Clone Information

BLAST Search Result

Clone Name	bah62i05
Clone Library Name	barley_pub

No.	Definition	Score (bits)	E Value
1	gb\|AF327413.1\|AF327413 Oryza sativa translational elongation fac...	476	e-131
2	gb\|BT018667.1\| Zea mays clone EL01N0510C05.d mRNA sequence	460	e-126
3	ref\|XM_466527.1\| Oryza sativa (japonica cultivar-group), mRNA	452	e-124
4	ref\|XM_507491.1\| PREDICTED Oryza sativa (japonica cultivar-group...	452	e-124
5	ref\|XM_506850.2\| PREDICTED Oryza sativa (japonica cultivar-group...	452	e-124
6	dbj\|AP008208.1\| Oryza sativa (japonica cultivar-group) genomic D...	452	e-124
7	dbj\|AP004023.3\| Oryza sativa (japonica cultivar-group) genomic D...	452	e-124
8	dbj\|AK064937.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	452	e-124
9	dbj\|AK104785.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	444	e-121
10	gb\|AF145053.1\|AF145053 Oryza sativa chloroplast translational el...	438	e-120
11	dbj\|AK119587.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	436	e-119
12	gb\|AY105509.1\| Zea mays PCO100031 mRNA sequence	420	e-114
13	gb\|CP000110.1\| Synechococcus sp. CC9605, complete genome	107	4e-20
14	emb\|BX569694.1\| Synechococcus sp. WH8102 complete genome; segmen...	88	4e-14
15	gb\|AF109211.1\|AF109211 Synechococcus WH8103 elongation factor Tu...	88	4e-14
16	ref\|XM_466528.1\| Oryza sativa (japonica cultivar-group), mRNA	84	6e-13
17	dbj\|AK066858.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	84	6e-13
18	ref\|XM_323038.1\| Neurospora crassa OR74A hypothetical protein ( ...	80	9e-12
19	ref\|XM_956420.1\| Neurospora crassa OR74A hypothetical protein ( ...	80	9e-12
20	gb\|AY372040.1\| Lactobacillus paracasei strain NCC 2461 Tuf gene,...	80	9e-12
21	gb\|AY372039.1\| Lactobacillus paracasei strain NCC 989 Tuf gene, ...	80	9e-12
22	emb\|AJ459399.1\|LPA459399 Lactobacillus paracasei subsp. paracase...	80	9e-12
23	emb\|AJ459398.1\|LPA459398 Lactobacillus paracasei subsp. paracase...	80	9e-12
24	emb\|AJ459397.1\|LPA459397 Lactobacillus paracasei subsp. paracase...	80	9e-12
25	emb\|AJ459396.1\|LPA459396 Lactobacillus paracasei subsp. paracase...	80	9e-12
26	emb\|AJ459395.1\|LPA459395 Lactobacillus paracasei subsp. tolerans...	80	9e-12
27	emb\|AJ459394.1\|LPA459394 Lactobacillus paracasei subsp. paracase...	80	9e-12
28	emb\|AJ459393.1\|LPA459393 Lactobacillus paracasei subsp. paracase...	80	9e-12
29	emb\|AJ459392.1\|LPA459392 Lactobacillus paracasei subsp. paracase...	80	9e-12
30	emb\|AJ459391.1\|LPA459391 Lactobacillus paracasei subsp. paracase...	80	9e-12
31	emb\|AJ459389.1\|LPA459389 Lactobacillus paracasei subsp. paracase...	80	9e-12
32	emb\|AJ459388.1\|LPA459388 Lactobacillus paracasei subsp. paracase...	80	9e-12
33	emb\|AJ459387.1\|LZE459387 Lactobacillus zeae partial mRNA for put...	80	9e-12
34	emb\|AJ459386.1\|LCA459386 Lactobacillus casei partial mRNA for pu...	80	9e-12
35	emb\|AJ459385.1\|LPA459385 Lactobacillus paracasei subsp. paracase...	80	9e-12
36	emb\|AJ418937.2\|LCA418937 Lactobacillus paracasei subsp. paracase...	80	9e-12
37	emb\|AJ418923.2\|LCA418923 Lactobacillus casei partial mRNA for pu...	80	9e-12
38	emb\|AJ418922.2\|LCA418922 Lactobacillus paracasei subsp. tolerans...	80	9e-12
39	emb\|AJ418912.2\|LCA418912 Lactobacillus casei subsp. pseudoplanta...	80	9e-12
40	emb\|AL513467.1\|NC17E5 Neurospora crassa DNA linkage group V Cosm...	80	9e-12
41	emb\|X66062.1\|GMTUFA G.max tufA gene for chloroplast translation ...	78	3e-11
42	gb\|CP000097.1\| Synechococcus sp. CC9902, complete genome	76	1e-10
43	gb\|U09443.1\|PEU09443 Phormidium ectocarpi PCC 7375 protein synth...	76	1e-10
44	gb\|AY372038.1\| Lactobacillus casei strain NCC 2508 Tuf gene, par...	72	2e-09
45	emb\|AJ459390.1\|LCA459390 Lactobacillus casei subsp. casei partia...	72	2e-09
46	emb\|AJ418933.2\|LZE418933 Lactobacillus zeae partial mRNA for put...	72	2e-09
47	gb\|CP000142.2\| Pelobacter carbinolicus DSM 2380, complete genome	70	8e-09
48	dbj\|AP006627.1\| Bacillus clausii KSM-K16 DNA, complete genome	70	8e-09
49	gb\|U09444.1\|PBU09444 Plectonema boryanum PCC 73110 protein synth...	68	3e-08
50	gb\|M94204.1\|TOBTEFTU Nicotiana tabacum translation elongation fa...	68	3e-08
51	dbj\|D11469.1\|TOBTUFA2 Nicotiana sylvestris tufA gene for chlorop...	68	3e-08
52	dbj\|D11375.1\|TOBTUFA N. sylvestris tufA gene for chloroplast elo...	68	3e-08
53	emb\|CR628336.1\| Legionella pneumophila str. Paris complete genome	66	1e-07
54	gb\|BT014591.1\| Lycopersicon esculentum clone 134061F, mRNA sequence	64	5e-07
55	emb\|X17442.1\|ANORF150 A.nidulans DNA for a region containing ORF...	64	5e-07
56	dbj\|AP007154.1\| Aspergillus oryzae RIB40 genomic DNA, SC001	64	5e-07
57	dbj\|AP008231.1\| Synechococcus elongatus PCC 6301 DNA, complete g...	64	5e-07
58	gb\|CP000100.1\| Synechococcus elongatus PCC 7942, complete genome	64	5e-07
59	emb\|Z99104.2\|BSUB0001 Bacillus subtilis complete genome (section...	62	2e-06
60	gb\|AF234537.1\|AF234537 Pelargonium graveolens chloroplast transl...	62	2e-06
61	dbj\|BA000004.3\| Bacillus halodurans C-125 DNA, complete genome	62	2e-06
62	dbj\|D64127.1\| Bacillus subtilis genes for RNA polymerase beta su...	62	2e-06
63	dbj\|AB017508.1\| Bacillus halodurans C-125 genomic DNA, 32 kb fra...	62	2e-06
64	emb\|AJ781773.3\| Lactobacillus buchneri partial tuf gene for elon...	60	8e-06
65	emb\|AL111934.1\|CNS019PI Botrytis cinerea strain T4 cDNA library	60	8e-06
66	dbj\|BA000028.3\| Oceanobacillus iheyensis HTE831 DNA, complete ge...	60	8e-06
67	gb\|U09445.1\|PHU09445 Prochlorothrix hollandica protein synthesis...	60	8e-06
68	gb\|AE017194.1\| Bacillus cereus ATCC 10987, complete genome	58	3e-05
69	gb\|U09434.1\|GSU09434 Gloeothece PCC6501 protein synthesis elonga...	58	3e-05
70	gb\|CP000153.1\| Thiomicrospira denitrificans ATCC 33889, complete...	56	1e-04
71	gb\|AY372037.1\| Lactobacillus rhamnosus strain NCC 2504 Tuf gene,...	56	1e-04
72	gb\|AY305397.1\| Synthetic construct reconstructed ancestral elong...	56	1e-04
73	emb\|Y15107.1\|GMTUFA2 Glycine max tufA2 gene	56	1e-04
74	emb\|X98830.1\|PRFUSTUF P.rosea fus, tuf, rpsJ and rplC genes	56	1e-04
75	emb\|X76867.1\|FF13524 F.ferrugineum (DSM 13524) tuf gene	56	1e-04
76	emb\|CR522870.1\| Desulfotalea psychrophila LSv54 chromosome	56	1e-04
77	emb\|AJ786714.1\| Lactobacillus kimchii partial tuf gene for elong...	56	1e-04
78	emb\|AJ786713.1\| Lactobacillus alimentarius partial tuf gene for ...	56	1e-04
79	emb\|AJ459829.1\|LRH459829 Lactobacillus rhamnosus partial tuf gen...	56	1e-04
80	emb\|AJ459828.1\|LRH459828 Lactobacillus rhamnosus partial tuf gen...	56	1e-04
81	emb\|AJ418939.2\|LRH418939 Lactobacillus rhamnosus partial mRNA fo...	56	1e-04
82	emb\|AJ418930.2\|LAG418930 Lactobacillus agilis partial mRNA for p...	56	1e-04
83	emb\|AJ418920.2\|LPE418920 Lactobacillus pentosus partial mRNA for...	56	1e-04
84	gb\|U67308.1\|PRU67308 Planobispora rosea elongation factor Tu1 (t...	56	1e-04
85	gb\|DQ098151.1\| Uncultured Pseudonocardia sp. clone colony 30 Tuf...	54	5e-04
86	gb\|DQ098149.1\| Uncultured Pseudonocardia sp. clone colony 168 Tu...	54	5e-04
87	gb\|DQ098148.1\| Uncultured Pseudonocardia sp. clone colony 167 Tu...	54	5e-04
88	gb\|DQ098147.1\| Uncultured Pseudonocardia sp. clone colony SP0110...	54	5e-04
89	gb\|DQ098146.1\| Uncultured Pseudonocardia sp. clone colony CC0301...	54	5e-04
90	gb\|DQ098143.1\| Uncultured Pseudonocardia sp. clone colony CC0103...	54	5e-04
91	gb\|DQ098141.1\| Uncultured Pseudonocardia sp. clone colony 33 Tuf...	54	5e-04
92	gb\|DQ098140.1\| Uncultured Pseudonocardia sp. clone colony 101 Tu...	54	5e-04
93	gb\|DQ098139.1\| Uncultured Pseudonocardia sp. clone colony 12 Tuf...	54	5e-04
94	gb\|DQ098138.1\| Uncultured Pseudonocardia sp. clone colony 21 Tuf...	54	5e-04
95	gb\|DQ098136.1\| Uncultured Pseudonocardia sp. clone colony 31 Tuf...	54	5e-04
96	gb\|DQ098134.1\| Uncultured Pseudonocardia sp. clone colony 174 Tu...	54	5e-04
97	gb\|DQ098133.1\| Uncultured Pseudonocardia sp. clone colony 38 Tuf...	54	5e-04
98	gb\|DQ098132.1\| Uncultured Pseudonocardia sp. clone colony 43 Tuf...	54	5e-04
99	gb\|DQ098129.1\| Uncultured Pseudonocardia sp. clone colony 48 Tuf...	54	5e-04
100	gb\|DQ098126.1\| Uncultured Pseudonocardia sp. clone colony 117 Tu...	54	5e-04
101	gb\|DQ098123.1\| Uncultured Pseudonocardia sp. clone colony 20 Tuf...	54	5e-04
102	gb\|DQ098122.1\| Uncultured Pseudonocardia sp. clone colony 44 Tuf...	54	5e-04
103	gb\|DQ098121.1\| Uncultured Pseudonocardia sp. clone colony 170 Tu...	54	5e-04
104	gb\|DQ098120.1\| Uncultured Pseudonocardia sp. clone colony 24 Tuf...	54	5e-04
105	gb\|DQ098119.1\| Uncultured Pseudonocardia sp. clone colony 10 Tuf...	54	5e-04
106	gb\|DQ098118.1\| Uncultured Pseudonocardia sp. clone colony 13 Tuf...	54	5e-04
107	ref\|XM_387358.1\| Gibberella zeae PH-1 chromosome 4 hypothetical ...	54	5e-04
108	emb\|X77039.1\|SCTUF1FUS S.coelicolor tuf1 and fus genes	54	5e-04
109	emb\|AL939121.1\|SCO939121 Streptomyces coelicolor A3(2) complete ...	54	5e-04
110	emb\|AL596173.1\| Listeria innocua Clip11262 complete genome, segm...	54	5e-04
111	emb\|AL591984.1\| Listeria monocytogenes strain EGD, complete geno...	54	5e-04
112	gb\|AF274746.1\|AF274746 Listeria monocytogenes elongation factor ...	54	5e-04
113	gb\|AE017262.2\| Listeria monocytogenes str. 4b F2365, complete ge...	54	5e-04
114	ref\|XM_362579.1\| Magnaporthe grisea 70-15 hypothetical protein (...	52	0.002
115	gb\|AY305396.1\| Synthetic construct reconstructed ancestral elong...	52	0.002
116	gb\|AE016795.2\| Vibrio vulnificus CMCP6 chromosome I complete seq...	52	0.002
117	emb\|AJ786715.1\| Lactobacillus farciminis partial tuf gene for el...	52	0.002
118	dbj\|BA000037.2\| Vibrio vulnificus YJ016 DNA, chromosome I, compl...	52	0.002
119	dbj\|BA000031.2\| Vibrio parahaemolyticus RIMD 2210633 DNA, chromo...	52	0.002
120	gb\|CP000020.1\| Vibrio fischeri ES114 chromosome I, complete sequ...	52	0.002
121	gb\|AE017355.1\| Bacillus thuringiensis serovar konkukian str. 97-...	50	0.008
122	gb\|AE017334.2\| Bacillus anthracis str. 'Ames Ancestor', complete...	50	0.008
123	gb\|AE017225.1\| Bacillus anthracis str. Sterne, complete genome	50	0.008
124	gb\|CP000001.1\| Bacillus cereus E33L, complete genome	50	0.008
125	emb\|AJ544131.1\|PCA544131 Pleurochrysis carterae chloroplast part...	50	0.008
126	emb\|AJ418919.2\|LDE418919 Lactobacillus delbrueckii subsp. lactis...	50	0.008
127	emb\|AJ418911.2\|LDE418911 Lactobacillus delbrueckii subsp. delbru...	50	0.008
128	emb\|AJ418910.2\|LDE418910 Lactobacillus delbrueckii subsp. bulgar...	50	0.008
129	gb\|AF274736.1\|AF274736 Enterococcus saccharolyticus elongation f...	50	0.008
130	gb\|AE016877.1\| Bacillus cereus ATCC 14579, complete genome	50	0.008
131	gb\|AE016879.1\| Bacillus anthracis str. Ames, complete genome	50	0.008
132	emb\|AM049970.1\| Udotea orientalis plastid partial tufA gene for ...	50	0.008
133	ref\|NM_118155.2\| Arabidopsis thaliana ATP binding / GTP binding ...	48	0.030
134	ref\|XM_631056.1\| Dictyostelium discoideum hypothetical protein (...	48	0.030
135	gb\|AE017354.1\| Legionella pneumophila subsp. pneumophila str. Ph...	48	0.030
136	gb\|AY582542.1\| Streptococcus dysgalactiae strain CCRI-14550 elon...	48	0.030
137	gb\|AY582541.1\| Streptococcus dysgalactiae strain CCRI-14549 elon...	48	0.030
138	gb\|CP000003.1\| Streptococcus pyogenes MGAS10394, complete genome	48	0.030
139	gb\|CP000262.1\| Streptococcus pyogenes MGAS10750, complete genome	48	0.030
140	gb\|AY372042.1\| Bifidobacterium longum strain ATCC 15707 Tuf gene...	48	0.030
141	gb\|BT000998.1\| Arabidopsis thaliana clone U19264 putative transl...	48	0.030
142	gb\|BT000699.1\| Arabidopsis thaliana putative chloroplast transla...	48	0.030
143	gb\|AE004124.1\| Vibrio cholerae O1 biovar eltor str. N16961 chrom...	48	0.030
144	gb\|AE004120.1\| Vibrio cholerae O1 biovar eltor str. N16961 chrom...	48	0.030
145	gb\|CP000056.1\| Streptococcus pyogenes MGAS6180, complete genome	48	0.030
146	gb\|BT000687.1\| Arabidopsis thaliana clone RAFL09-18-H05 (R09411)...	48	0.030
147	gb\|CP000088.1\| Thermobifida fusca YX, complete genome	48	0.030
148	gb\|AY074355.1\| Arabidopsis thaliana putative translation elongat...	48	0.030
149	emb\|X52256.1\|ATTUFA A.thaliana tufA gene for elongation factor Tu	48	0.030
150	gb\|AY845412.1\| Neochlamydia hartmannellae translation elongation...	48	0.030
151	emb\|CR628337.1\| Legionella pneumophila str. Lens complete genome	48	0.030
152	emb\|AL161552.2\|ATCHRIV52 Arabidopsis thaliana DNA chromosome 4, ...	48	0.030
153	emb\|AL080253.2\|ATF9F13 Arabidopsis thaliana DNA chromosome 4, BA...	48	0.030
154	emb\|AJ555814.1\|PGI555814 Porphyromonas gingivalis partial ef-tu ...	48	0.030
155	emb\|AJ544132.1\|PDE544132 Pleurochrysis dentata chloroplast parti...	48	0.030
156	gb\|AE010001.1\| Streptococcus pyogenes strain MGAS8232, section 4...	48	0.030
157	gb\|AF419609.1\|AF419609 Arabidopsis thaliana AT4g20360/F9F13_10 m...	48	0.030
158	gb\|AF410329.1\|AF410329 Arabidopsis thaliana AT4g20360/F9F13_10 m...	48	0.030
159	emb\|BX827505.1\|CNS0A2SS Arabidopsis thaliana Full-length cDNA Co...	48	0.030
160	gb\|AF274733.1\|AF274733 Enterococcus pseudoavium strain ATCC49372...	48	0.030
161	gb\|CP000251.1\| Anaeromyxobacter dehalogenans 2CP-C, complete genome	48	0.030
162	gb\|BT002642.1\| Arabidopsis thaliana At4g20360/F9F13_10 gene, com...	48	0.030
163	dbj\|BA000022.2\| Synechocystis sp. PCC 6803 DNA, complete genome	48	0.030
164	gb\|AF153617.1\|AF153617 Streptomyces mobaraensis elongation facto...	48	0.030
165	gb\|AE016958.1\| Mycobacterium avium subsp. paratuberculosis str. ...	48	0.030
166	gb\|AE014295.3\| Bifidobacterium longum NCC2705, complete genome	48	0.030
167	gb\|DQ414204.1\| Staphylococcus aureus strain H116 TufA (tufA) gen...	46	0.12
168	gb\|DQ414203.1\| Staphylococcus aureus strain D547 TufA (tufA) gen...	46	0.12
169	gb\|DQ414202.1\| Staphylococcus aureus strain H591 TufA (tufA) gen...	46	0.12
170	gb\|DQ414201.1\| Staphylococcus aureus strain C2 TufA (tufA) gene,...	46	0.12
171	gb\|DQ414200.1\| Staphylococcus aureus strain H466 TufA (tufA) gen...	46	0.12
172	gb\|DQ414199.1\| Staphylococcus aureus strain EMRSA3 TufA (tufA) g...	46	0.12
173	gb\|DQ414198.1\| Staphylococcus aureus strain D535 TufA (tufA) gen...	46	0.12
174	gb\|DQ414197.1\| Staphylococcus aureus strain D97 TufA (tufA) gene...	46	0.12
175	gb\|DQ414196.1\| Staphylococcus aureus strain H560 TufA (tufA) gen...	46	0.12
176	gb\|DQ414195.1\| Staphylococcus aureus strain H417 TufA (tufA) gen...	46	0.12
177	gb\|DQ414194.1\| Staphylococcus aureus strain H707 TufA (tufA) gen...	46	0.12
178	gb\|DQ414193.1\| Staphylococcus aureus strain H295 TufA (tufA) gen...	46	0.12
179	gb\|DQ414192.1\| Staphylococcus aureus strain H831 TufA (tufA) gen...	46	0.12
180	gb\|DQ414191.1\| Staphylococcus aureus strain C101 TufA (tufA) gen...	46	0.12
181	gb\|DQ414190.1\| Staphylococcus aureus strain C437 TufA (tufA) gen...	46	0.12
182	gb\|DQ414189.1\| Staphylococcus aureus strain EMRSA9 TufA (tufA) g...	46	0.12
183	gb\|DQ414188.1\| Staphylococcus aureus strain EMRSA4 TufA (tufA) g...	46	0.12
184	gb\|DQ414187.1\| Staphylococcus aureus strain C720 TufA (tufA) gen...	46	0.12
185	gb\|DQ414186.1\| Staphylococcus aureus strain C640 TufA (tufA) gen...	46	0.12
186	gb\|DQ414185.1\| Staphylococcus aureus strain D17 TufA (tufA) gene...	46	0.12
187	gb\|DQ414184.1\| Staphylococcus aureus strain D470 TufA (tufA) gen...	46	0.12
188	gb\|DQ414183.1\| Staphylococcus aureus strain H512 TufA (tufA) gen...	46	0.12
189	gb\|DQ414182.1\| Staphylococcus aureus strain D22 TufA (tufA) gene...	46	0.12
190	gb\|DQ414181.1\| Staphylococcus aureus strain D274 TufA (tufA) gen...	46	0.12
191	gb\|DQ414180.1\| Staphylococcus aureus strain H783 TufA (tufA) gen...	46	0.12
192	gb\|DQ414179.1\| Staphylococcus aureus strain H402 TufA (tufA) gen...	46	0.12
193	gb\|DQ414178.1\| Staphylococcus aureus strain D365 TufA (tufA) gen...	46	0.12
194	gb\|DQ414177.1\| Staphylococcus aureus strain H19 TufA (tufA) gene...	46	0.12
195	gb\|DQ414176.1\| Staphylococcus aureus strain D456 TufA (tufA) gen...	46	0.12
196	emb\|X66322.1\|TAEFTUG T.aquaticus tufA and fus genes for elongati...	46	0.12
197	emb\|X89058.1\|GMRNAEFTU G.max DNA for EF-Tu chloroplast specific ...	46	0.12
198	emb\|X67057.1\|SRTUF1 S.ramocissimus tuf1 gene for elongation fact...	46	0.12
199	emb\|BX842654.1\| Bdellovibrio bacteriovorus complete genome, stra...	46	0.12
200	emb\|BX571857.1\| Staphylococcus aureus strain MSSA476, complete g...	46	0.12
201	gb\|AY741371.1\| Emiliania huxleyi strain CCMP 373 chloroplast, co...	46	0.12
202	gb\|CP000240.1\| Synechococcus sp. JA-2-3B'a(2-13), complete genome	46	0.12
203	dbj\|BA000017.4\| Staphylococcus aureus subsp. aureus Mu50 DNA, co...	46	0.12
204	dbj\|AP006716.1\| Staphylococcus haemolyticus JCSC1435 DNA, comple...	46	0.12
205	gb\|CP000046.1\| Staphylococcus aureus subsp. aureus COL, complete...	46	0.12
206	dbj\|AP008934.1\| Staphylococcus saprophyticus subsp. saprophyticu...	46	0.12
207	gb\|S79408.1\| tuf1=elongation factor Tu1 [Streptomyces collinus, ...	46	0.12
208	gb\|CP000253.1\| Staphylococcus aureus subsp. aureus NCTC 8325, co...	46	0.12
209	gb\|CP000255.1\| Staphylococcus aureus subsp. aureus USA300, compl...	46	0.12
210	gb\|AF298806.1\|AF298806 Staphylococcus warneri translation elonga...	46	0.12
211	gb\|AF298804.1\|AF298804 Staphylococcus saprophyticus translation ...	46	0.12
212	gb\|AF298803.1\|AF298803 Staphylococcus lugdunensis translation el...	46	0.12
213	gb\|AF298802.1\|AF298802 Staphylococcus hominis translation elonga...	46	0.12
214	gb\|AF298801.1\|AF298801 Staphylococcus haemolyticus translation e...	46	0.12
215	gb\|AF298800.1\|AF298800 Staphylococcus epidermidis translation el...	46	0.12
216	gb\|AF298798.1\|AF298798 Staphylococcus capitis translation elonga...	46	0.12
217	gb\|AF298796.1\|AF298796 Staphylococcus aureus translation elongat...	46	0.12
218	gb\|AF368284.1\|AF368284 Streptomyces aureofaciens strain 84/25 el...	46	0.12
219	gb\|AF274747.1\|AF274747 Listeria seeligeri elongation factor Tu (...	46	0.12
220	gb\|AF274740.1\|AF274740 Staphylococcus epidermidis elongation fac...	46	0.12
221	gb\|AF274739.1\|AF274739 Staphylococcus aureus elongation factor T...	46	0.12
222	gb\|AF274729.1\|AF274729 Enterococcus malodoratus strain ATCC43197...	46	0.12
223	dbj\|BA000030.2\| Streptomyces avermitilis MA-4680 genomic DNA, co...	46	0.12
224	gb\|AF269681.1\|AF269681 Staphylococcus epidermidis strain SR1 clo...	46	0.12
225	gb\|AF545609.1\| Emiliania huxleyi elongation factor Tu (tufA) gen...	46	0.12
226	dbj\|BA000033.2\| Staphylococcus aureus subsp. aureus MW2 DNA, com...	46	0.12
227	dbj\|AP008226.1\| Thermus thermophilus HB8 genomic DNA, complete g...	46	0.12
228	dbj\|BA000018.3\| Staphylococcus aureus subsp. aureus N315 genomic...	46	0.12
229	gb\|CP000029.1\| Staphylococcus epidermidis RP62A, complete genome	46	0.12
230	emb\|X05977.1\|TTTUF1 Thermus thermophilus tuf1 gene for elongatio...	46	0.12
231	emb\|X06657.1\|TTTUF Thermus thermophilus HB8 tuf gene for elongat...	46	0.12
232	emb\|BX571856.1\| Staphylococcus aureus subsp. aureus strain MRSA2...	46	0.12
233	gb\|AE015929.1\| Staphylococcus epidermidis ATCC 12228, complete g...	46	0.12
234	emb\|AJ938182.1\| Staphylococcus aureus RF122 complete genome	46	0.12
235	gb\|AF007125.1\|AF007125 Streptomyces aureofaciens elongation fact...	46	0.12
236	gb\|CP000148.1\| Geobacter metallireducens GS-15, complete genome	44	0.48
237	gb\|AY266999.1\| Streptococcus mitis ATCC 903 elongation factor Tu...	44	0.48
238	gb\|AY266998.1\| Streptococcus mitis elongation factor Tu (tuf) ge...	44	0.48
239	gb\|AY266996.1\| Streptococcus agalactiae CDCss-1073 elongation fa...	44	0.48
240	gb\|AY266993.1\| Streptococcus agalactiae ATCC 12403 elongation fa...	44	0.48
241	gb\|AF276274.1\| Streptococcus sanguinis elongation factor Tu (tuf...	44	0.48
242	gb\|AF276269.1\| Streptococcus mitis elongation factor Tu (tuf) ge...	44	0.48
243	gb\|AF276263.1\| Streptococcus dysgalactiae elongation factor Tu (...	44	0.48
244	gb\|AF276261.2\| Streptococcus cristatus elongation factor Tu (tuf...	44	0.48
245	gb\|AF276256.1\| Streptococcus agalactiae elongation factor Tu (tu...	44	0.48
246	gb\|AE006416.1\| Lactococcus lactis subsp. lactis IL1403 section 1...	44	0.48
247	gb\|CP000114.1\| Streptococcus agalactiae A909, complete genome	44	0.48
248	gb\|AY134478.1\| Salmonella bongori strain ATCC 43975 elongation f...	44	0.48
249	gb\|CP000117.1\| Anabaena variabilis ATCC 29413 chromosome, comple...	44	0.48
250	gb\|AE014226.1\| Streptococcus agalactiae 2603V/R section 36 of 10...	44	0.48
251	emb\|X76863.1\|BL20425 B.linens (DSM 20425) tuf gene	44	0.48
252	gb\|CP000095.1\| Prochlorococcus marinus str. NATL2A, complete genome	44	0.48
253	emb\|X52497.1\|CHCPSTR1 Cyanophora paradoxa cyanelle rps12, rps7 a...	44	0.48
254	emb\|BX950851.1\| Erwinia carotovora subsp. atroseptica SCRI1043, ...	44	0.48
255	emb\|BX294146.1\| Pirellula sp. strain 1 complete genome; segment ...	44	0.48
256	emb\|AL766847.1\|SAG766847 Streptococcus agalactiae NEM316 complet...	44	0.48
257	emb\|AJ891030.1\| Lactobacillus parabuchneri partial tuf gene for ...	44	0.48
258	gb\|AF274745.1\|AF274745 Lactococcus lactis elongation factor Tu (...	44	0.48
259	gb\|AF545608.1\| Rhodomonas abbreviata elongation factor Tu (tufA)...	44	0.48
260	emb\|CT573326.1\| Pseudomonas entomophila str. L48 chromosome,comp...	44	0.48
261	gb\|AE000520.1\| Treponema pallidum subsp. pallidum str. Nichols c...	44	0.48
262	gb\|U30821.1\|CPU30821 Cyanophora paradoxa cyanelle, complete genome	44	0.48
263	gb\|AY957604.1\| Pseudomonas putida EF-Tu-1 gene, complete cds	42	1.9
264	emb\|CR710932.2\|CNS0GBI8 Tetraodon nigroviridis full-length cDNA	42	1.9
265	emb\|CR706129.2\|CNS0G7ST Tetraodon nigroviridis full-length cDNA	42	1.9
266	emb\|CR692644.2\|CNS0FXE8 Tetraodon nigroviridis full-length cDNA	42	1.9
267	emb\|CR685186.2\|CNS0FRN2 Tetraodon nigroviridis full-length cDNA	42	1.9
268	emb\|CR684668.2\|CNS0FR8O Tetraodon nigroviridis full-length cDNA	42	1.9
269	emb\|CR679521.2\|CNS0FN9P Tetraodon nigroviridis full-length cDNA	42	1.9
270	emb\|CR674601.2\|CNS0FJHR Tetraodon nigroviridis full-length cDNA	42	1.9
271	emb\|CR671855.2\|CNS0FHDH Tetraodon nigroviridis full-length cDNA	42	1.9
272	emb\|CR663629.2\|CNS0FB0Z Tetraodon nigroviridis full-length cDNA	42	1.9
273	emb\|CR660686.2\|CNS0F8R8 Tetraodon nigroviridis full-length cDNA	42	1.9
274	emb\|CR641097.2\|CNS0ETN3 Tetraodon nigroviridis full-length cDNA	42	1.9
275	gb\|AY305395.1\| Synthetic construct reconstructed ancestral elong...	42	1.9
276	emb\|AL627281.1\| Salmonella enterica serovar Typhi (Salmonella ty...	42	1.9
277	emb\|AJ418938.2\|LFE418938 Lactobacillus fermentum partial mRNA fo...	42	1.9
278	emb\|AJ418913.2\|LRU418913 Lactobacillus ruminis partial mRNA for ...	42	1.9
279	dbj\|AP008230.1\| Desulfitobacterium hafniense Y51 genomic DNA, co...	42	1.9
280	gb\|CP000239.1\| Synechococcus sp. JA-3-3Ab, complete genome	42	1.9
281	gb\|CP000230.1\| Rhodospirillum rubrum ATCC 11170, complete genome	42	1.9
282	gb\|AF298799.1\|AF298799 Staphylococcus cohnii subsp. ureolyticus ...	42	1.9
283	gb\|AF274738.1\|AF274738 Enterococcus sulfureus elongation factor ...	42	1.9
284	gb\|AF274730.1\|AF274730 Enterococcus mundtii strain ATCC43186 elo...	42	1.9
285	gb\|AF274722.1\|AF274722 Enterococcus durans strain ATCC19432 elon...	42	1.9
286	gb\|AF274720.1\|AF274720 Enterococcus dispar strain ATCC51266 elon...	42	1.9
287	gb\|CP000026.1\| Salmonella enterica subsp. enterica serovar Parat...	42	1.9
288	dbj\|BA000039.2\| Thermosynechococcus elongatus BP-1 DNA, complete...	42	1.9
289	gb\|AE014613.1\| Salmonella enterica subsp. enterica serovar Typhi...	42	1.9
290	gb\|AF037997.1\|AF037997 Nannochloropsis oculata elongation factor...	42	1.9
291	gb\|AE015451.1\| Pseudomonas putida KT2440 complete genome	42	1.9
292	emb\|AL691454.15\| Mouse DNA sequence from clone RP23-423P8 on chr...	42	1.9
293	gb\|AE005674.1\| Shigella flexneri 2a str. 301, complete genome	40	7.4
294	gb\|DQ098135.1\| Uncultured Pseudonocardia sp. clone colony 113 Tu...	40	7.4
295	gb\|AC161484.4\| Mus musculus chromosome 5, clone RP23-6C10, compl...	40	7.4
296	gb\|AC119215.6\| Mus musculus chromosome 5, clone RP24-199K22, com...	40	7.4
297	gb\|AC147079.4\| Pan troglodytes BAC clone RP43-184E24 from 7, com...	40	7.4
298	gb\|AY582544.1\| Streptococcus oralis strain ATCC 10557 elongation...	40	7.4
299	gb\|AY267004.1\| Streptococcus parauberis DSM 6631 elongation fact...	40	7.4
300	gb\|AY266995.1\| Streptococcus agalactiae ATCC 13813 elongation fa...	40	7.4
301	gb\|AY266994.1\| Streptococcus agalactiae ATCC 12973 elongation fa...	40	7.4
302	gb\|CP000233.1\| Lactobacillus salivarius subsp. salivarius UCC118...	40	7.4
303	gb\|AY134479.1\| Raoultella ornithinolytica strain DSM 7464 elonga...	40	7.4
304	gb\|AY957605.1\| Pseudomonas putida EF-Tu-2 gene, complete cds	40	7.4
305	gb\|AY372049.1\| Lactobacillus johnsonii strain NCC 533 RpsT, RpsO...	40	7.4
306	gb\|AY372043.1\| Bifidobacterium longum bv. Infantis strain ATCC 1...	40	7.4
307	gb\|AY372036.1\| Lactobacillus johnsonii strain ATCC 33200 Tuf gen...	40	7.4
308	gb\|AY372035.1\| Lactobacillus gasseri strain ATCC 19992 Tuf gene,...	40	7.4
309	gb\|AC127236.3\| Mus musculus BAC clone RP24-351L1 from chromosome...	40	7.4
310	gb\|AC132389.3\| Mus musculus BAC clone RP23-448A4 from chromosome...	40	7.4
311	gb\|AC121973.2\| Mus musculus BAC clone RP24-276I10 from chromosom...	40	7.4
312	gb\|AE014075.1\| Escherichia coli CFT073, complete genome	40	7.4
313	emb\|X61957.1\|TTTUFB T.thermophilus HB8 tufB gene for elongation ...	40	7.4
314	gb\|CP000243.1\| Escherichia coli UTI89, complete genome	40	7.4
315	gb\|U00096.2\| Escherichia coli K-12 MG1655, complete genome	40	7.4
316	gb\|U00006.1\|ECOUW89 E. coli chromosomal region from 89.2 to 92.8...	40	7.4
317	emb\|Z67753.1\|OSCHLPLXX Odontella sinensis complete chloroplast g...	40	7.4
318	emb\|Z14314.1\|MLB1790G M.leprae genes rplL, rpoB, rpoC, end, rpsL...	40	7.4
319	emb\|Y15108.1\|GMTUFB2 Glycine max tufB2 gene	40	7.4
320	emb\|X98831.1\|SCFUSTUF S.cinnamoneus fus and tuf genes	40	7.4
321	gb\|AE008893.1\| Salmonella typhimurium LT2, section 197 of 220 of...	40	7.4
322	gb\|AE008858.1\| Salmonella typhimurium LT2, section 162 of 220 of...	40	7.4
323	emb\|X55117.1\|STTUFB S. typhimurium tufB gene for elongation fact...	40	7.4
324	emb\|X55116.1\|STTUFA S. typhimurium tufA gene for elongation fact...	40	7.4
325	emb\|AL627279.1\| Salmonella enterica serovar Typhi (Salmonella ty...	40	7.4
326	emb\|AL583923.1\|MLEPRTN7 Mycobacterium leprae strain TN complete ...	40	7.4
327	emb\|AJ418929.2\|LMU418929 Lactobacillus murinus partial mRNA for ...	40	7.4
328	emb\|AJ555817.1\|PGI555817 Porphyromonas gingivalis partial ef-tu ...	40	7.4
329	emb\|AJ555816.1\|PGI555816 Porphyromonas gingivalis partial ef-tu ...	40	7.4
330	emb\|AJ555815.1\|PGI555815 Porphyromonas gingivalis partial ef-tu ...	40	7.4
331	emb\|AJ555813.1\|PGI555813 Porphyromonas gingivalis partial ef-tu ...	40	7.4
332	emb\|AJ555811.1\|PGI555811 Porphyromonas gingivalis partial ef-tu ...	40	7.4
333	emb\|AJ555810.1\|PGI555810 Porphyromonas gingivalis partial ef-tu ...	40	7.4
334	emb\|AJ555809.1\|PGI555809 Porphyromonas gingivalis partial ef-tu ...	40	7.4
335	emb\|AJ555808.1\|PGI555808 Porphyromonas gingivalis partial ef-tu ...	40	7.4
336	emb\|AJ555807.1\|PGI555807 Porphyromonas gingivalis partial ef-tu ...	40	7.4
337	emb\|AJ555806.1\|PGI555806 Porphyromonas gingivalis partial ef-tu ...	40	7.4
338	emb\|AJ555805.1\|PGI555805 Porphyromonas gingivalis partial ef-tu ...	40	7.4
339	emb\|AJ555804.1\|PGI555804 Porphyromonas gingivalis partial ef-tu ...	40	7.4
340	emb\|AJ555803.1\|PGI555803 Porphyromonas gingivalis partial ef-tu ...	40	7.4
341	emb\|AJ555802.1\|PGI555802 Porphyromonas gingivalis partial ef-tu ...	40	7.4
342	emb\|AJ555801.1\|PGI555801 Porphyromonas gingivalis partial ef-tu ...	40	7.4
343	emb\|AJ555800.1\|PGI555800 Porphyromonas gingivalis partial ef-tu ...	40	7.4
344	emb\|AJ555799.1\|PGI555799 Porphyromonas gingivalis partial ef-tu ...	40	7.4
345	emb\|AJ418909.2\|LJE418909 Lactobacillus jensenii partial mRNA for...	40	7.4
346	emb\|AJ418908.2\|LJO418908 Lactobacillus johnsonii partial mRNA f...	40	7.4
347	dbj\|AP009048.1\| Escherichia coli W3110 DNA, complete genome	40	7.4
348	gb\|AE005800.1\| Caulobacter crescentus CB15 section 126 of 359 of...	40	7.4
349	gb\|AE005984.1\| Caulobacter crescentus CB15 section 310 of 359 of...	40	7.4
350	dbj\|D13869.1\|MSGEFTUA Mycobacterium leprae Tuf gene for elongati...	40	7.4
351	gb\|AC022164.8\| Homo sapiens chromosome 16 clone RP11-513N24, com...	40	7.4
352	gb\|CP000254.1\| Methanospirillum hungatei JF-1, complete genome	40	7.4
353	ref\|XM_691001.1\| PREDICTED: Danio rerio similar to chicken cadhe...	40	7.4
354	emb\|BX511023.8\| Zebrafish DNA sequence from clone DKEY-148A12 in...	40	7.4
355	gb\|AE006470.1\| Chlorobium tepidum TLS, complete genome	40	7.4
356	gb\|AC146149.2\| Pan troglodytes BAC clone RP43-37G13 from chromos...	40	7.4
357	gb\|AF274723.1\|AF274723 Enterococcus durans strain ATCC19432 elon...	40	7.4
358	gb\|J01690.1\|ECOSTR3 E.coli str operon with fusA and tufA genes c...	40	7.4
359	gb\|AE014073.1\| Shigella flexneri 2a str. 2457T, complete genome	40	7.4
360	gb\|AF545614.1\| Pylaiella littoralis elongation factor Tu (tufA) ...	40	7.4
361	dbj\|BA000040.2\| Bradyrhizobium japonicum USDA 110 DNA, complete ...	40	7.4
362	emb\|X57091.1\|ECTUFBT E.coli tufB gene for translation elongation...	40	7.4
363	gb\|AF170176.1\|STYSTMF1 Salmonella typhimurium fragment STMF1	40	7.4
364	gb\|AF153618.1\|AF153618 Streptomyces netropsis elongation factor ...	40	7.4
365	gb\|U18997.1\|ECOUW67 Escherichia coli K-12 chromosomal region fro...	40	7.4
366	gb\|AE017220.1\| Salmonella enterica subsp. enterica serovar Chole...	40	7.4
367	gb\|AF038004.1\|AF038004 Tribonema marinium elongation factor Tu (...	40	7.4
368	gb\|AE015924.1\| Porphyromonas gingivalis W83, complete genome	40	7.4
369	gb\|AE017198.1\| Lactobacillus johnsonii NCC 533, complete genome	40	7.4
370	gb\|AE017221.1\| Thermus thermophilus HB27, complete genome	40	7.4
371	gb\|U09441.1\|OSU09441 Odontella sp. protein synthesis elongation ...	40	7.4
372	gb\|AE005174.2\| Escherichia coli O157:H7 EDL933, complete genome	40	7.4
373	dbj\|BA000007.2\| Escherichia coli O157:H7 DNA, complete genome	40	7.4
374	gb\|CP000034.1\| Shigella dysenteriae Sd197, complete genome	40	7.4
375	emb\|AL928732.7\| Mouse DNA sequence from clone RP23-403C18 on chr...	40	7.4
376	gb\|U09429.1\|CCU09429 Costaria costata protein synthesis elongati...	40	7.4
377	gb\|L13276.1\|MSGEFTU Mycobacterium leprae elongation factor Tu ge...	40	7.4
378	gb\|CP000036.1\| Shigella boydii Sb227, complete genome	40	7.4
379	gb\|CP000038.1\| Shigella sonnei Ss046, complete genome	40	7.4
380	gb\|J01717.1\|ECOTGTUFB E.coli tufB gene coding for elongation fac...	40	7.4
381	dbj\|D11470.1\|TOBTUFB2 Nicotiana sylvestris tufB gene for chlorop...	40	7.4
382	dbj\|D11376.1\|TOBTUFB N. sylvestris tufB gene for chloroplast elo...	40	7.4
383	dbj\|AB035466.1\| Bacteroides forsythus gene for EF-Tu, complete c...	40	7.4
384	dbj\|AB035464.1\| Porphyromonas gingivalis gene for EF-Tu, complet...	40	7.4
385	dbj\|AB035462.1\| Porphyromonas gingivalis gene for EF-Tu, complet...	40	7.4
386	emb\|AL645647.8\| Mouse DNA sequence from clone RP23-332L17 on chr...	40	7.4

>gb|AF327413.1|AF327413 Oryza sativa translational elongation factor Tu (tufA) gene, complete
            cds; nuclear gene for chloroplast product
          Length = 2050

 Score =  476 bits (240), Expect = e-131
 Identities = 472/548 (86%), Gaps = 1/548 (0%)
 Strand = Plus / Plus

                                                                        
Query: 2    gctgcttgagctcgtcgatctcgag-tccgtgagctgctcacggcctatgagtacgatgg 60
            ||||||| |||||||||| |||||| |||| ||  ||||| |  |||| |||||||||||
Sbjct: 717  gctgcttcagctcgtcgagctcgaggtccgcgaattgctctcctcctacgagtacgatgg 776

                                                                        
Query: 61   tgacaatgtgccaatcgtctccggctctgcactcagagcgctcgaggccctcatggccac 120
             ||| | ||||| |||||| | ||||| || ||||  |||||||||  ||||||||||| 
Sbjct: 777  cgacgaagtgcccatcgtcgctggctccgcgctcaaggcgctcgagaacctcatggccaa 836

                                                                        
Query: 121  ccctggcctcaagcgtggggataacgagtgggtggatggcatcttctccttgattgactc 180
            ||||| | | ||||| || ||| | ||||||||||| || |||||||| |||||||| ||
Sbjct: 837  ccctgccattaagcgcggcgatgatgagtgggtggacgggatcttctcgttgattgattc 896

                                                                        
Query: 181  cgtggacacccatatccctgtaccgcagaggcagacagacctgcccttcttgctcgctgt 240
            |||||| | | | |||||||| || ||| | ||||| ||||| || |||||||| |||||
Sbjct: 897  cgtggataactacatccctgtcccacagcgccagaccgacctcccgttcttgcttgctgt 956

                                                                        
Query: 241  tgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtgg 300
            ||||||||| ||||||||||||||||||||||| ||||||||||||||||| ||||||||
Sbjct: 957  tgaggatgtgttctccatcaccggtcgtggtaccgttgccactggccgtattgagcgtgg 1016

                                                                        
Query: 301  caccgtcaaggttggggacccagtcgacctcgtcggcatcagggagacccgcaatgccac 360
            ||||||||||||||||||| | |||||  ||||||| ||| ||||||| |||||   |||
Sbjct: 1017 caccgtcaaggttggggacacggtcgatatcgtcggtatccgggagactcgcaactgcac 1076

                                                                        
Query: 361  ggtcactggtgttgagatgttccagaagaccatggatgatgccattgctggggacaatgt 420
            ||| |||||||||||||||||||||||||||||||||||||| || ||||||||||||||
Sbjct: 1077 ggtgactggtgttgagatgttccagaagaccatggatgatgcgatggctggggacaatgt 1136

                                                                        
Query: 421  tggcctgctgctccgtggtatgcagaaggaagacattgagagaggcatggtgttggcaaa 480
             |||||||| |||||||||||||||||||| || || ||||||||||||||| | |||||
Sbjct: 1137 cggcctgcttctccgtggtatgcagaaggatgatatcgagagaggcatggtgcttgcaaa 1196

                                                                        
Query: 481  gccgggttccatcacgccacacaccaagtttgaggcagttgtgtatgtgctcaagaagga 540
            ||| | ||||||||||||||||||||||||||| || ||||||||||| || ||||||||
Sbjct: 1197 gcctgcttccatcacgccacacaccaagtttgatgcggttgtgtatgtcctgaagaagga 1256

                    
Query: 541  ggagggtg 548
             |||||||
Sbjct: 1257 cgagggtg 1264

to top

>gb|BT018667.1| Zea mays clone EL01N0510C05.d mRNA sequence
          Length = 2057

 Score =  460 bits (232), Expect = e-126
 Identities = 470/548 (85%), Gaps = 1/548 (0%)
 Strand = Plus / Plus

                                                                        
Query: 2    gctgcttgagctcgtcgatctcgag-tccgtgagctgctcacggcctatgagtacgatgg 60
            |||||| ||||||||||| |||||| |||| ||||||||||    ||| |||||||| ||
Sbjct: 600  gctgctcgagctcgtcgagctcgaggtccgcgagctgctcagcaactacgagtacgacgg 659

                                                                        
Query: 61   tgacaatgtgccaatcgtctccggctctgcactcagagcgctcgaggccctcatggccac 120
             ||| | || ||||||||| | ||||| || ||||  ||||||||||| ||||||| || 
Sbjct: 660  cgacgacgtaccaatcgtcgctggctccgccctcaaggcgctcgaggctctcatggtcaa 719

                                                                        
Query: 121  ccctggcctcaagcgtggggataacgagtgggtggatggcatcttctccttgattgactc 180
            ||||| ||| ||||| || ||  | |||||||| ||   ||||||||| ||| ||||   
Sbjct: 720  ccctgccctgaagcgcggcgacgatgagtgggtcgactacatcttctcgttggttgataa 779

                                                                        
Query: 181  cgtggacacccatatccctgtaccgcagaggcagacagacctgcccttcttgctcgctgt 240
             |||||  || |||| || || |||||||||||||| ||||| || ||||||||||||||
Sbjct: 780  agtggattcctatattccagtcccgcagaggcagactgacctcccgttcttgctcgctgt 839

                                                                        
Query: 241  tgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtgg 300
            ||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 840  tgaagatgtcttctccatcaccggtcgtggtacagttgccactggccgtatagagcgtgg 899

                                                                        
Query: 301  caccgtcaaggttggggacccagtcgacctcgtcggcatcagggagacccgcaatgccac 360
            |||||||||| |||| ||| |||||||  ||||||| ||| |||| ||||| ||   |||
Sbjct: 900  caccgtcaagattggtgacacagtcgatatcgtcggaatccgggacacccggaactgcac 959

                                                                        
Query: 361  ggtcactggtgttgagatgttccagaagaccatggatgatgccattgctggggacaatgt 420
            ||||||||||||||||||||||||||||||||||||||||||||| || || ||||||||
Sbjct: 960  ggtcactggtgttgagatgttccagaagaccatggatgatgccatggccggagacaatgt 1019

                                                                        
Query: 421  tggcctgctgctccgtggtatgcagaaggaagacattgagagaggcatggtgttggcaaa 480
            ||| |||||||||||||||||||||||||| |||||||| |||||||||||| |||||||
Sbjct: 1020 tgggctgctgctccgtggtatgcagaaggatgacattgaaagaggcatggtgctggcaaa 1079

                                                                        
Query: 481  gccgggttccatcacgccacacaccaagtttgaggcagttgtgtatgtgctcaagaagga 540
            ||| || || ||||| || ||||||||||||||||| |||||||||||||| ||||||||
Sbjct: 1080 gcctggctctatcacaccgcacaccaagtttgaggctgttgtgtatgtgcttaagaagga 1139

                    
Query: 541  ggagggtg 548
             |||||||
Sbjct: 1140 agagggtg 1147

to top

>ref|XM_466527.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1614

 Score =  452 bits (228), Expect = e-124
 Identities = 435/504 (86%)
 Strand = Plus / Plus

                                                                        
Query: 45   cctatgagtacgatggtgacaatgtgccaatcgtctccggctctgcactcagagcgctcg 104
            |||| ||||||||||| ||| | ||||| |||||| | ||||| || ||||  |||||||
Sbjct: 684  cctacgagtacgatggcgacgaagtgcccatcgtcgctggctccgcgctcaaggcgctcg 743

                                                                        
Query: 105  aggccctcatggccacccctggcctcaagcgtggggataacgagtgggtggatggcatct 164
            ||  ||||||||||| ||||| | | ||||| || ||| | ||||||||||| || ||||
Sbjct: 744  agaacctcatggccaaccctgccattaagcgcggcgatgatgagtgggtggacgggatct 803

                                                                        
Query: 165  tctccttgattgactccgtggacacccatatccctgtaccgcagaggcagacagacctgc 224
            |||| |||||||| |||||||| | | | |||||||| || ||| | ||||| ||||| |
Sbjct: 804  tctcgttgattgattccgtggataactacatccctgtcccacagcgccagaccgacctcc 863

                                                                        
Query: 225  ccttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactg 284
            | |||||||| |||||||||||||| ||||||||||||||||||||||| ||||||||||
Sbjct: 864  cgttcttgcttgctgttgaggatgtgttctccatcaccggtcgtggtaccgttgccactg 923

                                                                        
Query: 285  gccgtatcgagcgtggcaccgtcaaggttggggacccagtcgacctcgtcggcatcaggg 344
            ||||||| ||||||||||||||||||||||||||| | |||||  ||||||| ||| |||
Sbjct: 924  gccgtattgagcgtggcaccgtcaaggttggggacacggtcgatatcgtcggtatccggg 983

                                                                        
Query: 345  agacccgcaatgccacggtcactggtgttgagatgttccagaagaccatggatgatgcca 404
            |||| |||||   |||||| |||||||||||||||||||||||||||||||||||||| |
Sbjct: 984  agactcgcaactgcacggtgactggtgttgagatgttccagaagaccatggatgatgcga 1043

                                                                        
Query: 405  ttgctggggacaatgttggcctgctgctccgtggtatgcagaaggaagacattgagagag 464
            | |||||||||||||| |||||||| ||||| |||||||||||||| || || |||||||
Sbjct: 1044 tggctggggacaatgtcggcctgcttctccgaggtatgcagaaggatgatatcgagagag 1103

                                                                        
Query: 465  gcatggtgttggcaaagccgggttccatcacgccacacaccaagtttgaggcagttgtgt 524
            |||||||| | || ||||| | ||||||||||||||||||||||||||| || |||||||
Sbjct: 1104 gcatggtgcttgcgaagcctgcttccatcacgccacacaccaagtttgatgcggttgtgt 1163

                                    
Query: 525  atgtgctcaagaaggaggagggtg 548
            |||| || |||||||| |||||||
Sbjct: 1164 atgtcctgaagaaggacgagggtg 1187

to top

>ref|XM_507491.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1126_D09.31-2
            mRNA
          Length = 1701

 Score =  452 bits (228), Expect = e-124
 Identities = 435/504 (86%)
 Strand = Plus / Plus

                                                                        
Query: 45   cctatgagtacgatggtgacaatgtgccaatcgtctccggctctgcactcagagcgctcg 104
            |||| ||||||||||| ||| | ||||| |||||| | ||||| || ||||  |||||||
Sbjct: 685  cctacgagtacgatggcgacgaagtgcccatcgtcgctggctccgcgctcaaggcgctcg 744

                                                                        
Query: 105  aggccctcatggccacccctggcctcaagcgtggggataacgagtgggtggatggcatct 164
            ||  ||||||||||| ||||| | | ||||| || ||| | ||||||||||| || ||||
Sbjct: 745  agaacctcatggccaaccctgccattaagcgcggcgatgatgagtgggtggacgggatct 804

                                                                        
Query: 165  tctccttgattgactccgtggacacccatatccctgtaccgcagaggcagacagacctgc 224
            |||| |||||||| |||||||| | | | |||||||| || ||| | ||||| ||||| |
Sbjct: 805  tctcgttgattgattccgtggataactacatccctgtcccacagcgccagaccgacctcc 864

                                                                        
Query: 225  ccttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactg 284
            | |||||||| |||||||||||||| ||||||||||||||||||||||| ||||||||||
Sbjct: 865  cgttcttgcttgctgttgaggatgtgttctccatcaccggtcgtggtaccgttgccactg 924

                                                                        
Query: 285  gccgtatcgagcgtggcaccgtcaaggttggggacccagtcgacctcgtcggcatcaggg 344
            ||||||| ||||||||||||||||||||||||||| | |||||  ||||||| ||| |||
Sbjct: 925  gccgtattgagcgtggcaccgtcaaggttggggacacggtcgatatcgtcggtatccggg 984

                                                                        
Query: 345  agacccgcaatgccacggtcactggtgttgagatgttccagaagaccatggatgatgcca 404
            |||| |||||   |||||| |||||||||||||||||||||||||||||||||||||| |
Sbjct: 985  agactcgcaactgcacggtgactggtgttgagatgttccagaagaccatggatgatgcga 1044

                                                                        
Query: 405  ttgctggggacaatgttggcctgctgctccgtggtatgcagaaggaagacattgagagag 464
            | |||||||||||||| |||||||| ||||| |||||||||||||| || || |||||||
Sbjct: 1045 tggctggggacaatgtcggcctgcttctccgaggtatgcagaaggatgatatcgagagag 1104

                                                                        
Query: 465  gcatggtgttggcaaagccgggttccatcacgccacacaccaagtttgaggcagttgtgt 524
            |||||||| | || ||||| | ||||||||||||||||||||||||||| || |||||||
Sbjct: 1105 gcatggtgcttgcgaagcctgcttccatcacgccacacaccaagtttgatgcggttgtgt 1164

                                    
Query: 525  atgtgctcaagaaggaggagggtg 548
            |||| || |||||||| |||||||
Sbjct: 1165 atgtcctgaagaaggacgagggtg 1188

to top

>ref|XM_506850.2| PREDICTED Oryza sativa (japonica cultivar-group), OJ1126_D09.31-2
            mRNA
          Length = 1894

 Score =  452 bits (228), Expect = e-124
 Identities = 435/504 (86%)
 Strand = Plus / Plus

                                                                        
Query: 45   cctatgagtacgatggtgacaatgtgccaatcgtctccggctctgcactcagagcgctcg 104
            |||| ||||||||||| ||| | ||||| |||||| | ||||| || ||||  |||||||
Sbjct: 756  cctacgagtacgatggcgacgaagtgcccatcgtcgctggctccgcgctcaaggcgctcg 815

                                                                        
Query: 105  aggccctcatggccacccctggcctcaagcgtggggataacgagtgggtggatggcatct 164
            ||  ||||||||||| ||||| | | ||||| || ||| | ||||||||||| || ||||
Sbjct: 816  agaacctcatggccaaccctgccattaagcgcggcgatgatgagtgggtggacgggatct 875

                                                                        
Query: 165  tctccttgattgactccgtggacacccatatccctgtaccgcagaggcagacagacctgc 224
            |||| |||||||| |||||||| | | | |||||||| || ||| | ||||| ||||| |
Sbjct: 876  tctcgttgattgattccgtggataactacatccctgtcccacagcgccagaccgacctcc 935

                                                                        
Query: 225  ccttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactg 284
            | |||||||| |||||||||||||| ||||||||||||||||||||||| ||||||||||
Sbjct: 936  cgttcttgcttgctgttgaggatgtgttctccatcaccggtcgtggtaccgttgccactg 995

                                                                        
Query: 285  gccgtatcgagcgtggcaccgtcaaggttggggacccagtcgacctcgtcggcatcaggg 344
            ||||||| ||||||||||||||||||||||||||| | |||||  ||||||| ||| |||
Sbjct: 996  gccgtattgagcgtggcaccgtcaaggttggggacacggtcgatatcgtcggtatccggg 1055

                                                                        
Query: 345  agacccgcaatgccacggtcactggtgttgagatgttccagaagaccatggatgatgcca 404
            |||| |||||   |||||| |||||||||||||||||||||||||||||||||||||| |
Sbjct: 1056 agactcgcaactgcacggtgactggtgttgagatgttccagaagaccatggatgatgcga 1115

                                                                        
Query: 405  ttgctggggacaatgttggcctgctgctccgtggtatgcagaaggaagacattgagagag 464
            | |||||||||||||| |||||||| ||||| |||||||||||||| || || |||||||
Sbjct: 1116 tggctggggacaatgtcggcctgcttctccgaggtatgcagaaggatgatatcgagagag 1175

                                                                        
Query: 465  gcatggtgttggcaaagccgggttccatcacgccacacaccaagtttgaggcagttgtgt 524
            |||||||| | || ||||| | ||||||||||||||||||||||||||| || |||||||
Sbjct: 1176 gcatggtgcttgcgaagcctgcttccatcacgccacacaccaagtttgatgcggttgtgt 1235

                                    
Query: 525  atgtgctcaagaaggaggagggtg 548
            |||| || |||||||| |||||||
Sbjct: 1236 atgtcctgaagaaggacgagggtg 1259

to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  452 bits (228), Expect = e-124
 Identities = 435/504 (86%)
 Strand = Plus / Plus

                                                                            
Query: 45       cctatgagtacgatggtgacaatgtgccaatcgtctccggctctgcactcagagcgctcg 104
                |||| ||||||||||| ||| | ||||| |||||| | ||||| || ||||  |||||||
Sbjct: 23132085 cctacgagtacgatggcgacgaagtgcccatcgtcgctggctccgcgctcaaggcgctcg 23132144

                                                                            
Query: 105      aggccctcatggccacccctggcctcaagcgtggggataacgagtgggtggatggcatct 164
                ||  ||||||||||| ||||| | | ||||| || ||| | ||||||||||| || ||||
Sbjct: 23132145 agaacctcatggccaaccctgccattaagcgcggcgatgatgagtgggtggacgggatct 23132204

                                                                            
Query: 165      tctccttgattgactccgtggacacccatatccctgtaccgcagaggcagacagacctgc 224
                |||| |||||||| |||||||| | | | |||||||| || ||| | ||||| ||||| |
Sbjct: 23132205 tctcgttgattgattccgtggataactacatccctgtcccacagcgccagaccgacctcc 23132264

                                                                            
Query: 225      ccttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactg 284
                | |||||||| |||||||||||||| ||||||||||||||||||||||| ||||||||||
Sbjct: 23132265 cgttcttgcttgctgttgaggatgtgttctccatcaccggtcgtggtaccgttgccactg 23132324

                                                                            
Query: 285      gccgtatcgagcgtggcaccgtcaaggttggggacccagtcgacctcgtcggcatcaggg 344
                ||||||| ||||||||||||||||||||||||||| | |||||  ||||||| ||| |||
Sbjct: 23132325 gccgtattgagcgtggcaccgtcaaggttggggacacggtcgatatcgtcggtatccggg 23132384

                                                                            
Query: 345      agacccgcaatgccacggtcactggtgttgagatgttccagaagaccatggatgatgcca 404
                |||| |||||   |||||| |||||||||||||||||||||||||||||||||||||| |
Sbjct: 23132385 agactcgcaactgcacggtgactggtgttgagatgttccagaagaccatggatgatgcga 23132444

                                                                            
Query: 405      ttgctggggacaatgttggcctgctgctccgtggtatgcagaaggaagacattgagagag 464
                | |||||||||||||| |||||||| ||||| |||||||||||||| || || |||||||
Sbjct: 23132445 tggctggggacaatgtcggcctgcttctccgaggtatgcagaaggatgatatcgagagag 23132504

                                                                            
Query: 465      gcatggtgttggcaaagccgggttccatcacgccacacaccaagtttgaggcagttgtgt 524
                |||||||| | || ||||| | ||||||||||||||||||||||||||| || |||||||
Sbjct: 23132505 gcatggtgcttgcgaagcctgcttccatcacgccacacaccaagtttgatgcggttgtgt 23132564

                                        
Query: 525      atgtgctcaagaaggaggagggtg 548
                |||| || |||||||| |||||||
Sbjct: 23132565 atgtcctgaagaaggacgagggtg 23132588

to top

>dbj|AP004023.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1126_D09
          Length = 138615

 Score =  452 bits (228), Expect = e-124
 Identities = 435/504 (86%)
 Strand = Plus / Plus

                                                                         
Query: 45    cctatgagtacgatggtgacaatgtgccaatcgtctccggctctgcactcagagcgctcg 104
             |||| ||||||||||| ||| | ||||| |||||| | ||||| || ||||  |||||||
Sbjct: 99123 cctacgagtacgatggcgacgaagtgcccatcgtcgctggctccgcgctcaaggcgctcg 99182

                                                                         
Query: 105   aggccctcatggccacccctggcctcaagcgtggggataacgagtgggtggatggcatct 164
             ||  ||||||||||| ||||| | | ||||| || ||| | ||||||||||| || ||||
Sbjct: 99183 agaacctcatggccaaccctgccattaagcgcggcgatgatgagtgggtggacgggatct 99242

                                                                         
Query: 165   tctccttgattgactccgtggacacccatatccctgtaccgcagaggcagacagacctgc 224
             |||| |||||||| |||||||| | | | |||||||| || ||| | ||||| ||||| |
Sbjct: 99243 tctcgttgattgattccgtggataactacatccctgtcccacagcgccagaccgacctcc 99302

                                                                         
Query: 225   ccttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactg 284
             | |||||||| |||||||||||||| ||||||||||||||||||||||| ||||||||||
Sbjct: 99303 cgttcttgcttgctgttgaggatgtgttctccatcaccggtcgtggtaccgttgccactg 99362

                                                                         
Query: 285   gccgtatcgagcgtggcaccgtcaaggttggggacccagtcgacctcgtcggcatcaggg 344
             ||||||| ||||||||||||||||||||||||||| | |||||  ||||||| ||| |||
Sbjct: 99363 gccgtattgagcgtggcaccgtcaaggttggggacacggtcgatatcgtcggtatccggg 99422

                                                                         
Query: 345   agacccgcaatgccacggtcactggtgttgagatgttccagaagaccatggatgatgcca 404
             |||| |||||   |||||| |||||||||||||||||||||||||||||||||||||| |
Sbjct: 99423 agactcgcaactgcacggtgactggtgttgagatgttccagaagaccatggatgatgcga 99482

                                                                         
Query: 405   ttgctggggacaatgttggcctgctgctccgtggtatgcagaaggaagacattgagagag 464
             | |||||||||||||| |||||||| ||||| |||||||||||||| || || |||||||
Sbjct: 99483 tggctggggacaatgtcggcctgcttctccgaggtatgcagaaggatgatatcgagagag 99542

                                                                         
Query: 465   gcatggtgttggcaaagccgggttccatcacgccacacaccaagtttgaggcagttgtgt 524
             |||||||| | || ||||| | ||||||||||||||||||||||||||| || |||||||
Sbjct: 99543 gcatggtgcttgcgaagcctgcttccatcacgccacacaccaagtttgatgcggttgtgt 99602

                                     
Query: 525   atgtgctcaagaaggaggagggtg 548
             |||| || |||||||| |||||||
Sbjct: 99603 atgtcctgaagaaggacgagggtg 99626

to top

>dbj|AK064937.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000P03, full
            insert sequence
          Length = 1700

 Score =  452 bits (228), Expect = e-124
 Identities = 435/504 (86%)
 Strand = Plus / Plus

                                                                        
Query: 45   cctatgagtacgatggtgacaatgtgccaatcgtctccggctctgcactcagagcgctcg 104
            |||| ||||||||||| ||| | ||||| |||||| | ||||| || ||||  |||||||
Sbjct: 684  cctacgagtacgatggcgacgaagtgcccatcgtcgctggctccgcgctcaaggcgctcg 743

                                                                        
Query: 105  aggccctcatggccacccctggcctcaagcgtggggataacgagtgggtggatggcatct 164
            ||  ||||||||||| ||||| | | ||||| || ||| | ||||||||||| || ||||
Sbjct: 744  agaacctcatggccaaccctgccattaagcgcggcgatgatgagtgggtggacgggatct 803

                                                                        
Query: 165  tctccttgattgactccgtggacacccatatccctgtaccgcagaggcagacagacctgc 224
            |||| |||||||| |||||||| | | | |||||||| || ||| | ||||| ||||| |
Sbjct: 804  tctcgttgattgattccgtggataactacatccctgtcccacagcgccagaccgacctcc 863

                                                                        
Query: 225  ccttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactg 284
            | |||||||| |||||||||||||| ||||||||||||||||||||||| ||||||||||
Sbjct: 864  cgttcttgcttgctgttgaggatgtgttctccatcaccggtcgtggtaccgttgccactg 923

                                                                        
Query: 285  gccgtatcgagcgtggcaccgtcaaggttggggacccagtcgacctcgtcggcatcaggg 344
            ||||||| ||||||||||||||||||||||||||| | |||||  ||||||| ||| |||
Sbjct: 924  gccgtattgagcgtggcaccgtcaaggttggggacacggtcgatatcgtcggtatccggg 983

                                                                        
Query: 345  agacccgcaatgccacggtcactggtgttgagatgttccagaagaccatggatgatgcca 404
            |||| |||||   |||||| |||||||||||||||||||||||||||||||||||||| |
Sbjct: 984  agactcgcaactgcacggtgactggtgttgagatgttccagaagaccatggatgatgcga 1043

                                                                        
Query: 405  ttgctggggacaatgttggcctgctgctccgtggtatgcagaaggaagacattgagagag 464
            | |||||||||||||| |||||||| ||||| |||||||||||||| || || |||||||
Sbjct: 1044 tggctggggacaatgtcggcctgcttctccgaggtatgcagaaggatgatatcgagagag 1103

                                                                        
Query: 465  gcatggtgttggcaaagccgggttccatcacgccacacaccaagtttgaggcagttgtgt 524
            |||||||| | || ||||| | ||||||||||||||||||||||||||| || |||||||
Sbjct: 1104 gcatggtgcttgcgaagcctgcttccatcacgccacacaccaagtttgatgcggttgtgt 1163

                                    
Query: 525  atgtgctcaagaaggaggagggtg 548
            |||| || |||||||| |||||||
Sbjct: 1164 atgtcctgaagaaggacgagggtg 1187

to top

>dbj|AK104785.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-D07, full
            insert sequence
          Length = 1614

 Score =  444 bits (224), Expect = e-121
 Identities = 434/504 (86%)
 Strand = Plus / Plus

                                                                        
Query: 45   cctatgagtacgatggtgacaatgtgccaatcgtctccggctctgcactcagagcgctcg 104
            |||| ||||||||||| ||| | ||||| |||||| | ||||| || ||||  |||||||
Sbjct: 684  cctacgagtacgatggcgacgaagtgcccatcgtcgctggctccgcgctcaaggcgctcg 743

                                                                        
Query: 105  aggccctcatggccacccctggcctcaagcgtggggataacgagtgggtggatggcatct 164
            ||  ||||||||||| ||||| | | ||||| || ||| | |||||| |||| || ||||
Sbjct: 744  agaacctcatggccaaccctgccattaagcgcggcgatgatgagtggatggacgggatct 803

                                                                        
Query: 165  tctccttgattgactccgtggacacccatatccctgtaccgcagaggcagacagacctgc 224
            |||| |||||||| |||||||| | | | |||||||| || ||| | ||||| ||||| |
Sbjct: 804  tctcgttgattgattccgtggataactacatccctgtcccacagcgccagaccgacctcc 863

                                                                        
Query: 225  ccttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactg 284
            | |||||||| |||||||||||||| ||||||||||||||||||||||| ||||||||||
Sbjct: 864  cgttcttgcttgctgttgaggatgtgttctccatcaccggtcgtggtaccgttgccactg 923

                                                                        
Query: 285  gccgtatcgagcgtggcaccgtcaaggttggggacccagtcgacctcgtcggcatcaggg 344
            ||||||| ||||||||||||||||||||||||||| | |||||  ||||||| ||| |||
Sbjct: 924  gccgtattgagcgtggcaccgtcaaggttggggacacggtcgatatcgtcggtatccggg 983

                                                                        
Query: 345  agacccgcaatgccacggtcactggtgttgagatgttccagaagaccatggatgatgcca 404
            |||| |||||   |||||| |||||||||||||||||||||||||||||||||||||| |
Sbjct: 984  agactcgcaactgcacggtgactggtgttgagatgttccagaagaccatggatgatgcga 1043

                                                                        
Query: 405  ttgctggggacaatgttggcctgctgctccgtggtatgcagaaggaagacattgagagag 464
            | |||||||||||||| |||||||| ||||| |||||||||||||| || || |||||||
Sbjct: 1044 tggctggggacaatgtcggcctgcttctccgaggtatgcagaaggatgatatcgagagag 1103

                                                                        
Query: 465  gcatggtgttggcaaagccgggttccatcacgccacacaccaagtttgaggcagttgtgt 524
            |||||||| | || ||||| | ||||||||||||||||||||||||||| || |||||||
Sbjct: 1104 gcatggtgcttgcgaagcctgcttccatcacgccacacaccaagtttgatgcggttgtgt 1163

                                    
Query: 525  atgtgctcaagaaggaggagggtg 548
            |||| || |||||||| |||||||
Sbjct: 1164 atgtcctgaagaaggacgagggtg 1187

to top

>gb|AF145053.1|AF145053 Oryza sativa chloroplast translational elongation factor Tu (tufA)
            mRNA, complete cds; nuclear gene for chloroplast product
          Length = 1678

 Score =  438 bits (221), Expect = e-120
 Identities = 425/493 (86%)
 Strand = Plus / Plus

                                                                        
Query: 45   cctatgagtacgatggtgacaatgtgccaatcgtctccggctctgcactcagagcgctcg 104
            |||| ||||||||||| ||| | ||||| |||||| | ||||| || ||||  |||||||
Sbjct: 714  cctacgagtacgatggcgacgaagtgcccatcgtcgctggctccgcgctcaaggcgctcg 773

                                                                        
Query: 105  aggccctcatggccacccctggcctcaagcgtggggataacgagtgggtggatggcatct 164
            ||  ||||||||||| ||||| | | ||||| || ||| | ||||||||||| || ||||
Sbjct: 774  agaacctcatggccaaccctgccattaagcgcggcgatgatgagtgggtggacgggatct 833

                                                                        
Query: 165  tctccttgattgactccgtggacacccatatccctgtaccgcagaggcagacagacctgc 224
            |||| |||||||| |||||||| | | | |||||||| || ||| | ||||| ||||| |
Sbjct: 834  tctcgttgattgattccgtggataactacatccctgtcccacagcgccagaccgacctcc 893

                                                                        
Query: 225  ccttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactg 284
            | |||||||| |||||||||||||| ||||||||||||||||||||||| ||||||||||
Sbjct: 894  cgttcttgcttgctgttgaggatgtgttctccatcaccggtcgtggtaccgttgccactg 953

                                                                        
Query: 285  gccgtatcgagcgtggcaccgtcaaggttggggacccagtcgacctcgtcggcatcaggg 344
            ||||||| ||||||||||||||||||||||||||| | |||||  ||||||| ||| |||
Sbjct: 954  gccgtattgagcgtggcaccgtcaaggttggggacacggtcgatatcgtcggtatccggg 1013

                                                                        
Query: 345  agacccgcaatgccacggtcactggtgttgagatgttccagaagaccatggatgatgcca 404
            |||| |||||   |||||| |||||||||||||||||||||||||||||||||||||| |
Sbjct: 1014 agactcgcaactgcacggtgactggtgttgagatgttccagaagaccatggatgatgcga 1073

                                                                        
Query: 405  ttgctggggacaatgttggcctgctgctccgtggtatgcagaaggaagacattgagagag 464
            | |||||||||||||| |||||||| ||||| |||||||||||||| || || |||||||
Sbjct: 1074 tggctggggacaatgtcggcctgcttctccgaggtatgcagaaggatgatatcgagagag 1133

                                                                        
Query: 465  gcatggtgttggcaaagccgggttccatcacgccacacaccaagtttgaggcagttgtgt 524
            |||||||| | || ||||| | ||||||||||||||||||||||||||| || |||||||
Sbjct: 1134 gcatggtgcttgcgaagcctgcttccatcacgccacacaccaagtttgatgcggttgtgt 1193

                         
Query: 525  atgtgctcaagaa 537
            |||| || |||||
Sbjct: 1194 atgtcctgaagaa 1206

to top

>dbj|AK119587.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-117-C11, full
            insert sequence
          Length = 1894

 Score =  436 bits (220), Expect = e-119
 Identities = 433/504 (85%)
 Strand = Plus / Plus

                                                                        
Query: 45   cctatgagtacgatggtgacaatgtgccaatcgtctccggctctgcactcagagcgctcg 104
            |||| ||||||||||| ||| | ||||| |||||| | ||||| || ||||  |||||||
Sbjct: 756  cctacgagtacgatggcgacgaagtgcccatcgtcgctggctccgcgctcaaggcgctcg 815

                                                                        
Query: 105  aggccctcatggccacccctggcctcaagcgtggggataacgagtgggtggatggcatct 164
            ||  ||||||||||| ||||| | | ||||| || ||| | ||||||||||| || ||||
Sbjct: 816  agaacctcatggccaaccctgccattaagcgcggcgatgatgagtgggtggacgggatct 875

                                                                        
Query: 165  tctccttgattgactccgtggacacccatatccctgtaccgcagaggcagacagacctgc 224
            |||| |||||||| |||||||| | | | |||||||| || ||  | ||||| ||||| |
Sbjct: 876  tctcgttgattgattccgtggataactacatccctgtcccacaacgccagaccgacctcc 935

                                                                        
Query: 225  ccttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactg 284
            | |||||||| |||||||||||||| |||||||||||||| |||||||| ||||||||||
Sbjct: 936  cgttcttgcttgctgttgaggatgtgttctccatcaccggccgtggtaccgttgccactg 995

                                                                        
Query: 285  gccgtatcgagcgtggcaccgtcaaggttggggacccagtcgacctcgtcggcatcaggg 344
            ||||||| ||||||||||||||||||||||||||| | |||||  ||||||| ||| |||
Sbjct: 996  gccgtattgagcgtggcaccgtcaaggttggggacacggtcgatatcgtcggtatccggg 1055

                                                                        
Query: 345  agacccgcaatgccacggtcactggtgttgagatgttccagaagaccatggatgatgcca 404
            |||| |||||   |||||| |||||||||||||||||||||||||||||||||||||| |
Sbjct: 1056 agactcgcaactgcacggtgactggtgttgagatgttccagaagaccatggatgatgcga 1115

                                                                        
Query: 405  ttgctggggacaatgttggcctgctgctccgtggtatgcagaaggaagacattgagagag 464
            | |||||||||||||| |||||||| ||||| |||||||||||||| || || |||||||
Sbjct: 1116 tggctggggacaatgtcggcctgcttctccgaggtatgcagaaggatgatatcgagagag 1175

                                                                        
Query: 465  gcatggtgttggcaaagccgggttccatcacgccacacaccaagtttgaggcagttgtgt 524
            |||||||| | || ||||| | ||||||||||||||||||||||||||| || |||||||
Sbjct: 1176 gcatggtgcttgcgaagcctgcttccatcacgccacacaccaagtttgatgcggttgtgt 1235

                                    
Query: 525  atgtgctcaagaaggaggagggtg 548
            |||| || |||||||| |||||||
Sbjct: 1236 atgtcctgaagaaggacgagggtg 1259

to top

>gb|AY105509.1| Zea mays PCO100031 mRNA sequence
          Length = 1193

 Score =  420 bits (212), Expect = e-114
 Identities = 465/548 (84%), Gaps = 1/548 (0%)
 Strand = Plus / Plus

                                                                       
Query: 2   gctgcttgagctcgtcgatctcga-gtccgtgagctgctcacggcctatgagtacgatgg 60
           |||||| ||||||||||| || || ||||| ||||||||||    |||||||||||| ||
Sbjct: 161 gctgctcgagctcgtcgagctggaagtccgcgagctgctcagcaactatgagtacgacgg 220

                                                                       
Query: 61  tgacaatgtgccaatcgtctccggctctgcactcagagcgctcgaggccctcatggccac 120
            ||| | |||||||||||| | ||||| || ||||  ||||||||||||||||||| || 
Sbjct: 221 cgacgaggtgccaatcgtcgctggctccgccctcaaggcgctcgaggccctcatgggcaa 280

                                                                       
Query: 121 ccctggcctcaagcgtggggataacgagtgggtggatggcatcttctccttgattgactc 180
           ||||  ||| ||||| || ||  | |||||||||||  ||||||||    || |||| ||
Sbjct: 281 ccctaccctgaagcgcggcgacgatgagtgggtggactgcatcttcaagctggttgattc 340

                                                                       
Query: 181 cgtggacacccatatccctgtaccgcagaggcagacagacctgcccttcttgctcgctgt 240
            |||||  || | || || || || ||| ||||||| ||||| || ||||| ||||||||
Sbjct: 341 tgtggattcctacattccagtgccacagcggcagaccgacctcccgttcttactcgctgt 400

                                                                       
Query: 241 tgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtgg 300
           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 401 tgaagatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtgg 460

                                                                       
Query: 301 caccgtcaaggttggggacccagtcgacctcgtcggcatcagggagacccgcaatgccac 360
           |||||||||| |||| ||| |||||||  |||| || ||| |||| ||||| ||   |||
Sbjct: 461 caccgtcaagattggtgacacagtcgatatcgttggaatccgggacacccggaactgcac 520

                                                                       
Query: 361 ggtcactggtgttgagatgttccagaagaccatggatgatgccattgctggggacaatgt 420
            || ||||| |||||||||||||||||||||||||| |||||||| ||||| ||||||||
Sbjct: 521 cgtgactggcgttgagatgttccagaagaccatggacgatgccatggctggagacaatgt 580

                                                                       
Query: 421 tggcctgctgctccgtggtatgcagaaggaagacattgagagaggcatggtgttggcaaa 480
            || |||||||||||||||||||||||||| ||||||||||||||||||||| |||||||
Sbjct: 581 cggactgctgctccgtggtatgcagaaggatgacattgagagaggcatggtgctggcaaa 640

                                                                       
Query: 481 gccgggttccatcacgccacacaccaagtttgaggcagttgtgtatgtgctcaagaagga 540
           ||| || || ||||| || ||||||||||||||||| |||||||||||||| ||||||||
Sbjct: 641 gcccggctctatcacaccgcacaccaagtttgaggctgttgtgtatgtgcttaagaagga 700

                   
Query: 541 ggagggtg 548
            |||||||
Sbjct: 701 agagggtg 708

to top

>gb|CP000110.1| Synechococcus sp. CC9605, complete genome
          Length = 2510659

 Score =  107 bits (54), Expect = 4e-20
 Identities = 252/318 (79%)
 Strand = Plus / Minus

                                                                          
Query: 223    gcccttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggtacagttgccac 282
              ||||||| || | ||||| || || |||||||||||||||||||| || || || |||||
Sbjct: 324745 gcccttcctgatggctgtggaagacgtcttctccatcaccggtcgcggcaccgtggccac 324686

                                                                          
Query: 283    tggccgtatcgagcgtggcaccgtcaaggttggggacccagtcgacctcgtcggcatcag 342
               |||||||||||||| || |  |||||||| || ||   | ||||  | ||||| |||| 
Sbjct: 324685 aggccgtatcgagcgcggaatagtcaaggtcggcgaagaaatcgaaattgtcggtatcaa 324626

                                                                          
Query: 343    ggagacccgcaatgccacggtcactggtgttgagatgttccagaagaccatggatgatgc 402
              ||| ||||||||  |||| ||||| ||||| || |||||||  |||    | ||||| | 
Sbjct: 324625 ggacacccgcaagaccaccgtcaccggtgtggaaatgttccgcaagctgctcgatgaggg 324566

                                                                          
Query: 403    cattgctggggacaatgttggcctgctgctccgtggtatgcagaaggaagacattgagag 462
              ||| ||||| ||||| ||||| |||||||| || || || |||||||||||||| ||| |
Sbjct: 324565 catggctggcgacaacgttggtctgctgcttcgcggcatccagaaggaagacatcgagcg 324506

                                                                          
Query: 463    aggcatggtgttggcaaagccgggttccatcacgccacacaccaagtttgaggcagttgt 522
               ||||||||| | |  ||||| ||||||||||| || ||||||||||||||||     ||
Sbjct: 324505 cggcatggtgctcgtgaagcccggttccatcacccctcacaccaagtttgagggtcaggt 324446

                                
Query: 523    gtatgtgctcaagaagga 540
              ||| ||||||||||||||
Sbjct: 324445 gtacgtgctcaagaagga 324428

to top

>emb|BX569694.1| Synechococcus sp. WH8102 complete genome; segment 6/7
          Length = 349122

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 71/80 (88%)
 Strand = Plus / Plus

                                                                          
Query: 236    gctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgag 295
              ||||||||||| ||||||||||||||||||||||| || || ||||| || || ||||||
Sbjct: 288777 gctgttgaggacgtcttctccatcaccggtcgtggcaccgtggccaccggtcggatcgag 288836

                                  
Query: 296    cgtggcaccgtcaaggttgg 315
              |||||||  |||||||||||
Sbjct: 288837 cgtggcaaagtcaaggttgg 288856



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 97/119 (81%)
 Strand = Plus / Plus

                                                                          
Query: 422    ggcctgctgctccgtggtatgcagaaggaagacattgagagaggcatggtgttggcaaag 481
              ||||| |||||||| ||||| ||||| || ||||| ||| | ||||||||| |||  |||
Sbjct: 288963 ggccttctgctccgcggtatccagaaagaggacatcgagcgcggcatggtgctggtgaag 289022

                                                                         
Query: 482    ccgggttccatcacgccacacaccaagtttgaggcagttgtgtatgtgctcaagaagga 540
              || ||||||||||| || |||||||| || || |  |  || |||||||||||||||||
Sbjct: 289023 cccggttccatcacccctcacaccaaattcgaaggtgaggtttatgtgctcaagaagga 289081

to top

>gb|AF109211.1|AF109211 Synechococcus WH8103 elongation factor Tu (tufA) gene, partial cds
          Length = 535

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 71/80 (88%)
 Strand = Plus / Plus

                                                                       
Query: 236 gctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgag 295
           ||||||||||| ||||||||||||||||||||||| || || ||||| || || ||||||
Sbjct: 376 gctgttgaggacgtcttctccatcaccggtcgtggcaccgtggccaccggtcggatcgag 435

                               
Query: 296 cgtggcaccgtcaaggttgg 315
           |||||||  |||||||||||
Sbjct: 436 cgtggcaaggtcaaggttgg 455

to top

>ref|XM_466528.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 900

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 57/62 (91%)
 Strand = Plus / Plus

                                                                       
Query: 487 ttccatcacgccacacaccaagtttgaggcagttgtgtatgtgctcaagaaggaggaggg 546
           ||||||||||||||||||||||||||| || ||||||||||| || |||||||| |||||
Sbjct: 429 ttccatcacgccacacaccaagtttgatgcggttgtgtatgtcctgaagaaggacgaggg 488

             
Query: 547 tg 548
           ||
Sbjct: 489 tg 490



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 67/81 (82%)
 Strand = Plus / Plus

                                                                       
Query: 45  cctatgagtacgatggtgacaatgtgccaatcgtctccggctctgcactcagagcgctcg 104
           |||| ||||||||||| ||| | ||||| |||||| | ||||| || ||||  |||||||
Sbjct: 347 cctacgagtacgatggcgacgaagtgcccatcgtcgctggctccgcgctcaaggcgctcg 406

                                
Query: 105 aggccctcatggccacccctg 125
           ||  ||||||||||| |||||
Sbjct: 407 agaacctcatggccaaccctg 427

to top

>dbj|AK066858.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013084O08, full
           insert sequence
          Length = 899

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 57/62 (91%)
 Strand = Plus / Plus

                                                                       
Query: 487 ttccatcacgccacacaccaagtttgaggcagttgtgtatgtgctcaagaaggaggaggg 546
           ||||||||||||||||||||||||||| || ||||||||||| || |||||||| |||||
Sbjct: 428 ttccatcacgccacacaccaagtttgatgcggttgtgtatgtcctgaagaaggacgaggg 487

             
Query: 547 tg 548
           ||
Sbjct: 488 tg 489



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 67/81 (82%)
 Strand = Plus / Plus

                                                                       
Query: 45  cctatgagtacgatggtgacaatgtgccaatcgtctccggctctgcactcagagcgctcg 104
           |||| ||||||||||| ||| | ||||| |||||| | ||||| || ||||  |||||||
Sbjct: 346 cctacgagtacgatggcgacgaagtgcccatcgtcgctggctccgcgctcaaggcgctcg 405

                                
Query: 105 aggccctcatggccacccctg 125
           ||  ||||||||||| |||||
Sbjct: 406 agaacctcatggccaaccctg 426

to top

>ref|XM_323038.1| Neurospora crassa OR74A hypothetical protein ( (AL513467) probable
           translation elongation factor EF-Tu precursor,
           mitochondrial [Neurospora crassa OR74> (NCU03737.1)
           partial mRNA; nuclear gene for mitochondrial product
          Length = 1314

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 64/72 (88%)
 Strand = Plus / Plus

                                                                       
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgt 298
           ||||||||||||||||||||| |||| |||||||| || ||| |||||||| ||||||||
Sbjct: 754 gttgaggatgtcttctccatcgccggccgtggtaccgtcgcctctggccgtgtcgagcgt 813

                       
Query: 299 ggcaccgtcaag 310
           || ||| |||||
Sbjct: 814 ggtaccctcaag 825

to top

>ref|XM_956420.1| Neurospora crassa OR74A hypothetical protein ( (AL513467) probable
           translation elongation factor EF-Tu precursor,
           mitochondrial [Neurospora crassa OR74A> (NCU03737.1)
           partial mRNA
          Length = 1314

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 64/72 (88%)
 Strand = Plus / Plus

                                                                       
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgt 298
           ||||||||||||||||||||| |||| |||||||| || ||| |||||||| ||||||||
Sbjct: 754 gttgaggatgtcttctccatcgccggccgtggtaccgtcgcctctggccgtgtcgagcgt 813

                       
Query: 299 ggcaccgtcaag 310
           || ||| |||||
Sbjct: 814 ggtaccctcaag 825

to top

>gb|AY372040.1| Lactobacillus paracasei strain NCC 2461 Tuf gene, partial cds
          Length = 699

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 237 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 296
           ||||||| ||||||||| ||||||| |||||||||||||||||  ||||||||||||| |
Sbjct: 334 ctgttgaagatgtcttcaccatcactggtcgtggtacagttgcttctggccgtatcgatc 393

               
Query: 297 gtgg 300
           ||||
Sbjct: 394 gtgg 397

to top

>gb|AY372039.1| Lactobacillus paracasei strain NCC 989 Tuf gene, partial cds
          Length = 701

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 237 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 296
           ||||||| ||||||||| ||||||| |||||||||||||||||  ||||||||||||| |
Sbjct: 335 ctgttgaagatgtcttcaccatcactggtcgtggtacagttgcttctggccgtatcgatc 394

               
Query: 297 gtgg 300
           ||||
Sbjct: 395 gtgg 398

to top

>emb|AJ459399.1|LPA459399 Lactobacillus paracasei subsp. paracasei partial mRNA for putative
           elongation factor Tu (tuf gene), strain ATCC 335
          Length = 761

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 237 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 296
           ||||||| ||||||||| ||||||| |||||||||||||||||  ||||||||||||| |
Sbjct: 347 ctgttgaagatgtcttcaccatcactggtcgtggtacagttgcttctggccgtatcgatc 406

               
Query: 297 gtgg 300
           ||||
Sbjct: 407 gtgg 410

to top

>emb|AJ459398.1|LPA459398 Lactobacillus paracasei subsp. paracasei partial mRNA for putative
           elongation factor Tu (tuf gene), strain ATCC 25303
          Length = 761

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 237 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 296
           ||||||| ||||||||| ||||||| |||||||||||||||||  ||||||||||||| |
Sbjct: 347 ctgttgaagatgtcttcaccatcactggtcgtggtacagttgcttctggccgtatcgatc 406

               
Query: 297 gtgg 300
           ||||
Sbjct: 407 gtgg 410

to top

>emb|AJ459397.1|LPA459397 Lactobacillus paracasei subsp. paracasei partial mRNA for putative
           elongation factor Tu (tuf gene), strain ATCC 25180
          Length = 761

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 237 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 296
           ||||||| ||||||||| ||||||| |||||||||||||||||  ||||||||||||| |
Sbjct: 347 ctgttgaagatgtcttcaccatcactggtcgtggtacagttgcttctggccgtatcgatc 406

               
Query: 297 gtgg 300
           ||||
Sbjct: 407 gtgg 410

to top

>emb|AJ459396.1|LPA459396 Lactobacillus paracasei subsp. paracasei partial mRNA for putative
           elongation factor Tu (tuf gene), strain DSM 20207
          Length = 761

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 237 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 296
           ||||||| ||||||||| ||||||| |||||||||||||||||  ||||||||||||| |
Sbjct: 347 ctgttgaagatgtcttcaccatcactggtcgtggtacagttgcttctggccgtatcgatc 406

               
Query: 297 gtgg 300
           ||||
Sbjct: 407 gtgg 410

to top

>emb|AJ459395.1|LPA459395 Lactobacillus paracasei subsp. tolerans partial mRNA for putative
           elongation factor Tu (tuf gene), strain DSM 20012
          Length = 761

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 237 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 296
           ||||||| ||||||||| ||||||| |||||||||||||||||  ||||||||||||| |
Sbjct: 347 ctgttgaagatgtcttcaccatcactggtcgtggtacagttgcttctggccgtatcgatc 406

               
Query: 297 gtgg 300
           ||||
Sbjct: 407 gtgg 410

to top

>emb|AJ459394.1|LPA459394 Lactobacillus paracasei subsp. paracasei partial mRNA for putative
           elongation factor Tu (tuf gene), strain ATCC 11582
          Length = 761

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 237 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 296
           ||||||| ||||||||| ||||||| |||||||||||||||||  ||||||||||||| |
Sbjct: 347 ctgttgaagatgtcttcaccatcactggtcgtggtacagttgcttctggccgtatcgatc 406

               
Query: 297 gtgg 300
           ||||
Sbjct: 407 gtgg 410

to top

>emb|AJ459393.1|LPA459393 Lactobacillus paracasei subsp. paracasei partial mRNA for putative
           elongation factor Tu (tuf gene), strain NCFB 151
          Length = 761

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 237 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 296
           ||||||| ||||||||| ||||||| |||||||||||||||||  ||||||||||||| |
Sbjct: 347 ctgttgaagatgtcttcaccatcactggtcgtggtacagttgcttctggccgtatcgatc 406

               
Query: 297 gtgg 300
           ||||
Sbjct: 407 gtgg 410

to top

>emb|AJ459392.1|LPA459392 Lactobacillus paracasei subsp. paracasei partial mRNA for putative
           elongation factor Tu (tuf gene), strain ATCC 27092
          Length = 761

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 237 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 296
           ||||||| ||||||||| ||||||| |||||||||||||||||  ||||||||||||| |
Sbjct: 347 ctgttgaagatgtcttcaccatcactggtcgtggtacagttgcttctggccgtatcgatc 406

               
Query: 297 gtgg 300
           ||||
Sbjct: 407 gtgg 410

to top

>emb|AJ459391.1|LPA459391 Lactobacillus paracasei subsp. paracasei partial mRNA for putative
           elongation factor Tu (tuf gene), strain DSM 20006
          Length = 761

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 237 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 296
           ||||||| ||||||||| ||||||| |||||||||||||||||  ||||||||||||| |
Sbjct: 347 ctgttgaagatgtcttcaccatcactggtcgtggtacagttgcttctggccgtatcgatc 406

               
Query: 297 gtgg 300
           ||||
Sbjct: 407 gtgg 410

to top

>emb|AJ459389.1|LPA459389 Lactobacillus paracasei subsp. paracasei partial mRNA for putative
           elongation factor Tu (tuf gene), strain NCDO206
          Length = 761

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 237 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 296
           ||||||| ||||||||| ||||||| |||||||||||||||||  ||||||||||||| |
Sbjct: 347 ctgttgaagatgtcttcaccatcactggtcgtggtacagttgcttctggccgtatcgatc 406

               
Query: 297 gtgg 300
           ||||
Sbjct: 407 gtgg 410

to top

>emb|AJ459388.1|LPA459388 Lactobacillus paracasei subsp. paracasei partial mRNA for putative
           elongation factor Tu (tuf gene), strain NCDO 205
          Length = 761

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 237 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 296
           ||||||| ||||||||| ||||||| |||||||||||||||||  ||||||||||||| |
Sbjct: 347 ctgttgaagatgtcttcaccatcactggtcgtggtacagttgcttctggccgtatcgatc 406

               
Query: 297 gtgg 300
           ||||
Sbjct: 407 gtgg 410

to top

>emb|AJ459387.1|LZE459387 Lactobacillus zeae partial mRNA for putative elongation factor Tu
           (tuf gene), strain ATCC 15820
          Length = 761

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 67/76 (88%)
 Strand = Plus / Plus

                                                                       
Query: 237 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 296
           ||||||| ||||||||| ||||||| ||||||||||| |||||  ||||||||||||| |
Sbjct: 347 ctgttgaagatgtcttcaccatcactggtcgtggtaccgttgcttctggccgtatcgatc 406

                           
Query: 297 gtggcaccgtcaaggt 312
           |||| ||||| |||||
Sbjct: 407 gtggtaccgttaaggt 422

to top

>emb|AJ459386.1|LCA459386 Lactobacillus casei partial mRNA for putative elongation factor Tu
           (tuf gene), strain ATCC 4646
          Length = 761

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 237 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 296
           ||||||| ||||||||| ||||||| |||||||||||||||||  ||||||||||||| |
Sbjct: 347 ctgttgaagatgtcttcaccatcactggtcgtggtacagttgcttctggccgtatcgatc 406

               
Query: 297 gtgg 300
           ||||
Sbjct: 407 gtgg 410

to top

>emb|AJ459385.1|LPA459385 Lactobacillus paracasei subsp. paracasei partial mRNA for putative
           elongation factor Tu (tuf gene), strain ATCC 29599
          Length = 761

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 237 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 296
           ||||||| ||||||||| ||||||| |||||||||||||||||  ||||||||||||| |
Sbjct: 347 ctgttgaagatgtcttcaccatcactggtcgtggtacagttgcttctggccgtatcgatc 406

               
Query: 297 gtgg 300
           ||||
Sbjct: 407 gtgg 410

to top

>emb|AJ418937.2|LCA418937 Lactobacillus paracasei subsp. paracasei partial mRNA for putative
           elongation factor Tu (tuf gene), strain ATCC 27216
          Length = 761

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 237 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 296
           ||||||| ||||||||| ||||||| |||||||||||||||||  ||||||||||||| |
Sbjct: 347 ctgttgaagatgtcttcaccatcactggtcgtggtacagttgcttctggccgtatcgatc 406

               
Query: 297 gtgg 300
           ||||
Sbjct: 407 gtgg 410

to top

>emb|AJ418923.2|LCA418923 Lactobacillus casei partial mRNA for putative elongation factor Tu
           (tuf gene), strain ATCC 334
          Length = 761

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 237 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 296
           ||||||| ||||||||| ||||||| |||||||||||||||||  ||||||||||||| |
Sbjct: 347 ctgttgaagatgtcttcaccatcactggtcgtggtacagttgcttctggccgtatcgatc 406

               
Query: 297 gtgg 300
           ||||
Sbjct: 407 gtgg 410

to top

>emb|AJ418922.2|LCA418922 Lactobacillus paracasei subsp. tolerans partial mRNA for putative
           elongation factor Tu (tuf gene), strain ATCC 25599
          Length = 761

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 237 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 296
           ||||||| ||||||||| ||||||| |||||||||||||||||  ||||||||||||| |
Sbjct: 347 ctgttgaagatgtcttcaccatcactggtcgtggtacagttgcttctggccgtatcgatc 406

               
Query: 297 gtgg 300
           ||||
Sbjct: 407 gtgg 410

to top

>emb|AJ418912.2|LCA418912 Lactobacillus casei subsp. pseudoplantarum partial mRNA for
           putative elongation factor Tu (tuf gene), strain ATCC
           25598
          Length = 761

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 237 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 296
           ||||||| ||||||||| ||||||| |||||||||||||||||  ||||||||||||| |
Sbjct: 347 ctgttgaagatgtcttcaccatcactggtcgtggtacagttgcttctggccgtatcgatc 406

               
Query: 297 gtgg 300
           ||||
Sbjct: 407 gtgg 410

to top

>emb|AL513467.1|NC17E5 Neurospora crassa DNA linkage group V Cosmid contig 17E5
          Length = 130049

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 64/72 (88%)
 Strand = Plus / Minus

                                                                         
Query: 239   gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgt 298
             ||||||||||||||||||||| |||| |||||||| || ||| |||||||| ||||||||
Sbjct: 23973 gttgaggatgtcttctccatcgccggccgtggtaccgtcgcctctggccgtgtcgagcgt 23914

                         
Query: 299   ggcaccgtcaag 310
             || ||| |||||
Sbjct: 23913 ggtaccctcaag 23902

to top

>emb|X66062.1|GMTUFA G.max tufA gene for chloroplast translation elongation factor EF-Tu
          Length = 2313

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 90/107 (84%)
 Strand = Plus / Plus

                                                                        
Query: 212  cagacagacctgcccttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggt 271
            ||||| ||||| |||||| | ||||| || || || ||||||||||||||||| ||||| 
Sbjct: 1565 cagaccgacctccccttcctcctcgccgtcgaagacgtcttctccatcaccggccgtggc 1624

                                                           
Query: 272  acagttgccactggccgtatcgagcgtggcaccgtcaaggttgggga 318
            || || |||||||||||| | |||||||||||| |||| || |||||
Sbjct: 1625 accgtcgccactggccgtgtagagcgtggcaccatcaaagtagggga 1671

to top

>gb|CP000097.1| Synechococcus sp. CC9902, complete genome
          Length = 2234828

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                           
Query: 413     gacaatgttggcctgctgctccgtggtatgcagaaggaagacattgagagaggcatggtg 472
               ||||| ||||| || ||||| || ||||| |||||||||||||| ||| | |||||||||
Sbjct: 1929975 gacaacgttggtctcctgcttcgcggtattcagaaggaagacatcgagcgcggcatggtg 1930034

                                                     
Query: 473     ttggcaaagccgggttccatcacgccacacaccaagtt 510
               ||||  ||||| || |||||||| || |||||||||||
Sbjct: 1930035 ttggtgaagcctggctccatcacacctcacaccaagtt 1930072



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 74/89 (83%)
 Strand = Plus / Plus

                                                                           
Query: 227     ttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggc 286
               |||||| | ||| |||| ||||| ||||||||||| || || || || ||||| || || 
Sbjct: 1929789 ttcttgatggctattgaagatgtgttctccatcacgggccgaggcacggttgctaccggt 1929848

                                            
Query: 287     cgtatcgagcgtggcaccgtcaaggttgg 315
               |||||||||||||||| |||||| |||||
Sbjct: 1929849 cgtatcgagcgtggcatcgtcaaagttgg 1929877

to top

>gb|U09443.1|PEU09443 Phormidium ectocarpi PCC 7375 protein synthesis elongation factor
           Tu (tufA) gene, partial cds
          Length = 706

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 65/74 (87%)
 Strand = Plus / Plus

                                                                       
Query: 227 ttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggc 286
           |||||| | ||||||||||| ||||||||||| || ||||||||||| || || ||||||
Sbjct: 394 ttcttgatggctgttgaggacgtcttctccattactggtcgtggtactgtagctactggc 453

                         
Query: 287 cgtatcgagcgtgg 300
           || |||||||||||
Sbjct: 454 cgaatcgagcgtgg 467



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 371 gttgagatgttccagaagacc 391
           |||||||||||||||||||||
Sbjct: 538 gttgagatgttccagaagacc 558

to top

>gb|AY372038.1| Lactobacillus casei strain NCC 2508 Tuf gene, partial cds
          Length = 700

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Plus

                                                                       
Query: 245 gatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggcacc 304
           ||||||||| ||||||| ||||||||||| |||||  ||||||||||||| ||||| |||
Sbjct: 342 gatgtcttcaccatcactggtcgtggtactgttgcttctggccgtatcgatcgtggtacc 401

                   
Query: 305 gtcaaggt 312
           || |||||
Sbjct: 402 gttaaggt 409

to top

>emb|AJ459390.1|LCA459390 Lactobacillus casei subsp. casei partial mRNA for putative
           elongation factor Tu (tuf gene), strain NCDO173
          Length = 761

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Plus

                                                                       
Query: 245 gatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggcacc 304
           ||||||||| ||||||| ||||||||||| |||||  ||||||||||||| ||||| |||
Sbjct: 355 gatgtcttcaccatcactggtcgtggtactgttgcttctggccgtatcgatcgtggtacc 414

                   
Query: 305 gtcaaggt 312
           || |||||
Sbjct: 415 gttaaggt 422

to top

>emb|AJ418933.2|LZE418933 Lactobacillus zeae partial mRNA for putative elongation factor Tu
           (tuf gene), strain ATCC 393
          Length = 761

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Plus

                                                                       
Query: 245 gatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggcacc 304
           ||||||||| ||||||| ||||||||||| |||||  ||||||||||||| ||||| |||
Sbjct: 355 gatgtcttcaccatcactggtcgtggtactgttgcttctggccgtatcgatcgtggtacc 414

                   
Query: 305 gtcaaggt 312
           || |||||
Sbjct: 415 gttaaggt 422

to top

>gb|CP000142.2| Pelobacter carbinolicus DSM 2380, complete genome
          Length = 3665893

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 41/43 (95%)
 Strand = Plus / Plus

                                                         
Query: 237    ctgttgaggatgtcttctccatcaccggtcgtggtacagttgc 279
              ||||||||||||||||||||||| ||||||||||||| |||||
Sbjct: 836025 ctgttgaggatgtcttctccatctccggtcgtggtactgttgc 836067



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 56/64 (87%)
 Strand = Plus / Plus

                                                                          
Query: 237    ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 296
              ||||||||||||| ||||||||| |||||||||| || |||||||| || ||| | ||||
Sbjct: 852342 ctgttgaggatgttttctccatctccggtcgtggcacggttgccaccggtcgtgttgagc 852401

                  
Query: 297    gtgg 300
              ||||
Sbjct: 852402 gtgg 852405

to top

>dbj|AP006627.1| Bacillus clausii KSM-K16 DNA, complete genome
          Length = 4303871

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 56/63 (88%)
 Strand = Plus / Plus

                                                                          
Query: 239    gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgt 298
              |||||||| || ||||| ||||| ||||||||||||||||| ||||||||| | ||||||
Sbjct: 181693 gttgaggacgtattctctatcactggtcgtggtacagttgcgactggccgtgtagagcgt 181752

                 
Query: 299    ggc 301
              |||
Sbjct: 181753 ggc 181755

to top

>gb|U09444.1|PBU09444 Plectonema boryanum PCC 73110 protein synthesis elongation factor
           Tu (tufA) gene, partial cds
          Length = 706

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 121/150 (80%)
 Strand = Plus / Plus

                                                                       
Query: 365 actggtgttgagatgttccagaagaccatggatgatgccattgctggggacaatgttggc 424
           ||||| ||||||||||||||||||||  |||||  ||  || ||||| ||||| || |||
Sbjct: 532 actggcgttgagatgttccagaagacattggattctggtatggctggcgacaacgtgggc 591

                                                                       
Query: 425 ctgctgctccgtggtatgcagaaggaagacattgagagaggcatggtgttggcaaagccg 484
            | ||||| |||||| | ||||| |||||||| ||| | ||||||||  |||| ||| | 
Sbjct: 592 gtactgcttcgtggtgttcagaaagaagacatcgagcgtggcatggtactggcgaagtcc 651

                                         
Query: 485 ggttccatcacgccacacaccaagtttgag 514
           || |||||||| || |||||| ||||||||
Sbjct: 652 ggctccatcacacctcacaccgagtttgag 681



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccac 282
           |||||||| || ||||| || || ||||||||||| ||||||||
Sbjct: 406 gttgaggacgtgttctctattacgggtcgtggtacggttgccac 449

to top

>gb|M94204.1|TOBTEFTU Nicotiana tabacum translation elongation factor EF-Tu gene, complete
            cds
          Length = 2342

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 76/90 (84%)
 Strand = Plus / Plus

                                                                        
Query: 459  agagaggcatggtgttggcaaagccgggttccatcacgccacacaccaagtttgaggcag 518
            ||||||| |||||||||||||| || ||  | || || || |||||||||||||| ||  
Sbjct: 1443 agagaggaatggtgttggcaaaacccggaacaattacccctcacaccaagtttgaagcta 1502

                                          
Query: 519  ttgtgtatgtgctcaagaaggaggagggtg 548
            ||||||||||| | ||||||||||||||||
Sbjct: 1503 ttgtgtatgtgttgaagaaggaggagggtg 1532

to top

>dbj|D11469.1|TOBTUFA2 Nicotiana sylvestris tufA gene for chloroplast elongation factor TuA,
            complete cds
          Length = 2667

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 76/90 (84%)
 Strand = Plus / Plus

                                                                        
Query: 459  agagaggcatggtgttggcaaagccgggttccatcacgccacacaccaagtttgaggcag 518
            ||||||| |||||||||||||| || ||  | || || || |||||||||||||| ||  
Sbjct: 1767 agagaggaatggtgttggcaaaacccggaacaattacccctcacaccaagtttgaagcga 1826

                                          
Query: 519  ttgtgtatgtgctcaagaaggaggagggtg 548
            ||||||||||| | ||||||||||||||||
Sbjct: 1827 ttgtgtatgtgttgaagaaggaggagggtg 1856

to top

>dbj|D11375.1|TOBTUFA N. sylvestris tufA gene for chloroplast elongation factor TuA
            (EF-TuA), partial sequence
          Length = 1390

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 76/90 (84%)
 Strand = Plus / Plus

                                                                        
Query: 459  agagaggcatggtgttggcaaagccgggttccatcacgccacacaccaagtttgaggcag 518
            ||||||| |||||||||||||| || ||  | || || || |||||||||||||| ||  
Sbjct: 1119 agagaggaatggtgttggcaaaacccggaacaattacccctcacaccaagtttgaagcga 1178

                                          
Query: 519  ttgtgtatgtgctcaagaaggaggagggtg 548
            ||||||||||| | ||||||||||||||||
Sbjct: 1179 ttgtgtatgtgttgaagaaggaggagggtg 1208

to top

>emb|CR628336.1| Legionella pneumophila str. Paris complete genome
          Length = 3503610

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 51/57 (89%)
 Strand = Plus / Plus

                                                                       
Query: 473    ttggcaaagccgggttccatcacgccacacaccaagtttgaggcagttgtgtatgtg 529
              ||||||||||| ||| |||||| |||||||||||||||||| ||||  |||||||||
Sbjct: 455641 ttggcaaagccaggtaccatcaagccacacaccaagtttgaagcagaagtgtatgtg 455697



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 51/57 (89%)
 Strand = Plus / Plus

                                                                       
Query: 473    ttggcaaagccgggttccatcacgccacacaccaagtttgaggcagttgtgtatgtg 529
              ||||||||||| ||| |||||| |||||||||||||||||| ||||  |||||||||
Sbjct: 439358 ttggcaaagccaggtaccatcaagccacacaccaagtttgaagcagaagtgtatgtg 439414

to top

>gb|BT014591.1| Lycopersicon esculentum clone 134061F, mRNA sequence
          Length = 1873

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 74/88 (84%)
 Strand = Plus / Plus

                                                                        
Query: 461  agaggcatggtgttggcaaagccgggttccatcacgccacacaccaagtttgaggcagtt 520
            ||||| ||||||||||| || |||||  | ||||| || |||||||||||||| ||  ||
Sbjct: 1257 agaggaatggtgttggcgaaaccgggaacaatcactcctcacaccaagtttgaagctctt 1316

                                        
Query: 521  gtgtatgtgctcaagaaggaggagggtg 548
            |||||||| || || |||||||||||||
Sbjct: 1317 gtgtatgttctgaaaaaggaggagggtg 1344

to top

>emb|X17442.1|ANORF150 A.nidulans DNA for a region containing ORF150, rps12, rps7, fus, tufA
          Length = 5139

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                    
Query: 260  accggtcgtggtacagttgccactggccgtatcgagcgtggcaccgtcaaggttgg 315
            ||||||||||| || || || |||||||| ||||||||||||| ||||||||||||
Sbjct: 4515 accggtcgtggcacggtggcgactggccggatcgagcgtggcagcgtcaaggttgg 4570



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                            
Query: 467  atggtgttggcaaagccgggttccatcacgccacacaccaagtttgag 514
            ||||| ||||| || || ||||| || ||||| |||||||||||||||
Sbjct: 4722 atggtcttggccaaacccggttcgattacgcctcacaccaagtttgag 4769

to top

>dbj|AP007154.1| Aspergillus oryzae RIB40 genomic DNA, SC001
          Length = 2005935

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 56/64 (87%)
 Strand = Plus / Minus

                                                                          
Query: 237    ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 296
              |||| ||||| |||||||||||| ||||||||||||| |||||| | |||||| |||| |
Sbjct: 834275 ctgtcgaggaagtcttctccatcgccggtcgtggtaccgttgcctccggccgtgtcgaac 834216

                  
Query: 297    gtgg 300
              ||||
Sbjct: 834215 gtgg 834212

to top

>dbj|AP008231.1| Synechococcus elongatus PCC 6301 DNA, complete genome
          Length = 2696255

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                      
Query: 260    accggtcgtggtacagttgccactggccgtatcgagcgtggcaccgtcaaggttgg 315
              ||||||||||| || || || |||||||| ||||||||||||| ||||||||||||
Sbjct: 730632 accggtcgtggcacggtggcgactggccggatcgagcgtggcagcgtcaaggttgg 730687



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                              
Query: 467    atggtgttggcaaagccgggttccatcacgccacacaccaagtttgag 514
              ||||| ||||| || || ||||| || ||||| |||||||||||||||
Sbjct: 730839 atggtcttggccaaacccggttcgattacgcctcacaccaagtttgag 730886

to top

>gb|CP000100.1| Synechococcus elongatus PCC 7942, complete genome
          Length = 2695903

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                      
Query: 260    accggtcgtggtacagttgccactggccgtatcgagcgtggcaccgtcaaggttgg 315
              ||||||||||| || || || |||||||| ||||||||||||| ||||||||||||
Sbjct: 890233 accggtcgtggcacggtggcgactggccggatcgagcgtggcagcgtcaaggttgg 890178



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                              
Query: 467    atggtgttggcaaagccgggttccatcacgccacacaccaagtttgag 514
              ||||| ||||| || || ||||| || ||||| |||||||||||||||
Sbjct: 890026 atggtcttggccaaacccggttcgattacgcctcacaccaagtttgag 889979

to top

>emb|Z99104.2|BSUB0001 Bacillus subtilis complete genome (section 1 of 21): from 1 to 213080
          Length = 213080

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                                 
Query: 239    gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
              |||||||| || ||||| ||||| ||||||||||||||||| |||||||||
Sbjct: 133526 gttgaggacgtattctcaatcactggtcgtggtacagttgctactggccgt 133576

to top

>gb|AF234537.1|AF234537 Pelargonium graveolens chloroplast translational elongation factor
           Tu (tufA) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 1584

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                       
Query: 212 cagacagacctgcccttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggt 271
           ||||| ||||| || || ||||| |||||||||||||| || || |||||||| ||||||
Sbjct: 861 cagactgaccttccgtttttgctagctgttgaggatgtgttttcaatcaccggacgtggt 920

                      
Query: 272 acagttgccac 282
           || ||||||||
Sbjct: 921 accgttgccac 931

to top

>dbj|BA000004.3| Bacillus halodurans C-125 DNA, complete genome
          Length = 4202352

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                             
Query: 239    gttgaggatgtcttctccatcaccggtcgtggtacagttgccactgg 285
              ||||||||||| ||||| ||||| ||||||||||||||||| |||||
Sbjct: 167281 gttgaggatgtattctctatcactggtcgtggtacagttgctactgg 167327

to top

>dbj|D64127.1| Bacillus subtilis genes for RNA polymerase beta subunit, ribosomal
            proteins L12 and S7, elongation factors G and Tu and
            ribosomal proteins S10 and L3, partial and complete cds
          Length = 8977

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                               
Query: 239  gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
            |||||||| || ||||| ||||| ||||||||||||||||| |||||||||
Sbjct: 6614 gttgaggacgtattctcaatcactggtcgtggtacagttgctactggccgt 6664

to top

>dbj|AB017508.1| Bacillus halodurans C-125 genomic DNA, 32 kb fragment, complete cds
          Length = 32050

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                            
Query: 239   gttgaggatgtcttctccatcaccggtcgtggtacagttgccactgg 285
             ||||||||||| ||||| ||||| ||||||||||||||||| |||||
Sbjct: 11795 gttgaggatgtattctctatcactggtcgtggtacagttgctactgg 11841

to top

>emb|AJ781773.3| Lactobacillus buchneri partial tuf gene for elongation factor Tu
          Length = 518

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgt 298
           ||||| ||||||||| | ||||| ||||||||||| |||||  ||||||||||||| |||
Sbjct: 202 gttgaagatgtcttcactatcactggtcgtggtactgttgcatctggccgtatcgatcgt 261

             
Query: 299 gg 300
           ||
Sbjct: 262 gg 263

to top

>emb|AL111934.1|CNS019PI Botrytis cinerea strain T4 cDNA library
          Length = 780

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgt 298
           ||||||||||| ||||||||| | |||||||| || || ||| |||||||| ||||||||
Sbjct: 335 gttgaggatgttttctccatcccaggtcgtggaactgtcgcctctggccgtgtcgagcgt 394

             
Query: 299 gg 300
           ||
Sbjct: 395 gg 396

to top

>dbj|BA000028.3| Oceanobacillus iheyensis HTE831 DNA, complete genome
          Length = 3630528

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                          
Query: 239    gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgt 298
              ||||||||||| ||||| ||||| |||||||| |||||||| ||||| ||| | ||||||
Sbjct: 140371 gttgaggatgtattctcaatcactggtcgtggaacagttgcaactggacgtgttgagcgt 140430

                
Query: 299    gg 300
              ||
Sbjct: 140431 gg 140432

to top

>gb|U09445.1|PHU09445 Prochlorothrix hollandica protein synthesis elongation factor Tu
           (tufA) gene, cds
          Length = 703

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 51/58 (87%)
 Strand = Plus / Plus

                                                                     
Query: 240 ttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcg 297
           ||||||||||||||||||| ||||||||||| || || ||||| || ||||| |||||
Sbjct: 407 ttgaggatgtcttctccattaccggtcgtggaaccgtggccaccggtcgtattgagcg 464

to top

>gb|AE017194.1| Bacillus cereus ATCC 10987, complete genome
          Length = 5224283

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                               
Query: 237    ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactgg 285
              |||| |||||||| ||||| ||||| ||||||||||||||||| |||||
Sbjct: 120017 ctgtagaggatgtattctctatcacaggtcgtggtacagttgctactgg 120065

to top

>gb|U09434.1|GSU09434 Gloeothece PCC6501 protein synthesis elongation factor Tu (tufA)
           gene, partial cds
          Length = 706

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                
Query: 245 gatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcg 297
           ||||||||||| ||||||||||| || |||||||| ||||| || ||||||||
Sbjct: 412 gatgtcttctctatcaccggtcggggaacagttgctactggacggatcgagcg 464

to top

>gb|CP000153.1| Thiomicrospira denitrificans ATCC 33889, complete genome
          Length = 2201561

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                          
Query: 237    ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 296
              ||||||| ||||| ||||| ||| | |||||||| |||||||  ||||| ||||||||||
Sbjct: 343785 ctgttgaagatgttttctcaatctctggtcgtggaacagttgtaactggtcgtatcgagc 343844

                  
Query: 297    gtgg 300
              ||||
Sbjct: 343845 gtgg 343848

to top

>gb|AY372037.1| Lactobacillus rhamnosus strain NCC 2504 Tuf gene, partial cds
          Length = 701

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 237 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 296
           ||||||| ||||||||| |||| || ||||||||||| |||||  |||| |||||||| |
Sbjct: 335 ctgttgaagatgtcttcaccattactggtcgtggtaccgttgcttctggtcgtatcgatc 394

               
Query: 297 gtgg 300
           ||||
Sbjct: 395 gtgg 398

to top

>gb|AY305397.1| Synthetic construct reconstructed ancestral elongation factor Tu
           Alt-stem gene, complete cds
          Length = 1185

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                   
Query: 474 tggcaaagccgggttccatcacgccacacaccaagtttga 513
           |||| |||||||||  ||||||||||||||||||||||||
Sbjct: 878 tggctaagccgggtagcatcacgccacacaccaagtttga 917

to top

>emb|Y15107.1|GMTUFA2 Glycine max tufA2 gene
          Length = 890

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Plus

                                                                       
Query: 251 ttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggcaccgtcaag 310
           |||||||||||||| ||||| || || ||||| |||||  | ||||||||||||||||| 
Sbjct: 202 ttctccatcaccggccgtgggaccgtcgccaccggccgcgtagagcgtggcaccgtcaaa 261

                   
Query: 311 gttgggga 318
           || |||||
Sbjct: 262 gtagggga 269



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 65/80 (81%)
 Strand = Plus / Plus

                                                                       
Query: 74  atcgtctccggctctgcactcagagcgctcgaggccctcatggccacccctggcctcaag 133
           |||||||||||||| ||||||  ||| || || ||||| ||||| | ||||| | |||| 
Sbjct: 25  atcgtctccggctccgcactcttagccctagaagcccttatggcgaaccctgccatcaaa 84

                               
Query: 134 cgtggggataacgagtgggt 153
           || || || |||||||||||
Sbjct: 85  cgcggcgacaacgagtgggt 104

to top

>emb|X98830.1|PRFUSTUF P.rosea fus, tuf, rpsJ and rplC genes
          Length = 2742

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                    
Query: 242  gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcg 297
            ||||| |||||||| |||||||||||||| || || | ||| ||||||||||||||
Sbjct: 1128 gaggacgtcttctcgatcaccggtcgtggaaccgtcgtcaccggccgtatcgagcg 1183

to top

>emb|X76867.1|FF13524 F.ferrugineum (DSM 13524) tuf gene
          Length = 1188

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Plus

                                                                       
Query: 242 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggc 301
           ||||| || ||||| ||||| ||||||||||| ||||| || || |||||||||||||||
Sbjct: 646 gaggacgtattctctatcactggtcgtggtactgttgctaccggtcgtatcgagcgtggc 705

to top

>emb|CR522870.1| Desulfotalea psychrophila LSv54 chromosome
          Length = 3523383

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                           
Query: 237     ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 296
               ||||||| ||||||||||| ||| ||||||||||||| ||||| || || ||| | ||||
Sbjct: 1271748 ctgttgaagatgtcttctctatctccggtcgtggtactgttgcaaccggtcgtgttgagc 1271807

                   
Query: 297     gtgg 300
               ||||
Sbjct: 1271808 gtgg 1271811



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 65/79 (82%)
 Strand = Plus / Plus

                                                                           
Query: 237     ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 296
               ||||||||||||| ||||| ||| |||||||||| || || || || || ||| | ||||
Sbjct: 1254879 ctgttgaggatgtattctctatctccggtcgtggaactgtagcaaccggtcgtgttgagc 1254938

                                  
Query: 297     gtggcaccgtcaaggttgg 315
               |||| | | ||||||||||
Sbjct: 1254939 gtggtatcatcaaggttgg 1254957

to top

>emb|AJ786714.1| Lactobacillus kimchii partial tuf gene for elongation factor Tu
          Length = 525

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 237 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 296
           ||||||| ||||||||| | ||||| ||||||||||| |||||  |||| |||||||| |
Sbjct: 203 ctgttgaagatgtcttcactatcactggtcgtggtactgttgcatctggtcgtatcgatc 262

               
Query: 297 gtgg 300
           ||||
Sbjct: 263 gtgg 266

to top

>emb|AJ786713.1| Lactobacillus alimentarius partial tuf gene for elongation factor
           Tu
          Length = 510

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 237 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 296
           ||||||| ||||||||| | ||||| ||||||||||| |||||  |||| |||||||| |
Sbjct: 185 ctgttgaagatgtcttcactatcactggtcgtggtactgttgcatctggtcgtatcgacc 244

               
Query: 297 gtgg 300
           ||||
Sbjct: 245 gtgg 248

to top

>emb|AJ459829.1|LRH459829 Lactobacillus rhamnosus partial tuf gene for putative elongation
           factor Tu, strain ATCC 11981
          Length = 761

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 237 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 296
           ||||||| ||||||||| |||| || ||||||||||| |||||  |||| |||||||| |
Sbjct: 347 ctgttgaagatgtcttcaccattactggtcgtggtaccgttgcttctggtcgtatcgatc 406

               
Query: 297 gtgg 300
           ||||
Sbjct: 407 gtgg 410

to top

>emb|AJ459828.1|LRH459828 Lactobacillus rhamnosus partial tuf gene for putative elongation
           factor Tu, strain ATCC 11443
          Length = 761

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 237 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 296
           ||||||| ||||||||| |||| || ||||||||||| |||||  |||| |||||||| |
Sbjct: 347 ctgttgaagatgtcttcaccattactggtcgtggtaccgttgcttctggtcgtatcgatc 406

               
Query: 297 gtgg 300
           ||||
Sbjct: 407 gtgg 410

to top

>emb|AJ418939.2|LRH418939 Lactobacillus rhamnosus partial mRNA for putative elongation factor
           Tu (tuf gene), strain ATCC 7469
          Length = 761

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 237 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 296
           ||||||| ||||||||| |||| || ||||||||||| |||||  |||| |||||||| |
Sbjct: 347 ctgttgaagatgtcttcaccattactggtcgtggtaccgttgcttctggtcgtatcgatc 406

               
Query: 297 gtgg 300
           ||||
Sbjct: 407 gtgg 410

to top

>emb|AJ418930.2|LAG418930 Lactobacillus agilis partial mRNA for putative elongation factor Tu
           (tuf gene), strain NCIB 11716
          Length = 761

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 237 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 296
           ||||||| ||||||||| | ||||| ||||||||||| |||||  |||| |||||||| |
Sbjct: 347 ctgttgaagatgtcttcactatcacaggtcgtggtactgttgcttctggtcgtatcgacc 406

               
Query: 297 gtgg 300
           ||||
Sbjct: 407 gtgg 410

to top

>emb|AJ418920.2|LPE418920 Lactobacillus pentosus partial mRNA for putative elongation factor
           Tu (tuf gene), strain ATCC 8041
          Length = 761

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 237 ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagc 296
           ||||||| ||||||||||| ||||| |||||||| || |||||  |||| |||||||| |
Sbjct: 347 ctgttgaagatgtcttctcaatcactggtcgtgggactgttgcttctggtcgtatcgatc 406

               
Query: 297 gtgg 300
           ||||
Sbjct: 407 gtgg 410

to top

>gb|U67308.1|PRU67308 Planobispora rosea elongation factor Tu1 (tuf1) gene, complete cds
          Length = 1826

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                    
Query: 242  gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcg 297
            ||||| |||||||| |||||||||||||| || || | ||| ||||||||||||||
Sbjct: 1128 gaggacgtcttctcgatcaccggtcgtggaaccgtcgtcaccggccgtatcgagcg 1183

to top

>gb|DQ098151.1| Uncultured Pseudonocardia sp. clone colony 30 Tuf1 (tuf1) gene,
           partial cds
          Length = 691

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 242 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggc 301
           ||||| |||||| | ||||||||||| || || || | ||| |||||||||||||| |||
Sbjct: 459 gaggacgtcttcacgatcaccggtcgcggcacggtcgtcaccggccgtatcgagcgcggc 518

                      
Query: 302 accgtcaaggt 312
           | |||||||||
Sbjct: 519 atcgtcaaggt 529

to top

>gb|DQ098149.1| Uncultured Pseudonocardia sp. clone colony 168 Tuf1 (tuf1) gene,
           partial cds
          Length = 692

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 242 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggc 301
           ||||| |||||| | ||||||||||| || || || | ||| |||||||||||||| |||
Sbjct: 460 gaggacgtcttcacgatcaccggtcgcggcacggtcgtcaccggccgtatcgagcgcggc 519

                      
Query: 302 accgtcaaggt 312
           | |||||||||
Sbjct: 520 atcgtcaaggt 530

to top

>gb|DQ098148.1| Uncultured Pseudonocardia sp. clone colony 167 Tuf1 (tuf1) gene,
           partial cds
          Length = 692

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 242 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggc 301
           ||||| |||||| | ||||||||||| || || || | ||| |||||||||||||| |||
Sbjct: 460 gaggacgtcttcacgatcaccggtcgcggcacggtcgtcaccggccgtatcgagcgcggc 519

                      
Query: 302 accgtcaaggt 312
           | |||||||||
Sbjct: 520 atcgtcaaggt 530

to top

>gb|DQ098147.1| Uncultured Pseudonocardia sp. clone colony SP011026-1 Tuf1 (tuf1)
           gene, partial cds
          Length = 692

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 242 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggc 301
           ||||| |||||| | ||||||||||| || || || | ||| |||||||||||||| |||
Sbjct: 460 gaggacgtcttcacgatcaccggtcgcggcacggtcgtcaccggccgtatcgagcgcggc 519

                      
Query: 302 accgtcaaggt 312
           | |||||||||
Sbjct: 520 atcgtcaaggt 530

to top

>gb|DQ098146.1| Uncultured Pseudonocardia sp. clone colony CC030106-15 Tuf1 (tuf1)
           gene, partial cds
          Length = 692

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 242 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggc 301
           ||||| |||||| | ||||||||||| || || || | ||| |||||||||||||| |||
Sbjct: 460 gaggacgtcttcacgatcaccggtcgcggcacggtcgtcaccggccgtatcgagcgcggc 519

                      
Query: 302 accgtcaaggt 312
           | |||||||||
Sbjct: 520 atcgtcaaggt 530

to top

>gb|DQ098143.1| Uncultured Pseudonocardia sp. clone colony CC010325-7 Tuf1 (tuf1)
           gene, partial cds
          Length = 692

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 242 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggc 301
           ||||| |||||| | ||||||||||| || || || | ||| |||||||||||||| |||
Sbjct: 460 gaggacgtcttcacgatcaccggtcgcggcacggtcgtcaccggccgtatcgagcgcggc 519

                      
Query: 302 accgtcaaggt 312
           | |||||||||
Sbjct: 520 atcgtcaaggt 530

to top

>gb|DQ098141.1| Uncultured Pseudonocardia sp. clone colony 33 Tuf1 (tuf1) gene,
           partial cds
          Length = 691

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 242 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggc 301
           ||||| |||||| | ||||||||||| || || || | ||| |||||||||||||| |||
Sbjct: 460 gaggacgtcttcacgatcaccggtcgcggcacggtcgtcaccggccgtatcgagcgcggc 519

                      
Query: 302 accgtcaaggt 312
           | |||||||||
Sbjct: 520 atcgtcaaggt 530

to top

>gb|DQ098140.1| Uncultured Pseudonocardia sp. clone colony 101 Tuf1 (tuf1) gene,
           partial cds
          Length = 692

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 242 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggc 301
           ||||| |||||| | ||||||||||| || || || | ||| |||||||||||||| |||
Sbjct: 460 gaggacgtcttcacgatcaccggtcgcggcacggtcgtcaccggccgtatcgagcgcggc 519

                      
Query: 302 accgtcaaggt 312
           | |||||||||
Sbjct: 520 atcgtcaaggt 530

to top

>gb|DQ098139.1| Uncultured Pseudonocardia sp. clone colony 12 Tuf1 (tuf1) gene,
           partial cds
          Length = 692

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 242 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggc 301
           ||||| |||||| | ||||||||||| || || || | ||| |||||||||||||| |||
Sbjct: 460 gaggacgtcttcacgatcaccggtcgcggcacggtcgtcaccggccgtatcgagcgcggc 519

                      
Query: 302 accgtcaaggt 312
           | |||||||||
Sbjct: 520 atcgtcaaggt 530

to top

>gb|DQ098138.1| Uncultured Pseudonocardia sp. clone colony 21 Tuf1 (tuf1) gene,
           partial cds
          Length = 692

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 242 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggc 301
           ||||| |||||| | ||||||||||| || || || | ||| |||||||||||||| |||
Sbjct: 460 gaggacgtcttcacgatcaccggtcgcggcacggtcgtcaccggccgtatcgagcgcggc 519

                      
Query: 302 accgtcaaggt 312
           | |||||||||
Sbjct: 520 atcgtcaaggt 530

to top

>gb|DQ098136.1| Uncultured Pseudonocardia sp. clone colony 31 Tuf1 (tuf1) gene,
           partial cds
          Length = 692

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 242 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggc 301
           ||||| |||||| | ||||||||||| || || || | ||| |||||||||||||| |||
Sbjct: 460 gaggacgtcttcacgatcaccggtcgcggcacggtcgtcaccggccgtatcgagcgcggc 519

                      
Query: 302 accgtcaaggt 312
           | |||||||||
Sbjct: 520 atcgtcaaggt 530

to top

>gb|DQ098134.1| Uncultured Pseudonocardia sp. clone colony 174 Tuf1 (tuf1) gene,
           partial cds
          Length = 692

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 242 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggc 301
           ||||| |||||| | ||||||||||| || || || | ||| |||||||||||||| |||
Sbjct: 460 gaggacgtcttcacgatcaccggtcgcggcacggtcgtcaccggccgtatcgagcgcggc 519

                      
Query: 302 accgtcaaggt 312
           | |||||||||
Sbjct: 520 atcgtcaaggt 530

to top

>gb|DQ098133.1| Uncultured Pseudonocardia sp. clone colony 38 Tuf1 (tuf1) gene,
           partial cds
          Length = 692

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 242 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggc 301
           ||||| |||||| | ||||||||||| || || || | ||| |||||||||||||| |||
Sbjct: 460 gaggacgtcttcacgatcaccggtcgcggcacggtcgtcaccggccgtatcgagcgcggc 519

                      
Query: 302 accgtcaaggt 312
           | |||||||||
Sbjct: 520 atcgtcaaggt 530

to top

>gb|DQ098132.1| Uncultured Pseudonocardia sp. clone colony 43 Tuf1 (tuf1) gene,
           partial cds
          Length = 692

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 242 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggc 301
           ||||| |||||| | ||||||||||| || || || | ||| |||||||||||||| |||
Sbjct: 460 gaggacgtcttcacgatcaccggtcgcggcacggtcgtcaccggccgtatcgagcgcggc 519

                      
Query: 302 accgtcaaggt 312
           | |||||||||
Sbjct: 520 atcgtcaaggt 530

to top

>gb|DQ098129.1| Uncultured Pseudonocardia sp. clone colony 48 Tuf1 (tuf1) gene,
           partial cds
          Length = 540

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 242 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggc 301
           ||||| |||||| | ||||||||||| || || || | ||| |||||||||||||| |||
Sbjct: 308 gaggacgtcttcacgatcaccggtcgcggcacggtcgtcaccggccgtatcgagcgcggc 367

                      
Query: 302 accgtcaaggt 312
           | |||||||||
Sbjct: 368 atcgtcaaggt 378

to top

>gb|DQ098126.1| Uncultured Pseudonocardia sp. clone colony 117 Tuf1 (tuf1) gene,
           partial cds
          Length = 692

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 242 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggc 301
           ||||| |||||| | ||||||||||| || || || | ||| |||||||||||||| |||
Sbjct: 460 gaggacgtcttcacgatcaccggtcgcggcacggtcgtcaccggccgtatcgagcgcggc 519

                      
Query: 302 accgtcaaggt 312
           | |||||||||
Sbjct: 520 atcgtcaaggt 530

to top

>gb|DQ098123.1| Uncultured Pseudonocardia sp. clone colony 20 Tuf1 (tuf1) gene,
           partial cds
          Length = 692

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 242 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggc 301
           ||||| |||||| | ||||||||||| || || || | ||| |||||||||||||| |||
Sbjct: 460 gaggacgtcttcacgatcaccggtcgcggcacggtcgtcaccggccgtatcgagcgcggc 519

                      
Query: 302 accgtcaaggt 312
           | |||||||||
Sbjct: 520 atcgtcaaggt 530

to top

>gb|DQ098122.1| Uncultured Pseudonocardia sp. clone colony 44 Tuf1 (tuf1) gene,
           partial cds
          Length = 679

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 242 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggc 301
           ||||| |||||| | ||||||||||| || || || | ||| |||||||||||||| |||
Sbjct: 447 gaggacgtcttcacgatcaccggtcgcggcacggtcgtcaccggccgtatcgagcgcggc 506

                      
Query: 302 accgtcaaggt 312
           | |||||||||
Sbjct: 507 atcgtcaaggt 517

to top

>gb|DQ098121.1| Uncultured Pseudonocardia sp. clone colony 170 Tuf1 (tuf1) gene,
           partial cds
          Length = 692

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 242 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggc 301
           ||||| |||||| | ||||||||||| || || || | ||| |||||||||||||| |||
Sbjct: 460 gaggacgtcttcacgatcaccggtcgcggcacggtcgtcaccggccgtatcgagcgcggc 519

                      
Query: 302 accgtcaaggt 312
           | |||||||||
Sbjct: 520 atcgtcaaggt 530

to top

>gb|DQ098120.1| Uncultured Pseudonocardia sp. clone colony 24 Tuf1 (tuf1) gene,
           partial cds
          Length = 636

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 242 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggc 301
           ||||| |||||| | ||||||||||| || || || | ||| |||||||||||||| |||
Sbjct: 404 gaggacgtcttcacgatcaccggtcgcggcacggtcgtcaccggccgtatcgagcgcggc 463

                      
Query: 302 accgtcaaggt 312
           | |||||||||
Sbjct: 464 atcgtcaaggt 474

to top

>gb|DQ098119.1| Uncultured Pseudonocardia sp. clone colony 10 Tuf1 (tuf1) gene,
           partial cds
          Length = 692

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 242 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggc 301
           ||||| |||||| | ||||||||||| || || || | ||| |||||||||||||| |||
Sbjct: 460 gaggacgtcttcacgatcaccggtcgcggcacggtcgtcaccggccgtatcgagcgcggc 519

                      
Query: 302 accgtcaaggt 312
           | |||||||||
Sbjct: 520 atcgtcaaggt 530

to top

>gb|DQ098118.1| Uncultured Pseudonocardia sp. clone colony 13 Tuf1 (tuf1) gene,
           partial cds
          Length = 675

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 242 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggc 301
           ||||| |||||| | ||||||||||| || || || | ||| |||||||||||||| |||
Sbjct: 443 gaggacgtcttcacgatcaccggtcgcggcacggtcgtcaccggccgtatcgagcgcggc 502

                      
Query: 302 accgtcaaggt 312
           | |||||||||
Sbjct: 503 atcgtcaaggt 513

to top

>ref|XM_387358.1| Gibberella zeae PH-1 chromosome 4 hypothetical protein (FG07182.1)
           partial mRNA
          Length = 1338

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 242 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtgg 300
           |||||||||||||||||  |||| |||||||| || | | |||||||| ||||||||||
Sbjct: 781 gaggatgtcttctccattgccggccgtggtactgtcgtctctggccgtgtcgagcgtgg 839

to top

>emb|X77039.1|SCTUF1FUS S.coelicolor tuf1 and fus genes
          Length = 1900

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                       
Query: 242  gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtgg 300
            ||||| |||||| ||||||||||||| ||||| || | ||| ||||| |||||||||||
Sbjct: 1107 gaggacgtcttcaccatcaccggtcgcggtacggtcgtcaccggccgcatcgagcgtgg 1165

to top

>emb|AL939121.1|SCO939121 Streptomyces coelicolor A3(2) complete genome; segment 18/29
          Length = 292100

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                        
Query: 242   gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtgg 300
             ||||| |||||| ||||||||||||| ||||| || | ||| ||||| |||||||||||
Sbjct: 14831 gaggacgtcttcaccatcaccggtcgcggtacggtcgtcaccggccgcatcgagcgtgg 14889

to top

>emb|AL596173.1| Listeria innocua Clip11262 complete genome, segment 11/12
          Length = 305050

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                             
Query: 239    gttgaggatgtcttctccatcaccggtcgtggtacagttgccactgg 285
              ||||||||||| ||||| ||||| |||||||| |||||||| |||||
Sbjct: 207503 gttgaggatgtattctcaatcactggtcgtggaacagttgcaactgg 207457

to top

>emb|AL591984.1| Listeria monocytogenes strain EGD, complete genome, segment 12/12
          Length = 225528

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                           
Query: 239  gttgaggatgtcttctccatcaccggtcgtggtacagttgccactgg 285
            ||||||||||| ||||| ||||| |||||||| |||||||| |||||
Sbjct: 7553 gttgaggatgtattctcaatcactggtcgtggaacagttgcaactgg 7507

to top

>gb|AF274746.1|AF274746 Listeria monocytogenes elongation factor Tu (tuf) gene, partial cds
          Length = 835

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactgg 285
           ||||||||||| ||||| ||||| |||||||| |||||||| |||||
Sbjct: 344 gttgaggatgtattctcaatcactggtcgtggaacagttgcaactgg 390

to top

>gb|AE017262.2| Listeria monocytogenes str. 4b F2365, complete genome
          Length = 2905187

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                              
Query: 239     gttgaggatgtcttctccatcaccggtcgtggtacagttgccactgg 285
               ||||||||||| ||||| ||||| |||||||| |||||||| |||||
Sbjct: 2678294 gttgaggatgtattctcaatcactggtcgtggaacagttgcaactgg 2678248

to top

>ref|XM_362579.1| Magnaporthe grisea 70-15 hypothetical protein (MG08162.4) partial
           mRNA
          Length = 1332

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagt 276
           ||||||||||||||| |||||  |||||||||||||||
Sbjct: 772 gttgaggatgtcttcaccatcggcggtcgtggtacagt 809

to top

>gb|AY305396.1| Synthetic construct reconstructed ancestral elongation factor Tu
           ML-stem gene, complete cds
          Length = 1185

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 474 tggcaaagccgggttccatcacgccacacaccaagttt 511
           |||| |||||||||  ||||||||||||||||||||||
Sbjct: 878 tggctaagccgggtagcatcacgccacacaccaagttt 915

to top

>gb|AE016795.2| Vibrio vulnificus CMCP6 chromosome I complete sequence
          Length = 3281944

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                     
Query: 263     ggtcgtggtacagttgccactggccgtatcgagcgtgg 300
               |||||||||||||| |  ||||||||||||||||||||
Sbjct: 1324599 ggtcgtggtacagtagtaactggccgtatcgagcgtgg 1324636



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                     
Query: 263     ggtcgtggtacagttgccactggccgtatcgagcgtgg 300
               |||||||||||||| |  ||||||||||||||||||||
Sbjct: 1183146 ggtcgtggtacagtagtaactggccgtatcgagcgtgg 1183183

to top

>emb|AJ786715.1| Lactobacillus farciminis partial tuf gene for elongation factor Tu,
           strain ATCC 29644
          Length = 525

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                       
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgt 298
           ||||| ||||||||| | ||||| ||||||||||| |||||  |||| |||||||| |||
Sbjct: 205 gttgaagatgtcttcactatcacaggtcgtggtactgttgcatctggtcgtatcgatcgt 264

             
Query: 299 gg 300
           ||
Sbjct: 265 gg 266

to top

>dbj|BA000037.2| Vibrio vulnificus YJ016 DNA, chromosome I, complete sequence
          Length = 3354505

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                     
Query: 263     ggtcgtggtacagttgccactggccgtatcgagcgtgg 300
               |||||||||||||| |  ||||||||||||||||||||
Sbjct: 3250399 ggtcgtggtacagtagtaactggccgtatcgagcgtgg 3250362



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                     
Query: 263     ggtcgtggtacagttgccactggccgtatcgagcgtgg 300
               |||||||||||||| |  ||||||||||||||||||||
Sbjct: 3108297 ggtcgtggtacagtagtaactggccgtatcgagcgtgg 3108260

to top

>dbj|BA000031.2| Vibrio parahaemolyticus RIMD 2210633 DNA, chromosome 1, complete sequence
          Length = 3288558

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                     
Query: 263     ggtcgtggtacagttgccactggccgtatcgagcgtgg 300
               |||||||||||||| |  ||||||||||||||||||||
Sbjct: 3121410 ggtcgtggtacagtagtaactggccgtatcgagcgtgg 3121373



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                     
Query: 263     ggtcgtggtacagttgccactggccgtatcgagcgtgg 300
               |||||||||||||| |  ||||||||||||||||||||
Sbjct: 2939032 ggtcgtggtacagtagtaactggccgtatcgagcgtgg 2938995

to top

>gb|CP000020.1| Vibrio fischeri ES114 chromosome I, complete sequence
          Length = 2906179

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                     
Query: 263     ggtcgtggtacagttgccactggccgtatcgagcgtgg 300
               ||||||||||||||||  ||||| ||||||||||||||
Sbjct: 2715925 ggtcgtggtacagttgtaactggtcgtatcgagcgtgg 2715888



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                    
Query: 263    ggtcgtggtacagttgccactggccgtatcgagcgtgg 300
              ||||||||||||||||  ||||| ||||||||||||||
Sbjct: 252729 ggtcgtggtacagttgtaactggtcgtatcgagcgtgg 252766

to top

>gb|AE017355.1| Bacillus thuringiensis serovar konkukian str. 97-27, complete genome
          Length = 5237682

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                               
Query: 237    ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactgg 285
              |||| ||||| || ||||| ||||| ||||||||||||||||| |||||
Sbjct: 125748 ctgtagaggacgtattctctatcacaggtcgtggtacagttgctactgg 125796

to top

>gb|AE017334.2| Bacillus anthracis str. 'Ames Ancestor', complete genome
          Length = 5227419

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                               
Query: 237    ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactgg 285
              |||| ||||| || ||||| ||||| ||||||||||||||||| |||||
Sbjct: 120016 ctgtagaggacgtattctctatcacaggtcgtggtacagttgctactgg 120064

to top

>gb|AE017225.1| Bacillus anthracis str. Sterne, complete genome
          Length = 5228663

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                               
Query: 237    ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactgg 285
              |||| ||||| || ||||| ||||| ||||||||||||||||| |||||
Sbjct: 120017 ctgtagaggacgtattctctatcacaggtcgtggtacagttgctactgg 120065

to top

>gb|CP000001.1| Bacillus cereus E33L, complete genome
          Length = 5300915

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                               
Query: 237    ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactgg 285
              |||| ||||| || ||||| ||||| ||||||||||||||||| |||||
Sbjct: 120011 ctgtagaggacgtattctctatcacaggtcgtggtacagttgctactgg 120059

to top

>emb|AJ544131.1|PCA544131 Pleurochrysis carterae chloroplast partial tufA gene for elongation
           factor Tu, isolate HAP1
          Length = 747

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 236 gctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgag 295
           ||||| |||||||| ||||| || || ||||||||||||||||| || || || || |||
Sbjct: 406 gctgtagaggatgtattctctattacaggtcgtggtacagttgcaacgggtcgaatagag 465

                
Query: 296 cgtgg 300
           |||||
Sbjct: 466 cgtgg 470

to top

>emb|AJ418919.2|LDE418919 Lactobacillus delbrueckii subsp. lactis partial mRNA for putative
           elongation factor Tu (tuf gene), strain ATCC 12315
          Length = 761

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 64/77 (83%)
 Strand = Plus / Plus

                                                                       
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgt 298
           ||||| || |||||| | ||||| ||||||||||| |||||  | ||||||||||| |||
Sbjct: 349 gttgaagacgtcttcactatcactggtcgtggtactgttgcttcaggccgtatcgaccgt 408

                            
Query: 299 ggcaccgtcaaggttgg 315
           || || || ||||||||
Sbjct: 409 ggtactgttaaggttgg 425

to top

>emb|AJ418911.2|LDE418911 Lactobacillus delbrueckii subsp. delbrueckii partial mRNA for
           putative elongation factor Tu (tuf gene), strain ATCC
           9649
          Length = 761

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 64/77 (83%)
 Strand = Plus / Plus

                                                                       
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgt 298
           ||||| || |||||| | ||||| ||||||||||| |||||  | ||||||||||| |||
Sbjct: 349 gttgaagacgtcttcactatcactggtcgtggtactgttgcttcaggccgtatcgaccgt 408

                            
Query: 299 ggcaccgtcaaggttgg 315
           || || || ||||||||
Sbjct: 409 ggtactgttaaggttgg 425

to top

>emb|AJ418910.2|LDE418910 Lactobacillus delbrueckii subsp. bulgaricus partial mRNA for
           putative elongation factor Tu (tuf gene), strain ATCC
           11842
          Length = 761

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 64/77 (83%)
 Strand = Plus / Plus

                                                                       
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgt 298
           ||||| || |||||| | ||||| ||||||||||| |||||  | ||||||||||| |||
Sbjct: 349 gttgaagacgtcttcactatcactggtcgtggtactgttgcttcaggccgtatcgaccgt 408

                            
Query: 299 ggcaccgtcaaggttgg 315
           || || || ||||||||
Sbjct: 409 ggtactgttaaggttgg 425

to top

>gb|AF274736.1|AF274736 Enterococcus saccharolyticus elongation factor Tu (tuf) gene,
           partial cds
          Length = 835

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgc 279
           ||||||||||| ||||| ||||| ||||||||||| |||||
Sbjct: 344 gttgaggatgtattctcaatcactggtcgtggtactgttgc 384

to top

>gb|AE016877.1| Bacillus cereus ATCC 14579, complete genome
          Length = 5411809

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                               
Query: 237    ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactgg 285
              |||| ||||| || ||||| ||||| ||||||||||||||||| |||||
Sbjct: 125534 ctgtagaggacgtattctctatcacaggtcgtggtacagttgctactgg 125582

to top

>gb|AE016879.1| Bacillus anthracis str. Ames, complete genome
          Length = 5227293

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                               
Query: 237    ctgttgaggatgtcttctccatcaccggtcgtggtacagttgccactgg 285
              |||| ||||| || ||||| ||||| ||||||||||||||||| |||||
Sbjct: 120016 ctgtagaggacgtattctctatcacaggtcgtggtacagttgctactgg 120064

to top

>emb|AM049970.1| Udotea orientalis plastid partial tufA gene for elongation factor
           Tu, specimen voucher HV817
          Length = 859

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 51/61 (83%)
 Strand = Plus / Plus

                                                                       
Query: 240 ttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtg 299
           |||| ||||||||||| || || ||||||||||| || || || ||||| || |||||||
Sbjct: 407 ttgaagatgtcttctcaattacaggtcgtggtactgtwgcgacaggccgwattgagcgtg 466

            
Query: 300 g 300
           |
Sbjct: 467 g 467

to top

>ref|NM_118155.2| Arabidopsis thaliana ATP binding / GTP binding / translation
           elongation factor AT4G20360 mRNA, complete cds
          Length = 1758

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 222 tgcccttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggtac 273
           |||| |||||| | |||||||||||||| ||||| ||||| || ||||||||
Sbjct: 941 tgccattcttgttagctgttgaggatgtgttctctatcactggacgtggtac 992



 Score = 44.1 bits (22), Expect = 0.48
 Identities = 73/90 (81%)
 Strand = Plus / Plus

                                                                        
Query: 459  agagaggcatggtgttggcaaagccgggttccatcacgccacacaccaagtttgaggcag 518
            ||||||| ||||| || || |||||||| || || || ||||| ||||||||||| ||| 
Sbjct: 1178 agagaggtatggttttagctaagccgggatcgattactccacataccaagtttgaagcaa 1237

                                          
Query: 519  ttgtgtatgtgctcaagaaggaggagggtg 548
            || | |||||| | ||||| ||||| ||||
Sbjct: 1238 ttatctatgtgttgaagaaagaggaaggtg 1267

to top

>ref|XM_631056.1| Dictyostelium discoideum hypothetical protein (DDB0219464), partial
           mRNA
          Length = 1290

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 251 ttctccatcaccggtcgtggtacagttgccactggccgtatcga 294
           ||||||||| | ||||||||||| || |||||||| ||||||||
Sbjct: 760 ttctccatctctggtcgtggtactgtcgccactggtcgtatcga 803

to top

>gb|AE017354.1| Legionella pneumophila subsp. pneumophila str. Philadelphia 1, complete
              genome
          Length = 3397754

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                      
Query: 489    ccatcacgccacacaccaagtttgaggcagttgtgtatgt 528
              |||||| |||||||||||||||||| ||||  ||||||||
Sbjct: 382615 ccatcaagccacacaccaagtttgaagcagaagtgtatgt 382654



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                      
Query: 489    ccatcacgccacacaccaagtttgaggcagttgtgtatgt 528
              |||||| |||||||||||||||||| ||||  ||||||||
Sbjct: 366333 ccatcaagccacacaccaagtttgaagcagaagtgtatgt 366372

to top

>gb|AY582542.1| Streptococcus dysgalactiae strain CCRI-14550 elongation factor Tu
           (tuf) gene, partial cds
          Length = 761

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 245 gatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtgg 300
           ||||| ||||| ||||| |||||||||||||||||  | || |||||||| |||||
Sbjct: 319 gatgtattctcaatcacaggtcgtggtacagttgcttcaggacgtatcgaccgtgg 374

to top

>gb|AY582541.1| Streptococcus dysgalactiae strain CCRI-14549 elongation factor Tu
           (tuf) gene, partial cds
          Length = 761

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 245 gatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtgg 300
           ||||| ||||| ||||| |||||||||||||||||  | || |||||||| |||||
Sbjct: 319 gatgtattctcaatcacaggtcgtggtacagttgcttcaggacgtatcgaccgtgg 374

to top

>gb|CP000003.1| Streptococcus pyogenes MGAS10394, complete genome
          Length = 1899877

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                      
Query: 245    gatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtgg 300
              ||||| ||||| ||||| |||||||||||||||||  | || |||||||| |||||
Sbjct: 520690 gatgtattctcaatcacaggtcgtggtacagttgcttcaggacgtatcgaccgtgg 520745

to top

>gb|CP000262.1| Streptococcus pyogenes MGAS10750, complete genome
          Length = 1937111

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                      
Query: 245    gatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtgg 300
              ||||| ||||| ||||| |||||||||||||||||  | || |||||||| |||||
Sbjct: 509232 gatgtattctcaatcacaggtcgtggtacagttgcttcaggacgtatcgaccgtgg 509287

to top

>gb|AY372042.1| Bifidobacterium longum strain ATCC 15707 Tuf gene, partial cds
          Length = 990

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 242 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggc 301
           ||||| |||||| ||||| |||| |||||||| |||| ||| || ||| |||||||||||
Sbjct: 491 gaggacgtcttcaccatctccggccgtggtaccgttgtcaccggtcgtgtcgagcgtggc 550

to top

>gb|BT000998.1| Arabidopsis thaliana clone U19264 putative translation elongation
           factor EF-Tu precursor, chloroplast (At4g20360) mRNA,
           complete cds
          Length = 1462

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 222 tgcccttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggtac 273
           |||| |||||| | |||||||||||||| ||||| ||||| || ||||||||
Sbjct: 857 tgccattcttgttagctgttgaggatgtgttctctatcactggacgtggtac 908



 Score = 44.1 bits (22), Expect = 0.48
 Identities = 73/90 (81%)
 Strand = Plus / Plus

                                                                        
Query: 459  agagaggcatggtgttggcaaagccgggttccatcacgccacacaccaagtttgaggcag 518
            ||||||| ||||| || || |||||||| || || || ||||| ||||||||||| ||| 
Sbjct: 1094 agagaggtatggttttagctaagccgggatcgattactccacataccaagtttgaagcaa 1153

                                          
Query: 519  ttgtgtatgtgctcaagaaggaggagggtg 548
            || | |||||| | ||||| ||||| ||||
Sbjct: 1154 ttatctatgtgttgaagaaagaggaaggtg 1183

to top

>gb|BT000699.1| Arabidopsis thaliana putative chloroplast translation elongation
           factor EF-Tu precursor (At4g20360) mRNA, complete cds
          Length = 1670

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 222 tgcccttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggtac 273
           |||| |||||| | |||||||||||||| ||||| ||||| || ||||||||
Sbjct: 922 tgccattcttgttagctgttgaggatgtgttctctatcactggacgtggtac 973



 Score = 44.1 bits (22), Expect = 0.48
 Identities = 73/90 (81%)
 Strand = Plus / Plus

                                                                        
Query: 459  agagaggcatggtgttggcaaagccgggttccatcacgccacacaccaagtttgaggcag 518
            ||||||| ||||| || || |||||||| || || || ||||| ||||||||||| ||| 
Sbjct: 1159 agagaggtatggttttagctaagccgggatcgattactccacataccaagtttgaagcaa 1218

                                          
Query: 519  ttgtgtatgtgctcaagaaggaggagggtg 548
            || | |||||| | ||||| ||||| ||||
Sbjct: 1219 ttatctatgtgttgaagaaagaggaaggtg 1248

to top

>gb|AE004124.1| Vibrio cholerae O1 biovar eltor str. N16961 chromosome I, section 32
            of 251 of the complete chromosome
          Length = 11069

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                    
Query: 263  ggtcgtggtacagttgccactggccgtatcgagcgtggca 302
            |||||||||||||| |  ||||||||||||||||| ||||
Sbjct: 6935 ggtcgtggtacagtagtaactggccgtatcgagcgcggca 6974

to top

>gb|AE004120.1| Vibrio cholerae O1 biovar eltor str. N16961 chromosome I, section 28
            of 251 of the complete chromosome
          Length = 9995

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                    
Query: 263  ggtcgtggtacagttgccactggccgtatcgagcgtggca 302
            |||||||||||||| |  ||||||||||||||||| ||||
Sbjct: 6880 ggtcgtggtacagtagtaactggccgtatcgagcgcggca 6919

to top

>gb|CP000056.1| Streptococcus pyogenes MGAS6180, complete genome
          Length = 1897573

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                      
Query: 245    gatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtgg 300
              ||||| ||||| ||||| |||||||||||||||||  | || |||||||| |||||
Sbjct: 492367 gatgtattctcaatcacaggtcgtggtacagttgcttcaggacgtatcgaccgtgg 492422

to top

>gb|BT000687.1| Arabidopsis thaliana clone RAFL09-18-H05 (R09411) putative
           chloroplast translation elongation factor EF-Tu
           precursor (At4g20360) mRNA, complete cds
          Length = 1671

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 222 tgcccttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggtac 273
           |||| |||||| | |||||||||||||| ||||| ||||| || ||||||||
Sbjct: 920 tgccattcttgttagctgttgaggatgtgttctctatcactggacgtggtac 971



 Score = 44.1 bits (22), Expect = 0.48
 Identities = 73/90 (81%)
 Strand = Plus / Plus

                                                                        
Query: 459  agagaggcatggtgttggcaaagccgggttccatcacgccacacaccaagtttgaggcag 518
            ||||||| ||||| || || |||||||| || || || ||||| ||||||||||| ||| 
Sbjct: 1157 agagaggtatggttttagctaagccgggatcgattactccacataccaagtttgaagcaa 1216

                                          
Query: 519  ttgtgtatgtgctcaagaaggaggagggtg 548
            || | |||||| | ||||| ||||| ||||
Sbjct: 1217 ttatctatgtgttgaagaaagaggaaggtg 1246

to top

>gb|CP000088.1| Thermobifida fusca YX, complete genome
          Length = 3642249

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                       
Query: 242     gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcg 297
               ||||| || ||||| ||||||||||| ||||| || | ||| ||||||||||||||
Sbjct: 3109674 gaggacgtgttctcgatcaccggtcgcggtaccgtcgtcaccggccgtatcgagcg 3109619

to top

>gb|AY074355.1| Arabidopsis thaliana putative translation elongation factor EF-Tu
           precursor, chloroplast (At4g20360) mRNA, complete cds
          Length = 1688

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 222 tgcccttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggtac 273
           |||| |||||| | |||||||||||||| ||||| ||||| || ||||||||
Sbjct: 941 tgccattcttgttagctgttgaggatgtgttctctatcactggacgtggtac 992



 Score = 44.1 bits (22), Expect = 0.48
 Identities = 73/90 (81%)
 Strand = Plus / Plus

                                                                        
Query: 459  agagaggcatggtgttggcaaagccgggttccatcacgccacacaccaagtttgaggcag 518
            ||||||| ||||| || || |||||||| || || || ||||| ||||||||||| ||| 
Sbjct: 1178 agagaggtatggttttagctaagccgggatcgattactccacataccaagtttgaagcaa 1237

                                          
Query: 519  ttgtgtatgtgctcaagaaggaggagggtg 548
            || | |||||| | ||||| ||||| ||||
Sbjct: 1238 ttatctatgtgttgaagaaagaggaaggtg 1267

to top

>emb|X52256.1|ATTUFA A.thaliana tufA gene for elongation factor Tu
          Length = 2272

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                                
Query: 222  tgcccttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggtac 273
            |||| |||||| | |||||||||||||| ||||| ||||| || ||||||||
Sbjct: 1271 tgccattcttgttagctgttgaggatgtgttctctatcactggacgtggtac 1322



 Score = 44.1 bits (22), Expect = 0.48
 Identities = 73/90 (81%)
 Strand = Plus / Plus

                                                                        
Query: 459  agagaggcatggtgttggcaaagccgggttccatcacgccacacaccaagtttgaggcag 518
            ||||||| ||||| || || |||||||| || || || ||||| ||||||||||| ||| 
Sbjct: 1508 agagaggtatggttttagctaagccgggatcgattactccacataccaagtttgaagcaa 1567

                                          
Query: 519  ttgtgtatgtgctcaagaaggaggagggtg 548
            || | |||||| | ||||| ||||| ||||
Sbjct: 1568 ttatctatgtgttgaagaaagaggaaggtg 1597

to top

>gb|AY845412.1| Neochlamydia hartmannellae translation elongation factor TU gene,
           partial cds
          Length = 810

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 364 cactggtgttgagatgttccagaagaccatggatga 399
           ||||||||||||||||||| | ||| ||||||||||
Sbjct: 513 cactggtgttgagatgttcaataagtccatggatga 548

to top

>emb|CR628337.1| Legionella pneumophila str. Lens complete genome
          Length = 3345687

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                      
Query: 489    ccatcacgccacacaccaagtttgaggcagttgtgtatgt 528
              |||||| |||||||||||||||||| ||||  ||||||||
Sbjct: 431571 ccatcaagccacacaccaagtttgaagcagaagtgtatgt 431610



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                      
Query: 489    ccatcacgccacacaccaagtttgaggcagttgtgtatgt 528
              |||||| |||||||||||||||||| ||||  ||||||||
Sbjct: 415289 ccatcaagccacacaccaagtttgaagcagaagtgtatgt 415328

to top

>emb|AL161552.2|ATCHRIV52 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 52
          Length = 198427

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                                  
Query: 222    tgcccttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggtac 273
              |||| |||||| | |||||||||||||| ||||| ||||| || ||||||||
Sbjct: 188464 tgccattcttgttagctgttgaggatgtgttctctatcactggacgtggtac 188515



 Score = 44.1 bits (22), Expect = 0.48
 Identities = 73/90 (81%)
 Strand = Plus / Plus

                                                                          
Query: 459    agagaggcatggtgttggcaaagccgggttccatcacgccacacaccaagtttgaggcag 518
              ||||||| ||||| || || |||||||| || || || ||||| ||||||||||| ||| 
Sbjct: 188701 agagaggtatggttttagctaagccgggatcgattactccacataccaagtttgaagcaa 188760

                                            
Query: 519    ttgtgtatgtgctcaagaaggaggagggtg 548
              || | |||||| | ||||| ||||| ||||
Sbjct: 188761 ttatctatgtgttgaagaaagaggaaggtg 188790

to top

>emb|AL080253.2|ATF9F13 Arabidopsis thaliana DNA chromosome 4, BAC clone F9F13 (ESSA project)
          Length = 109936

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                                
Query: 222  tgcccttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggtac 273
            |||| |||||| | |||||||||||||| ||||| ||||| || ||||||||
Sbjct: 9490 tgccattcttgttagctgttgaggatgtgttctctatcactggacgtggtac 9541



 Score = 44.1 bits (22), Expect = 0.48
 Identities = 73/90 (81%)
 Strand = Plus / Plus

                                                                        
Query: 459  agagaggcatggtgttggcaaagccgggttccatcacgccacacaccaagtttgaggcag 518
            ||||||| ||||| || || |||||||| || || || ||||| ||||||||||| ||| 
Sbjct: 9727 agagaggtatggttttagctaagccgggatcgattactccacataccaagtttgaagcaa 9786

                                          
Query: 519  ttgtgtatgtgctcaagaaggaggagggtg 548
            || | |||||| | ||||| ||||| ||||
Sbjct: 9787 ttatctatgtgttgaagaaagaggaaggtg 9816

to top

>emb|AJ555814.1|PGI555814 Porphyromonas gingivalis partial ef-tu gene, strain GDR11
          Length = 380

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcga 294
           ||||| ||||| ||||| ||||| ||||||||||| ||||| || || ||||||||
Sbjct: 3   gttgaagatgtgttctctatcacgggtcgtggtacggttgctacaggacgtatcga 58

to top

>emb|AJ544132.1|PDE544132 Pleurochrysis dentata chloroplast partial tufA gene for elongation
           factor Tu, isolate HAP6
          Length = 747

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 236 gctgttgaggatgtcttctccatcaccggtcgtggtacagttgc 279
           ||||| |||||||| ||||| || || |||||||||||||||||
Sbjct: 406 gctgtagaggatgtattctctattacaggtcgtggtacagttgc 449

to top

>gb|AE010001.1| Streptococcus pyogenes strain MGAS8232, section 49 of 173 of the
            complete genome
          Length = 10344

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                    
Query: 245  gatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtgg 300
            ||||| ||||| ||||| |||||||||||||||||  | || |||||||| |||||
Sbjct: 5345 gatgtattctcaatcacaggtcgtggtacagttgcttcaggacgtatcgaccgtgg 5400

to top

>gb|AF419609.1|AF419609 Arabidopsis thaliana AT4g20360/F9F13_10 mRNA, complete cds
          Length = 1663

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 222 tgcccttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggtac 273
           |||| |||||| | |||||||||||||| ||||| ||||| || ||||||||
Sbjct: 923 tgccattcttgttagctgttgaggatgtgttctctatcactggacgtggtac 974



 Score = 44.1 bits (22), Expect = 0.48
 Identities = 73/90 (81%)
 Strand = Plus / Plus

                                                                        
Query: 459  agagaggcatggtgttggcaaagccgggttccatcacgccacacaccaagtttgaggcag 518
            ||||||| ||||| || || |||||||| || || || ||||| ||||||||||| ||| 
Sbjct: 1160 agagaggtatggttttagctaagccgggatcgattactccacataccaagtttgaagcaa 1219

                                          
Query: 519  ttgtgtatgtgctcaagaaggaggagggtg 548
            || | |||||| | ||||| ||||| ||||
Sbjct: 1220 ttatctatgtgttgaagaaagaggaaggtg 1249

to top

>gb|AF410329.1|AF410329 Arabidopsis thaliana AT4g20360/F9F13_10 mRNA, complete cds
          Length = 1669

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 222 tgcccttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggtac 273
           |||| |||||| | |||||||||||||| ||||| ||||| || ||||||||
Sbjct: 921 tgccattcttgttagctgttgaggatgtgttctctatcactggacgtggtac 972



 Score = 44.1 bits (22), Expect = 0.48
 Identities = 73/90 (81%)
 Strand = Plus / Plus

                                                                        
Query: 459  agagaggcatggtgttggcaaagccgggttccatcacgccacacaccaagtttgaggcag 518
            ||||||| ||||| || || |||||||| || || || ||||| ||||||||||| ||| 
Sbjct: 1158 agagaggtatggttttagctaagccgggatcgattactccacataccaagtttgaagcaa 1217

                                          
Query: 519  ttgtgtatgtgctcaagaaggaggagggtg 548
            || | |||||| | ||||| ||||| ||||
Sbjct: 1218 ttatctatgtgttgaagaaagaggaaggtg 1247

to top

>emb|BX827505.1|CNS0A2SS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS66ZD02 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1617

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 222 tgcccttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggtac 273
           |||| |||||| | |||||||||||||| ||||| ||||| || ||||||||
Sbjct: 902 tgccattcttgttagctgttgaggatgtgttctctatcactggacgtggtac 953



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 146/187 (78%)
 Strand = Plus / Plus

                                                                        
Query: 362  gtcactggtgttgagatgttccagaagaccatggatgatgccattgctggggacaatgtt 421
            |||||||| ||||| ||||| |||||||   | ||||| ||  | ||||| |||||||| 
Sbjct: 1042 gtcactggggttgaaatgtttcagaagattcttgatgaggctttagctggtgacaatgta 1101

                                                                        
Query: 422  ggcctgctgctccgtggtatgcagaaggaagacattgagagaggcatggtgttggcaaag 481
            ||  || |||| || ||||| || ||||  || ||| ||||||| ||||| || || |||
Sbjct: 1102 gggttgttgcttcggggtattcaaaaggctgatattcagagaggtatggttttagctaag 1161

                                                                        
Query: 482  ccgggttccatcacgccacacaccaagtttgaggcagttgtgtatgtgctcaagaaggag 541
            ||||| || || || ||||| ||||||||||| ||| || | |||||| | ||||| |||
Sbjct: 1162 ccgggatcgattactccacataccaagtttgaagcaattatctatgtgttgaagaaagag 1221

                   
Query: 542  gagggtg 548
            || ||||
Sbjct: 1222 gaaggtg 1228

to top

>gb|AF274733.1|AF274733 Enterococcus pseudoavium strain ATCC49372 elongation factor Tu
           (tufB) gene, partial cds
          Length = 669

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 245 gatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtgg 300
           ||||||||||| ||||| || |||||||| |||||  |||| |||||||| |||||
Sbjct: 349 gatgtcttctcaatcacaggacgtggtacggttgcatctggtcgtatcgatcgtgg 404

to top

>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                           
Query: 469     ggtgttggcaaagccgggttccatcacgccacacaccaagtttgaggcagttgtgtatgt 528
               |||| |||| |||||||| || |||||||| ||||| |||||  |||| |  ||||| ||
Sbjct: 2186540 ggtgctggcgaagccggggtcgatcacgccgcacacgaagttcaaggccgaggtgtacgt 2186481

                                   
Query: 529     gctcaagaaggaggagggtg 548
               ||| | ||||||||||||||
Sbjct: 2186480 gctgacgaaggaggagggtg 2186461



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 66/80 (82%)
 Strand = Plus / Plus

                                                                           
Query: 469     ggtgttggcaaagccgggttccatcacgccacacaccaagtttgaggcagttgtgtatgt 528
               |||| |||| |||||||| || |||||||| ||||| |||||  |||| |  ||||| ||
Sbjct: 1815325 ggtgctggcgaagccggggtcgatcacgccgcacacgaagttcaaggccgaggtgtacgt 1815384

                                   
Query: 529     gctcaagaaggaggagggtg 548
               ||| | ||||||||||||||
Sbjct: 1815385 gctgacgaaggaggagggtg 1815404

to top

>gb|BT002642.1| Arabidopsis thaliana At4g20360/F9F13_10 gene, complete cds
          Length = 1431

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 222 tgcccttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggtac 273
           |||| |||||| | |||||||||||||| ||||| ||||| || ||||||||
Sbjct: 857 tgccattcttgttagctgttgaggatgtgttctctatcactggacgtggtac 908



 Score = 44.1 bits (22), Expect = 0.48
 Identities = 73/90 (81%)
 Strand = Plus / Plus

                                                                        
Query: 459  agagaggcatggtgttggcaaagccgggttccatcacgccacacaccaagtttgaggcag 518
            ||||||| ||||| || || |||||||| || || || ||||| ||||||||||| ||| 
Sbjct: 1094 agagaggtatggttttagctaagccgggatcgattactccacataccaagtttgaagcaa 1153

                                          
Query: 519  ttgtgtatgtgctcaagaaggaggagggtg 548
            || | |||||| | ||||| ||||| ||||
Sbjct: 1154 ttatctatgtgttgaagaaagaggaaggtg 1183

to top

>dbj|BA000022.2| Synechocystis sp. PCC 6803 DNA, complete genome
          Length = 3573470

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                               
Query: 251     ttctccatcaccggtcgtggtacagttgccac 282
               ||||||||||| ||||||||||| ||||||||
Sbjct: 1915819 ttctccatcactggtcgtggtaccgttgccac 1915788

to top

>gb|AF153617.1|AF153617 Streptomyces mobaraensis elongation factor G (fus) gene, partial cds;
            and elongation factor Tu1 (tuf1) gene, complete cds
          Length = 1770

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                    
Query: 242  gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcg 297
            ||||| |||||| | |||||||||||||| || || | ||| ||||||||||||||
Sbjct: 1198 gaggacgtcttcacgatcaccggtcgtggcaccgtcgtcaccggccgtatcgagcg 1253

to top

>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome
          Length = 4829781

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                       
Query: 242     gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcg 297
               ||||| |||||| |||||||||||||||| || || | ||| |||||| |||||||
Sbjct: 4621594 gaggacgtcttcaccatcaccggtcgtggcacggtggtcaccggccgtgtcgagcg 4621649

to top

>gb|AE014295.3| Bifidobacterium longum NCC2705, complete genome
          Length = 2256640

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 51/60 (85%)
 Strand = Plus / Minus

                                                                          
Query: 242    gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggc 301
              ||||| |||||| ||||| |||| |||||||| |||| ||| || ||| |||||||||||
Sbjct: 931057 gaggacgtcttcaccatctccggccgtggtaccgttgtcaccggtcgtgtcgagcgtggc 930998

to top

>gb|DQ414204.1| Staphylococcus aureus strain H116 TufA (tufA) gene, partial cds
          Length = 462

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 280 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 330

to top

>gb|DQ414203.1| Staphylococcus aureus strain D547 TufA (tufA) gene, partial cds
          Length = 462

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 280 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 330

to top

>gb|DQ414202.1| Staphylococcus aureus strain H591 TufA (tufA) gene, partial cds
          Length = 462

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 280 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 330

to top

>gb|DQ414201.1| Staphylococcus aureus strain C2 TufA (tufA) gene, partial cds
          Length = 462

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 280 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 330

to top

>gb|DQ414200.1| Staphylococcus aureus strain H466 TufA (tufA) gene, partial cds
          Length = 462

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 280 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 330

to top

>gb|DQ414199.1| Staphylococcus aureus strain EMRSA3 TufA (tufA) gene, partial cds
          Length = 462

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 280 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 330

to top

>gb|DQ414198.1| Staphylococcus aureus strain D535 TufA (tufA) gene, partial cds
          Length = 462

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 280 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 330

to top

>gb|DQ414197.1| Staphylococcus aureus strain D97 TufA (tufA) gene, partial cds
          Length = 462

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 280 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 330

to top

>gb|DQ414196.1| Staphylococcus aureus strain H560 TufA (tufA) gene, partial cds
          Length = 462

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 280 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 330

to top

>gb|DQ414195.1| Staphylococcus aureus strain H417 TufA (tufA) gene, partial cds
          Length = 462

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 280 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 330

to top

>gb|DQ414194.1| Staphylococcus aureus strain H707 TufA (tufA) gene, partial cds
          Length = 462

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 280 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 330

to top

>gb|DQ414193.1| Staphylococcus aureus strain H295 TufA (tufA) gene, partial cds
          Length = 462

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 280 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 330

to top

>gb|DQ414192.1| Staphylococcus aureus strain H831 TufA (tufA) gene, partial cds
          Length = 462

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 280 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 330

to top

>gb|DQ414191.1| Staphylococcus aureus strain C101 TufA (tufA) gene, partial cds
          Length = 462

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 280 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 330

to top

>gb|DQ414190.1| Staphylococcus aureus strain C437 TufA (tufA) gene, partial cds
          Length = 462

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 280 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 330

to top

>gb|DQ414189.1| Staphylococcus aureus strain EMRSA9 TufA (tufA) gene, partial cds
          Length = 462

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 280 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 330

to top

>gb|DQ414188.1| Staphylococcus aureus strain EMRSA4 TufA (tufA) gene, partial cds
          Length = 462

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 280 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 330

to top

>gb|DQ414187.1| Staphylococcus aureus strain C720 TufA (tufA) gene, partial cds
          Length = 462

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 280 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 330

to top

>gb|DQ414186.1| Staphylococcus aureus strain C640 TufA (tufA) gene, partial cds
          Length = 462

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 280 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 330

to top

>gb|DQ414185.1| Staphylococcus aureus strain D17 TufA (tufA) gene, partial cds
          Length = 462

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 280 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 330

to top

>gb|DQ414184.1| Staphylococcus aureus strain D470 TufA (tufA) gene, partial cds
          Length = 462

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 280 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 330

to top

>gb|DQ414183.1| Staphylococcus aureus strain H512 TufA (tufA) gene, partial cds
          Length = 462

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 280 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 330

to top

>gb|DQ414182.1| Staphylococcus aureus strain D22 TufA (tufA) gene, partial cds
          Length = 462

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 280 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 330

to top

>gb|DQ414181.1| Staphylococcus aureus strain D274 TufA (tufA) gene, partial cds
          Length = 462

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 280 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 330

to top

>gb|DQ414180.1| Staphylococcus aureus strain H783 TufA (tufA) gene, partial cds
          Length = 462

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 280 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 330

to top

>gb|DQ414179.1| Staphylococcus aureus strain H402 TufA (tufA) gene, partial cds
          Length = 462

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 280 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 330

to top

>gb|DQ414178.1| Staphylococcus aureus strain D365 TufA (tufA) gene, partial cds
          Length = 462

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 280 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 330

to top

>gb|DQ414177.1| Staphylococcus aureus strain H19 TufA (tufA) gene, partial cds
          Length = 462

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 280 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 330

to top

>gb|DQ414176.1| Staphylococcus aureus strain D456 TufA (tufA) gene, partial cds
          Length = 462

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 280 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 330

to top

>emb|X66322.1|TAEFTUG T.aquaticus tufA and fus genes for elongation factor Tu and
            elongation factor G (partial)
          Length = 1347

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 490  catcacgccacacaccaagtttgaggc 516
            ||||||||| |||||||||||||||||
Sbjct: 1044 catcacgccgcacaccaagtttgaggc 1070

to top

>emb|X89058.1|GMRNAEFTU G.max DNA for EF-Tu chloroplast specific protein
          Length = 3079

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                           
Query: 240  ttgaggatgtcttctccatcaccggtcgtgg 270
            |||||||||| ||| ||||||||||||||||
Sbjct: 2102 ttgaggatgttttcaccatcaccggtcgtgg 2132



 Score = 44.1 bits (22), Expect = 0.48
 Identities = 112/142 (78%)
 Strand = Plus / Plus

                                                                        
Query: 407  gctggggacaatgttggcctgctgctccgtggtatgcagaaggaagacattgagagaggc 466
            |||||||||||||| ||| || ||||  | ||||| |||||    || ||| ||||||| 
Sbjct: 2269 gctggggacaatgtgggcttgttgcttaggggtattcagaaaactgatattcagagaggg 2328

                                                                        
Query: 467  atggtgttggcaaagccgggttccatcacgccacacaccaagtttgaggcagttgtgtat 526
            ||||| ||||| ||||| ||  |||| || || ||||||||||||   ||| ||||||||
Sbjct: 2329 atggttttggctaagcctggaaccattactcctcacaccaagttttctgcaattgtgtat 2388

                                  
Query: 527  gtgctcaagaaggaggagggtg 548
            ||  | |||||||| |||||||
Sbjct: 2389 gtcttgaagaaggaagagggtg 2410

to top

>emb|X67057.1|SRTUF1 S.ramocissimus tuf1 gene for elongation factor Tu1
          Length = 2836

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                       
Query: 242  gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtgg 300
            ||||| |||||| | ||||||||||| || || || | ||| |||||||||||||||||
Sbjct: 1835 gaggacgtcttcacgatcaccggtcgcggcacggtcgtcaccggccgtatcgagcgtgg 1893

to top

>emb|BX842654.1| Bdellovibrio bacteriovorus complete genome, strain HD100; segment 9/11
          Length = 344249

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                         
Query: 242    gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtgg 300
              ||||| || ||||| ||| | ||||||||||||||||  ||||||||| | ||||||||
Sbjct: 109500 gaggacgtattctctatctctggtcgtggtacagttgttactggccgtgtagagcgtgg 109442

to top

>emb|BX571857.1| Staphylococcus aureus strain MSSA476, complete genome
          Length = 2799802

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                                 
Query: 239    gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
              |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 580625 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 580675

to top

>gb|AY741371.1| Emiliania huxleyi strain CCMP 373 chloroplast, complete genome
          Length = 105309

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                 
Query: 365    actggtgttgagatgttccagaagaccatggatga 399
              |||||| |||||||||||||||||||  |||||||
Sbjct: 103198 actggtattgagatgttccagaagactctggatga 103232

to top

>gb|CP000240.1| Synechococcus sp. JA-2-3B'a(2-13), complete genome
          Length = 3046682

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 62/75 (82%)
 Strand = Plus / Plus

                                                                          
Query: 223    gcccttcttgctcgctgttgaggatgtcttctccatcaccggtcgtggtacagttgccac 282
              ||||||| || | ||||| |||||||||||||| || || ||||| || || || |||||
Sbjct: 959561 gcccttcctgatggctgtggaggatgtcttctcgattactggtcggggcacggtggccac 959620

                             
Query: 283    tggccgtatcgagcg 297
               ||||| ||||||||
Sbjct: 959621 gggccggatcgagcg 959635

to top

>dbj|BA000017.4| Staphylococcus aureus subsp. aureus Mu50 DNA, complete genome
          Length = 2878529

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                                 
Query: 239    gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
              |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 615678 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 615728

to top

>dbj|AP006716.1| Staphylococcus haemolyticus JCSC1435 DNA, complete genome
          Length = 2685015

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                                  
Query: 239     gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
               |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 2457435 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 2457385

to top

>gb|CP000046.1| Staphylococcus aureus subsp. aureus COL, complete genome
          Length = 2809422

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                                 
Query: 239    gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
              |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 618800 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 618850

to top

>dbj|AP008934.1| Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 DNA, complete
               genome
          Length = 2516575

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                                  
Query: 239     gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
               |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 2265641 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 2265591

to top

>gb|S79408.1| tuf1=elongation factor Tu1 [Streptomyces collinus, BSM 40733,
           Genomic, 1358 nt]
          Length = 1358

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                      
Query: 242 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtgg 300
           ||||| |||||| | |||||||||||||| || || | ||| || ||||||||||||||
Sbjct: 800 gaggacgtcttcacgatcaccggtcgtggcaccgtcgtcaccggtcgtatcgagcgtgg 858

to top

>gb|CP000253.1| Staphylococcus aureus subsp. aureus NCTC 8325, complete genome
          Length = 2821361

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                                 
Query: 239    gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
              |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 533972 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 534022

to top

>gb|CP000255.1| Staphylococcus aureus subsp. aureus USA300, complete genome
          Length = 2872769

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                                 
Query: 239    gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
              |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 597367 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 597417

to top

>gb|AF298806.1|AF298806 Staphylococcus warneri translation elongation factor Tu (tuf) gene,
           partial cds
          Length = 812

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 341 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 391

to top

>gb|AF298804.1|AF298804 Staphylococcus saprophyticus translation elongation factor Tu (tuf)
           gene, partial cds
          Length = 815

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 341 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 391

to top

>gb|AF298803.1|AF298803 Staphylococcus lugdunensis translation elongation factor Tu (tuf)
           gene, partial cds
          Length = 812

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 341 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 391

to top

>gb|AF298802.1|AF298802 Staphylococcus hominis translation elongation factor Tu (tuf) gene,
           partial cds
          Length = 812

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 341 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 391

to top

>gb|AF298801.1|AF298801 Staphylococcus haemolyticus translation elongation factor Tu (tuf)
           gene, partial cds
          Length = 812

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 341 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 391

to top

>gb|AF298800.1|AF298800 Staphylococcus epidermidis translation elongation factor Tu (tuf)
           gene, partial cds
          Length = 812

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 341 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 391

to top

>gb|AF298798.1|AF298798 Staphylococcus capitis translation elongation factor Tu (tuf) gene,
           partial cds
          Length = 812

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 341 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 391

to top

>gb|AF298796.1|AF298796 Staphylococcus aureus translation elongation factor Tu (tuf) gene,
           partial cds
          Length = 812

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 341 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 391

to top

>gb|AF368284.1|AF368284 Streptomyces aureofaciens strain 84/25 elongation factor Tu (tuf1)
           gene, complete cds
          Length = 1374

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 59/71 (83%)
 Strand = Plus / Plus

                                                                       
Query: 242 gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtggc 301
           ||||| |||||| | |||||||||||||| || || | ||| || ||||||||||| |||
Sbjct: 782 gaggacgtcttcacgatcaccggtcgtggcaccgtcgtcaccggtcgtatcgagcgcggc 841

                      
Query: 302 accgtcaaggt 312
           | | |||||||
Sbjct: 842 atcctcaaggt 852

to top

>gb|AF274747.1|AF274747 Listeria seeligeri elongation factor Tu (tuf) gene, partial cds
          Length = 821

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactgg 285
           ||||||||||| ||||| ||||| |||||||| || ||||| |||||
Sbjct: 337 gttgaggatgtattctcaatcactggtcgtggaactgttgcaactgg 383

to top

>gb|AF274740.1|AF274740 Staphylococcus epidermidis elongation factor Tu (tuf) gene, partial
           cds
          Length = 818

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 344 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 394

to top

>gb|AF274739.1|AF274739 Staphylococcus aureus elongation factor Tu (tuf) gene, partial cds
          Length = 748

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 344 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 394

to top

>gb|AF274729.1|AF274729 Enterococcus malodoratus strain ATCC43197 elongation factor Tu
           (tufB) gene, partial cds
          Length = 653

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgt 298
           ||||||||||| ||||| ||||| || |||||||| || ||  |||| |||||||| |||
Sbjct: 342 gttgaggatgttttctcgatcacaggacgtggtactgtagcttctggtcgtatcgaccgt 401

              
Query: 299 ggc 301
           |||
Sbjct: 402 ggc 404

to top

>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                          
Query: 242     gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtgg 300
               ||||| |||||| | |||||||||||||| || || | ||| || ||||||||||||||
Sbjct: 5981957 gaggacgtcttcacgatcaccggtcgtggcacggtcgtcaccggtcgtatcgagcgtgg 5982015

to top

>gb|AF269681.1|AF269681 Staphylococcus epidermidis strain SR1 clone step.1017a11 genomic
           sequence
          Length = 2997

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 287 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 237

to top

>gb|AF545609.1| Emiliania huxleyi elongation factor Tu (tufA) gene, partial cds;
           chloroplast gene for chloroplast product
          Length = 966

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 365 actggtgttgagatgttccagaagaccatggatga 399
           |||||| |||||||||||||||||||  |||||||
Sbjct: 721 actggtattgagatgttccagaagactctggatga 755

to top

>dbj|BA000033.2| Staphylococcus aureus subsp. aureus MW2 DNA, complete genome, strain:MW2
          Length = 2820462

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                                 
Query: 239    gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
              |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 581994 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 582044

to top

>dbj|AP008226.1| Thermus thermophilus HB8 genomic DNA, complete genome
          Length = 1849742

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                      
Query: 494     acgccacacaccaagtttgaggcagttgtgtatgtgctcaagaaggaggagggtg 548
               ||||| ||||| |||||||||||    ||||||||| | ||||||||||||||||
Sbjct: 1591383 acgccgcacacgaagtttgaggcctcggtgtatgtgttgaagaaggaggagggtg 1591329



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 133     gcgtggggataacgagtgggtgga 156
               ||||||||| ||||||||||||||
Sbjct: 1591747 gcgtggggagaacgagtgggtgga 1591724



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 133    gcgtggggataacgagtgggtgga 156
              ||||||||| ||||||||||||||
Sbjct: 239598 gcgtggggagaacgagtgggtgga 239575

to top

>dbj|BA000018.3| Staphylococcus aureus subsp. aureus N315 genomic DNA, complete genome
          Length = 2814816

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                                 
Query: 239    gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
              |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 591432 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 591482

to top

>gb|CP000029.1| Staphylococcus epidermidis RP62A, complete genome
          Length = 2616530

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                                 
Query: 239    gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
              |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 197930 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 197980

to top

>emb|X05977.1|TTTUF1 Thermus thermophilus tuf1 gene for elongation factor Tu
          Length = 1576

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 47/55 (85%)
 Strand = Plus / Plus

                                                                   
Query: 494  acgccacacaccaagtttgaggcagttgtgtatgtgctcaagaaggaggagggtg 548
            ||||| ||||| |||||||||||    ||||||||| | ||||||||||||||||
Sbjct: 1154 acgccgcacacgaagtttgaggcctcggtgtatgtgttgaagaaggaggagggtg 1208



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 133 gcgtggggataacgagtgggtgga 156
           ||||||||| ||||||||||||||
Sbjct: 790 gcgtggggagaacgagtgggtgga 813

to top

>emb|X06657.1|TTTUF Thermus thermophilus HB8 tuf gene for elongation factor Tu (EF-Tu)
          Length = 1578

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 47/55 (85%)
 Strand = Plus / Plus

                                                                   
Query: 494  acgccacacaccaagtttgaggcagttgtgtatgtgctcaagaaggaggagggtg 548
            ||||| ||||| |||||||||||    ||||||||| | ||||||||||||||||
Sbjct: 1156 acgccgcacacgaagtttgaggcctcggtgtatgtgttgaagaaggaggagggtg 1210



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 133 gcgtggggataacgagtgggtgga 156
           ||||||||| ||||||||||||||
Sbjct: 792 gcgtggggagaacgagtgggtgga 815

to top

>emb|BX571856.1| Staphylococcus aureus subsp. aureus strain MRSA252, complete genome
          Length = 2902619

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                                 
Query: 239    gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
              |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 602643 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 602693

to top

>gb|AE015929.1| Staphylococcus epidermidis ATCC 12228, complete genome
          Length = 2499279

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                                 
Query: 239    gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
              |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 313679 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 313729

to top

>emb|AJ938182.1| Staphylococcus aureus RF122 complete genome
          Length = 2742531

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                                 
Query: 239    gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgt 289
              |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 559979 gttgaggacgtattctcaatcactggtcgtggtactgttgctacaggccgt 560029

to top

>gb|AF007125.1|AF007125 Streptomyces aureofaciens elongation factor G (fus) gene, partial
            cds, and elongation factor Tu (tuf1) gene, complete cds
          Length = 1741

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                       
Query: 242  gaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtgg 300
            ||||| |||||| | |||||||||||||| || || | ||| ||||| |||||||||||
Sbjct: 1063 gaggacgtcttcacgatcaccggtcgtggcaccgtcgtcaccggccgcatcgagcgtgg 1121

to top

>gb|CP000148.1| Geobacter metallireducens GS-15, complete genome
          Length = 3997420

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                    
Query: 248    gtcttctccatcaccggtcgtggtacagttgccactgg 285
              ||||| |||||| ||||||| ||||| |||||||||||
Sbjct: 699432 gtcttttccatctccggtcgcggtaccgttgccactgg 699469



 Score = 44.1 bits (22), Expect = 0.48
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                    
Query: 248    gtcttctccatcaccggtcgtggtacagttgccactgg 285
              ||||| |||||| ||||||| ||||| |||||||||||
Sbjct: 683138 gtcttttccatctccggtcgcggtaccgttgccactgg 683175

to top

>gb|AY266999.1| Streptococcus mitis ATCC 903 elongation factor Tu (tuf) gene,
           partial cds
          Length = 761

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 251 ttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtgg 300
           ||||| ||||| |||||||||||||||||  | || |||||||| |||||
Sbjct: 325 ttctcaatcactggtcgtggtacagttgcttcaggacgtatcgaccgtgg 374

to top

>gb|AY266998.1| Streptococcus mitis elongation factor Tu (tuf) gene, partial cds
          Length = 761

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 251 ttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtgg 300
           ||||| ||||| |||||||||||||||||  | || |||||||| |||||
Sbjct: 325 ttctcaatcactggtcgtggtacagttgcttcaggacgtatcgaccgtgg 374

to top

>gb|AY266996.1| Streptococcus agalactiae CDCss-1073 elongation factor Tu (tuf)
           gene, partial cds
          Length = 761

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 52/62 (83%)
 Strand = Plus / Plus

                                                                       
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgt 298
           ||||| ||||| ||||| ||||| || ||||||||||||||  | || |||||||| |||
Sbjct: 313 gttgaagatgtattctcaatcactggacgtggtacagttgcttcaggacgtatcgaccgt 372

             
Query: 299 gg 300
           ||
Sbjct: 373 gg 374

to top

>gb|AY266993.1| Streptococcus agalactiae ATCC 12403 elongation factor Tu (tuf)
           gene, partial cds
          Length = 761

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 52/62 (83%)
 Strand = Plus / Plus

                                                                       
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgt 298
           ||||| ||||| ||||| ||||| || ||||||||||||||  | || |||||||| |||
Sbjct: 313 gttgaagatgtattctcaatcactggacgtggtacagttgcttcaggacgtatcgaccgt 372

             
Query: 299 gg 300
           ||
Sbjct: 373 gg 374

to top

>gb|AF276274.1| Streptococcus sanguinis elongation factor Tu (tuf) gene, partial
           cds
          Length = 795

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 251 ttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtgg 300
           ||||| ||||| |||||||||||||||||  | || |||||||| |||||
Sbjct: 344 ttctcaatcactggtcgtggtacagttgcttcaggacgtatcgaccgtgg 393

to top

>gb|AF276269.1| Streptococcus mitis elongation factor Tu (tuf) gene, partial cds
          Length = 810

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 251 ttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtgg 300
           ||||| ||||| |||||||||||||||||  | || |||||||| |||||
Sbjct: 351 ttctcaatcactggtcgtggtacagttgcttcaggacgtatcgaccgtgg 400

to top

>gb|AF276263.1| Streptococcus dysgalactiae elongation factor Tu (tuf) gene, partial
           cds
          Length = 795

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 251 ttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtgg 300
           ||||| ||||| |||||||||||||||||  | || |||||||| |||||
Sbjct: 343 ttctcaatcacaggtcgtggtacagttgcttcaggacgtatcgaccgtgg 392

to top

>gb|AF276261.2| Streptococcus cristatus elongation factor Tu (tuf) gene, partial
           cds
          Length = 761

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 251 ttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtgg 300
           ||||| ||||| |||||||||||||||||  | || |||||||| |||||
Sbjct: 325 ttctcaatcactggtcgtggtacagttgcttcaggacgtatcgaccgtgg 374

to top

>gb|AF276256.1| Streptococcus agalactiae elongation factor Tu (tuf) gene, partial
           cds
          Length = 818

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 52/62 (83%)
 Strand = Plus / Plus

                                                                       
Query: 239 gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgt 298
           ||||| ||||| ||||| ||||| || ||||||||||||||  | || |||||||| |||
Sbjct: 344 gttgaagatgtattctcaatcactggacgtggtacagttgcttcaggacgtatcgaccgt 403

             
Query: 299 gg 300
           ||
Sbjct: 404 gg 405

to top

>gb|AE006416.1| Lactococcus lactis subsp. lactis IL1403 section 178 of 218 of the
            complete genome
          Length = 13423

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                              
Query: 251  ttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtgg 300
            ||||| ||||| |||||||||||||||||  | || |||||||| |||||
Sbjct: 2882 ttctctatcactggtcgtggtacagttgcttcaggacgtatcgaacgtgg 2833

to top

>gb|CP000114.1| Streptococcus agalactiae A909, complete genome
          Length = 2127839

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 52/62 (83%)
 Strand = Plus / Plus

                                                                          
Query: 239    gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgt 298
              ||||| ||||| ||||| ||||| || ||||||||||||||  | || |||||||| |||
Sbjct: 834907 gttgaagatgtattctcaatcactggacgtggtacagttgcttcaggacgtatcgaccgt 834966

                
Query: 299    gg 300
              ||
Sbjct: 834967 gg 834968

to top

>gb|AY134478.1| Salmonella bongori strain ATCC 43975 elongation factor Tu (tuf)
           gene, partial cds
          Length = 812

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 245 gatgtcttctccatcaccggtcgtggtacagttg 278
           ||||| ||||||||| ||||||||||||| ||||
Sbjct: 345 gatgtattctccatctccggtcgtggtaccgttg 378

to top

>gb|CP000117.1| Anabaena variabilis ATCC 29413 chromosome, complete sequence
          Length = 6365727

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                                 
Query: 251     ttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgtgg 300
               ||||| || |||||||||||||||||||| || || || || ||||||||
Sbjct: 1577433 ttctctattaccggtcgtggtacagttgctaccggtcggattgagcgtgg 1577384

to top

>gb|AE014226.1| Streptococcus agalactiae 2603V/R section 36 of 100 of the complete
             genome
          Length = 20634

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 52/62 (83%)
 Strand = Plus / Plus

                                                                         
Query: 239   gttgaggatgtcttctccatcaccggtcgtggtacagttgccactggccgtatcgagcgt 298
             ||||| ||||| ||||| ||||| || ||||||||||||||  | || |||||||| |||
Sbjct: 11294 gttgaagatgtattctcaatcactggacgtggtacagttgcttcaggacgtatcgaccgt 11353

               
Query: 299   gg 300
             ||
Sbjct: 11354 gg 11355


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,452,953
Number of Sequences: 3902068
Number of extensions: 4452953
Number of successful extensions: 98358
Number of sequences better than 10.0: 386
Number of HSP's better than 10.0 without gapping: 384
Number of HSP's successfully gapped in prelim test: 3
Number of HSP's that attempted gapping in prelim test: 96429
Number of HSP's gapped (non-prelim): 1927
length of query: 548
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 525
effective length of database: 17,143,297,704
effective search space: 9000231294600
effective search space used: 9000231294600
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

to top

full-length cDNA and EST

Clone Information

BLAST Search Result