ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | bah62i03 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_476776.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2619 Score = 270 bits (136), Expect = 5e-69 Identities = 412/504 (81%) Strand = Plus / Plus Query: 80 ggctcgctcctcgtcgccaacgcgctccttggcatgtatgtcaagtgcggtcgcttagag 139 |||||||||||||||| ||||||||| || || ||||| |||||| |||| ||||| || Sbjct: 550 ggctcgctcctcgtcgacaacgcgctgctcgggatgtacgtcaagggcggccgcttcgac 609 Query: 140 gacgctctcaggatgttccacgggatggaggagcgtgacgtgtcctcgtggaacacggta 199 ||||| || | | ||||| ||||||||||| || ||||| || |||||||||||||| Sbjct: 610 gacgcgctgaaggtgttcgacgggatggagcgacgggacgtctcgtcgtggaacacggtc 669 Query: 200 ctgtccggcctggtcgagctggggaggtacgaggaggcgtttgagctgtttggggatatg 259 |||||||||||||||||||||||||||||||| |||||||| |||||||| ||||| ||| Sbjct: 670 ctgtccggcctggtcgagctggggaggtacgacgaggcgttcgagctgttcggggacatg 729 Query: 260 cggacgagcgatgttgcggtcgaccggttttctctgtcagcgcttttggccgcggctacc 319 ||| |||| |||| || |||| |||| || || || ||||| ||||| ||||| || Sbjct: 730 cgggacagcggcgttggggccgacaggttctcgctctcggcgctgttggctgcggccgcc 789 Query: 320 gaagggttctgcctgccccacggggcagcggttcacgctctgtctctcaagtccgggctg 379 || |||||| |||||| | | || || ||||| || || |||| |||||||| |||||| Sbjct: 790 gaggggttcggcctgcacgagggcgcggcggtgcatgcgttgtcgctcaagtctgggctg 849 Query: 380 gaggtggatttgagtgtgggcaatgcgctcattggattttatgctgagcatggtgattct 439 ||| |||||||||| || ||||| |||||| | || || || || ||||||||| |||| Sbjct: 850 gagatggatttgagcgttggcaacgcgctcgtcgggttctacgcggagcatggtcattcc 909 Query: 440 gtcgaggatatggttggtgtgtttcagaggatgccagtgaaggacgtaatttcgtggact 499 | |||||| |||||| ||||||| |||| ||||| | |||||| || ||||| ||||| Sbjct: 910 attgaggatgtggttgatgtgtttgagagaatgcctgcgaaggatgtgatttcatggacc 969 Query: 500 gggttactcaatggatacatggaatttggtttagttgacaatgctctgggtgtgttttat 559 ||||||||||||||||||||||| ||||| | ||||||| || ||| |||||| | Sbjct: 970 gggttactcaatggatacatggagtttggccttgttgacatggcaatggatgtgttcgac 1029 Query: 560 cggatgcctgagaggaattttgtt 583 || ||||||| ||||||||||||| Sbjct: 1030 cgtatgcctgtgaggaattttgtt 1053
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 270 bits (136), Expect = 5e-69 Identities = 412/504 (81%) Strand = Plus / Minus Query: 80 ggctcgctcctcgtcgccaacgcgctccttggcatgtatgtcaagtgcggtcgcttagag 139 |||||||||||||||| ||||||||| || || ||||| |||||| |||| ||||| || Sbjct: 3852321 ggctcgctcctcgtcgacaacgcgctgctcgggatgtacgtcaagggcggccgcttcgac 3852262 Query: 140 gacgctctcaggatgttccacgggatggaggagcgtgacgtgtcctcgtggaacacggta 199 ||||| || | | ||||| ||||||||||| || ||||| || |||||||||||||| Sbjct: 3852261 gacgcgctgaaggtgttcgacgggatggagcgacgggacgtctcgtcgtggaacacggtc 3852202 Query: 200 ctgtccggcctggtcgagctggggaggtacgaggaggcgtttgagctgtttggggatatg 259 |||||||||||||||||||||||||||||||| |||||||| |||||||| ||||| ||| Sbjct: 3852201 ctgtccggcctggtcgagctggggaggtacgacgaggcgttcgagctgttcggggacatg 3852142 Query: 260 cggacgagcgatgttgcggtcgaccggttttctctgtcagcgcttttggccgcggctacc 319 ||| |||| |||| || |||| |||| || || || ||||| ||||| ||||| || Sbjct: 3852141 cgggacagcggcgttggggccgacaggttctcgctctcggcgctgttggctgcggccgcc 3852082 Query: 320 gaagggttctgcctgccccacggggcagcggttcacgctctgtctctcaagtccgggctg 379 || |||||| |||||| | | || || ||||| || || |||| |||||||| |||||| Sbjct: 3852081 gaggggttcggcctgcacgagggcgcggcggtgcatgcgttgtcgctcaagtctgggctg 3852022 Query: 380 gaggtggatttgagtgtgggcaatgcgctcattggattttatgctgagcatggtgattct 439 ||| |||||||||| || ||||| |||||| | || || || || ||||||||| |||| Sbjct: 3852021 gagatggatttgagcgttggcaacgcgctcgtcgggttctacgcggagcatggtcattcc 3851962 Query: 440 gtcgaggatatggttggtgtgtttcagaggatgccagtgaaggacgtaatttcgtggact 499 | |||||| |||||| ||||||| |||| ||||| | |||||| || ||||| ||||| Sbjct: 3851961 attgaggatgtggttgatgtgtttgagagaatgcctgcgaaggatgtgatttcatggacc 3851902 Query: 500 gggttactcaatggatacatggaatttggtttagttgacaatgctctgggtgtgttttat 559 ||||||||||||||||||||||| ||||| | ||||||| || ||| |||||| | Sbjct: 3851901 gggttactcaatggatacatggagtttggccttgttgacatggcaatggatgtgttcgac 3851842 Query: 560 cggatgcctgagaggaattttgtt 583 || ||||||| ||||||||||||| Sbjct: 3851841 cgtatgcctgtgaggaattttgtt 3851818
>dbj|AP004670.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0496D04 Length = 197358 Score = 270 bits (136), Expect = 5e-69 Identities = 412/504 (81%) Strand = Plus / Minus Query: 80 ggctcgctcctcgtcgccaacgcgctccttggcatgtatgtcaagtgcggtcgcttagag 139 |||||||||||||||| ||||||||| || || ||||| |||||| |||| ||||| || Sbjct: 91433 ggctcgctcctcgtcgacaacgcgctgctcgggatgtacgtcaagggcggccgcttcgac 91374 Query: 140 gacgctctcaggatgttccacgggatggaggagcgtgacgtgtcctcgtggaacacggta 199 ||||| || | | ||||| ||||||||||| || ||||| || |||||||||||||| Sbjct: 91373 gacgcgctgaaggtgttcgacgggatggagcgacgggacgtctcgtcgtggaacacggtc 91314 Query: 200 ctgtccggcctggtcgagctggggaggtacgaggaggcgtttgagctgtttggggatatg 259 |||||||||||||||||||||||||||||||| |||||||| |||||||| ||||| ||| Sbjct: 91313 ctgtccggcctggtcgagctggggaggtacgacgaggcgttcgagctgttcggggacatg 91254 Query: 260 cggacgagcgatgttgcggtcgaccggttttctctgtcagcgcttttggccgcggctacc 319 ||| |||| |||| || |||| |||| || || || ||||| ||||| ||||| || Sbjct: 91253 cgggacagcggcgttggggccgacaggttctcgctctcggcgctgttggctgcggccgcc 91194 Query: 320 gaagggttctgcctgccccacggggcagcggttcacgctctgtctctcaagtccgggctg 379 || |||||| |||||| | | || || ||||| || || |||| |||||||| |||||| Sbjct: 91193 gaggggttcggcctgcacgagggcgcggcggtgcatgcgttgtcgctcaagtctgggctg 91134 Query: 380 gaggtggatttgagtgtgggcaatgcgctcattggattttatgctgagcatggtgattct 439 ||| |||||||||| || ||||| |||||| | || || || || ||||||||| |||| Sbjct: 91133 gagatggatttgagcgttggcaacgcgctcgtcgggttctacgcggagcatggtcattcc 91074 Query: 440 gtcgaggatatggttggtgtgtttcagaggatgccagtgaaggacgtaatttcgtggact 499 | |||||| |||||| ||||||| |||| ||||| | |||||| || ||||| ||||| Sbjct: 91073 attgaggatgtggttgatgtgtttgagagaatgcctgcgaaggatgtgatttcatggacc 91014 Query: 500 gggttactcaatggatacatggaatttggtttagttgacaatgctctgggtgtgttttat 559 ||||||||||||||||||||||| ||||| | ||||||| || ||| |||||| | Sbjct: 91013 gggttactcaatggatacatggagtttggccttgttgacatggcaatggatgtgttcgac 90954 Query: 560 cggatgcctgagaggaattttgtt 583 || ||||||| ||||||||||||| Sbjct: 90953 cgtatgcctgtgaggaattttgtt 90930
>gb|AC155915.2| Mus musculus 6 BAC RP24-462N21 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 152279 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 469 gatgccagtgaaggacgtaat 489 ||||||||||||||||||||| Sbjct: 116212 gatgccagtgaaggacgtaat 116232
>gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete genome Length = 2584158 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 87 tcctcgtcgccaacgcgctc 106 |||||||||||||||||||| Sbjct: 1309794 tcctcgtcgccaacgcgctc 1309775
>gb|AY079087.1| Leishmania donovani actin gene, complete cds Length = 1131 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 228 acgaggaggcgtttgagctg 247 |||||||||||||||||||| Sbjct: 707 acgaggaggcgtttgagctg 726
>ref|XM_883541.1| Leishmania major strain Friedlin actin (L1156.01) partial mRNA Length = 1131 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 228 acgaggaggcgtttgagctg 247 |||||||||||||||||||| Sbjct: 707 acgaggaggcgtttgagctg 726
>emb|AL139794.3|LMFLCHR4B Leishmania major Friedlin chromosome 4, right end Length = 247462 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 228 acgaggaggcgtttgagctg 247 |||||||||||||||||||| Sbjct: 242476 acgaggaggcgtttgagctg 242457
>gb|AC097641.6| Homo sapiens, clone RP11-143K11, complete sequence Length = 167127 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 428 catggtgattctgtcgagga 447 |||||||||||||||||||| Sbjct: 46626 catggtgattctgtcgagga 46607
>emb|BX640442.1| Bordetella bronchiseptica strain RB50, complete genome; segment 6/16 Length = 349876 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 202 gtccggcctggtcgagctgg 221 |||||||||||||||||||| Sbjct: 116005 gtccggcctggtcgagctgg 115986
>emb|BX640430.1| Bordetella parapertussis strain 12822, complete genome; segment 8/14 Length = 348014 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 202 gtccggcctggtcgagctgg 221 |||||||||||||||||||| Sbjct: 26905 gtccggcctggtcgagctgg 26886
>emb|BX640416.1| Bordetella pertussis strain Tohama I, complete genome; segment 6/12 Length = 349354 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 202 gtccggcctggtcgagctgg 221 |||||||||||||||||||| Sbjct: 311825 gtccggcctggtcgagctgg 311806
>gb|CP000248.1| Novosphingobium aromaticivorans DSM 12444, complete genome Length = 3561584 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 82 ctcgctcctcgtcgccaacg 101 |||||||||||||||||||| Sbjct: 2787136 ctcgctcctcgtcgccaacg 2787117
>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome Length = 9025608 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 40 ccaggtccatgcgctcgccg 59 |||||||||||||||||||| Sbjct: 8861273 ccaggtccatgcgctcgccg 8861292
>ref|XM_580082.1| PREDICTED: Rattus norvegicus LOC500544 (LOC500544), mRNA Length = 530 Score = 40.1 bits (20), Expect = 7.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 361 gtctctcaagtccgggctggaggt 384 ||||||||||||| |||||||||| Sbjct: 296 gtctctcaagtccaggctggaggt 319
>emb|BX005105.6| Zebrafish DNA sequence from clone DKEY-37M8 in linkage group 22, complete sequence Length = 171403 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 355 cgctctgtctctcaagtccg 374 |||||||||||||||||||| Sbjct: 32145 cgctctgtctctcaagtccg 32164
>gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete sequence Length = 2648638 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 421 tgctgagcatggtgattctg 440 |||||||||||||||||||| Sbjct: 1047866 tgctgagcatggtgattctg 1047847
>gb|L16961.1|LEIACTIN Leishmania major (clone LT252) actin gene, complete cds Length = 1706 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 228 acgaggaggcgtttgagctg 247 |||||||||||||||||||| Sbjct: 777 acgaggaggcgtttgagctg 796 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,737,730 Number of Sequences: 3902068 Number of extensions: 3737730 Number of successful extensions: 63042 Number of sequences better than 10.0: 18 Number of HSP's better than 10.0 without gapping: 18 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 62840 Number of HSP's gapped (non-prelim): 196 length of query: 583 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 560 effective length of database: 17,143,297,704 effective search space: 9600246714240 effective search space used: 9600246714240 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
