ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baalo24
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_463609.1| Oryza sativa (japonica cultivar-group), predic... 486 e-134
2dbj|AK064782.1| Oryza sativa (japonica cultivar-group) cDNA clon... 486 e-134
3gb|AY466159.1| Zea mays DEAD box RNA helicase (DRH1) mRNA, compl... 452 e-124
4dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 206 6e-50
5dbj|AP003416.4| Oryza sativa (japonica cultivar-group) genomic D... 206 6e-50
6dbj|AP003436.2| Oryza sativa (japonica cultivar-group) genomic D... 206 6e-50
7ref|NM_125706.2| Arabidopsis thaliana ATP binding / ATP-dependen... 103 7e-19
8ref|NM_203256.1| Arabidopsis thaliana ATP binding / ATP-dependen... 103 7e-19
9gb|BT000610.1| Arabidopsis thaliana AtP-dependent RNA helicase-l... 103 7e-19
10gb|AY060589.1| Arabidopsis thaliana AT5g63120/MDC12_8 mRNA, comp... 103 7e-19
11emb|BX832051.1|CNS09YVO Arabidopsis thaliana Full-length cDNA Co... 92 2e-15
12dbj|AB008265.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 92 2e-15
13ref|NM_004396.2| Homo sapiens DEAD (Asp-Glu-Ala-Asp) box polypep... 66 1e-07
14ref|XM_512004.1| PREDICTED: Pan troglodytes DEAD (Asp-Glu-Ala-As... 66 1e-07
15gb|BC016027.1| Homo sapiens DEAD (Asp-Glu-Ala-Asp) box polypepti... 66 1e-07
16ref|XM_448941.1| Candida glabrata CBS138, CAGL0L03846 partial mRNA 66 1e-07
17emb|X52104.1|HSP68A Human mRNA for p68 protein 66 1e-07
18emb|X15729.1|HSNP68M Human mRNA for nuclear p68 protein 66 1e-07
19emb|CR380958.1| Candida glabrata strain CBS138 chromosome L comp... 66 1e-07
20emb|BX571764.1|HSM806634 Homo sapiens mRNA; cDNA DKFZp686J01190 ... 66 1e-07
21gb|BT007642.1| Synthetic construct Homo sapiens DEAD/H (Asp-Glu-... 66 1e-07
22gb|BT006943.1| Homo sapiens DEAD/H (Asp-Glu-Ala-Asp/His) box pol... 66 1e-07
23emb|CR607012.1| full-length cDNA clone CS0DA009YD21 of Neuroblas... 66 1e-07
24gb|AF479823.1| Pantodon buchholzi DEAD box RNA helicase Vasa mRN... 66 1e-07
25gb|AC138744.4| Homo sapiens chromosome 17, clone RP11-859E19, co... 66 1e-07
26gb|AY892740.1| Synthetic construct Homo sapiens clone FLH024742.... 66 1e-07
27gb|AY890256.1| Synthetic construct Homo sapiens clone FLH024746.... 66 1e-07
28gb|AY890255.1| Synthetic construct Homo sapiens clone FLH024745.... 66 1e-07
29gb|AF015812.1|AF015812 Homo sapiens RNA helicase p68 (HUMP68) ge... 66 1e-07
30dbj|AB209919.1| Homo sapiens mRNA for Hypothetical protein DKFZp... 66 1e-07
31gb|AC009994.10| Homo sapiens chromosome 17, clone RP11-87N3, com... 66 1e-07
32emb|AJ010476.1|ATH010476 Arabidopsis thaliana mRNA for DEAD box ... 64 6e-07
33gb|AC145395.3| Oryza sativa (japonica cultivar-group) chromosome... 64 6e-07
34dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 64 6e-07
35gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 64 6e-07
36gb|BT012961.1| Lycopersicon esculentum clone 114151R, mRNA sequence 62 2e-06
37emb|CR861259.1| Pongo pygmaeus mRNA; cDNA DKFZp459M043 (from clo... 58 3e-05
38ref|XM_658443.1| Aspergillus nidulans FGSC A4 hypothetical prote... 56 1e-04
39ref|XM_502093.1| Yarrowia lipolytica CLIB122, YALI0C21472g predi... 56 1e-04
40emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB1... 56 1e-04
41gb|CP000103.1| Nitrosospira multiformis ATCC 25196, complete genome 56 1e-04
42gb|BT016697.1| Zea mays clone Contig530 mRNA sequence 54 5e-04
43gb|AY587260.1| Sparus aurata vasa-like protein mRNA, partial cds 54 5e-04
44gb|AF520608.1| Sparus aurata vasa-like mRNA, partial cds 54 5e-04
45emb|X52648.1|SPP68 Schizosaccharomyces pombe p68 gene for p68 pr... 54 5e-04
46emb|AL032684.1|SPBP8B7 S.pombe chromosome II p1 p8B7 54 5e-04
47gb|DQ399799.1| Acanthopagrus schlegelii vasa protein mRNA, parti... 54 5e-04
48ref|NM_001022444.1| Schizosaccharomyces pombe 972h- hypothetical... 54 5e-04
49dbj|AK068197.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 5e-04
50gb|AF096248.1|AF096248 Lycopersicon esculentum ethylene-responsi... 54 5e-04
51dbj|AP006094.1| Lotus japonicus genomic DNA, chromosome 4, clone... 54 5e-04
52gb|L11574.1|YSPP68DBP Schizosaccharomyces pombe p68 RNA helicase... 54 5e-04
53ref|NM_104388.2| Arabidopsis thaliana ATP binding / ATP-dependen... 52 0.002
54ref|NM_111523.2| Arabidopsis thaliana ATP binding / ATP-dependen... 52 0.002
55ref|XR_002773.1| PREDICTED: Mus musculus hypothetical protein LO... 52 0.002
56gb|AC011623.5|ATAC011623 Arabidopsis thaliana chromosome III BAC... 52 0.002
57emb|AL645849.17| Mouse DNA sequence from clone RP23-14F5 on chro... 52 0.002
58ref|NM_204708.1| Gallus gallus DEAD (Asp-Glu-Ala-Asp) box polype... 52 0.002
59gb|AY128786.1| Arabidopsis thaliana unknown protein (At1g55150) ... 52 0.002
60gb|AY062745.1| Arabidopsis thaliana Unknown protein (At1g55150; ... 52 0.002
61emb|BX813460.1|CNS0AC9L Arabidopsis thaliana Full-length cDNA Co... 52 0.002
62gb|AC073944.6|AC073944 Arabidopsis thaliana chromosome 1 BAC T7N... 52 0.002
63emb|AJ010936.1|HSA010936 Homo sapiens ddx5-ps1 gene, partial 52 0.002
64dbj|AB004836.1| Gallus gallus mRNA for Cvh, complete cds 52 0.002
65ref|NM_188251.1| Oryza sativa (japonica cultivar-group), predic... 50 0.008
66emb|CR954247.1| Pseudoalteromonas haloplanktis str. TAC125 chrom... 50 0.008
67ref|XM_855709.1| PREDICTED: Canis familiaris similar to Probable... 50 0.008
68ref|XM_855680.1| PREDICTED: Canis familiaris similar to Probable... 50 0.008
69ref|XM_855640.1| PREDICTED: Canis familiaris similar to Probable... 50 0.008
70ref|XM_845027.1| PREDICTED: Canis familiaris similar to Probable... 50 0.008
71ref|XM_855575.1| PREDICTED: Canis familiaris similar to Probable... 50 0.008
72ref|XM_531736.2| PREDICTED: Canis familiaris similar to Probable... 50 0.008
73ref|XM_855514.1| PREDICTED: Canis familiaris similar to Probable... 50 0.008
74ref|XM_855481.1| PREDICTED: Canis familiaris similar to Probable... 50 0.008
75ref|XM_855444.1| PREDICTED: Canis familiaris similar to Probable... 50 0.008
76ref|XM_855416.1| PREDICTED: Canis familiaris similar to Probable... 50 0.008
77ref|XM_855385.1| PREDICTED: Canis familiaris similar to Probable... 50 0.008
78ref|XM_855349.1| PREDICTED: Canis familiaris similar to Probable... 50 0.008
79dbj|AP003244.3| Oryza sativa (japonica cultivar-group) genomic D... 50 0.008
80gb|AY786204.1| Monopterus albus DEAD box RNA helicase-PL10B mRNA... 50 0.008
81ref|XM_550287.1| Oryza sativa (japonica cultivar-group), mRNA 48 0.033
82ref|XM_550286.1| Oryza sativa (japonica cultivar-group), mRNA 48 0.033
83gb|AE014291.4| Brucella suis 1330 chromosome I, complete sequence 48 0.033
84gb|AC092238.2| Drosophila melanogaster clone BACR03D18, complete... 48 0.033
85ref|XM_504478.1| Yarrowia lipolytica CLIB122, YALI0E27715g predi... 48 0.033
86ref|NM_165103.2| Drosophila melanogaster vasa CG3506-RA (vas), mRNA 48 0.033
87gb|AY084126.1| Drosophila melanogaster RE20606 full insert cDNA 48 0.033
88gb|AC093101.1| Drosophila melanogaster, chromosome 2L, region 35... 48 0.033
89gb|AE009543.1| Brucella melitensis 16M chromosome I, section 100... 48 0.033
90dbj|AP003282.2| Oryza sativa (japonica cultivar-group) genomic D... 48 0.033
91gb|AE017223.1| Brucella abortus biovar 1 str. 9-941 chromosome I... 48 0.033
92ref|XM_320481.2| Anopheles gambiae str. PEST ENSANGP00000015773 ... 48 0.033
93dbj|AK100326.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.033
94gb|AE003646.3| Drosophila melanogaster chromosome 2L, section 55... 48 0.033
95emb|AM040264.1| Brucella melitensis biovar Abortus chromosome I,... 48 0.033
96emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB ... 48 0.033
97emb|X12946.1|DMVASA2 D.melanogaster vasa gene (exons 3 to 7) 48 0.033
98gb|M23560.1|DROVASA D.melanogaster antigen Mab46F11 (vasa) mRNA,... 48 0.033
99gb|AE017354.1| Legionella pneumophila subsp. pneumophila str. Ph... 46 0.13
100emb|CR628336.1| Legionella pneumophila str. Paris complete genome 46 0.13
101emb|BX950851.1| Erwinia carotovora subsp. atroseptica SCRI1043, ... 46 0.13
102dbj|BA000032.2| Vibrio parahaemolyticus RIMD 2210633 DNA, chromo... 46 0.13
103gb|AY730697.1| Nematostella vectensis DEAD box helicase Vasa2 (V... 46 0.13
104gb|AE014299.1| Shewanella oneidensis MR-1, complete genome 46 0.13
105gb|BC086320.1| Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypepti... 44 0.52
106ref|NM_001016781.2| Xenopus tropicalis hypothetical protein LOC5... 44 0.52
107gb|BC084159.1| Xenopus tropicalis cDNA clone IMAGE:7016603 44 0.52
108gb|BC080992.1| Xenopus laevis hypothetical protein LOC398649, mR... 44 0.52
109gb|CP000082.1| Psychrobacter arcticus 273-4, complete genome 44 0.52
110ref|NM_007840.2| Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypep... 44 0.52
111gb|BC054236.1| Xenopus laevis hypothetical protein LOC398649, mR... 44 0.52
112gb|BC062916.1| Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypepti... 44 0.52
113ref|XM_946895.1| Theileria annulata strain Ankara ATP-dependent ... 44 0.52
114ref|XM_967408.1| PREDICTED: Tribolium castaneum similar to DEAD ... 44 0.52
115emb|X65627.1|MMHELI M.musculus mRNA TNZ2 for p68 RNA helicase 44 0.52
116dbj|AK129022.1| Mus musculus cDNA fis, clone TRACH3036683, highl... 44 0.52
117gb|AF479821.1| Hyphessobrycon ecuadoriensis DEAD box RNA helicas... 44 0.52
118dbj|AK132779.1| Mus musculus adult male testis cDNA, RIKEN full-... 44 0.52
119dbj|AK135173.1| Mus musculus 12 days embryo female ovary cDNA, R... 44 0.52
120dbj|AK166698.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 44 0.52
121dbj|AK166045.1| Mus musculus lung RCB-0558 LLC cDNA, RIKEN full-... 44 0.52
122dbj|AB169223.1| Macaca fascicularis testis cDNA, clone: QtsA-181... 44 0.52
123dbj|AB169157.1| Macaca fascicularis testis cDNA, clone: QtsA-176... 44 0.52
124dbj|AK088887.1| Mus musculus 2 days neonate thymus thymic cells ... 44 0.52
125gb|DQ336393.1| Elephas maximus DEAD/H box polypeptide (DBY) gene... 44 0.52
126dbj|AK044792.1| Mus musculus adult retina cDNA, RIKEN full-lengt... 44 0.52
127dbj|AK076018.1| Mus musculus 10 days embryo whole body cDNA, RIK... 44 0.52
128ref|XM_392069.2| PREDICTED: Apis mellifera similar to ENSANGP000... 44 0.52
129ref|NM_001007613.1| Rattus norvegicus ddx5 gene (Ddx5), mRNA 44 0.52
130gb|BC079036.1| Rattus norvegicus ddx5 gene, mRNA (cDNA clone MGC... 44 0.52
131emb|AJ010940.1|RNO010940 Rattus norvegicus ddx5-ps1 pseudogene, ... 44 0.52
132emb|CR855694.2| Xenopus tropicalis finished cDNA, clone TGas068f07 44 0.52
133gb|BC046554.1| Mus musculus cDNA clone IMAGE:4973650 44 0.52
134gb|BC108369.1| Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypepti... 44 0.52
135gb|AC149403.2| Phakopsora pachyrhizi clone JGIAFNA-61H19, comple... 42 2.1
136gb|AY391418.1| Danio rerio DEAD (Asp-Glu-Ala-Asp) box polypeptid... 42 2.1
137gb|CP000148.1| Geobacter metallireducens GS-15, complete genome 42 2.1
138ref|XM_629763.1| Dictyostelium discoideum hypothetical protein (... 42 2.1
139ref|NM_212612.1| Danio rerio DEAD (Asp-Glu-Ala-Asp) box polypept... 42 2.1
140gb|BC082849.1| Xenopus laevis p68 RNA helicase, mRNA (cDNA clone... 42 2.1
141gb|AE017136.1| Yersinia pestis biovar Medievalis str. 91001 sect... 42 2.1
142gb|BC063223.1| Xenopus tropicalis DEAD (Asp-Glu-Ala-Asp) box pol... 42 2.1
143ref|XM_361961.1| Magnaporthe grisea 70-15 hypothetical protein (... 42 2.1
144gb|DQ441593.1| Odontesthes hatcheri vasa-like protein mRNA, part... 42 2.1
145gb|AE009952.1| Yersinia pestis KIM, complete genome 42 2.1
146ref|XM_456137.1| Kluyveromyces lactis NRRL Y-1140, KLLA0F23716g ... 42 2.1
147gb|BC067585.1| Danio rerio DEAD (Asp-Glu-Ala-Asp) box polypeptid... 42 2.1
148gb|AC165060.2| Phakopsora pachyrhizi clone JGIAFNA-205B5, comple... 42 2.1
149gb|BC047981.1| Xenopus laevis similar to DEAD/H (Asp-Glu-Ala-Asp... 42 2.1
150ref|XM_719206.1| Plasmodium yoelii yoelii str. 17XNL U5 snRNP 10... 42 2.1
151gb|AC136842.2| Oryza sativa (japonica cultivar-group) chromosome... 42 2.1
152gb|CP000323.1| Psychrobacter cryohalolentis K5, complete genome 42 2.1
153emb|Z71388.1|SCYNL112W S.cerevisiae chromosome XIV reading frame... 42 2.1
154emb|Z69382.1|SCCXIV38K S.cerevisiae 37,800 bp segment of chromos... 42 2.1
155emb|X52649.1|SCP68 S.cerevisiae p68 gene 42 2.1
156emb|CR628337.1| Legionella pneumophila str. Lens complete genome 42 2.1
157emb|CR626927.1| Bacteroides fragilis NCTC 9343, complete genome 42 2.1
158emb|CR382126.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso... 42 2.1
159emb|BX936398.1| Yersinia pseudotuberculosis IP32953 genome, comp... 42 2.1
160ref|NM_203898.1| Xenopus tropicalis DEAD (Asp-Glu-Ala-Asp) box p... 42 2.1
161emb|AJ414153.1| Yersinia pestis strain CO92 complete genome; seg... 42 2.1
162emb|BX936324.6| Zebrafish DNA sequence from clone CH211-74F16 in... 42 2.1
163dbj|AP007171.1| Aspergillus oryzae RIB40 genomic DNA, SC011 42 2.1
164gb|AC118347.2| Oryza sativa (japonica cultivar-group) chromosome... 42 2.1
165gb|AE015928.1| Bacteroides thetaiotaomicron VPI-5482, complete g... 42 2.1
166gb|AF218580.1|AF218580 Xenopus laevis p68 RNA helicase mRNA, com... 42 2.1
167ref|NM_065859.3| Caenorhabditis elegans F01F1.7 (F01F1.7) mRNA, ... 42 2.1
168gb|AF188678.1|AF188678 Pisum sativum P72 DEAD box protein mRNA, ... 42 2.1
169gb|AY960203.1| Odontesthes bonariensis Vasa-like protein mRNA, p... 42 2.1
170dbj|AP006841.1| Bacteroides fragilis YCH46 DNA, complete genome 42 2.1
171dbj|AB051835.1| Oreochromis niloticus vas-s mRNA for vasa short ... 42 2.1
172dbj|AB032467.1| Oreochromis niloticus mRNA for vasa, complete cds 42 2.1
173emb|BX085195.5| Zebrafish DNA sequence from clone DKEY-226A5 in ... 42 2.1
174gb|AY110750.1| Zea mays CL9052_1 mRNA sequence 42 2.1
175emb|CR848548.2| Xenopus tropicalis finished cDNA, clone TEgg028e13 42 2.1
176gb|U13070.1| Caenorhabditis elegans cosmid F01F1, complete sequence 42 2.1
177gb|AE008692.1| Zymomonas mobilis subsp. mobilis ZM4, complete ge... 42 2.1
178gb|AC154130.1| Tribolium castaneum BAC T.cast_C11O3 (Clemson Un... 40 8.1
179gb|AF510054.1| Schistocerca gregaria vasa-like gene, partial cds 40 8.1
180ref|XM_635505.1| Dictyostelium discoideum hypothetical protein (... 40 8.1
181ref|NM_177069.2| Mus musculus RIKEN cDNA E330009P21 gene (E33000... 40 8.1
182gb|AY723847.1| Saccharomyces cerevisiae clone FLH004944.01X YLR2... 40 8.1
183ref|XM_613184.2| PREDICTED: Bos taurus similar to Probable RNA-d... 40 8.1
184gb|BC068766.1| Xenopus laevis hypothetical protein MGC81281, mRN... 40 8.1
185ref|NM_026360.1| Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypep... 40 8.1
186ref|NM_175214.3| Mus musculus kinesin family member 27 (Kif27), ... 40 8.1
187ref|XM_705616.1| Candida albicans SC5314 putative nonsense-media... 40 8.1
188ref|XM_705602.1| Candida albicans SC5314 putative nonsense-media... 40 8.1
189ref|XM_816398.1| Trypanosoma cruzi strain CL Brener ATP-dependen... 40 8.1
190gb|BC060168.1| Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypepti... 40 8.1
191ref|XM_651823.1| Entamoeba histolytica HM-1:IMSS DEAD/DEAH box h... 40 8.1
192ref|XM_759104.1| Theileria parva strain Muguga chromosome 4 RNA ... 40 8.1
193gb|AY274092.1| Coccyzus erythropthalmus phosphoenolpyruvate carb... 40 8.1
194emb|AL450389.12| Human DNA sequence from clone RP5-929G5 on chro... 40 8.1
195gb|CP000284.1| Methylobacillus flagellatus KT, complete genome 40 8.1
196ref|XM_505193.1| Yarrowia lipolytica CLIB122, YALI0F09141g predi... 40 8.1
197emb|CR388143.6| Zebrafish DNA sequence from clone DKEY-189O20 in... 40 8.1
198gb|AE008734.1| Salmonella typhimurium LT2, section 42 of 220 of ... 40 8.1
199gb|BC099397.1| Mus musculus RIKEN cDNA E330009P21 gene, mRNA (cD... 40 8.1
200emb|BX897699.1| Bartonella henselae strain Houston-1, complete g... 40 8.1
201emb|AL627268.1| Salmonella enterica serovar Typhi (Salmonella ty... 40 8.1
202emb|AL162756.2|NMA5Z2491 Neisseria meningitidis serogroup A stra... 40 8.1
203gb|BC095944.1| Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypepti... 40 8.1
204emb|BX647482.1|HSM807628 Homo sapiens genomic DNA; cDNA DKFZp686... 40 8.1
205emb|AJ719824.1| Gallus gallus mRNA for hypothetical protein, clo... 40 8.1
206ref|NM_001007853.1| Gallus gallus DEAD (Asp-Glu-Ala-Asp) box pol... 40 8.1
207gb|AC105094.6| Homo sapiens chromosome 18, clone RP11-1096D5, co... 40 8.1
208gb|AC110997.4| Homo sapiens chromosome 18, clone RP11-56J20, com... 40 8.1
209dbj|AK136136.1| Mus musculus in vitro fertilized eggs cDNA, RIKE... 40 8.1
210dbj|AK135949.1| Mus musculus in vitro fertilized eggs cDNA, RIKE... 40 8.1
211gb|AC106746.2| Homo sapiens chromosome 5 clone RP11-149E17, comp... 40 8.1
212gb|L80215.1|HUM69DC8Z Homo sapiens (subclone 1_a7 from P1 H69) D... 40 8.1
213ref|NM_199036.1| Mus musculus F-box and WD-40 domain protein 15 ... 40 8.1
214dbj|AK010310.1| Mus musculus ES cells cDNA, RIKEN full-length en... 40 8.1
215gb|AC154437.2| Mus musculus BAC clone RP24-194D17 from chromosom... 40 8.1
216dbj|AK087902.1| Mus musculus 2 days pregnant adult female ovary ... 40 8.1
217gb|DQ067445.1| Mus musculus early ovarian protein-1 (Eop1) mRNA,... 40 8.1
218dbj|AK087710.1| Mus musculus 2 days pregnant adult female ovary ... 40 8.1
219dbj|AK087669.1| Mus musculus 2 days pregnant adult female ovary ... 40 8.1
220gb|BC103318.1| Bos taurus cDNA clone IMAGE:7941432, partial cds 40 8.1
221dbj|AK076982.1| Mus musculus adult male testis cDNA, RIKEN full-... 40 8.1
222ref|NM_001039431.1| Tribolium castaneum vasa RNA helicase (vasa)... 40 8.1
223tpg|BK001056.1| TPA: TPA_exp: Mus musculus kinesin-related prote... 40 8.1
224gb|AE002098.2| Neisseria meningitidis MC58, complete genome 40 8.1
225gb|AC147286.3| Pan troglodytes BAC clone RP43-75F15 from chromos... 40 8.1
226gb|CP000026.1| Salmonella enterica subsp. enterica serovar Parat... 40 8.1
227dbj|AK196692.1| Mus musculus cDNA, clone:Y1G0122J24, strand:plus... 40 8.1
228dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome 40 8.1
229emb|AL731729.10| Mouse DNA sequence from clone RP23-92L12 on chr... 40 8.1
230gb|AC005534.2|AC005534 Homo sapiens PAC clone RP5-982E9 from 7q3... 40 8.1
231gb|AC131718.5| Mus musculus BAC clone RP23-171B16 from 6, comple... 40 8.1
232gb|AE014613.1| Salmonella enterica subsp. enterica serovar Typhi... 40 8.1
233emb|AJ010934.1|RNO010934 Rattus norvegicus ddx5 gene, exons 2 to... 40 8.1
234gb|AE017220.1| Salmonella enterica subsp. enterica serovar Chole... 40 8.1
235gb|AY887136.1| Tribolium castaneum vasa RNA helicase mRNA, compl... 40 8.1
236gb|AC140287.3| Mus musculus BAC clone RP23-346L16 from 6, comple... 40 8.1
237gb|U17245.1|YSCL9328 Saccharomyces cerevisiae chromosome XII cos... 40 8.1
238emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB1... 40 8.1
239gb|L81906.1|HSL81906 Homo sapiens (subclone 2_f8 from P1 H69) DN... 40 8.1
240gb|AC001214.1|HSAC001214 Homo sapiens (subclone 1_a7 from P1 H69... 40 8.1
241emb|AL606529.9| Human DNA sequence from clone RP4-744B2 on chrom... 40 8.1
242emb|X94313.1|MMHLR1 M.musculus Hlr1 gene 40 8.1
243dbj|D86601.1| Bombyx mori BmVLG mRNA, complete cds 40 8.1
244dbj|AB048845.1| Aurelia aurita mRNA for PL10-related protein CnP... 40 8.1
245emb|AL603664.16| Mouse DNA sequence from clone RP23-247J12 on ch... 40 8.1

>ref|XM_463609.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1443

 Score =  486 bits (245), Expect = e-134
 Identities = 445/512 (86%)
 Strand = Plus / Plus

                                                                       
Query: 84  gtgcccaagcctatccgcttcttccatgaagccaactttccagattactgcatgcaagcg 143
           |||||||||||  | |||| |||||| || |||||||| ||||||||||| |||||||| 
Sbjct: 451 gtgcccaagccggttcgctacttccaggaggccaacttcccagattactgtatgcaagca 510

                                                                       
Query: 144 atcgccaagtccggntttgtggagccaacgcctatccaagctcagggttggccgatggct 203
           || ||||||   || || || ||||| |||||||| ||  | || |||||||| ||||||
Sbjct: 511 atagccaagagtggattcgtagagcccacgcctattcagtcacaaggttggccaatggct 570

                                                                       
Query: 204 ttgaagggcagggacgtgattggtattgcagaaactggatctgggaaaacactatcttac 263
           ||||||||||||||| |||| ||||| ||| ||||||| |||||||||||||||||||||
Sbjct: 571 ttgaagggcagggacatgatcggtatcgcacaaactggctctgggaaaacactatcttac 630

                                                                       
Query: 264 atactacctggtttggttcatgttggtgcacaacctcgactcgaacaaggtgatggccca 323
            | || ||||| |||||||||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 631 cttctccctgggttggttcatgttggtgcacagcctcgactagaacaaggtgatggccca 690

                                                                       
Query: 324 attgtcttgatccttgctccaacaagagaactggctgttcaaatacaggcagaagctaca 383
           |||||  ||||||||||||| ||||||||||||||||||||||||||   |||| ||   
Sbjct: 691 attgttctgatccttgctcctacaagagaactggctgttcaaatacaacaagaatctggc 750

                                                                       
Query: 384 aagtttggatcatactcgagaactagaagcacatgtatctacggtggagcacctaaggga 443
           || |||||||||||||| |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 751 aaatttggatcatactcaagaactagaagcacttgtatctatggtggagcacctaaggga 810

                                                                       
Query: 444 ccacaaatacgtgacctcaggagaggagttgaaatcgtcattgcaacaccaggtcggttg 503
           ||||||||||||||||| |||||||| ||||| || |||||||||||||| |||||||||
Sbjct: 811 ccacaaatacgtgaccttaggagaggggttgagattgtcattgcaacacctggtcggttg 870

                                                                       
Query: 504 attgatatgctggaagctggtcacacaaacctacgtcgggttacataccttgtgctggat 563
           || ||||||||||||| ||||||||| ||||| ||  | || |||||||| || ||||||
Sbjct: 871 atcgatatgctggaaggtggtcacactaacctgcgaagagtaacatacctcgtcctggat 930

                                           
Query: 564 gaggcagaccgtatgctcgatatgggttttga 595
           ||||| ||||| ||||| || |||||||||||
Sbjct: 931 gaggctgaccgcatgcttgacatgggttttga 962



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 1   ccccgccgtgcaggccatgtc 21
           |||||||||||||||||||||
Sbjct: 372 ccccgccgtgcaggccatgtc 392



to top

>dbj|AK064782.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000B12, full
            insert sequence
          Length = 3413

 Score =  486 bits (245), Expect = e-134
 Identities = 445/512 (86%)
 Strand = Plus / Plus

                                                                        
Query: 84   gtgcccaagcctatccgcttcttccatgaagccaactttccagattactgcatgcaagcg 143
            |||||||||||  | |||| |||||| || |||||||| ||||||||||| |||||||| 
Sbjct: 597  gtgcccaagccggttcgctacttccaggaggccaacttcccagattactgtatgcaagca 656

                                                                        
Query: 144  atcgccaagtccggntttgtggagccaacgcctatccaagctcagggttggccgatggct 203
            || ||||||   || || || ||||| |||||||| ||  | || |||||||| ||||||
Sbjct: 657  atagccaagagtggattcgtagagcccacgcctattcagtcacaaggttggccaatggct 716

                                                                        
Query: 204  ttgaagggcagggacgtgattggtattgcagaaactggatctgggaaaacactatcttac 263
            ||||||||||||||| |||| ||||| ||| ||||||| |||||||||||||||||||||
Sbjct: 717  ttgaagggcagggacatgatcggtatcgcacaaactggctctgggaaaacactatcttac 776

                                                                        
Query: 264  atactacctggtttggttcatgttggtgcacaacctcgactcgaacaaggtgatggccca 323
             | || ||||| |||||||||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 777  cttctccctgggttggttcatgttggtgcacagcctcgactagaacaaggtgatggccca 836

                                                                        
Query: 324  attgtcttgatccttgctccaacaagagaactggctgttcaaatacaggcagaagctaca 383
            |||||  ||||||||||||| ||||||||||||||||||||||||||   |||| ||   
Sbjct: 837  attgttctgatccttgctcctacaagagaactggctgttcaaatacaacaagaatctggc 896

                                                                        
Query: 384  aagtttggatcatactcgagaactagaagcacatgtatctacggtggagcacctaaggga 443
            || |||||||||||||| |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 897  aaatttggatcatactcaagaactagaagcacttgtatctatggtggagcacctaaggga 956

                                                                        
Query: 444  ccacaaatacgtgacctcaggagaggagttgaaatcgtcattgcaacaccaggtcggttg 503
            ||||||||||||||||| |||||||| ||||| || |||||||||||||| |||||||||
Sbjct: 957  ccacaaatacgtgaccttaggagaggggttgagattgtcattgcaacacctggtcggttg 1016

                                                                        
Query: 504  attgatatgctggaagctggtcacacaaacctacgtcgggttacataccttgtgctggat 563
            || ||||||||||||| ||||||||| ||||| ||  | || |||||||| || ||||||
Sbjct: 1017 atcgatatgctggaaggtggtcacactaacctgcgaagagtaacatacctcgtcctggat 1076

                                            
Query: 564  gaggcagaccgtatgctcgatatgggttttga 595
            ||||| ||||| ||||| || |||||||||||
Sbjct: 1077 gaggctgaccgcatgcttgacatgggttttga 1108



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 1   ccccgccgtgcaggccatgtc 21
           |||||||||||||||||||||
Sbjct: 518 ccccgccgtgcaggccatgtc 538



to top

>gb|AY466159.1| Zea mays DEAD box RNA helicase (DRH1) mRNA, complete cds
          Length = 2214

 Score =  452 bits (228), Expect = e-124
 Identities = 422/485 (87%), Gaps = 4/485 (0%)
 Strand = Plus / Plus

                                                                        
Query: 111  gaagccaactttccagattactgcatgcaagcgatcgccaagtccggntttgtggagcca 170
            ||||||||||| |||||||||||||||||||| || ||||| || || ||||||||||||
Sbjct: 554  gaagccaacttcccagattactgcatgcaagctattgccaa-tctggatttgtggagcca 612

                                                                        
Query: 171  acgcctatccaagctcagggttggccgatggctttgaagggcagggacgtgattggtatt 230
            || ||||| ||| |||| |||||||| |||   |||||||| |||||| |||||||||| 
Sbjct: 613  acacctattcaatctcaaggttggcctatg---ttgaagggtagggacctgattggtatc 669

                                                                        
Query: 231  gcagaaactggatctgggaaaacactatcttacatactacctggtttggttcatgttggt 290
            ||  |||| || || ||||||||| |||||||  |  |||||||  ||||||||||||||
Sbjct: 670  gctcaaacaggctcagggaaaacattatcttatctgttacctgggctggttcatgttggt 729

                                                                        
Query: 291  gcacaacctcgactcgaacaaggtgatggcccaattgtcttgatccttgctccaacaaga 350
            || || ||||| || |||||||| |||||||||||||| || || || ||||| ||||||
Sbjct: 730  gcccagcctcggctagaacaaggcgatggcccaattgtattaattctcgctcccacaaga 789

                                                                        
Query: 351  gaactggctgttcaaatacaggcagaagctacaaagtttggatcatactcgagaactaga 410
            |||||||||||||||||||||| |||| ||||||| ||||||||||| || |||||||||
Sbjct: 790  gaactggctgttcaaatacaggaagaatctacaaaatttggatcatattcaagaactaga 849

                                                                        
Query: 411  agcacatgtatctacggtggagcacctaagggaccacaaatacgtgacctcaggagagga 470
            ||||||||| |||| ||||| ||||||||||| ||||||||||| ||||| || ||||||
Sbjct: 850  agcacatgtgtctatggtggtgcacctaagggtccacaaatacgggaccttagaagagga 909

                                                                        
Query: 471  gttgaaatcgtcattgcaacaccaggtcggttgattgatatgctggaagctggtcacaca 530
            |||||||| ||||||||||| || || |||||||||||||||||||||||||||||||||
Sbjct: 910  gttgaaattgtcattgcaactcctggccggttgattgatatgctggaagctggtcacaca 969

                                                                        
Query: 531  aacctacgtcgggttacataccttgtgctggatgaggcagaccgtatgctcgatatgggt 590
            ||||||||| | || |||||||||||| |||||||||| ||||| ||||| |||||||| 
Sbjct: 970  aacctacgtagagtgacataccttgtgttggatgaggctgaccggatgctagatatgggg 1029

                 
Query: 591  tttga 595
            |||||
Sbjct: 1030 tttga 1034



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  206 bits (104), Expect = 6e-50
 Identities = 149/164 (90%)
 Strand = Plus / Minus

                                                                            
Query: 306      gaacaaggtgatggcccaattgtcttgatccttgctccaacaagagaactggctgttcaa 365
                |||||||||||||||||||||||  ||||||||||||| |||||||||||||||||||||
Sbjct: 39684703 gaacaaggtgatggcccaattgttctgatccttgctcctacaagagaactggctgttcaa 39684644

                                                                            
Query: 366      atacaggcagaagctacaaagtttggatcatactcgagaactagaagcacatgtatctac 425
                |||||   |||| ||   || |||||||||||||| |||||||||||||| |||||||| 
Sbjct: 39684643 atacaacaagaatctggcaaatttggatcatactcaagaactagaagcacttgtatctat 39684584

                                                            
Query: 426      ggtggagcacctaagggaccacaaatacgtgacctcaggagagg 469
                ||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 39684583 ggtggagcacctaagggaccacaaatacgtgaccttaggagagg 39684540



 Score =  155 bits (78), Expect = 2e-34
 Identities = 155/181 (85%)
 Strand = Plus / Minus

                                                                            
Query: 124      cagattactgcatgcaagcgatcgccaagtccggntttgtggagccaacgcctatccaag 183
                |||||||||| |||||||| || ||||||   || || || ||||| |||||||| ||  
Sbjct: 39684965 cagattactgtatgcaagcaatagccaagagtggattcgtagagcccacgcctattcagt 39684906

                                                                            
Query: 184      ctcagggttggccgatggctttgaagggcagggacgtgattggtattgcagaaactggat 243
                | || |||||||| ||||||||||||||||||||| |||| ||||| ||| ||||||| |
Sbjct: 39684905 cacaaggttggccaatggctttgaagggcagggacatgatcggtatcgcacaaactggct 39684846

                                                                            
Query: 244      ctgggaaaacactatcttacatactacctggtttggttcatgttggtgcacaacctcgac 303
                |||||||||||||||||||| | || ||||| |||||||||||||||||||| |||||||
Sbjct: 39684845 ctgggaaaacactatcttaccttctccctgggttggttcatgttggtgcacagcctcgac 39684786

                 
Query: 304      t 304
                |
Sbjct: 39684785 t 39684785



 Score =  113 bits (57), Expect = 7e-22
 Identities = 108/125 (86%)
 Strand = Plus / Minus

                                                                            
Query: 471      gttgaaatcgtcattgcaacaccaggtcggttgattgatatgctggaagctggtcacaca 530
                ||||| || |||||||||||||| ||||||||||| ||||||||||||| ||||||||| 
Sbjct: 39684463 gttgagattgtcattgcaacacctggtcggttgatcgatatgctggaaggtggtcacact 39684404

                                                                            
Query: 531      aacctacgtcgggttacataccttgtgctggatgaggcagaccgtatgctcgatatgggt 590
                ||||| ||  | || |||||||| || ||||||||||| ||||| ||||| || ||||||
Sbjct: 39684403 aacctgcgaagagtaacatacctcgtcctggatgaggctgaccgcatgcttgacatgggt 39684344

                     
Query: 591      tttga 595
                |||||
Sbjct: 39684343 tttga 39684339



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                    
Query: 561     gatgaggcagaccgtatgctcgatatgggttttgaac 597
               |||||||||||||| ||||| |||||||| |||||||
Sbjct: 5248026 gatgaggcagaccggatgctggatatgggctttgaac 5247990



 Score = 48.1 bits (24), Expect = 0.033
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                           
Query: 552     cttgtgctggatgaggcagaccgtatgctcgatatgggttttga 595
               ||||| || |||||||| ||||| ||||| ||||||||||||||
Sbjct: 3715154 cttgttcttgatgaggctgaccgcatgcttgatatgggttttga 3715111



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 1        ccccgccgtgcaggccatgtc 21
                |||||||||||||||||||||
Sbjct: 39685200 ccccgccgtgcaggccatgtc 39685180



to top

>dbj|AP003416.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0456E05
          Length = 173699

 Score =  206 bits (104), Expect = 6e-50
 Identities = 149/164 (90%)
 Strand = Plus / Minus

                                                                          
Query: 306    gaacaaggtgatggcccaattgtcttgatccttgctccaacaagagaactggctgttcaa 365
              |||||||||||||||||||||||  ||||||||||||| |||||||||||||||||||||
Sbjct: 165659 gaacaaggtgatggcccaattgttctgatccttgctcctacaagagaactggctgttcaa 165600

                                                                          
Query: 366    atacaggcagaagctacaaagtttggatcatactcgagaactagaagcacatgtatctac 425
              |||||   |||| ||   || |||||||||||||| |||||||||||||| |||||||| 
Sbjct: 165599 atacaacaagaatctggcaaatttggatcatactcaagaactagaagcacttgtatctat 165540

                                                          
Query: 426    ggtggagcacctaagggaccacaaatacgtgacctcaggagagg 469
              ||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 165539 ggtggagcacctaagggaccacaaatacgtgaccttaggagagg 165496



 Score =  155 bits (78), Expect = 2e-34
 Identities = 155/181 (85%)
 Strand = Plus / Minus

                                                                          
Query: 124    cagattactgcatgcaagcgatcgccaagtccggntttgtggagccaacgcctatccaag 183
              |||||||||| |||||||| || ||||||   || || || ||||| |||||||| ||  
Sbjct: 165921 cagattactgtatgcaagcaatagccaagagtggattcgtagagcccacgcctattcagt 165862

                                                                          
Query: 184    ctcagggttggccgatggctttgaagggcagggacgtgattggtattgcagaaactggat 243
              | || |||||||| ||||||||||||||||||||| |||| ||||| ||| ||||||| |
Sbjct: 165861 cacaaggttggccaatggctttgaagggcagggacatgatcggtatcgcacaaactggct 165802

                                                                          
Query: 244    ctgggaaaacactatcttacatactacctggtttggttcatgttggtgcacaacctcgac 303
              |||||||||||||||||||| | || ||||| |||||||||||||||||||| |||||||
Sbjct: 165801 ctgggaaaacactatcttaccttctccctgggttggttcatgttggtgcacagcctcgac 165742

               
Query: 304    t 304
              |
Sbjct: 165741 t 165741



 Score =  113 bits (57), Expect = 7e-22
 Identities = 108/125 (86%)
 Strand = Plus / Minus

                                                                          
Query: 471    gttgaaatcgtcattgcaacaccaggtcggttgattgatatgctggaagctggtcacaca 530
              ||||| || |||||||||||||| ||||||||||| ||||||||||||| ||||||||| 
Sbjct: 165419 gttgagattgtcattgcaacacctggtcggttgatcgatatgctggaaggtggtcacact 165360

                                                                          
Query: 531    aacctacgtcgggttacataccttgtgctggatgaggcagaccgtatgctcgatatgggt 590
              ||||| ||  | || |||||||| || ||||||||||| ||||| ||||| || ||||||
Sbjct: 165359 aacctgcgaagagtaacatacctcgtcctggatgaggctgaccgcatgcttgacatgggt 165300

                   
Query: 591    tttga 595
              |||||
Sbjct: 165299 tttga 165295



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 1      ccccgccgtgcaggccatgtc 21
              |||||||||||||||||||||
Sbjct: 166156 ccccgccgtgcaggccatgtc 166136



to top

>dbj|AP003436.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0470A12
          Length = 185095

 Score =  206 bits (104), Expect = 6e-50
 Identities = 149/164 (90%)
 Strand = Plus / Minus

                                                                         
Query: 306   gaacaaggtgatggcccaattgtcttgatccttgctccaacaagagaactggctgttcaa 365
             |||||||||||||||||||||||  ||||||||||||| |||||||||||||||||||||
Sbjct: 35602 gaacaaggtgatggcccaattgttctgatccttgctcctacaagagaactggctgttcaa 35543

                                                                         
Query: 366   atacaggcagaagctacaaagtttggatcatactcgagaactagaagcacatgtatctac 425
             |||||   |||| ||   || |||||||||||||| |||||||||||||| |||||||| 
Sbjct: 35542 atacaacaagaatctggcaaatttggatcatactcaagaactagaagcacttgtatctat 35483

                                                         
Query: 426   ggtggagcacctaagggaccacaaatacgtgacctcaggagagg 469
             ||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 35482 ggtggagcacctaagggaccacaaatacgtgaccttaggagagg 35439



 Score =  155 bits (78), Expect = 2e-34
 Identities = 155/181 (85%)
 Strand = Plus / Minus

                                                                         
Query: 124   cagattactgcatgcaagcgatcgccaagtccggntttgtggagccaacgcctatccaag 183
             |||||||||| |||||||| || ||||||   || || || ||||| |||||||| ||  
Sbjct: 35864 cagattactgtatgcaagcaatagccaagagtggattcgtagagcccacgcctattcagt 35805

                                                                         
Query: 184   ctcagggttggccgatggctttgaagggcagggacgtgattggtattgcagaaactggat 243
             | || |||||||| ||||||||||||||||||||| |||| ||||| ||| ||||||| |
Sbjct: 35804 cacaaggttggccaatggctttgaagggcagggacatgatcggtatcgcacaaactggct 35745

                                                                         
Query: 244   ctgggaaaacactatcttacatactacctggtttggttcatgttggtgcacaacctcgac 303
             |||||||||||||||||||| | || ||||| |||||||||||||||||||| |||||||
Sbjct: 35744 ctgggaaaacactatcttaccttctccctgggttggttcatgttggtgcacagcctcgac 35685

              
Query: 304   t 304
             |
Sbjct: 35684 t 35684



 Score =  113 bits (57), Expect = 7e-22
 Identities = 108/125 (86%)
 Strand = Plus / Minus

                                                                         
Query: 471   gttgaaatcgtcattgcaacaccaggtcggttgattgatatgctggaagctggtcacaca 530
             ||||| || |||||||||||||| ||||||||||| ||||||||||||| ||||||||| 
Sbjct: 35362 gttgagattgtcattgcaacacctggtcggttgatcgatatgctggaaggtggtcacact 35303

                                                                         
Query: 531   aacctacgtcgggttacataccttgtgctggatgaggcagaccgtatgctcgatatgggt 590
             ||||| ||  | || |||||||| || ||||||||||| ||||| ||||| || ||||||
Sbjct: 35302 aacctgcgaagagtaacatacctcgtcctggatgaggctgaccgcatgcttgacatgggt 35243

                  
Query: 591   tttga 595
             |||||
Sbjct: 35242 tttga 35238



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1     ccccgccgtgcaggccatgtc 21
             |||||||||||||||||||||
Sbjct: 36099 ccccgccgtgcaggccatgtc 36079



to top

>ref|NM_125706.2| Arabidopsis thaliana ATP binding / ATP-dependent helicase/
           helicase/ nucleic acid binding AT5G63120 transcript
           variant AT5G63120.1 mRNA, complete cds
          Length = 2372

 Score =  103 bits (52), Expect = 7e-19
 Identities = 163/200 (81%)
 Strand = Plus / Plus

                                                                       
Query: 165 gagccaacgcctatccaagctcagggttggccgatggctttgaagggcagggacgtgatt 224
           |||||||| ||||| ||||||||||| ||||||||||| |||||||| |||||  |||||
Sbjct: 753 gagccaacacctatacaagctcagggatggccgatggcgttgaagggtagggatttgatt 812

                                                                       
Query: 225 ggtattgcagaaactggatctgggaaaacactatcttacatactacctggtttggttcat 284
           |||||||| || ||||| ||||| || ||| |  ||||| |  |||| |  |||||||| 
Sbjct: 813 ggtattgctgagactggctctggtaagacattggcttacttgttaccagcattggttcac 872

                                                                       
Query: 285 gttggtgcacaacctcgactcgaacaaggtgatggcccaattgtcttgatccttgctcca 344
           ||| |||||||||||||| | |  || | ||||||||| ||||| || ||  | ||||| 
Sbjct: 873 gttagtgcacaacctcgattaggtcaggatgatggccccattgtgttaatattagctccc 932

                               
Query: 345 acaagagaactggctgttca 364
           ||||||||||| ||||||||
Sbjct: 933 acaagagaactagctgttca 952



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 92/112 (82%)
 Strand = Plus / Plus

                                                                        
Query: 407  tagaagcacatgtatctacggtggagcacctaagggaccacaaatacgtgacctcaggag 466
            |||||| || |||||||| ||||| || ||||| ||||| || || ||||| || || ||
Sbjct: 995  tagaagtacttgtatctatggtggtgctcctaaaggacctcagattcgtgatcttagaag 1054

                                                                
Query: 467  aggagttgaaatcgtcattgcaacaccaggtcggttgattgatatgctggaa 518
            ||| ||||| || || ||||| ||||| ||||| |||||||||||| |||||
Sbjct: 1055 aggtgttgagattgtaattgctacacctggtcgtttgattgatatgttggaa 1106



to top

>ref|NM_203256.1| Arabidopsis thaliana ATP binding / ATP-dependent helicase/
           helicase/ nucleic acid binding AT5G63120 transcript
           variant AT5G63120.2 mRNA, complete cds
          Length = 2185

 Score =  103 bits (52), Expect = 7e-19
 Identities = 163/200 (81%)
 Strand = Plus / Plus

                                                                       
Query: 165 gagccaacgcctatccaagctcagggttggccgatggctttgaagggcagggacgtgatt 224
           |||||||| ||||| ||||||||||| ||||||||||| |||||||| |||||  |||||
Sbjct: 753 gagccaacacctatacaagctcagggatggccgatggcgttgaagggtagggatttgatt 812

                                                                       
Query: 225 ggtattgcagaaactggatctgggaaaacactatcttacatactacctggtttggttcat 284
           |||||||| || ||||| ||||| || ||| |  ||||| |  |||| |  |||||||| 
Sbjct: 813 ggtattgctgagactggctctggtaagacattggcttacttgttaccagcattggttcac 872

                                                                       
Query: 285 gttggtgcacaacctcgactcgaacaaggtgatggcccaattgtcttgatccttgctcca 344
           ||| |||||||||||||| | |  || | ||||||||| ||||| || ||  | ||||| 
Sbjct: 873 gttagtgcacaacctcgattaggtcaggatgatggccccattgtgttaatattagctccc 932

                               
Query: 345 acaagagaactggctgttca 364
           ||||||||||| ||||||||
Sbjct: 933 acaagagaactagctgttca 952



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 92/112 (82%)
 Strand = Plus / Plus

                                                                        
Query: 407  tagaagcacatgtatctacggtggagcacctaagggaccacaaatacgtgacctcaggag 466
            |||||| || |||||||| ||||| || ||||| ||||| || || ||||| || || ||
Sbjct: 995  tagaagtacttgtatctatggtggtgctcctaaaggacctcagattcgtgatcttagaag 1054

                                                                
Query: 467  aggagttgaaatcgtcattgcaacaccaggtcggttgattgatatgctggaa 518
            ||| ||||| || || ||||| ||||| ||||| |||||||||||| |||||
Sbjct: 1055 aggtgttgagattgtaattgctacacctggtcgtttgattgatatgttggaa 1106



to top

>gb|BT000610.1| Arabidopsis thaliana AtP-dependent RNA helicase-like protein
           (At5g63120/MDC12_8) mRNA, complete cds
          Length = 1455

 Score =  103 bits (52), Expect = 7e-19
 Identities = 163/200 (81%)
 Strand = Plus / Plus

                                                                       
Query: 165 gagccaacgcctatccaagctcagggttggccgatggctttgaagggcagggacgtgatt 224
           |||||||| ||||| ||||||||||| ||||||||||| |||||||| |||||  |||||
Sbjct: 559 gagccaacacctatacaagctcagggatggccgatggcgttgaagggtagggatttgatt 618

                                                                       
Query: 225 ggtattgcagaaactggatctgggaaaacactatcttacatactacctggtttggttcat 284
           |||||||| || ||||| ||||| || ||| |  ||||| |  |||| |  |||||||| 
Sbjct: 619 ggtattgctgagactggctctggtaagacattggcttacttgttaccagcattggttcac 678

                                                                       
Query: 285 gttggtgcacaacctcgactcgaacaaggtgatggcccaattgtcttgatccttgctcca 344
           ||| |||||||||||||| | |  || | ||||||||| ||||| || ||  | ||||| 
Sbjct: 679 gttagtgcacaacctcgattaggtcaggatgatggccccattgtgttaatattagctccc 738

                               
Query: 345 acaagagaactggctgttca 364
           ||||||||||| ||||||||
Sbjct: 739 acaagagaactagctgttca 758



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 92/112 (82%)
 Strand = Plus / Plus

                                                                       
Query: 407 tagaagcacatgtatctacggtggagcacctaagggaccacaaatacgtgacctcaggag 466
           |||||| || |||||||| ||||| || ||||| ||||| || || ||||| || || ||
Sbjct: 801 tagaagtacttgtatctatggtggtgctcctaaaggacctcagattcgtgatcttagaag 860

                                                               
Query: 467 aggagttgaaatcgtcattgcaacaccaggtcggttgattgatatgctggaa 518
           ||| ||||| || || ||||| ||||| ||||| |||||||||||| |||||
Sbjct: 861 aggtgttgagattgtaattgctacacctggtcgtttgattgatatgttggaa 912



to top

>gb|AY060589.1| Arabidopsis thaliana AT5g63120/MDC12_8 mRNA, complete cds
          Length = 2366

 Score =  103 bits (52), Expect = 7e-19
 Identities = 163/200 (81%)
 Strand = Plus / Plus

                                                                       
Query: 165 gagccaacgcctatccaagctcagggttggccgatggctttgaagggcagggacgtgatt 224
           |||||||| ||||| ||||||||||| ||||||||||| |||||||| |||||  |||||
Sbjct: 754 gagccaacacctatacaagctcagggatggccgatggcgttgaagggtagggatttgatt 813

                                                                       
Query: 225 ggtattgcagaaactggatctgggaaaacactatcttacatactacctggtttggttcat 284
           |||||||| || ||||| ||||| || ||| |  ||||| |  |||| |  |||||||| 
Sbjct: 814 ggtattgctgagactggctctggtaagacattggcttacttgttaccagcattggttcac 873

                                                                       
Query: 285 gttggtgcacaacctcgactcgaacaaggtgatggcccaattgtcttgatccttgctcca 344
           ||| |||||||||||||| | |  || | ||||||||| ||||| || ||  | ||||| 
Sbjct: 874 gttagtgcacaacctcgattaggtcaggatgatggccccattgtgttaatattagctccc 933

                               
Query: 345 acaagagaactggctgttca 364
           ||||||||||| ||||||||
Sbjct: 934 acaagagaactagctgttca 953



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 92/112 (82%)
 Strand = Plus / Plus

                                                                        
Query: 407  tagaagcacatgtatctacggtggagcacctaagggaccacaaatacgtgacctcaggag 466
            |||||| || |||||||| ||||| || ||||| ||||| || || ||||| || || ||
Sbjct: 996  tagaagtacttgtatctatggtggtgctcctaaaggacctcagattcgtgatcttagaag 1055

                                                                
Query: 467  aggagttgaaatcgtcattgcaacaccaggtcggttgattgatatgctggaa 518
            ||| ||||| || || ||||| ||||| ||||| |||||||||||| |||||
Sbjct: 1056 aggtgttgagattgtaattgctacacctggtcgtttgattgatatgttggaa 1107



to top

>emb|BX832051.1|CNS09YVO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH48ZH12 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 2119

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 115/138 (83%)
 Strand = Plus / Plus

                                                                       
Query: 165 gagccaacgcctatccaagctcagggttggccgatggctttgaagggcagggacgtgatt 224
           |||||||| ||||| ||||||||||| ||||||||||| |||||||| |||||  |||||
Sbjct: 742 gagccaacacctatacaagctcagggatggccgatggcgttgaagggtagggatttgatt 801

                                                                       
Query: 225 ggtattgcagaaactggatctgggaaaacactatcttacatactacctggtttggttcat 284
           |||||||| || ||||| ||||| || ||| |  ||||| |  |||| |  |||||||| 
Sbjct: 802 ggtattgctgagactggctctggtaagacattggcttacttgttaccagcattggttcac 861

                             
Query: 285 gttggtgcacaacctcga 302
           ||| ||||||||||||||
Sbjct: 862 gttagtgcacaacctcga 879



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                  
Query: 465  agaggagttgaaatcgtcattgcaacaccaggtcggttgattgatatgctggaa 518
            ||||| ||||| || || ||||| ||||| ||||| |||||||||||| |||||
Sbjct: 1041 agaggtgttgagattgtaattgctacacctggtcgtttgattgatatgttggaa 1094



to top

>dbj|AB008265.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MDC12
          Length = 81662

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 115/138 (83%)
 Strand = Plus / Minus

                                                                         
Query: 165   gagccaacgcctatccaagctcagggttggccgatggctttgaagggcagggacgtgatt 224
             |||||||| ||||| ||||||||||| ||||||||||| |||||||| |||||  |||||
Sbjct: 29983 gagccaacacctatacaagctcagggatggccgatggcgttgaagggtagggatttgatt 29924

                                                                         
Query: 225   ggtattgcagaaactggatctgggaaaacactatcttacatactacctggtttggttcat 284
             |||||||| || ||||| ||||| || ||| |  ||||| |  |||| |  |||||||| 
Sbjct: 29923 ggtattgctgagactggctctggtaagacattggcttacttgttaccagcattggttcac 29864

                               
Query: 285   gttggtgcacaacctcga 302
             ||| ||||||||||||||
Sbjct: 29863 gttagtgcacaacctcga 29846



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                 
Query: 483   attgcaacaccaggtcggttgattgatatgctggaa 518
             ||||| ||||| ||||| |||||||||||| |||||
Sbjct: 29490 attgctacacctggtcgtttgattgatatgttggaa 29455



to top

>ref|NM_004396.2| Homo sapiens DEAD (Asp-Glu-Ala-Asp) box polypeptide 5 (DDX5), mRNA
          Length = 2325

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 417 tgtatctacggtggagcacctaagggaccacaaatacgtga 457
           |||||||||||||| || |||||||||||||||||||||||
Sbjct: 768 tgtatctacggtggtgctcctaagggaccacaaatacgtga 808



to top

>ref|XM_512004.1| PREDICTED: Pan troglodytes DEAD (Asp-Glu-Ala-Asp) box polypeptide 5
           (LOC455267), mRNA
          Length = 1462

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 417 tgtatctacggtggagcacctaagggaccacaaatacgtga 457
           |||||||||||||| || |||||||||||||||||||||||
Sbjct: 743 tgtatctacggtggtgctcctaagggaccacaaatacgtga 783



to top

>gb|BC016027.1| Homo sapiens DEAD (Asp-Glu-Ala-Asp) box polypeptide 5, mRNA (cDNA
           clone MGC:1516 IMAGE:3528578), complete cds
          Length = 2366

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 417 tgtatctacggtggagcacctaagggaccacaaatacgtga 457
           |||||||||||||| || |||||||||||||||||||||||
Sbjct: 739 tgtatctacggtggtgctcctaagggaccacaaatacgtga 779



to top

>ref|XM_448941.1| Candida glabrata CBS138, CAGL0L03846 partial mRNA
          Length = 1635

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 51/57 (89%)
 Strand = Plus / Plus

                                                                    
Query: 311 aggtgatggcccaattgtcttgatccttgctccaacaagagaactggctgttcaaat 367
           ||||||||| |||||||||||| | || |||||||| |||||||| |||||||||||
Sbjct: 540 aggtgatggtccaattgtcttggttctagctccaaccagagaacttgctgttcaaat 596



 Score = 48.1 bits (24), Expect = 0.033
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                           
Query: 473 tgaaatcgtcattgcaacaccaggtcggttgattgatatgctggaagc 520
           |||||| |||||||| || |||||| | |||||||||||||| |||||
Sbjct: 702 tgaaattgtcattgctaccccaggtagattgattgatatgcttgaagc 749



to top

>emb|X52104.1|HSP68A Human mRNA for p68 protein
          Length = 2330

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 417 tgtatctacggtggagcacctaagggaccacaaatacgtga 457
           |||||||||||||| || |||||||||||||||||||||||
Sbjct: 773 tgtatctacggtggtgctcctaagggaccacaaatacgtga 813



to top

>emb|X15729.1|HSNP68M Human mRNA for nuclear p68 protein
          Length = 2323

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 417 tgtatctacggtggagcacctaagggaccacaaatacgtga 457
           |||||||||||||| || |||||||||||||||||||||||
Sbjct: 765 tgtatctacggtggtgctcctaagggaccacaaatacgtga 805



to top

>emb|CR380958.1| Candida glabrata strain CBS138 chromosome L complete sequence
          Length = 1440588

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 51/57 (89%)
 Strand = Plus / Minus

                                                                       
Query: 311    aggtgatggcccaattgtcttgatccttgctccaacaagagaactggctgttcaaat 367
              ||||||||| |||||||||||| | || |||||||| |||||||| |||||||||||
Sbjct: 443875 aggtgatggtccaattgtcttggttctagctccaaccagagaacttgctgttcaaat 443819



 Score = 48.1 bits (24), Expect = 0.033
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                              
Query: 473    tgaaatcgtcattgcaacaccaggtcggttgattgatatgctggaagc 520
              |||||| |||||||| || |||||| | |||||||||||||| |||||
Sbjct: 443713 tgaaattgtcattgctaccccaggtagattgattgatatgcttgaagc 443666



to top

>emb|BX571764.1|HSM806634 Homo sapiens mRNA; cDNA DKFZp686J01190 (from clone DKFZp686J01190)
          Length = 3572

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 417 tgtatctacggtggagcacctaagggaccacaaatacgtga 457
           |||||||||||||| || |||||||||||||||||||||||
Sbjct: 769 tgtatctacggtggtgctcctaagggaccacaaatacgtga 809



to top

>gb|BT007642.1| Synthetic construct Homo sapiens DEAD/H (Asp-Glu-Ala-Asp/His) box
           polypeptide 5 (RNA helicase, 68kDa) mRNA, partial cds
          Length = 1845

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 417 tgtatctacggtggagcacctaagggaccacaaatacgtga 457
           |||||||||||||| || |||||||||||||||||||||||
Sbjct: 598 tgtatctacggtggtgctcctaagggaccacaaatacgtga 638



to top

>gb|BT006943.1| Homo sapiens DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 5 (RNA
           helicase, 68kDa) mRNA, complete cds
          Length = 1845

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 417 tgtatctacggtggagcacctaagggaccacaaatacgtga 457
           |||||||||||||| || |||||||||||||||||||||||
Sbjct: 598 tgtatctacggtggtgctcctaagggaccacaaatacgtga 638



to top

>emb|CR607012.1| full-length cDNA clone CS0DA009YD21 of Neuroblastoma of Homo
           sapiens (human)
          Length = 1800

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 417 tgtatctacggtggagcacctaagggaccacaaatacgtga 457
           |||||||||||||| || |||||||||||||||||||||||
Sbjct: 265 tgtatctacggtggtgctcctaagggaccacaaatacgtga 305



to top

>gb|AF479823.1| Pantodon buchholzi DEAD box RNA helicase Vasa mRNA, complete cds
          Length = 1512

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 45/49 (91%)
 Strand = Plus / Plus

                                                            
Query: 549 taccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaac 597
           |||||||| ||||||||||||||||| ||| | ||||||||||||||||
Sbjct: 340 taccttgtactggatgaggcagaccgcatgttggatatgggttttgaac 388



to top

>gb|AC138744.4| Homo sapiens chromosome 17, clone RP11-859E19, complete sequence
          Length = 177325

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                       
Query: 417    tgtatctacggtggagcacctaagggaccacaaatacgtga 457
              |||||||||||||| || |||||||||||||||||||||||
Sbjct: 169364 tgtatctacggtggtgctcctaagggaccacaaatacgtga 169324



to top

>gb|AY892740.1| Synthetic construct Homo sapiens clone FLH024742.01L DEAD box
           polypeptide 5 (DDX5) mRNA, partial cds
          Length = 1845

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 417 tgtatctacggtggagcacctaagggaccacaaatacgtga 457
           |||||||||||||| || |||||||||||||||||||||||
Sbjct: 598 tgtatctacggtggtgctcctaagggaccacaaatacgtga 638



to top

>gb|AY890256.1| Synthetic construct Homo sapiens clone FLH024746.01X DEAD box
           polypeptide 5 (DDX5) mRNA, complete cds
          Length = 1845

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 417 tgtatctacggtggagcacctaagggaccacaaatacgtga 457
           |||||||||||||| || |||||||||||||||||||||||
Sbjct: 598 tgtatctacggtggtgctcctaagggaccacaaatacgtga 638



to top

>gb|AY890255.1| Synthetic construct Homo sapiens clone FLH024745.01X DEAD box
           polypeptide 5 (DDX5) mRNA, complete cds
          Length = 1845

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 417 tgtatctacggtggagcacctaagggaccacaaatacgtga 457
           |||||||||||||| || |||||||||||||||||||||||
Sbjct: 598 tgtatctacggtggtgctcctaagggaccacaaatacgtga 638



to top

>gb|AF015812.1|AF015812 Homo sapiens RNA helicase p68 (HUMP68) gene, complete cds
          Length = 7834

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                     
Query: 417  tgtatctacggtggagcacctaagggaccacaaatacgtga 457
            |||||||||||||| || |||||||||||||||||||||||
Sbjct: 3767 tgtatctacggtggtgctcctaagggaccacaaatacgtga 3807



to top

>dbj|AB209919.1| Homo sapiens mRNA for Hypothetical protein DKFZp686J01190 variant
           protein
          Length = 3539

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 417 tgtatctacggtggagcacctaagggaccacaaatacgtga 457
           |||||||||||||| || |||||||||||||||||||||||
Sbjct: 752 tgtatctacggtggtgctcctaagggaccacaaatacgtga 792



to top

>gb|AC009994.10| Homo sapiens chromosome 17, clone RP11-87N3, complete sequence
          Length = 188552

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                       
Query: 417    tgtatctacggtggagcacctaagggaccacaaatacgtga 457
              |||||||||||||| || |||||||||||||||||||||||
Sbjct: 149714 tgtatctacggtggtgctcctaagggaccacaaatacgtga 149754



to top

>emb|AJ010476.1|ATH010476 Arabidopsis thaliana mRNA for DEAD box RNA helicase, RH30
          Length = 790

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 92/112 (82%)
 Strand = Plus / Plus

                                                                       
Query: 407 tagaagcacatgtatctacggtggagcacctaagggaccacaaatacgtgacctcaggag 466
           |||||| || |||||||| ||||| || ||||| ||||| || || ||||| || || ||
Sbjct: 34  tagaagtacttgtatctatggtggtgctcctaaaggacctcagattcgtgatcttagaag 93

                                                               
Query: 467 aggagttgaaatcgtcattgcaacaccaggtcggttgattgatatgctggaa 518
           ||| ||||| || || ||||| ||||| ||||| |||||||||||| |||||
Sbjct: 94  aggtgttgagattgtaattgctacacctggtcgtttgattgatatgttggaa 145



to top

>gb|AC145395.3| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone
             OSJNBa0047M04, complete sequence
          Length = 109523

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                         
Query: 552   cttgtgctggatgaggcagaccgtatgctcgatatgggttttga 595
             |||||||| |||||||| ||||||||||| ||||||||||||||
Sbjct: 77215 cttgtgcttgatgaggctgaccgtatgcttgatatgggttttga 77258



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                            
Query: 552      cttgtgctggatgaggcagaccgtatgctcgatatgggttttga 595
                |||||||| |||||||| ||||||||||| ||||||||||||||
Sbjct: 27126162 cttgtgcttgatgaggctgaccgtatgcttgatatgggttttga 27126205



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                     
Query: 561      gatgaggcagaccgtatgctcgatatgggttttgaac 597
                |||||||||||  | ||||| ||||||||||||||||
Sbjct: 22097173 gatgaggcagatagaatgcttgatatgggttttgaac 22097209



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                            
Query: 552      cttgtgctggatgaggcagaccgtatgctcgatatgggttttga 595
                |||||||| |||||||| ||||||||||| ||||||||||||||
Sbjct: 27453215 cttgtgcttgatgaggctgaccgtatgcttgatatgggttttga 27453258



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                     
Query: 561      gatgaggcagaccgtatgctcgatatgggttttgaac 597
                |||||||||||  | ||||| ||||||||||||||||
Sbjct: 22407120 gatgaggcagatagaatgcttgatatgggttttgaac 22407156



to top

>gb|BT012961.1| Lycopersicon esculentum clone 114151R, mRNA sequence
          Length = 1763

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 103/127 (81%)
 Strand = Plus / Plus

                                                                       
Query: 471 gttgaaatcgtcattgcaacaccaggtcggttgattgatatgctggaagctggtcacaca 530
           |||||||| || ||||| ||||| ||  |||||||||||||| | ||| ||  ||| |||
Sbjct: 701 gttgaaattgttattgccacacctggaaggttgattgatatgttagaatctaatcataca 760

                                                                       
Query: 531 aacctacgtcgggttacataccttgtgctggatgaggcagaccgtatgctcgatatgggt 590
           || || ||  | || ||||| || |||||||||||||| ||||| ||||| || ||||||
Sbjct: 761 aatcttcgaagagtgacatatctcgtgctggatgaggctgaccgcatgctagacatgggt 820

                  
Query: 591 tttgaac 597
           |||||||
Sbjct: 821 tttgaac 827



to top

>emb|CR861259.1| Pongo pygmaeus mRNA; cDNA DKFZp459M043 (from clone DKFZp459M043)
          Length = 3724

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 417 tgtatctacggtggagcacctaagggaccacaaatacgtga 457
           |||||||| ||||| || |||||||||||||||||||||||
Sbjct: 768 tgtatctatggtggtgctcctaagggaccacaaatacgtga 808



to top

>ref|XM_658443.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN5931.2), mRNA
          Length = 1692

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Plus

                                                                       
Query: 504 attgatatgctggaagctggtcacacaaacctacgtcgggttacataccttgtgctggat 563
           ||||||||||| |||||||| | ||| ||||| || || ||||| ||||| || || || 
Sbjct: 823 attgatatgctcgaagctggccgcaccaaccttcgccgagttacttacctcgttcttgac 882

                                           
Query: 564 gaggcagaccgtatgctcgatatgggttttga 595
           ||||| ||||| ||| | ||||||||||||||
Sbjct: 883 gaggccgaccgcatgttggatatgggttttga 914



to top

>ref|XM_502093.1| Yarrowia lipolytica CLIB122, YALI0C21472g predicted mRNA
          Length = 1857

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                        
Query: 549  taccttgtgctggatgaggcagaccgtatgctcgatatgggttt 592
            |||||||| || |||||||| ||||| |||||||||||||||||
Sbjct: 961  taccttgtccttgatgaggccgaccgaatgctcgatatgggttt 1004



to top

>emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB122 of Yarrowia lipolytica
          Length = 3272609

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                           
Query: 549     taccttgtgctggatgaggcagaccgtatgctcgatatgggttt 592
               |||||||| || |||||||| ||||| |||||||||||||||||
Sbjct: 2869924 taccttgtccttgatgaggccgaccgaatgctcgatatgggttt 2869881



to top

>gb|CP000103.1| Nitrosospira multiformis ATCC 25196, complete genome
          Length = 3184243

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                   
Query: 558     ctggatgaggcagaccgtatgctcgatatgggtttt 593
               ||||||||||||||||| |||||||| |||||||||
Sbjct: 3049759 ctggatgaggcagaccggatgctcgacatgggtttt 3049724



to top

>gb|BT016697.1| Zea mays clone Contig530 mRNA sequence
          Length = 1750

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 78/95 (82%)
 Strand = Plus / Plus

                                                                       
Query: 159 tttgtggagccaacgcctatccaagctcagggttggccgatggctttgaagggcagggac 218
           |||||||| || || ||||||||| | || |||||||||||||| ||||  ||| | |||
Sbjct: 253 tttgtggaacctacccctatccaatcgcaaggttggccgatggcattgagaggccgcgac 312

                                              
Query: 219 gtgattggtattgcagaaactggatctgggaaaac 253
            | ||||| |||||||| || ||||| ||||||||
Sbjct: 313 cttattggcattgcagagacaggatcagggaaaac 347



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 63/77 (81%)
 Strand = Plus / Plus

                                                                       
Query: 315 gatggcccaattgtcttgatccttgctccaacaagagaactggctgttcaaatacaggca 374
           ||||| |||||||||||| |  | ||||| ||| | ||||| |||||||| ||||||  |
Sbjct: 409 gatggtccaattgtcttggtgttagctcctacacgtgaacttgctgttcagatacagcaa 468

                            
Query: 375 gaagctacaaagtttgg 391
           ||||| || ||||||||
Sbjct: 469 gaagcaaccaagtttgg 485



to top

>gb|AY587260.1| Sparus aurata vasa-like protein mRNA, partial cds
          Length = 594

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 553 ttgtgctggatgaggcagaccgtatgctcgatatgggttttga 595
           |||||||||||||||| ||||| ||| | ||||||||||||||
Sbjct: 371 ttgtgctggatgaggctgaccggatgttggatatgggttttga 413



to top

>gb|AF520608.1| Sparus aurata vasa-like mRNA, partial cds
          Length = 1586

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 553 ttgtgctggatgaggcagaccgtatgctcgatatgggttttga 595
           |||||||||||||||| ||||| ||| | ||||||||||||||
Sbjct: 344 ttgtgctggatgaggctgaccggatgttggatatgggttttga 386



to top

>emb|X52648.1|SPP68 Schizosaccharomyces pombe p68 gene for p68 protein
          Length = 2742

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                       
Query: 555  gtgctggatgaggcagaccgtatgctcgatatgggttttgaac 597
            ||||||||||| || ||||| ||||| ||||||||||||||||
Sbjct: 1102 gtgctggatgaagccgaccgaatgcttgatatgggttttgaac 1144



to top

>emb|AL032684.1|SPBP8B7 S.pombe chromosome II p1 p8B7
          Length = 71000

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                        
Query: 555   gtgctggatgaggcagaccgtatgctcgatatgggttttgaac 597
             ||||||||||| || ||||| ||||| ||||||||||||||||
Sbjct: 31858 gtgctggatgaagccgaccgaatgcttgatatgggttttgaac 31816



to top

>gb|DQ399799.1| Acanthopagrus schlegelii vasa protein mRNA, partial cds
          Length = 780

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 553 ttgtgctggatgaggcagaccgtatgctcgatatgggttttga 595
           |||||||||||||||| ||||| ||| | ||||||||||||||
Sbjct: 200 ttgtgctggatgaggctgaccggatgttggatatgggttttga 242



to top

>ref|NM_001022444.1| Schizosaccharomyces pombe 972h- hypothetical protein (SPBP8B7.16c),
           partial mRNA
          Length = 1653

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 555 gtgctggatgaggcagaccgtatgctcgatatgggttttgaac 597
           ||||||||||| || ||||| ||||| ||||||||||||||||
Sbjct: 820 gtgctggatgaagccgaccgaatgcttgatatgggttttgaac 862



to top

>dbj|AK068197.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013140N02, full
           insert sequence
          Length = 4012

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 63/75 (84%)
 Strand = Plus / Plus

                                                                       
Query: 521 tggtcacacaaacctacgtcgggttacataccttgtgctggatgaggcagaccgtatgct 580
           ||||||||| ||||| ||  | || |||||||| || ||||||||||| ||||| |||||
Sbjct: 2   tggtcacactaacctgcgaagagtaacatacctcgtcctggatgaggctgaccgcatgct 61

                          
Query: 581 cgatatgggttttga 595
            || |||||||||||
Sbjct: 62  tgacatgggttttga 76



to top

>gb|AF096248.1|AF096248 Lycopersicon esculentum ethylene-responsive RNA helicase (ER68)
           mRNA, complete cds
          Length = 1752

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 555 gtgctggatgaggcagaccgtatgctcgatatgggttttgaac 597
           |||||||||||||| ||||| ||||| || |||||||||||||
Sbjct: 824 gtgctggatgaggctgaccgcatgctagacatgggttttgaac 866



to top

>dbj|AP006094.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT39H01, TM0172,
              complete sequence
          Length = 127731

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                          
Query: 159    tttgtggagccaacgcctatccaagctcagggttggccgatggctttgaagggcagggac 218
              ||||| ||||| || || ||||| |||||||||||||| |||||| ||| ||| ||||| 
Sbjct: 104909 tttgttgagcccactccaatccaggctcagggttggcccatggctctgacgggtagggat 104850

                                     
Query: 219    gtgattggtattgcagaaactgg 241
               ||||||| ||||| || |||||
Sbjct: 104849 ttgattggcattgctgagactgg 104827



to top

>gb|L11574.1|YSPP68DBP Schizosaccharomyces pombe p68 RNA helicase (dbp2) mRNA, complete
           cds
          Length = 1780

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 555 gtgctggatgaggcagaccgtatgctcgatatgggttttgaac 597
           ||||||||||| || ||||| ||||| ||||||||||||||||
Sbjct: 820 gtgctggatgaagccgaccgaatgcttgatatgggttttgaac 862



to top

>ref|NM_104388.2| Arabidopsis thaliana ATP binding / ATP-dependent helicase/
           helicase/ nucleic acid binding AT1G55150 mRNA, complete
           cds
          Length = 1825

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Plus

                                                                       
Query: 526 acacaaacctacgtcgggttacataccttgtgctggatgaggcagaccgtatgctcgata 585
           |||||||||||||  ||||||| || |||||  |||||||||| || || ||||| ||||
Sbjct: 872 acacaaacctacgaagggttacttatcttgttttggatgaggctgatcgaatgcttgata 931

                     
Query: 586 tgggttttga 595
           |||| |||||
Sbjct: 932 tggggtttga 941



to top

>ref|NM_111523.2| Arabidopsis thaliana ATP binding / ATP-dependent helicase/ helicase/
            nucleic acid binding AT3G06480 mRNA, complete cds
          Length = 3605

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 552  cttgtgctggatgaggcagaccgtatgctcgatatgggttttgaac 597
            |||||||| || ||||||||||| ||||| || |||||||||||||
Sbjct: 1849 cttgtgcttgacgaggcagaccgaatgcttgacatgggttttgaac 1894



to top

>ref|XR_002773.1| PREDICTED: Mus musculus hypothetical protein LOC670055 (LOC670055),
            mRNA
          Length = 2773

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                      
Query: 237  actggatctgggaaaacactatctta 262
            ||||||||||||||||||||||||||
Sbjct: 1070 actggatctgggaaaacactatctta 1095



to top

>gb|AC011623.5|ATAC011623 Arabidopsis thaliana chromosome III BAC F24P17 genomic sequence,
            complete sequence
          Length = 86022

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 552  cttgtgctggatgaggcagaccgtatgctcgatatgggttttgaac 597
            |||||||| || ||||||||||| ||||| || |||||||||||||
Sbjct: 4902 cttgtgcttgacgaggcagaccgaatgcttgacatgggttttgaac 4947



to top

>emb|AL645849.17| Mouse DNA sequence from clone RP23-14F5 on chromosome 11 Contains a
             DEAD box polypeptide 5 (Ddx5) pseudogene, the Gnb2-rs1
             gene for guanine nucleotide binding protein, beta 2
             related sequence 1, the Trim41 gene for tripartite
             motif-containing 41, a novel protein similar to CDK2
             (cyclin-dependent kinase 2)-associated protein 1 (Cdkap1),
             the Trim7 gene for tripartite motif protein 7, the Ifi1
             gene for interferon inducible protein 1, a novel gene
             (LOC277018), two novel genes and four CpG islands,
             complete sequence
          Length = 202559

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                       
Query: 237   actggatctgggaaaacactatctta 262
             ||||||||||||||||||||||||||
Sbjct: 13020 actggatctgggaaaacactatctta 12995



to top

>ref|NM_204708.1| Gallus gallus DEAD (Asp-Glu-Ala-Asp) box polypeptide 4 (DDX4), mRNA
          Length = 1989

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                              
Query: 561  gatgaggcagaccgtatgctcgatatgggttttg 594
            ||||| |||||||| |||||||||||||||||||
Sbjct: 1177 gatgaagcagaccgcatgctcgatatgggttttg 1210



to top

>gb|AY128786.1| Arabidopsis thaliana unknown protein (At1g55150) mRNA, complete cds
          Length = 1539

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Plus

                                                                       
Query: 526 acacaaacctacgtcgggttacataccttgtgctggatgaggcagaccgtatgctcgata 585
           |||||||||||||  ||||||| || |||||  |||||||||| || || ||||| ||||
Sbjct: 722 acacaaacctacgaagggttacttatcttgttttggatgaggctgatcgaatgcttgata 781

                     
Query: 586 tgggttttga 595
           |||| |||||
Sbjct: 782 tggggtttga 791



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                       
Query: 312 ggtgatggcccaattgtcttgatccttgctccaacaagagaactggctgttcaaatacag 371
           ||||| |||||||| |||||| | |||||||| ||  | ||||||||||| || ||||||
Sbjct: 508 ggtgacggcccaatcgtcttggttcttgctcccactcgtgaactggctgtgcagatacag 567



to top

>gb|AY062745.1| Arabidopsis thaliana Unknown protein (At1g55150; T7N22.9) mRNA,
           complete cds
          Length = 1814

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Plus

                                                                       
Query: 526 acacaaacctacgtcgggttacataccttgtgctggatgaggcagaccgtatgctcgata 585
           |||||||||||||  ||||||| || |||||  |||||||||| || || ||||| ||||
Sbjct: 872 acacaaacctacgaagggttacttatcttgttttggatgaggctgatcgaatgcttgata 931

                     
Query: 586 tgggttttga 595
           |||| |||||
Sbjct: 932 tggggtttga 941



to top

>emb|BX813460.1|CNS0AC9L Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB18ZH04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1731

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Plus

                                                                       
Query: 526 acacaaacctacgtcgggttacataccttgtgctggatgaggcagaccgtatgctcgata 585
           |||||||||||||  ||||||| || |||||  |||||||||| || || ||||| ||||
Sbjct: 850 acacaaacctacgaagggttacttatcttgttttggatgaggctgatcgaatgcttgata 909

                     
Query: 586 tgggttttga 595
           |||| |||||
Sbjct: 910 tggggtttga 919



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                       
Query: 312 ggtgatggcccaattgtcttgatccttgctccaacaagagaactggctgttcaaatacag 371
           ||||| |||||||| |||||| | |||||||| ||  | ||||||||||| || ||||||
Sbjct: 636 ggtgacggcccaatcgtcttggttcttgctcccactcgtgaactggctgtgcagatacag 695



to top

>gb|AC073944.6|AC073944 Arabidopsis thaliana chromosome 1 BAC T7N22 genomic sequence, complete
             sequence
          Length = 44540

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Plus

                                                                         
Query: 526   acacaaacctacgtcgggttacataccttgtgctggatgaggcagaccgtatgctcgata 585
             |||||||||||||  ||||||| || |||||  |||||||||| || || ||||| ||||
Sbjct: 35818 acacaaacctacgaagggttacttatcttgttttggatgaggctgatcgaatgcttgata 35877

                       
Query: 586   tgggttttga 595
             |||| |||||
Sbjct: 35878 tggggtttga 35887



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                         
Query: 312   ggtgatggcccaattgtcttgatccttgctccaacaagagaactggctgttcaaatacag 371
             ||||| |||||||| |||||| | |||||||| ||  | ||||||||||| || ||||||
Sbjct: 35499 ggtgacggcccaatcgtcttggttcttgctcccactcgtgaactggctgtgcagatacag 35558



to top

>emb|AJ010936.1|HSA010936 Homo sapiens ddx5-ps1 gene, partial
          Length = 334

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 237 actggatctgggaaaacactatctta 262
           ||||||||||||||||||||||||||
Sbjct: 262 actggatctgggaaaacactatctta 287



to top

>dbj|AB004836.1| Gallus gallus mRNA for Cvh, complete cds
          Length = 1989

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                              
Query: 561  gatgaggcagaccgtatgctcgatatgggttttg 594
            ||||| |||||||| |||||||||||||||||||
Sbjct: 1177 gatgaagcagaccgcatgctcgatatgggttttg 1210



to top

>ref|NM_188251.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1485

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                
Query: 561 gatgaggcagaccgtatgctcgatatgggttttgaac 597
           |||||||||||||| ||||| |||||||| |||||||
Sbjct: 733 gatgaggcagaccggatgctggatatgggctttgaac 769



to top

>emb|CR954247.1| Pseudoalteromonas haloplanktis str. TAC125 chromosome II, complete
              sequence
          Length = 635328

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                           
Query: 561    gatgaggcagaccgtatgctcgatatggg 589
              ||||| |||||||||||||||||||||||
Sbjct: 468000 gatgaagcagaccgtatgctcgatatggg 468028



to top

>ref|XM_855709.1| PREDICTED: Canis familiaris similar to Probable RNA-dependent
            helicase p72 (DEAD-box protein p72) (DEAD-box protein
            17), transcript variant 14 (LOC474508), mRNA
          Length = 4759

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                             
Query: 549  taccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaac 597
            |||||||| ||||||||||| ||| | ||||| |||||||| |||||||
Sbjct: 1058 taccttgtactggatgaggctgacaggatgcttgatatgggctttgaac 1106



to top

>ref|XM_855680.1| PREDICTED: Canis familiaris similar to Probable RNA-dependent
            helicase p72 (DEAD-box protein p72) (DEAD-box protein
            17), transcript variant 13 (LOC474508), mRNA
          Length = 4789

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                             
Query: 549  taccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaac 597
            |||||||| ||||||||||| ||| | ||||| |||||||| |||||||
Sbjct: 980  taccttgtactggatgaggctgacaggatgcttgatatgggctttgaac 1028



to top

>ref|XM_855640.1| PREDICTED: Canis familiaris similar to Probable RNA-dependent
            helicase p72 (DEAD-box protein p72) (DEAD-box protein
            17), transcript variant 12 (LOC474508), mRNA
          Length = 4885

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                             
Query: 549  taccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaac 597
            |||||||| ||||||||||| ||| | ||||| |||||||| |||||||
Sbjct: 1058 taccttgtactggatgaggctgacaggatgcttgatatgggctttgaac 1106



to top

>ref|XM_845027.1| PREDICTED: Canis familiaris similar to Probable RNA-dependent
            helicase p72 (DEAD-box protein p72) (DEAD-box protein
            17), transcript variant 2 (LOC474508), mRNA
          Length = 4873

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                             
Query: 549  taccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaac 597
            |||||||| ||||||||||| ||| | ||||| |||||||| |||||||
Sbjct: 1058 taccttgtactggatgaggctgacaggatgcttgatatgggctttgaac 1106



to top

>ref|XM_855575.1| PREDICTED: Canis familiaris similar to Probable RNA-dependent
            helicase p72 (DEAD-box protein p72) (DEAD-box protein
            17), transcript variant 11 (LOC474508), mRNA
          Length = 4870

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                             
Query: 549  taccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaac 597
            |||||||| ||||||||||| ||| | ||||| |||||||| |||||||
Sbjct: 1058 taccttgtactggatgaggctgacaggatgcttgatatgggctttgaac 1106



to top

>ref|XM_531736.2| PREDICTED: Canis familiaris similar to Probable RNA-dependent
            helicase p72 (DEAD-box protein p72) (DEAD-box protein
            17), transcript variant 1 (LOC474508), mRNA
          Length = 4909

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                             
Query: 549  taccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaac 597
            |||||||| ||||||||||| ||| | ||||| |||||||| |||||||
Sbjct: 1058 taccttgtactggatgaggctgacaggatgcttgatatgggctttgaac 1106



to top

>ref|XM_855514.1| PREDICTED: Canis familiaris similar to Probable RNA-dependent
            helicase p72 (DEAD-box protein p72) (DEAD-box protein
            17), transcript variant 10 (LOC474508), mRNA
          Length = 4882

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                             
Query: 549  taccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaac 597
            |||||||| ||||||||||| ||| | ||||| |||||||| |||||||
Sbjct: 1058 taccttgtactggatgaggctgacaggatgcttgatatgggctttgaac 1106



to top

>ref|XM_855481.1| PREDICTED: Canis familiaris similar to Probable RNA-dependent
            helicase p72 (DEAD-box protein p72) (DEAD-box protein
            17), transcript variant 9 (LOC474508), mRNA
          Length = 1645

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                             
Query: 549  taccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaac 597
            |||||||| ||||||||||| ||| | ||||| |||||||| |||||||
Sbjct: 1058 taccttgtactggatgaggctgacaggatgcttgatatgggctttgaac 1106



to top

>ref|XM_855444.1| PREDICTED: Canis familiaris similar to Probable RNA-dependent
            helicase p72 (DEAD-box protein p72) (DEAD-box protein
            17), transcript variant 8 (LOC474508), mRNA
          Length = 1946

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                             
Query: 549  taccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaac 597
            |||||||| ||||||||||| ||| | ||||| |||||||| |||||||
Sbjct: 1058 taccttgtactggatgaggctgacaggatgcttgatatgggctttgaac 1106



to top

>ref|XM_855416.1| PREDICTED: Canis familiaris similar to Probable RNA-dependent
            helicase p72 (DEAD-box protein p72) (DEAD-box protein
            17), transcript variant 7 (LOC474508), mRNA
          Length = 1637

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                             
Query: 549  taccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaac 597
            |||||||| ||||||||||| ||| | ||||| |||||||| |||||||
Sbjct: 1058 taccttgtactggatgaggctgacaggatgcttgatatgggctttgaac 1106



to top

>ref|XM_855385.1| PREDICTED: Canis familiaris similar to Probable RNA-dependent
            helicase p72 (DEAD-box protein p72) (DEAD-box protein
            17), transcript variant 6 (LOC474508), mRNA
          Length = 1887

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                             
Query: 549  taccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaac 597
            |||||||| ||||||||||| ||| | ||||| |||||||| |||||||
Sbjct: 1058 taccttgtactggatgaggctgacaggatgcttgatatgggctttgaac 1106



to top

>ref|XM_855349.1| PREDICTED: Canis familiaris similar to Probable RNA-dependent
            helicase p72 (DEAD-box protein p72) (DEAD-box protein
            17), transcript variant 5 (LOC474508), mRNA
          Length = 4807

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                             
Query: 549  taccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaac 597
            |||||||| ||||||||||| ||| | ||||| |||||||| |||||||
Sbjct: 1058 taccttgtactggatgaggctgacaggatgcttgatatgggctttgaac 1106



to top

>dbj|AP003244.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0419B01
          Length = 149610

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                  
Query: 561   gatgaggcagaccgtatgctcgatatgggttttgaac 597
             |||||||||||||| ||||| |||||||| |||||||
Sbjct: 43277 gatgaggcagaccggatgctggatatgggctttgaac 43241



to top

>gb|AY786204.1| Monopterus albus DEAD box RNA helicase-PL10B mRNA, partial cds
          Length = 1127

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 549 taccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaac 597
           ||||| || |||||||||||||| |||||||| || ||||| |||||||
Sbjct: 571 tacctggtcctggatgaggcagatcgtatgcttgacatgggctttgaac 619



to top

>ref|XM_550287.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2864

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                        
Query: 552  cttgtgctggatgaggcagaccgtatgctcgatatgggttttga 595
            ||||| || |||||||| ||||| ||||| ||||||||||||||
Sbjct: 1356 cttgttcttgatgaggctgaccgcatgcttgatatgggttttga 1399



to top

>ref|XM_550286.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2127

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                        
Query: 552  cttgtgctggatgaggcagaccgtatgctcgatatgggttttga 595
            ||||| || |||||||| ||||| ||||| ||||||||||||||
Sbjct: 988  cttgttcttgatgaggctgaccgcatgcttgatatgggttttga 1031



to top

>gb|AE014291.4| Brucella suis 1330 chromosome I, complete sequence
          Length = 2107794

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                              
Query: 561    gatgaggcagaccgtatgctcgatatgggttt 592
              ||||| || |||||||||||||||||||||||
Sbjct: 912330 gatgaagccgaccgtatgctcgatatgggttt 912361



to top

>gb|AC092238.2| Drosophila melanogaster clone BACR03D18, complete sequence
          Length = 184681

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 553 ttgtgctggatgaggcagaccgtatgctcgatatgggttt 592
           |||||||||||||||| || || ||||| |||||||||||
Sbjct: 152 ttgtgctggatgaggccgatcgcatgctagatatgggttt 113



to top

>ref|XM_504478.1| Yarrowia lipolytica CLIB122, YALI0E27715g predicted mRNA
          Length = 1659

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 561 gatgaggcagaccgtatgctcgatatgggttt 592
           |||||||| ||||| |||||||||||||||||
Sbjct: 808 gatgaggccgaccgaatgctcgatatgggttt 839



to top

>ref|NM_165103.2| Drosophila melanogaster vasa CG3506-RA (vas), mRNA
          Length = 2285

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                    
Query: 553  ttgtgctggatgaggcagaccgtatgctcgatatgggttt 592
            |||||||||||||||| || || ||||| |||||||||||
Sbjct: 1338 ttgtgctggatgaggccgatcgcatgctagatatgggttt 1377



to top

>gb|AY084126.1| Drosophila melanogaster RE20606 full insert cDNA
          Length = 2252

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                    
Query: 553  ttgtgctggatgaggcagaccgtatgctcgatatgggttt 592
            |||||||||||||||| || || ||||| |||||||||||
Sbjct: 1333 ttgtgctggatgaggccgatcgcatgctagatatgggttt 1372



to top

>gb|AC093101.1| Drosophila melanogaster, chromosome 2L, region 35X-35X, BAC clone
             BACR06I01, complete sequence
          Length = 175167

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                     
Query: 553   ttgtgctggatgaggcagaccgtatgctcgatatgggttt 592
             |||||||||||||||| || || ||||| |||||||||||
Sbjct: 27903 ttgtgctggatgaggccgatcgcatgctagatatgggttt 27942



to top

>gb|AE009543.1| Brucella melitensis 16M chromosome I, section 100 of 195 of the
            complete sequence
          Length = 14857

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 561  gatgaggcagaccgtatgctcgatatgggttt 592
            ||||| || |||||||||||||||||||||||
Sbjct: 6366 gatgaagccgaccgtatgctcgatatgggttt 6335



to top

>dbj|AP003282.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0583G08
          Length = 135295

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                          
Query: 552    cttgtgctggatgaggcagaccgtatgctcgatatgggttttga 595
              ||||| || |||||||| ||||| ||||| ||||||||||||||
Sbjct: 123634 cttgttcttgatgaggctgaccgcatgcttgatatgggttttga 123591



to top

>gb|AE017223.1| Brucella abortus biovar 1 str. 9-941 chromosome I, complete sequence
          Length = 2124241

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                              
Query: 561    gatgaggcagaccgtatgctcgatatgggttt 592
              ||||| || |||||||||||||||||||||||
Sbjct: 934021 gatgaagccgaccgtatgctcgatatgggttt 934052



to top

>ref|XM_320481.2| Anopheles gambiae str. PEST ENSANGP00000015773
           (ENSANGG00000013284), partial mRNA
          Length = 1587

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 546 acataccttgtgctggatgaggcagaccgtatgctcgatatggg 589
           |||||||| |||||||||||||| ||||| ||||| || |||||
Sbjct: 736 acatacctcgtgctggatgaggccgaccggatgctggacatggg 779



to top

>dbj|AK100326.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023079L21, full
            insert sequence
          Length = 2864

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                        
Query: 552  cttgtgctggatgaggcagaccgtatgctcgatatgggttttga 595
            ||||| || |||||||| ||||| ||||| ||||||||||||||
Sbjct: 1356 cttgttcttgatgaggctgaccgcatgcttgatatgggttttga 1399



to top

>gb|AE003646.3| Drosophila melanogaster chromosome 2L, section 55 of 83 of the complete
             sequence
          Length = 265413

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                     
Query: 553   ttgtgctggatgaggcagaccgtatgctcgatatgggttt 592
             |||||||||||||||| || || ||||| |||||||||||
Sbjct: 72956 ttgtgctggatgaggccgatcgcatgctagatatgggttt 72995



to top

>emb|AM040264.1| Brucella melitensis biovar Abortus chromosome I, complete sequence,
              strain 2308
          Length = 2121359

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                              
Query: 561    gatgaggcagaccgtatgctcgatatgggttt 592
              ||||| || |||||||||||||||||||||||
Sbjct: 931143 gatgaagccgaccgtatgctcgatatgggttt 931174



to top

>emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB 122 of Yarrowia lipolytica
          Length = 4224103

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                               
Query: 561     gatgaggcagaccgtatgctcgatatgggttt 592
               |||||||| ||||| |||||||||||||||||
Sbjct: 3273532 gatgaggccgaccgaatgctcgatatgggttt 3273501



to top

>emb|X12946.1|DMVASA2 D.melanogaster vasa gene (exons 3 to 7)
          Length = 1904

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 553 ttgtgctggatgaggcagaccgtatgctcgatatgggttt 592
           |||||||||||||||| || || ||||| |||||||||||
Sbjct: 864 ttgtgctggatgaggccgatcgcatgctagatatgggttt 903



to top

>gb|M23560.1|DROVASA D.melanogaster antigen Mab46F11 (vasa) mRNA, complete cds
          Length = 2225

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                    
Query: 553  ttgtgctggatgaggcagaccgtatgctcgatatgggttt 592
            |||||||||||||||| || || ||||| |||||||||||
Sbjct: 1279 ttgtgctggatgaggccgatcgcatgctagatatgggttt 1318



to top

>gb|AE017354.1| Legionella pneumophila subsp. pneumophila str. Philadelphia 1, complete
               genome
          Length = 3397754

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                  
Query: 559     tggatgaggcagaccgtatgctcgatatgggtttt 593
               |||||||||||||| | ||||| ||||||||||||
Sbjct: 2367638 tggatgaggcagacagaatgctggatatgggtttt 2367672



to top

>emb|CR628336.1| Legionella pneumophila str. Paris complete genome
          Length = 3503610

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                  
Query: 559     tggatgaggcagaccgtatgctcgatatgggtttt 593
               |||||||||||||| | ||||| ||||||||||||
Sbjct: 2307879 tggatgaggcagacagaatgctggatatgggtttt 2307913



to top

>emb|BX950851.1| Erwinia carotovora subsp. atroseptica SCRI1043, complete genome
          Length = 5064019

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                  
Query: 555     gtgctggatgaggcagaccgtatgctcgatatggg 589
               ||||||||||| |||||||| ||||| ||||||||
Sbjct: 3146658 gtgctggatgaagcagaccggatgctggatatggg 3146624



to top

>dbj|BA000032.2| Vibrio parahaemolyticus RIMD 2210633 DNA, chromosome 2, complete sequence
          Length = 1877212

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                 
Query: 555    gtgctggatgaggcagaccgtatgctcgatatggg 589
              ||||||||||| |||||||| ||||| ||||||||
Sbjct: 387945 gtgctggatgaagcagaccgcatgctggatatggg 387911



to top

>gb|AY730697.1| Nematostella vectensis DEAD box helicase Vasa2 (Vas2) mRNA, partial
           cds
          Length = 844

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                  
Query: 559 tggatgaggcagaccgtatgctcgatatgggttttgaac 597
           ||||||| |||||||||||||| || ||||| |||||||
Sbjct: 315 tggatgaagcagaccgtatgctggacatgggctttgaac 353



to top

>gb|AE014299.1| Shewanella oneidensis MR-1, complete genome
          Length = 4969803

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                      
Query: 555     gtgctggatgaggcagaccgtatgctcgatatgggtttt 593
               |||||||||||||| |||||| |||| || |||||||||
Sbjct: 1177879 gtgctggatgaggctgaccgtttgctggagatgggtttt 1177917



to top

>gb|BC086320.1| Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypeptide 5, mRNA (cDNA
           clone IMAGE:6466882), partial cds
          Length = 2275

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 237 actggatctgggaaaacactatctta 262
           |||||||||||||||||| |||||||
Sbjct: 519 actggatctgggaaaacattatctta 544



to top

>ref|NM_001016781.2| Xenopus tropicalis hypothetical protein LOC549535 (LOC549535), mRNA
          Length = 2430

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 417 tgtatctacggtggagcacctaagggaccacaaatacg 454
           |||||||| ||||| || ||||| ||||||||||||||
Sbjct: 704 tgtatctatggtggggctcctaaaggaccacaaatacg 741



to top

>gb|BC084159.1| Xenopus tropicalis cDNA clone IMAGE:7016603
          Length = 4542

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 417 tgtatctacggtggagcacctaagggaccacaaatacg 454
           |||||||| ||||| || ||||| ||||||||||||||
Sbjct: 704 tgtatctatggtggggctcctaaaggaccacaaatacg 741



to top

>gb|BC080992.1| Xenopus laevis hypothetical protein LOC398649, mRNA (cDNA clone
           MGC:80019 IMAGE:3401294), complete cds
          Length = 2818

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 417 tgtatctacggtggagcacctaagggaccacaaatacg 454
           |||||||| ||||| || ||||| ||||||||||||||
Sbjct: 672 tgtatctatggtggggctcctaaaggaccacaaatacg 709



to top

>gb|CP000082.1| Psychrobacter arcticus 273-4, complete genome
          Length = 2650701

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                                 
Query: 561     gatgaggcagaccgtatgctcgatatgggttttg 594
               ||||| || ||||||||||| |||||||||||||
Sbjct: 1292737 gatgaagctgaccgtatgctagatatgggttttg 1292770



to top

>ref|NM_007840.2| Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypeptide 5 (Ddx5), mRNA
          Length = 3521

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 237 actggatctgggaaaacactatctta 262
           |||||||||||||||||| |||||||
Sbjct: 597 actggatctgggaaaacattatctta 622



to top

>gb|BC054236.1| Xenopus laevis hypothetical protein LOC398649, mRNA (cDNA clone
           IMAGE:6880238), partial cds
          Length = 1336

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 417 tgtatctacggtggagcacctaagggaccacaaatacg 454
           |||||||| ||||| || ||||| ||||||||||||||
Sbjct: 651 tgtatctatggtggggctcctaaaggaccacaaatacg 688



to top

>gb|BC062916.1| Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypeptide 5, mRNA (cDNA
           clone IMAGE:6827275), partial cds
          Length = 3645

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 237 actggatctgggaaaacactatctta 262
           |||||||||||||||||| |||||||
Sbjct: 581 actggatctgggaaaacattatctta 606



to top

>ref|XM_946895.1| Theileria annulata strain Ankara ATP-dependent RNA helicase
           (TA14795) partial mRNA
          Length = 1368

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 330 ttgatccttgctccaacaagagaact 355
           ||||||||||||||||| ||||||||
Sbjct: 337 ttgatccttgctccaactagagaact 362



to top

>ref|XM_967408.1| PREDICTED: Tribolium castaneum similar to DEAD (Asp-Glu-Ala-Asp)
           box polypeptide 5 (LOC661233), mRNA
          Length = 1623

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 564 gaggcagaccgtatgctcgatatgggttttgaac 597
           |||||||| || ||||| ||||||||||||||||
Sbjct: 736 gaggcagatcggatgcttgatatgggttttgaac 769



to top

>emb|X65627.1|MMHELI M.musculus mRNA TNZ2 for p68 RNA helicase
          Length = 2318

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 237 actggatctgggaaaacactatctta 262
           |||||||||||||||||| |||||||
Sbjct: 578 actggatctgggaaaacattatctta 603



to top

>dbj|AK129022.1| Mus musculus cDNA fis, clone TRACH3036683, highly similar to
           Probable RNA-dependent helicase p68
          Length = 3602

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 237 actggatctgggaaaacactatctta 262
           |||||||||||||||||| |||||||
Sbjct: 596 actggatctgggaaaacattatctta 621



to top

>gb|AF479821.1| Hyphessobrycon ecuadoriensis DEAD box RNA helicase Vasa mRNA,
           complete cds
          Length = 1730

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 558 ctggatgaggcagaccgtatgctcgatatgggttttga 595
           ||||||||||| || ||||||||||| ||||| |||||
Sbjct: 349 ctggatgaggctgatcgtatgctcgacatgggatttga 386



to top

>dbj|AK132779.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:4922505M03 product:DEAD (Asp-Glu-Ala-Asp)
           box polypeptide 5, full insert sequence
          Length = 2375

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 237 actggatctgggaaaacactatctta 262
           |||||||||||||||||| |||||||
Sbjct: 643 actggatctgggaaaacattatctta 668



to top

>dbj|AK135173.1| Mus musculus 12 days embryo female ovary cDNA, RIKEN full-length
           enriched library, clone:6620402N06 product:DEAD
           (Asp-Glu-Ala-Asp) box polypeptide 5, full insert
           sequence
          Length = 3522

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 237 actggatctgggaaaacactatctta 262
           |||||||||||||||||| |||||||
Sbjct: 597 actggatctgggaaaacattatctta 622



to top

>dbj|AK166698.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched
           library, clone:I1C0003N03 product:DEAD (Asp-Glu-Ala-Asp)
           box polypeptide 5, full insert sequence
          Length = 2461

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 237 actggatctgggaaaacactatctta 262
           |||||||||||||||||| |||||||
Sbjct: 729 actggatctgggaaaacattatctta 754



to top

>dbj|AK166045.1| Mus musculus lung RCB-0558 LLC cDNA, RIKEN full-length enriched
           library, clone:G730030M03 product:DEAD (Asp-Glu-Ala-Asp)
           box polypeptide 5, full insert sequence
          Length = 3521

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 237 actggatctgggaaaacactatctta 262
           |||||||||||||||||| |||||||
Sbjct: 597 actggatctgggaaaacattatctta 622



to top

>dbj|AB169223.1| Macaca fascicularis testis cDNA, clone: QtsA-18104, similar to
           human DEAD (Asp-Glu-Ala-Asp) box polypeptide 5 (DDX5),
           mRNA, RefSeq: NM_004396.2
          Length = 2182

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                         
Query: 552 cttgtgctggatgaggcagaccgtatgctcgatatgggttttgaac 597
           ||||| || ||||| |||||| | ||||| ||||||||||||||||
Sbjct: 737 cttgtccttgatgaagcagacagaatgcttgatatgggttttgaac 782



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 417 tgtatctacggtggagcacctaagggaccacaaatacgtga 457
           |||||||| ||||| || || |||||||| |||||||||||
Sbjct: 602 tgtatctatggtggtgctcccaagggaccccaaatacgtga 642



to top

>dbj|AB169157.1| Macaca fascicularis testis cDNA, clone: QtsA-17658, similar to human
            DEAD (Asp-Glu-Ala-Asp) box polypeptide 5 (DDX5), mRNA,
            RefSeq: NM_004396.2
          Length = 2416

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                          
Query: 552  cttgtgctggatgaggcagaccgtatgctcgatatgggttttgaac 597
            ||||| || ||||| |||||| | ||||| ||||||||||||||||
Sbjct: 985  cttgtccttgatgaagcagacagaatgcttgatatgggttttgaac 1030



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 417 tgtatctacggtggagcacctaagggaccacaaatacgtga 457
           |||||||| ||||| || || |||||||| |||||||||||
Sbjct: 850 tgtatctatggtggtgctcccaagggaccccaaatacgtga 890



to top

>dbj|AK088887.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
           full-length enriched library, clone:E430029P14
           product:DEAD (aspartate-glutamate-alanine-aspartate) box
           polypeptide 5, full insert sequence
          Length = 2329

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 237 actggatctgggaaaacactatctta 262
           |||||||||||||||||| |||||||
Sbjct: 597 actggatctgggaaaacattatctta 622



to top

>gb|DQ336393.1| Elephas maximus DEAD/H box polypeptide (DBY) gene, partial sequence
          Length = 458

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 342 ccaacaagagaactggctgttcaaat 367
           |||||||||||||||||||| |||||
Sbjct: 284 ccaacaagagaactggctgtacaaat 309



to top

>dbj|AK044792.1| Mus musculus adult retina cDNA, RIKEN full-length enriched library,
           clone:A930106P08 product:DEAD
           (aspartate-glutamate-alanine-aspartate) box polypeptide
           5, full insert sequence
          Length = 2329

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 237 actggatctgggaaaacactatctta 262
           |||||||||||||||||| |||||||
Sbjct: 596 actggatctgggaaaacattatctta 621



to top

>dbj|AK076018.1| Mus musculus 10 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2610035N22 product:DEAD
           (aspartate-glutamate-alanine-aspartate) box polypeptide
           5, full insert sequence
          Length = 2338

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 237 actggatctgggaaaacactatctta 262
           |||||||||||||||||| |||||||
Sbjct: 598 actggatctgggaaaacattatctta 623



to top

>ref|XM_392069.2| PREDICTED: Apis mellifera similar to ENSANGP00000017814 (LOC408524),
            mRNA
          Length = 2743

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                  
Query: 559  tggatgaggcagaccgtatgctcgatatgggttttgaa 596
            ||||||| || || |||||| |||||||||||||||||
Sbjct: 1778 tggatgaagcggatcgtatgatcgatatgggttttgaa 1815



to top

>ref|NM_001007613.1| Rattus norvegicus ddx5 gene (Ddx5), mRNA
          Length = 2508

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 237 actggatctgggaaaacactatctta 262
           |||||||||||||||||| |||||||
Sbjct: 648 actggatctgggaaaacattatctta 673



to top

>gb|BC079036.1| Rattus norvegicus ddx5 gene, mRNA (cDNA clone MGC:93965
           IMAGE:7114313), complete cds
          Length = 2508

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 237 actggatctgggaaaacactatctta 262
           |||||||||||||||||| |||||||
Sbjct: 648 actggatctgggaaaacattatctta 673



to top

>emb|AJ010940.1|RNO010940 Rattus norvegicus ddx5-ps1 pseudogene, partial
          Length = 336

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 237 actggatctgggaaaacactatctta 262
           |||||||||||||||||| |||||||
Sbjct: 264 actggatctgggaaaacattatctta 289



to top

>emb|CR855694.2| Xenopus tropicalis finished cDNA, clone TGas068f07
          Length = 2430

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 417 tgtatctacggtggagcacctaagggaccacaaatacg 454
           |||||||| ||||| || ||||| ||||||||||||||
Sbjct: 704 tgtatctatggtggggctcctaaaggaccacaaatacg 741



to top

>gb|BC046554.1| Mus musculus cDNA clone IMAGE:4973650
          Length = 2321

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 237 actggatctgggaaaacactatctta 262
           |||||||||||||||||| |||||||
Sbjct: 574 actggatctgggaaaacattatctta 599



to top

>gb|BC108369.1| Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypeptide 5, mRNA (cDNA
           clone MGC:118083 IMAGE:6312791), complete cds
          Length = 2236

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 237 actggatctgggaaaacactatctta 262
           |||||||||||||||||| |||||||
Sbjct: 441 actggatctgggaaaacattatctta 466



to top

>gb|AC149403.2| Phakopsora pachyrhizi clone JGIAFNA-61H19, complete sequence
          Length = 36597

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                  
Query: 315   gatggcccaattgtcttgatccttgctccaacaagagaactggctgttcaaat 367
             |||||||| ||||| |||||| | || || ||| | |||||||||||||||||
Sbjct: 23701 gatggccctattgtattgatcttagcacccacacgggaactggctgttcaaat 23649



to top

>gb|AY391418.1| Danio rerio DEAD (Asp-Glu-Ala-Asp) box polypeptide 5 (DDX5) mRNA,
           complete cds
          Length = 2482

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 168 ccaacgcctatccaagctcagggttggcc 196
           ||||| ||||||||||||||||| |||||
Sbjct: 417 ccaacccctatccaagctcaggggtggcc 445



to top

>gb|CP000148.1| Geobacter metallireducens GS-15, complete genome
          Length = 3997420

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                            
Query: 564     gaggcagaccgtatgctcgatatgggttt 592
               ||||||||||| |||||||| ||||||||
Sbjct: 3430699 gaggcagaccggatgctcgacatgggttt 3430727



to top

>ref|XM_629763.1| Dictyostelium discoideum hypothetical protein (DDB0184159), partial
            mRNA
          Length = 2334

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                 
Query: 473  tgaaatcgtcattgcaacaccaggtcggttgattgat 509
            ||||||| ||||||||||||| ||||| ||| |||||
Sbjct: 1314 tgaaatcatcattgcaacaccgggtcgtttggttgat 1350



to top

>ref|NM_212612.1| Danio rerio DEAD (Asp-Glu-Ala-Asp) box polypeptide 5 (ddx5), mRNA
          Length = 2482

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 168 ccaacgcctatccaagctcagggttggcc 196
           ||||| ||||||||||||||||| |||||
Sbjct: 417 ccaacccctatccaagctcaggggtggcc 445



to top

>gb|BC082849.1| Xenopus laevis p68 RNA helicase, mRNA (cDNA clone MGC:81559
           IMAGE:6862986), complete cds
          Length = 2177

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 465 agaggagttgaaatcgtcattgcaacacc 493
           |||||||||||||||  ||||||||||||
Sbjct: 679 agaggagttgaaatctgcattgcaacacc 707



to top

>gb|AE017136.1| Yersinia pestis biovar Medievalis str. 91001 section 10 of 16 of the
              complete genome
          Length = 290294

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                   
Query: 558    ctggatgaggcagaccgtatgctcgatatgggttttg 594
              |||||||| || ||||||||||| || ||||||||||
Sbjct: 168361 ctggatgaagctgaccgtatgctggacatgggttttg 168325



to top

>gb|BC063223.1| Xenopus tropicalis DEAD (Asp-Glu-Ala-Asp) box polypeptide 5, mRNA
           (cDNA clone MGC:76265 IMAGE:5379210), complete cds
          Length = 2192

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 429 ggagcacctaagggaccacaaatacgtgacctcaggagaggagttgaaatcgtcattgca 488
           ||||| || ||||||||||| |||||||| ||    |||||||||||||||  |||||| 
Sbjct: 622 ggagctccaaagggaccacagatacgtgatctagaaagaggagttgaaatctgcattgct 681

                
Query: 489 acacc 493
           |||||
Sbjct: 682 acacc 686



to top

>ref|XM_361961.1| Magnaporthe grisea 70-15 hypothetical protein (MG04406.4) partial cds
          Length = 7962

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 234  gaaactggatctgggaaaaca 254
            |||||||||||||||||||||
Sbjct: 1288 gaaactggatctgggaaaaca 1308



to top

>gb|DQ441593.1| Odontesthes hatcheri vasa-like protein mRNA, partial cds
          Length = 287

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 555 gtgctggatgaggcagaccgtatgctcgatatgggttttga 595
           ||||||||||| ||||| || ||| | ||||||||||||||
Sbjct: 192 gtgctggatgaagcagatcgcatgttggatatgggttttga 232



to top

>gb|AE009952.1| Yersinia pestis KIM, complete genome
          Length = 4600755

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                    
Query: 558     ctggatgaggcagaccgtatgctcgatatgggttttg 594
               |||||||| || ||||||||||| || ||||||||||
Sbjct: 1430731 ctggatgaagctgaccgtatgctggacatgggttttg 1430695



to top

>ref|XM_456137.1| Kluyveromyces lactis NRRL Y-1140, KLLA0F23716g predicted mRNA
          Length = 1665

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 48/57 (84%)
 Strand = Plus / Plus

                                                                    
Query: 311 aggtgatggcccaattgtcttgatccttgctccaacaagagaactggctgttcaaat 367
           ||||||||| |||||||| ||| |  | |||||||| |||||| | |||||||||||
Sbjct: 549 aggtgatggtccaattgttttggtattggctccaaccagagaattagctgttcaaat 605



to top

>gb|BC067585.1| Danio rerio DEAD (Asp-Glu-Ala-Asp) box polypeptide 5, mRNA (cDNA
           clone MGC:85704 IMAGE:6963939), complete cds
          Length = 2245

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 168 ccaacgcctatccaagctcagggttggcc 196
           ||||| ||||||||||||||||| |||||
Sbjct: 438 ccaacccctatccaagctcaggggtggcc 466



to top

>gb|AC165060.2| Phakopsora pachyrhizi clone JGIAFNA-205B5, complete sequence
          Length = 44829

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                  
Query: 315   gatggcccaattgtcttgatccttgctccaacaagagaactggctgttcaaat 367
             |||||||| ||||| |||||| | || || ||| | |||||||||||||||||
Sbjct: 20583 gatggccctattgtattgatcttagcacccacacgggaactggctgttcaaat 20635



to top

>gb|BC047981.1| Xenopus laevis similar to DEAD/H (Asp-Glu-Ala-Asp/His) box
           polypeptide 5 (RNA helicase, 68kDa), mRNA (cDNA clone
           MGC:53795 IMAGE:5541855), complete cds
          Length = 2158

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 465 agaggagttgaaatcgtcattgcaacacc 493
           |||||||||||||||  ||||||||||||
Sbjct: 663 agaggagttgaaatctgcattgcaacacc 691



to top

>ref|XM_719206.1| Plasmodium yoelii yoelii str. 17XNL U5 snRNP 100 kD protein (PY04051)
            partial mRNA
          Length = 2904

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                             
Query: 222  attggtattgcagaaactggatctgggaaaaca 254
            ||||| ||||| |||||||||||||| ||||||
Sbjct: 1750 attggaattgctgaaactggatctggaaaaaca 1782



to top

>gb|AC136842.2| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone
              OSJNBa0085C16, complete sequence
          Length = 156069

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                   
Query: 561    gatgaggcagaccgtatgctcgatatgggttttgaac 597
              |||||||||||  | ||||| ||||||||||||||||
Sbjct: 135169 gatgaggcagatagaatgcttgatatgggttttgaac 135205



to top

>gb|CP000323.1| Psychrobacter cryohalolentis K5, complete genome
          Length = 3059876

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                            
Query: 561     gatgaggcagaccgtatgctcgatatggg 589
               ||||| |||||||| ||||||||||||||
Sbjct: 1814632 gatgaagcagaccgcatgctcgatatggg 1814604



to top

>emb|Z71388.1|SCYNL112W S.cerevisiae chromosome XIV reading frame ORF YNL112w
          Length = 3740

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 339  gctccaacaagagaactggctgttcaaat 367
            |||||||| |||||| |||||||||||||
Sbjct: 1016 gctccaactagagaattggctgttcaaat 1044



to top

>emb|Z69382.1|SCCXIV38K S.cerevisiae 37,800 bp segment of chromosome XIV
          Length = 37800

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 339   gctccaacaagagaactggctgttcaaat 367
             |||||||| |||||| |||||||||||||
Sbjct: 30156 gctccaactagagaattggctgttcaaat 30184



to top

>emb|X52649.1|SCP68 S.cerevisiae p68 gene
          Length = 2733

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 339 gctccaacaagagaactggctgttcaaat 367
           |||||||| |||||| |||||||||||||
Sbjct: 637 gctccaactagagaattggctgttcaaat 665



to top

>emb|CR628337.1| Legionella pneumophila str. Lens complete genome
          Length = 3345687

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                                
Query: 561     gatgaggcagaccgtatgctcgatatgggtttt 593
               |||||||||||| | ||||| ||||||||||||
Sbjct: 2284659 gatgaggcagacagaatgctggatatgggtttt 2284691



to top

>emb|CR626927.1| Bacteroides fragilis NCTC 9343, complete genome
          Length = 5205140

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                            
Query: 561     gatgaggcagaccgtatgctcgatatggg 589
               ||||| |||||||||||||| ||||||||
Sbjct: 2788064 gatgaagcagaccgtatgcttgatatggg 2788036



to top

>emb|CR382126.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome F of strain NRRL Y-1140
               of Kluyveromyces lactis
          Length = 2602197

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 48/57 (84%)
 Strand = Plus / Minus

                                                                        
Query: 311     aggtgatggcccaattgtcttgatccttgctccaacaagagaactggctgttcaaat 367
               ||||||||| |||||||| ||| |  | |||||||| |||||| | |||||||||||
Sbjct: 2217581 aggtgatggtccaattgttttggtattggctccaaccagagaattagctgttcaaat 2217525



to top

>emb|BX936398.1| Yersinia pseudotuberculosis IP32953 genome, complete sequence
          Length = 4744671

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                    
Query: 558     ctggatgaggcagaccgtatgctcgatatgggttttg 594
               |||||||| || ||||||||||| || ||||||||||
Sbjct: 3431694 ctggatgaagctgaccgtatgctggacatgggttttg 3431730



to top

>ref|NM_203898.1| Xenopus tropicalis DEAD (Asp-Glu-Ala-Asp) box polypeptide 5 (ddx5),
           mRNA
          Length = 2192

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 429 ggagcacctaagggaccacaaatacgtgacctcaggagaggagttgaaatcgtcattgca 488
           ||||| || ||||||||||| |||||||| ||    |||||||||||||||  |||||| 
Sbjct: 622 ggagctccaaagggaccacagatacgtgatctagaaagaggagttgaaatctgcattgct 681

                
Query: 489 acacc 493
           |||||
Sbjct: 682 acacc 686



to top

>emb|AJ414153.1| Yersinia pestis strain CO92 complete genome; segment 13/20
          Length = 258050

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                   
Query: 558    ctggatgaggcagaccgtatgctcgatatgggttttg 594
              |||||||| || ||||||||||| || ||||||||||
Sbjct: 122801 ctggatgaagctgaccgtatgctggacatgggttttg 122765



to top

>emb|BX936324.6| Zebrafish DNA sequence from clone CH211-74F16 in linkage group 3,
             complete sequence
          Length = 154312

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 168   ccaacgcctatccaagctcagggttggcc 196
             ||||| ||||||||||||||||| |||||
Sbjct: 58048 ccaacccctatccaagctcaggggtggcc 58020



to top

>dbj|AP007171.1| Aspergillus oryzae RIB40 genomic DNA, SC011
          Length = 2505489

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 72/89 (80%)
 Strand = Plus / Plus

                                                                           
Query: 504     attgatatgctggaagctggtcacacaaacctacgtcgggttacataccttgtgctggat 563
               ||||||||||| || ||||| | ||| ||||| || || || || |||||||| || || 
Sbjct: 1421874 attgatatgctcgaggctggccgcactaacctccgccgtgtcacttaccttgttcttgac 1421933

                                            
Query: 564     gaggcagaccgtatgctcgatatgggttt 592
               ||||| ||||| ||||| || ||||||||
Sbjct: 1421934 gaggccgaccgcatgctggacatgggttt 1421962



to top

>gb|AC118347.2| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone
             OSJNBa0043E10, complete sequence
          Length = 124591

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                  
Query: 561   gatgaggcagaccgtatgctcgatatgggttttgaac 597
             |||||||||||  | ||||| ||||||||||||||||
Sbjct: 97495 gatgaggcagatagaatgcttgatatgggttttgaac 97459



to top

>gb|AE015928.1| Bacteroides thetaiotaomicron VPI-5482, complete genome
          Length = 6260361

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                    
Query: 553     ttgtgctggatgaggcagaccgtatgctcgatatggg 589
               |||| ||||| || |||||||||||||| ||||||||
Sbjct: 2372992 ttgttctggacgaagcagaccgtatgcttgatatggg 2372956



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                               
Query: 558     ctggatgaggcagaccgtatgctcgatatggg 589
               ||||| || |||||||||||||| ||||||||
Sbjct: 1026523 ctggacgaagcagaccgtatgcttgatatggg 1026492



to top

>gb|AF218580.1|AF218580 Xenopus laevis p68 RNA helicase mRNA, complete cds
          Length = 2207

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 465 agaggagttgaaatcgtcattgcaacacc 493
           |||||||||||||||  ||||||||||||
Sbjct: 705 agaggagttgaaatctgcattgcaacacc 733



to top

>ref|NM_065859.3| Caenorhabditis elegans F01F1.7 (F01F1.7) mRNA, complete cds
          Length = 2282

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 471  gttgaaatcgtcattgcaacaccaggtcg 499
            |||||| | ||||||||||||||||||||
Sbjct: 1286 gttgaagtggtcattgcaacaccaggtcg 1314



to top

>gb|AF188678.1|AF188678 Pisum sativum P72 DEAD box protein mRNA, complete cds
          Length = 2924

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                 
Query: 561  gatgaggcagaccgtatgctcgatatgggttttgaac 597
            |||||||||||| | ||||| || |||||||||||||
Sbjct: 1100 gatgaggcagacaggatgctggacatgggttttgaac 1136



to top

>gb|AY960203.1| Odontesthes bonariensis Vasa-like protein mRNA, partial cds
          Length = 287

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 555 gtgctggatgaggcagaccgtatgctcgatatgggttttga 595
           ||||||||||| ||||| || ||| | ||||||||||||||
Sbjct: 192 gtgctggatgaagcagatcgcatgttggatatgggttttga 232



to top

>dbj|AP006841.1| Bacteroides fragilis YCH46 DNA, complete genome
          Length = 5277274

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                            
Query: 561     gatgaggcagaccgtatgctcgatatggg 589
               ||||| |||||||||||||| ||||||||
Sbjct: 2673286 gatgaagcagaccgtatgcttgatatggg 2673258



to top

>dbj|AB051835.1| Oreochromis niloticus vas-s mRNA for vasa short form, complete cds
          Length = 2058

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                     
Query: 555  gtgctggatgaggcagaccgtatgctcgatatgggttttga 595
            |||||||||||||| ||||| ||| | |||||||| |||||
Sbjct: 1062 gtgctggatgaggctgaccgcatgttggatatggggtttga 1102



to top

>dbj|AB032467.1| Oreochromis niloticus mRNA for vasa, complete cds
          Length = 2130

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                     
Query: 555  gtgctggatgaggcagaccgtatgctcgatatgggttttga 595
            |||||||||||||| ||||| ||| | |||||||| |||||
Sbjct: 1134 gtgctggatgaggctgaccgcatgttggatatggggtttga 1174



to top

>emb|BX085195.5| Zebrafish DNA sequence from clone DKEY-226A5 in linkage group 3, complete
              sequence
          Length = 227111

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 168    ccaacgcctatccaagctcagggttggcc 196
              ||||| ||||||||||||||||| |||||
Sbjct: 155137 ccaacccctatccaagctcaggggtggcc 155165



to top

>gb|AY110750.1| Zea mays CL9052_1 mRNA sequence
          Length = 1387

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 63/77 (81%)
 Strand = Plus / Minus

                                                                        
Query: 315  gatggcccaattgtcttgatccttgctccaacaagagaactggctgttcaaatacaggca 374
            ||||| |||||||||||| |  | ||||| ||| | ||||| |||||||| ||||||  |
Sbjct: 1297 gatggtccaattgtcttggtgttagctcctacacgtgaacttgctgttcagatacagcaa 1238

                             
Query: 375  gaagctacaaagtttgg 391
            ||||| || ||||||||
Sbjct: 1237 gaagcaaccaagtttgg 1221



to top

>emb|CR848548.2| Xenopus tropicalis finished cDNA, clone TEgg028e13
          Length = 2152

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 429 ggagcacctaagggaccacaaatacgtgacctcaggagaggagttgaaatcgtcattgca 488
           ||||| || ||||||||||| |||||||| ||    |||||||||||||||  |||||| 
Sbjct: 631 ggagctccaaagggaccacagatacgtgatctagaaagaggagttgaaatctgcattgct 690

                
Query: 489 acacc 493
           |||||
Sbjct: 691 acacc 695



to top

>gb|U13070.1| Caenorhabditis elegans cosmid F01F1, complete sequence
          Length = 40824

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 471  gttgaaatcgtcattgcaacaccaggtcg 499
            |||||| | ||||||||||||||||||||
Sbjct: 9533 gttgaagtggtcattgcaacaccaggtcg 9505



to top

>gb|AE008692.1| Zymomonas mobilis subsp. mobilis ZM4, complete genome
          Length = 2056416

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                            
Query: 561     gatgaggcagaccgtatgctcgatatggg 589
               |||||||| ||||| ||||||||||||||
Sbjct: 1238678 gatgaggctgaccggatgctcgatatggg 1238706



to top

>gb|AC154130.1| Tribolium castaneum  BAC T.cast_C11O3 (Clemson University Genomics
             Institute Tribolium castaneum BAC Library (Red Flour
             Beetle)) complete sequence
          Length = 148539

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 230   tgcagaaactggatctgggaaaac 253
             |||| |||||||||||||||||||
Sbjct: 37474 tgcacaaactggatctgggaaaac 37497



to top

>gb|AF510054.1| Schistocerca gregaria vasa-like gene, partial cds
          Length = 1764

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 561  gatgaggcagaccgtatgctcgatatgggttt 592
            ||||| ||||| |||||||| |||||||||||
Sbjct: 973  gatgaagcagatcgtatgctagatatgggttt 1004



to top

>ref|XM_635505.1| Dictyostelium discoideum hypothetical protein (DDB0204625), partial
           mRNA
          Length = 2352

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 480 gtcattgcaacaccaggtcg 499
           ||||||||||||||||||||
Sbjct: 943 gtcattgcaacaccaggtcg 962



to top

>ref|NM_177069.2| Mus musculus RIKEN cDNA E330009P21 gene (E330009P21Rik), mRNA
          Length = 1487

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 315 gatggcccaattgtcttgat 334
           ||||||||||||||||||||
Sbjct: 638 gatggcccaattgtcttgat 657



to top

>gb|AY723847.1| Saccharomyces cerevisiae clone FLH004944.01X YLR276C gene, complete
           cds
          Length = 1785

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 336 cttgctccaacaagagaactggct 359
           |||| |||||||||||||||||||
Sbjct: 298 cttgttccaacaagagaactggct 321



to top

>ref|XM_613184.2| PREDICTED: Bos taurus similar to Probable RNA-dependent helicase
           p68 (DEAD-box protein p68) (DEAD-box protein 5),
           transcript variant 1 (LOC533700), mRNA
          Length = 2468

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 438 aagggaccacaaatacgtga 457
           ||||||||||||||||||||
Sbjct: 921 aagggaccacaaatacgtga 940



to top

>gb|BC068766.1| Xenopus laevis hypothetical protein MGC81281, mRNA (cDNA clone
           MGC:81281 IMAGE:6631829), complete cds
          Length = 3614

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 234 gaaactggatctgggaaaac 253
           ||||||||||||||||||||
Sbjct: 458 gaaactggatctgggaaaac 477



to top

>ref|NM_026360.1| Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypeptide 47 (Ddx47),
           mRNA
          Length = 1752

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 231 gcagaaactggatctgggaaaaca 254
           |||||||| |||||||||||||||
Sbjct: 225 gcagaaacgggatctgggaaaaca 248



to top

>ref|NM_175214.3| Mus musculus kinesin family member 27 (Kif27), mRNA
          Length = 4462

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 235 aaactggatctgggaaaaca 254
           ||||||||||||||||||||
Sbjct: 254 aaactggatctgggaaaaca 273



to top

>ref|XM_705616.1| Candida albicans SC5314 putative nonsense-mediated decay helicase
           Dbp2 (CaO19.171), mRNA
          Length = 1332

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 189 ggttggccgatggctttgaagggcagggacgtgattggtattgc 232
           |||||||| ||||||||||  || |||||  |||||||||||||
Sbjct: 469 ggttggcctatggctttgagtggtagggatatgattggtattgc 512



to top

>ref|XM_705602.1| Candida albicans SC5314 putative nonsense-mediated decay helicase
           Dbp2 (CaO19.7804), mRNA
          Length = 1332

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 189 ggttggccgatggctttgaagggcagggacgtgattggtattgc 232
           |||||||| ||||||||||  || |||||  |||||||||||||
Sbjct: 469 ggttggcctatggctttgagtggtagggatatgattggtattgc 512



to top

>ref|XM_816398.1| Trypanosoma cruzi strain CL Brener ATP-dependent DEAD/H RNA
           helicase (Tc00.1047053510187.290) partial mRNA
          Length = 1788

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 564 gaggcagaccgtatgctcgatatgggttttga 595
           ||||| || ||||||||||||||||| |||||
Sbjct: 796 gaggccgatcgtatgctcgatatggggtttga 827



to top

>gb|BC060168.1| Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypeptide 47, mRNA (cDNA
           clone IMAGE:6826538), partial cds
          Length = 4039

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 231 gcagaaactggatctgggaaaaca 254
           |||||||| |||||||||||||||
Sbjct: 212 gcagaaacgggatctgggaaaaca 235



to top

>ref|XM_651823.1| Entamoeba histolytica HM-1:IMSS DEAD/DEAH box helicase, putative
           (6.t00035) partial mRNA
          Length = 1608

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 223 ttggtattgcagaaactggatctgggaaaaca 254
           ||||||||||||| |||||||| || ||||||
Sbjct: 581 ttggtattgcagagactggatcaggtaaaaca 612



to top

>ref|XM_759104.1| Theileria parva strain Muguga chromosome 4 RNA helicase (TP04_0562)
           partial mRNA
          Length = 1908

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 228 attgcagaaactggatctgg 247
           ||||||||||||||||||||
Sbjct: 757 attgcagaaactggatctgg 776



to top

>gb|AY274092.1| Coccyzus erythropthalmus phosphoenolpyruvate carboxykinase (PEPCK)
           gene, exon 9, intron 9, exon 10 and partial cds
          Length = 658

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 430 gagcacctaagggaccacaaatac 453
           ||||| ||||||||||||||||||
Sbjct: 485 gagcagctaagggaccacaaatac 508



to top

>emb|AL450389.12| Human DNA sequence from clone RP5-929G5 on chromosome 1 Contains the
             VANGL1 gene for vang-like 1 (van gogh, Drosophila), the 3'
             end of the CASQ2 gene for calsequestrin 2 (cardiac muscle)
             and one CpG island, complete sequence
          Length = 101623

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 356   ggctgttcaaatacaggcag 375
             ||||||||||||||||||||
Sbjct: 48002 ggctgttcaaatacaggcag 48021



to top

>gb|CP000284.1| Methylobacillus flagellatus KT, complete genome
          Length = 2971517

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                               
Query: 558     ctggatgaggcagaccgtatgctcgatatggg 589
               ||||||||||||||||| ||||| || |||||
Sbjct: 1145913 ctggatgaggcagaccgcatgctggacatggg 1145882



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                               
Query: 558     ctggatgaggcagaccgtatgctcgatatggg 589
               ||||||||||||||||| ||||| || |||||
Sbjct: 1002881 ctggatgaggcagaccgcatgctggacatggg 1002850



to top

>ref|XM_505193.1| Yarrowia lipolytica CLIB122, YALI0F09141g predicted mRNA
          Length = 3660

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 205  tgaagggcagggacgtgattggta 228
            ||||||||||||||| ||||||||
Sbjct: 1018 tgaagggcagggacgagattggta 995



to top

>emb|CR388143.6| Zebrafish DNA sequence from clone DKEY-189O20 in linkage group 21,
              complete sequence
          Length = 243457

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 348    agagaactggctgttcaaatacag 371
              |||||||| |||||||||||||||
Sbjct: 118236 agagaacttgctgttcaaatacag 118213



to top

>gb|AE008734.1| Salmonella typhimurium LT2, section 42 of 220 of the complete
           genome
          Length = 21522

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 558 ctggatgaggcagaccgtatgctcgatatggg 589
           |||||||| || ||||||||||| ||||||||
Sbjct: 608 ctggatgaagccgaccgtatgctggatatggg 639



to top

>gb|BC099397.1| Mus musculus RIKEN cDNA E330009P21 gene, mRNA (cDNA clone
           MGC:117557 IMAGE:30936381), complete cds
          Length = 1497

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 315 gatggcccaattgtcttgat 334
           ||||||||||||||||||||
Sbjct: 619 gatggcccaattgtcttgat 638



to top

>emb|BX897699.1| Bartonella henselae strain Houston-1, complete genome
          Length = 1931047

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                               
Query: 558     ctggatgaggcagaccgtatgctcgatatggg 589
               |||||||||||||| |||||| | ||||||||
Sbjct: 1176903 ctggatgaggcagatcgtatgttagatatggg 1176872



to top

>emb|AL627268.1| Salmonella enterica serovar Typhi (Salmonella typhi) strain CT18,
             complete chromosome; segment 4/20
          Length = 294050

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 558   ctggatgaggcagaccgtatgctcgatatggg 589
             |||||||| || ||||||||||| ||||||||
Sbjct: 90847 ctggatgaagccgaccgtatgctggatatggg 90878



to top

>emb|AL162756.2|NMA5Z2491 Neisseria meningitidis serogroup A strain Z2491 complete genome; segment
              5/7
          Length = 329861

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 570    gaccgtatgctcgatatgggtttt 593
              ||||||||||| ||||||||||||
Sbjct: 207992 gaccgtatgctggatatgggtttt 208015



to top

>gb|BC095944.1| Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypeptide 47, mRNA (cDNA
           clone MGC:106325 IMAGE:4935970), complete cds
          Length = 1762

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 231 gcagaaactggatctgggaaaaca 254
           |||||||| |||||||||||||||
Sbjct: 209 gcagaaacgggatctgggaaaaca 232



to top

>emb|BX647482.1|HSM807628 Homo sapiens genomic DNA; cDNA DKFZp686L02110 (from clone
            DKFZp686L02110)
          Length = 8436

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 197  gatggctttgaagggcaggg 216
            ||||||||||||||||||||
Sbjct: 2589 gatggctttgaagggcaggg 2608



to top

>emb|AJ719824.1| Gallus gallus mRNA for hypothetical protein, clone 6o10
          Length = 2510

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 231 gcagaaactggatctgggaaaaca 254
           ||||||||||| ||||||||||||
Sbjct: 224 gcagaaactggctctgggaaaaca 247



to top

>ref|NM_001007853.1| Gallus gallus DEAD (Asp-Glu-Ala-Asp) box polypeptide 47 (DDX47),
           mRNA
          Length = 2510

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 231 gcagaaactggatctgggaaaaca 254
           ||||||||||| ||||||||||||
Sbjct: 224 gcagaaactggctctgggaaaaca 247



to top

>gb|AC105094.6| Homo sapiens chromosome 18, clone RP11-1096D5, complete sequence
          Length = 210317

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 447    caaatacgtgacctcaggag 466
              ||||||||||||||||||||
Sbjct: 102923 caaatacgtgacctcaggag 102942



to top

>gb|AC110997.4| Homo sapiens chromosome 18, clone RP11-56J20, complete sequence
          Length = 160456

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 447    caaatacgtgacctcaggag 466
              ||||||||||||||||||||
Sbjct: 116420 caaatacgtgacctcaggag 116439



to top

>dbj|AK136136.1| Mus musculus in vitro fertilized eggs cDNA, RIKEN full-length
           enriched library, clone:7420462A02 product:Similar to
           F-box protein FBX12 homolog [Mus musculus], full insert
           sequence
          Length = 1755

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 315 gatggcccaattgtcttgat 334
           ||||||||||||||||||||
Sbjct: 634 gatggcccaattgtcttgat 653



to top

>dbj|AK135949.1| Mus musculus in vitro fertilized eggs cDNA, RIKEN full-length
           enriched library, clone:7420440J21 product:Similar to
           F-box protein FBX12 homolog [Mus musculus], full insert
           sequence
          Length = 2244

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 315 gatggcccaattgtcttgat 334
           ||||||||||||||||||||
Sbjct: 638 gatggcccaattgtcttgat 657



to top

>gb|AC106746.2| Homo sapiens chromosome 5 clone RP11-149E17, complete sequence
          Length = 179868

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 380    tacaaagtttggatcatact 399
              ||||||||||||||||||||
Sbjct: 173426 tacaaagtttggatcatact 173445



to top

>gb|L80215.1|HUM69DC8Z Homo sapiens (subclone 1_a7 from P1 H69) DNA sequence
          Length = 3296

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 380 tacaaagtttggatcatact 399
           ||||||||||||||||||||
Sbjct: 28  tacaaagtttggatcatact 47



to top

>ref|NM_199036.1| Mus musculus F-box and WD-40 domain protein 15 (Fbxw15), mRNA
          Length = 1488

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 315 gatggcccaattgtcttgat 334
           ||||||||||||||||||||
Sbjct: 637 gatggcccaattgtcttgat 656



to top

>dbj|AK010310.1| Mus musculus ES cells cDNA, RIKEN full-length enriched library,
           clone:2400010F03 product:DEAD BOX PROTEIN homolog [Homo
           sapiens], full insert sequence
          Length = 1752

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 231 gcagaaactggatctgggaaaaca 254
           |||||||| |||||||||||||||
Sbjct: 225 gcagaaacgggatctgggaaaaca 248



to top

>gb|AC154437.2| Mus musculus BAC clone RP24-194D17 from chromosome 13, complete
             sequence
          Length = 180558

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 235   aaactggatctgggaaaaca 254
             ||||||||||||||||||||
Sbjct: 95822 aaactggatctgggaaaaca 95803



to top

>dbj|AK087902.1| Mus musculus 2 days pregnant adult female ovary cDNA, RIKEN
           full-length enriched library, clone:E330038M07
           product:similar to F-box protein FBX12 (Fragment) [Mus
           musculus], full insert sequence
          Length = 910

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 315 gatggcccaattgtcttgat 334
           ||||||||||||||||||||
Sbjct: 636 gatggcccaattgtcttgat 655



to top

>gb|DQ067445.1| Mus musculus early ovarian protein-1 (Eop1) mRNA, complete cds
          Length = 1401

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 315 gatggcccaattgtcttgat 334
           ||||||||||||||||||||
Sbjct: 604 gatggcccaattgtcttgat 623



to top

>dbj|AK087710.1| Mus musculus 2 days pregnant adult female ovary cDNA, RIKEN
           full-length enriched library, clone:E330009P21
           product:similar to F-BOX PROTEIN FBX12 (FRAGMENT) [Mus
           musculus], full insert sequence
          Length = 1487

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 315 gatggcccaattgtcttgat 334
           ||||||||||||||||||||
Sbjct: 638 gatggcccaattgtcttgat 657



to top

>dbj|AK087669.1| Mus musculus 2 days pregnant adult female ovary cDNA, RIKEN
           full-length enriched library, clone:E330001M05
           product:similar to F-BOX PROTEIN FBX12 (FRAGMENT) [Mus
           musculus], full insert sequence
          Length = 1488

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 315 gatggcccaattgtcttgat 334
           ||||||||||||||||||||
Sbjct: 637 gatggcccaattgtcttgat 656



to top

>gb|BC103318.1| Bos taurus cDNA clone IMAGE:7941432, partial cds
          Length = 2409

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 438 aagggaccacaaatacgtga 457
           ||||||||||||||||||||
Sbjct: 790 aagggaccacaaatacgtga 809



to top

>dbj|AK076982.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:4930588A18 product:DEAD BOX PROTEIN
           homolog [Homo sapiens], full insert sequence
          Length = 1748

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 231 gcagaaactggatctgggaaaaca 254
           |||||||| |||||||||||||||
Sbjct: 217 gcagaaacgggatctgggaaaaca 240



to top

>ref|NM_001039431.1| Tribolium castaneum vasa RNA helicase (vasa), mRNA
          Length = 2183

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 230 tgcagaaactggatctgggaaaac 253
           |||| |||||||||||||||||||
Sbjct: 701 tgcacaaactggatctgggaaaac 724



to top

>tpg|BK001056.1| TPA: TPA_exp: Mus musculus kinesin-related protein KIF27A mRNA,
           complete cds
          Length = 4462

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 235 aaactggatctgggaaaaca 254
           ||||||||||||||||||||
Sbjct: 254 aaactggatctgggaaaaca 273



to top

>gb|AE002098.2| Neisseria meningitidis MC58, complete genome
          Length = 2272360

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 570     gaccgtatgctcgatatgggtttt 593
               ||||||||||| ||||||||||||
Sbjct: 1457322 gaccgtatgctggatatgggtttt 1457345



to top

>gb|AC147286.3| Pan troglodytes BAC clone RP43-75F15 from chromosome 7, complete
             sequence
          Length = 167461

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 197   gatggctttgaagggcaggg 216
             ||||||||||||||||||||
Sbjct: 54303 gatggctttgaagggcaggg 54284



to top

>gb|CP000026.1| Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150
          Length = 4585229

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                               
Query: 558     ctggatgaggcagaccgtatgctcgatatggg 589
               |||||||| || ||||||||||| ||||||||
Sbjct: 2014820 ctggatgaagccgaccgtatgctggatatggg 2014789



to top

>dbj|AK196692.1| Mus musculus cDNA, clone:Y1G0122J24, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000032326, based on BLAT search
          Length = 387

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 231 gcagaaactggatctgggaaaaca 254
           |||||||| |||||||||||||||
Sbjct: 151 gcagaaacgggatctgggaaaaca 174



to top

>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome
          Length = 7036071

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 515     ggaagctggtcacacaaacc 534
               ||||||||||||||||||||
Sbjct: 5296703 ggaagctggtcacacaaacc 5296722



to top

>emb|AL731729.10| Mouse DNA sequence from clone RP23-92L12 on chromosome X, complete
              sequence
          Length = 216656

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 367    tacaggcagaagctacaaag 386
              ||||||||||||||||||||
Sbjct: 146934 tacaggcagaagctacaaag 146953



to top

>gb|AC005534.2|AC005534 Homo sapiens PAC clone RP5-982E9 from 7q35-q36, complete sequence
          Length = 158219

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 197   gatggctttgaagggcaggg 216
             ||||||||||||||||||||
Sbjct: 85135 gatggctttgaagggcaggg 85154



to top

>gb|AC131718.5| Mus musculus BAC clone RP23-171B16 from 6, complete sequence
          Length = 199299

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 231    gcagaaactggatctgggaaaaca 254
              |||||||| |||||||||||||||
Sbjct: 196376 gcagaaacgggatctgggaaaaca 196353



to top

>gb|AE014613.1| Salmonella enterica subsp. enterica serovar Typhi Ty2, complete genome
          Length = 4791961

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                               
Query: 558     ctggatgaggcagaccgtatgctcgatatggg 589
               |||||||| || ||||||||||| ||||||||
Sbjct: 2131230 ctggatgaagccgaccgtatgctggatatggg 2131199



to top

>emb|AJ010934.1|RNO010934 Rattus norvegicus ddx5 gene, exons 2 to 5, partial
          Length = 894

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 237 actggatctgggaaaacactatct 260
           |||||||||||||||||| |||||
Sbjct: 719 actggatctgggaaaacattatct 742



to top

>gb|AE017220.1| Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67,
              complete genome
          Length = 4755700

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 558    ctggatgaggcagaccgtatgctcgatatggg 589
              |||||||| || ||||||||||| ||||||||
Sbjct: 914644 ctggatgaagccgaccgtatgctggatatggg 914675



to top

>gb|AY887136.1| Tribolium castaneum vasa RNA helicase mRNA, complete cds
          Length = 2183

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 230 tgcagaaactggatctgggaaaac 253
           |||| |||||||||||||||||||
Sbjct: 701 tgcacaaactggatctgggaaaac 724



to top

>gb|AC140287.3| Mus musculus BAC clone RP23-346L16 from 6, complete sequence
          Length = 213473

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 231    gcagaaactggatctgggaaaaca 254
              |||||||| |||||||||||||||
Sbjct: 110852 gcagaaacgggatctgggaaaaca 110829



to top

>gb|U17245.1|YSCL9328 Saccharomyces cerevisiae chromosome XII cosmid 9328
          Length = 14827

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 336   cttgctccaacaagagaactggct 359
             |||| |||||||||||||||||||
Sbjct: 10486 cttgttccaacaagagaactggct 10463



to top

>emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB122 of Yarrowia lipolytica
          Length = 4003362

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 205     tgaagggcagggacgtgattggta 228
               ||||||||||||||| ||||||||
Sbjct: 1276550 tgaagggcagggacgagattggta 1276527



to top

>gb|L81906.1|HSL81906 Homo sapiens (subclone 2_f8 from P1 H69) DNA sequence, complete
            sequence
          Length = 4059

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 380  tacaaagtttggatcatact 399
            ||||||||||||||||||||
Sbjct: 4006 tacaaagtttggatcatact 4025



to top

>gb|AC001214.1|HSAC001214 Homo sapiens (subclone 1_a7 from P1 H69) DNA sequence, complete
           sequence
          Length = 3296

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 380 tacaaagtttggatcatact 399
           ||||||||||||||||||||
Sbjct: 28  tacaaagtttggatcatact 47



to top

>emb|AL606529.9| Human DNA sequence from clone RP4-744B2 on chromosome 1, complete
             sequence
          Length = 66822

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 356   ggctgttcaaatacaggcag 375
             ||||||||||||||||||||
Sbjct: 15927 ggctgttcaaatacaggcag 15946



to top

>emb|X94313.1|MMHLR1 M.musculus Hlr1 gene
          Length = 4670

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 237  actggatctgggaaaacactatct 260
            |||||||||||||||||| |||||
Sbjct: 4078 actggatctgggaaaacattatct 4101



to top

>dbj|D86601.1| Bombyx mori BmVLG mRNA, complete cds
          Length = 2790

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 558  ctggatgaggcagaccgtatgctcgatatggg 589
            ||||||||||| ||||||||| | ||||||||
Sbjct: 1096 ctggatgaggctgaccgtatgttagatatggg 1127



to top

>dbj|AB048845.1| Aurelia aurita mRNA for PL10-related protein CnPL10, partial cds
          Length = 364

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 336 cttgctccaacaagagaact 355
           ||||||||||||||||||||
Sbjct: 131 cttgctccaacaagagaact 150



to top

>emb|AL603664.16| Mouse DNA sequence from clone RP23-247J12 on chromosome 11, complete
              sequence
          Length = 158098

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 237    actggatctgggaaaacactatct 260
              |||||||||||||||||| |||||
Sbjct: 141812 actggatctgggaaaacattatct 141789


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,924,250
Number of Sequences: 3902068
Number of extensions: 3924250
Number of successful extensions: 90040
Number of sequences better than 10.0: 245
Number of HSP's better than 10.0 without gapping: 245
Number of HSP's successfully gapped in prelim test: 4
Number of HSP's that attempted gapping in prelim test: 88917
Number of HSP's gapped (non-prelim): 1120
length of query: 597
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 574
effective length of database: 17,143,297,704
effective search space: 9840252882096
effective search space used: 9840252882096
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top