||||
Sbjct: 1235 agggaacagcacatccgccgagacaaggccac 1266

---

>gb|AE017343.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 3, complete
              sequence
          Length = 2105742

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                 
Query: 282    ctcgccaacatggcggcgatgtatgccgtctacca 316
              |||||||||||||| || ||||| |||||||||||
Sbjct: 307127 ctcgccaacatggccgccatgtacgccgtctacca 307161

---

>gb|CP000058.1| Pseudomonas syringae pv. phaseolicola 1448A, complete genome
          Length = 5928787

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 86/107 (80%)
 Strand = Plus / Minus

                                                                           
Query: 213     atgcagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcg 272
               ||||||||| | || ||||| || || || || ||||||||||||||||| ||||| || 
Sbjct: 1365704 atgcagacccgcgaacagcatattcgtcgcgagaaggccaccagcaacatttgcactgca 1365645

                                                              
Query: 273     caggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 319
               ||||   |||| |||||||| ||    ||||| ||||||||||||||
Sbjct: 1365644 caggtcctgctggccaacatcgccagcatgtacgccgtctaccatgg 1365598

---

>ref|XM_569428.1| Cryptococcus neoformans var. neoformans JEC21 glycine dehydrogenase
            mitochondrial precursor (CNC01070) partial mRNA
          Length = 3385

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                               
Query: 282  ctcgccaacatggcggcgatgtatgccgtctacca 316
            |||||||||||||| || ||||| |||||||||||
Sbjct: 1262 ctcgccaacatggccgccatgtacgccgtctacca 1296

---

>gb|CP000316.1| Polaromonas sp. JS666, complete genome
          Length = 5200264

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                                  
Query: 75      cgcttcggcgtgcccatggggtacggcggcccgcacgctgccttcctcgcc 125
               ||||| ||| ||||||||||  |||| ||||||||||| |||| |||||||
Sbjct: 1927958 cgctttggcatgcccatgggcaacggtggcccgcacgcggcctacctcgcc 1927908



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                                   
Query: 225     gagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgcagg 276
               |||||||| ||||| || || || ||||||  ||||||||||||||| ||||
Sbjct: 1927808 gagcagcatatccgccgcgaaaaagccacctccaacatctgcaccgcccagg 1927757

---

>dbj|AP008231.1| Synechococcus elongatus PCC 6301 DNA, complete genome
          Length = 2696255

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 53/63 (84%)
 Strand = Plus / Minus

                                                                           
Query: 214     tgcagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgc 273
               |||||||  ||||||| || || || || ||||||||||| ||||| |||||||| ||||
Sbjct: 2197589 tgcagacgcgggagcaacatattcgtcgcgacaaggccacgagcaatatctgcacggcgc 2197530

                  
Query: 274     agg 276
               |||
Sbjct: 2197529 agg 2197527



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 151    tgcccggccgcatcatcggtgtgagc 176
              ||||||||||||||| ||||||||||
Sbjct: 788369 tgcccggccgcatcaccggtgtgagc 788344

---

>gb|AE017285.1| Desulfovibrio vulgaris subsp. vulgaris str. Hildenborough, complete genome
          Length = 3570858

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                              
Query: 33      ccgggcgagattggcgccgacatcgccgtgg 63
               ||||||||||| || ||||||||||||||||
Sbjct: 1499952 ccgggcgagatgggggccgacatcgccgtgg 1499922

---

>ref|NM_204322.1| Gallus gallus glycine dehydrogenase (decarboxylating; glycine
            decarboxylase, glycine cleavage system protein P) (GLDC),
            mRNA
          Length = 3514

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 77/95 (81%)
 Strand = Plus / Plus

                                                                        
Query: 225  gagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgcaggcgttgctc 284
            |||||||||||| || | || || || ||||||||||||||||| || |||||  | || 
Sbjct: 1057 gagcagcacatcaggagggataaagctaccagcaacatctgcactgcacaggctctcctg 1116

                                               
Query: 285  gccaacatggcggcgatgtatgccgtctaccatgg 319
            || || ||||| || |||||||  |||||||||||
Sbjct: 1117 gctaatatggcagccatgtatggtgtctaccatgg 1151

---

>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                           
Query: 214     tgcagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgc 273
               |||||||| | || ||||||||||| || || ||||| |||  ||||||||||||||| |
Sbjct: 2651290 tgcagacccgcgaacagcacatccgccgggagaaggcgacctccaacatctgcaccgccc 2651349

                  
Query: 274     agg 276
               |||
Sbjct: 2651350 agg 2651352

---

>dbj|D90266.1|CHKGDCMR Gallus gallus mRNA for glycine decarboxylase, complete cds
          Length = 3514

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 77/95 (81%)
 Strand = Plus / Plus

                                                                        
Query: 225  gagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgcaggcgttgctc 284
            |||||||||||| || | || || || ||||||||||||||||| || |||||  | || 
Sbjct: 1057 gagcagcacatcaggagggataaagctaccagcaacatctgcactgcacaggctctcctg 1116

                                               
Query: 285  gccaacatggcggcgatgtatgccgtctaccatgg 319
            || || ||||| || |||||||  |||||||||||
Sbjct: 1117 gctaatatggcagccatgtatggtgtctaccatgg 1151

---

>gb|M64402.1|CHKPP Chicken glycine decarboxylase mRNA, complete cds
          Length = 3509

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 77/95 (81%)
 Strand = Plus / Plus

                                                                        
Query: 225  gagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgcaggcgttgctc 284
            |||||||||||| || | || || || ||||||||||||||||| || |||||  | || 
Sbjct: 1067 gagcagcacatcaggagggataaagctaccagcaacatctgcactgcacaggctctcctg 1126

                                               
Query: 285  gccaacatggcggcgatgtatgccgtctaccatgg 319
            || || ||||| || |||||||  |||||||||||
Sbjct: 1127 gctaatatggcagccatgtatggtgtctaccatgg 1161

---

>gb|CP000100.1| Synechococcus elongatus PCC 7942, complete genome
          Length = 2695903

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                           
Query: 214     tgcagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgc 273
               |||||||  ||||||| || || || || ||||||||||| ||||| |||||||| ||||
Sbjct: 2119441 tgcagacgcgggagcaacatattcgtcgcgacaaggccacgagcaatatctgcacggcgc 2119500

                  
Query: 274     agg 276
               |||
Sbjct: 2119501 agg 2119503



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 151    tgcccggccgcatcatcggtgtgagc 176
              ||||||||||||||| ||||||||||
Sbjct: 832498 tgcccggccgcatcaccggtgtgagc 832523

---

>gb|CP000097.1| Synechococcus sp. CC9902, complete genome
          Length = 2234828

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 58/70 (82%)
 Strand = Plus / Minus

                                                                           
Query: 214     tgcagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgcaccgcgc 273
               |||||||| | ||||||||||||||  | || |||||||| |||||||| || || ||||
Sbjct: 2096939 tgcagacccgagagcagcacatccgcagggataaggccacgagcaacatttgtacggcgc 2096880

                         
Query: 274     aggcgttgct 283
               | | ||||||
Sbjct: 2096879 aagtgttgct 2096870

---

>gb|CP000302.1| Shewanella denitrificans OS217, complete genome
          Length = 4545906

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                    
Query: 75     cgcttcggcgtgcccatggggtacggcggcccgcacgc 112
              ||||| ||||| || ||||||||||||||||| |||||
Sbjct: 957174 cgctttggcgtacctatggggtacggcggcccacacgc 957211

---

>emb|AL627277.1| Salmonella enterica serovar Typhi (Salmonella typhi) strain CT18,
              complete chromosome; segment 13/20
          Length = 230050

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                                
Query: 63     ggctccgcgcaacgcttcggcgtgcccatggggtacggcggcccgcacgc 112
              ||||| |||||||| || ||||| || ||||| ||||| |||||||||||
Sbjct: 100731 ggctctgcgcaacgttttggcgtaccgatgggttacggtggcccgcacgc 100682

---

>gb|AC124968.36| Medicago truncatula clone mth2-15e21, complete sequence
          Length = 106968

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 64/78 (82%)
 Strand = Plus / Minus

                                                                         
Query: 521   gatcaccgttgcctttgatgagaccaccaccttggaggatgttgacaagctgttcaaggt 580
             |||||| | ||| |||||||| || || || || ||||||||||| ||||| ||||| ||
Sbjct: 72163 gatcactgctgcgtttgatgaaacaactacattagaggatgttgataagcttttcaaagt 72104

                               
Query: 581   tttctctggtggcaagcc 598
             |||  | |||||||||||
Sbjct: 72103 ttttgccggtggcaagcc 72086

---

>gb|AC004747.3| Arabidopsis thaliana chromosome 2 clone T19L18 map B68, complete
             sequence
          Length = 87080

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 58/70 (82%)
 Strand = Plus / Plus

                                                                         
Query: 207   atggcaatgcagaccagggagcagcacatccggcgagacaaggccaccagcaacatctgc 266
             ||||| |||||||| ||||| ||||| |||||  | || || || |||||||||||||| 
Sbjct: 31873 atggctatgcagactagggaacagcatatccgcagggataaagctaccagcaacatctgt 31932

                       
Query: 267   accgcgcagg 276
             ||||| ||||
Sbjct: 31933 accgctcagg 31942

---

>gb|AE014613.1| Salmonella enterica subsp. enterica serovar Typhi Ty2, complete genome
          Length = 4791961

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                                 
Query: 63      ggctccgcgcaacgcttcggcgtgcccatggggtacggcggcccgcacgc 112
               ||||| |||||||| || ||||| || ||||| ||||| |||||||||||
Sbjct: 3062226 ggctctgcgcaacgttttggcgtaccgatgggttacggtggcccgcacgc 3062177

---

>gb|CP000155.1| Hahella chejuensis KCTC 2396, complete genome
          Length = 7215267

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                         
Query: 258     aacatctgcaccgcgcaggcgttgct 283
               ||||||||||||||||||||| ||||
Sbjct: 4004247 aacatctgcaccgcgcaggcgctgct 4004222

---

>gb|AY742967.1| Hepatitis C virus isolate G4MP102 E2 protein gene, partial cds
          Length = 172

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 168 ggtgtgagcgtcgactccagc 188
           |||||||||||||||||||||
Sbjct: 82  ggtgtgagcgtcgactccagc 62

---

>gb|AF321274.2| Staphylococcus aureus SA2198 and disulfide bond protein A (dsbA)
           genes, complete cds
          Length = 1076

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 516 aacacgatcaccgttgccttt 536
           |||||||||||||||||||||
Sbjct: 243 aacacgatcaccgttgccttt 223

---

>gb|AE017180.1| Geobacter sulfurreducens PCA, complete genome
          Length = 3814139

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                   
Query: 57     gccgtgggctccgcgcaacgcttcggcgtgcccatgg 93
              ||||||||||||||  ||| |||||||||| ||||||
Sbjct: 269170 gccgtgggctccgccaaactcttcggcgtgtccatgg 269134

---

>gb|CP000285.1| Chromohalobacter salexigens DSM 3043, complete genome
          Length = 3696649

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 72/89 (80%)
 Strand = Plus / Minus

                                                                           
Query: 204     cgcatggcaatgcagaccagggagcagcacatccggcgagacaaggccaccagcaacatc 263
               |||||||| ||||| ||| | |||||||||||||| || || ||||| ||   |||||| 
Sbjct: 2060264 cgcatggccatgcaaacccgcgagcagcacatccgccgggaaaaggcgacgtccaacatt 2060205

                                            
Query: 264     tgcaccgcgcaggcgttgctcgccaacat 292
               || ||||| |||||| | || ||||||||
Sbjct: 2060204 tgtaccgcccaggcgctactggccaacat 2060176

---

>ref|XM_659648.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN7136.2), mRNA
          Length = 4878

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                     
Query: 225  gagcagcacatccggcgagacaaggccaccagcaacatctg 265
            ||||||||||| || || || ||||| ||||||||||||||
Sbjct: 1228 gagcagcacattcgtcgcgaaaaggcaaccagcaacatctg 1268

---

>gb|CP000360.1| Acidobacteria bacterium Ellin345, complete genome
          Length = 5650368

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 68      cgcgcaacgcttcggcgtgcc 88
               |||||||||||||||||||||
Sbjct: 2610695 cgcgcaacgcttcggcgtgcc 2610715

---

>gb|DQ506958.1| Hepatitis C virus isolate P1 clone A5894 polyprotein precursor,
           gene, partial cds
          Length = 528

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 168 ggtgtgagcgtcgactccagc 188
           |||||||||||||||||||||
Sbjct: 189 ggtgtgagcgtcgactccagc 169

---

>gb|DQ506957.1| Hepatitis C virus isolate P1 clone A5805 polyprotein precursor,
           gene, partial cds
          Length = 528

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 168 ggtgtgagcgtcgactccagc 188
           |||||||||||||||||||||
Sbjct: 189 ggtgtgagcgtcgactccagc 169

---

>gb|DQ504505.1| Hepatitis C virus isolate P1 clone B4899 polyprotein precursor,
           gene, partial cds
          Length = 528

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 168 ggtgtgagcgtcgactccagc 188
           |||||||||||||||||||||
Sbjct: 189 ggtgtgagcgtcgactccagc 169

---

>gb|DQ504504.1| Hepatitis C virus isolate P1 clone B4898 polyprotein precursor,
           gene, partial cds
          Length = 528

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 168 ggtgtgagcgtcgactccagc 188
           |||||||||||||||||||||
Sbjct: 189 ggtgtgagcgtcgactccagc 169

---

>gb|DQ504503.1| Hepatitis C virus isolate P1 clone B4897 polyprotein precursor,
           gene, partial cds
          Length = 528

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 168 ggtgtgagcgtcgactccagc 188
           |||||||||||||||||||||
Sbjct: 189 ggtgtgagcgtcgactccagc 169

---

>gb|DQ504502.1| Hepatitis C virus isolate P1 clone B4896 polyprotein precursor,
           gene, partial cds
          Length = 528

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 168 ggtgtgagcgtcgactccagc 188
           |||||||||||||||||||||
Sbjct: 189 ggtgtgagcgtcgactccagc 169

---

>gb|DQ504501.1| Hepatitis C virus isolate P1 clone B4895 polyprotein precursor,
           gene, partial cds
          Length = 528

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 168 ggtgtgagcgtcgactccagc 188
           |||||||||||||||||||||
Sbjct: 189 ggtgtgagcgtcgactccagc 169

---

>gb|DQ504500.1| Hepatitis C virus isolate P1 clone B4894 polyprotein precursor,
           gene, partial cds
          Length = 528

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 168 ggtgtgagcgtcgactccagc 188
           |||||||||||||||||||||
Sbjct: 189 ggtgtgagcgtcgactccagc 169

---

>gb|DQ504499.1| Hepatitis C virus isolate P1 clone B4893 polyprotein precursor,
           gene, partial cds
          Length = 528

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 168 ggtgtgagcgtcgactccagc 188
           |||||||||||||||||||||
Sbjct: 189 ggtgtgagcgtcgactccagc 169

---

>gb|DQ504498.1| Hepatitis C virus isolate P1 clone B4891 polyprotein precursor,
           gene, partial cds
          Length = 528

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 168 ggtgtgagcgtcgactccagc 188
           |||||||||||||||||||||
Sbjct: 189 ggtgtgagcgtcgactccagc 169

---

>gb|DQ504497.1| Hepatitis C virus isolate P1 clone B4890 polyprotein precursor,
           gene, partial cds
          Length = 528

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 168 ggtgtgagcgtcgactccagc 188
           |||||||||||||||||||||
Sbjct: 189 ggtgtgagcgtcgactccagc 169


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,224,026
Number of Sequences: 3902068
Number of extensions: 4224026
Number of successful extensions: 80317
Number of sequences better than 10.0: 331
Number of HSP's better than 10.0 without gapping: 332
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 73518
Number of HSP's gapped (non-prelim): 6777
length of query: 629
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 606
effective length of database: 17,143,297,704
effective search space: 10388838408624
effective search space used: 10388838408624
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---