Clone Name | baalo14 |
---|---|
Clone Library Name | barley_pub |
No. | Definition | Score (bits) |
E Value |
1 | emb|CR626934.1| Triticum aestivum | 76 | 7e-11 | 2 | emb|CR626926.1| Aegilops tauschii | 76 | 7e-11 | 3 | dbj|AB088401.1| Aegilops speltoides DNA, centromeric repeat, clo... | 60 | 4e-06 | 4 | emb|AL603831.23| Human DNA sequence from clone RP11-486H9 on chr... | 40 | 3.8 | 5 | dbj|AB025389.1| Haliotis discus discus DNA, CA repeat region | 40 | 3.8 |
---|
>emb|CR626934.1| Triticum aestivum Length = 94398 Score = 75.8 bits (38), Expect = 7e-11 Identities = 41/42 (97%) Strand = Plus / Plus Query: 233 acattatcccccagtttaatttggatttatccatgttaaact 274 |||||| ||||||||||||||||||||||||||||||||||| Sbjct: 14104 acattagcccccagtttaatttggatttatccatgttaaact 14145
>emb|CR626926.1| Aegilops tauschii Length = 94421 Score = 75.8 bits (38), Expect = 7e-11 Identities = 41/42 (97%) Strand = Plus / Plus Query: 233 acattatcccccagtttaatttggatttatccatgttaaact 274 |||||| ||||||||||||||||||||||||||||||||||| Sbjct: 12202 acattagcccccagtttaatttggatttatccatgttaaact 12243
>dbj|AB088401.1| Aegilops speltoides DNA, centromeric repeat, clone:307-5, subclone:pBS301 Length = 1087 Score = 60.0 bits (30), Expect = 4e-06 Identities = 39/42 (92%) Strand = Plus / Plus Query: 233 acattatcccccagtttaatttggatttatccatgttaaact 274 |||||| |||||||||||||||| |||||||||| ||||||| Sbjct: 587 acattagcccccagtttaatttgaatttatccattttaaact 628
>emb|AL603831.23| Human DNA sequence from clone RP11-486H9 on chromosome 10 Contains the 3' end of the gene for adenovirus 5 E1A binding protein (BS69), the gene for a novel protein (KIAA0934) and four CpG islands, complete sequence Length = 179755 Score = 40.1 bits (20), Expect = 3.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 249 taatttggatttatccatgttaaa 272 ||||||| |||||||||||||||| Sbjct: 145409 taatttgtatttatccatgttaaa 145386
>dbj|AB025389.1| Haliotis discus discus DNA, CA repeat region Length = 407 Score = 40.1 bits (20), Expect = 3.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 203 tggggtatccatgttaaact 222 |||||||||||||||||||| Sbjct: 185 tggggtatccatgttaaact 204 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,943,089 Number of Sequences: 3902068 Number of extensions: 1943089 Number of successful extensions: 34564 Number of sequences better than 10.0: 5 Number of HSP's better than 10.0 without gapping: 5 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 34556 Number of HSP's gapped (non-prelim): 8 length of query: 292 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 270 effective length of database: 17,147,199,772 effective search space: 4629743938440 effective search space used: 4629743938440 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)