>emb|CR626934.1| Triticum aestivum
          Length = 94398

 Score = 75.8 bits (38), Expect = 7e-11
 Identities = 41/42 (97%)
 Strand = Plus / Plus

                                                       
Query: 233   acattatcccccagtttaatttggatttatccatgttaaact 274
             |||||| |||||||||||||||||||||||||||||||||||
Sbjct: 14104 acattagcccccagtttaatttggatttatccatgttaaact 14145

>emb|CR626926.1| Aegilops tauschii
          Length = 94421

 Score = 75.8 bits (38), Expect = 7e-11
 Identities = 41/42 (97%)
 Strand = Plus / Plus

                                                       
Query: 233   acattatcccccagtttaatttggatttatccatgttaaact 274
             |||||| |||||||||||||||||||||||||||||||||||
Sbjct: 12202 acattagcccccagtttaatttggatttatccatgttaaact 12243

>dbj|AB088401.1| Aegilops speltoides DNA, centromeric repeat, clone:307-5,
           subclone:pBS301
          Length = 1087

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 233 acattatcccccagtttaatttggatttatccatgttaaact 274
           |||||| |||||||||||||||| |||||||||| |||||||
Sbjct: 587 acattagcccccagtttaatttgaatttatccattttaaact 628

>emb|AL603831.23| Human DNA sequence from clone RP11-486H9 on chromosome 10 Contains the 3'
              end of the gene for adenovirus 5 E1A binding protein
              (BS69), the gene for a novel protein (KIAA0934) and four
              CpG islands, complete sequence
          Length = 179755

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 249    taatttggatttatccatgttaaa 272
              ||||||| ||||||||||||||||
Sbjct: 145409 taatttgtatttatccatgttaaa 145386

>dbj|AB025389.1| Haliotis discus discus DNA, CA repeat region
          Length = 407

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 203 tggggtatccatgttaaact 222
           ||||||||||||||||||||
Sbjct: 185 tggggtatccatgttaaact 204


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,943,089
Number of Sequences: 3902068
Number of extensions: 1943089
Number of successful extensions: 34564
Number of sequences better than 10.0: 5
Number of HSP's better than 10.0 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 34556
Number of HSP's gapped (non-prelim): 8
length of query: 292
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 270
effective length of database: 17,147,199,772
effective search space: 4629743938440
effective search space used: 4629743938440
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)