ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | baaln15 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY105417.1| Zea mays PCO109699 mRNA sequence Length = 1103 Score = 670 bits (338), Expect = 0.0 Identities = 511/568 (89%), Gaps = 3/568 (0%) Strand = Plus / Plus Query: 33 cagccgccggcgaaatggctcctaagcgaggcggcaaggcgcctgtcccggcgaagaaga 92 ||||||||||| ||||||| || ||| ||||||| | |||||| ||||| || ||||||| Sbjct: 56 cagccgccggcaaaatggccccgaagagaggcggtagggcgccggtccccgccaagaaga 115 Query: 93 aaacggaaaaggtgaccaatccgctgttcgagaagaggccgaagcaatttggcatcggcg 152 | ||| |||||| || ||||| |||||||||||||||||||| ||||| ||||||| Sbjct: 116 aggcggt---ggtgacgaacccgctcttcgagaagaggccgaagcagtttgggatcggcg 172 Query: 153 gcgccctcccgcccaagaaggacctccaccgcttcgttaagtggcccaaggttgtgcgca 212 ||||||| ||||||||||||||||||||||||||||| |||||||||||||| ||||||| Sbjct: 173 gcgcccttccgcccaagaaggacctccaccgcttcgtcaagtggcccaaggtcgtgcgca 232 Query: 213 tccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcccccggcacttcaccagt 272 ||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| Sbjct: 233 tccagcgccagcgccgcatcctcaagcagcgcctcaaggtgcccccggcgctcaaccagt 292 Query: 273 tcacccgcaccctcgacaagaaccttgcaacgaacttgttcaagatgcttcttaagtacc 332 |||| || ||||||||||||||||||||||| |||||||||||||||||||||||||||| Sbjct: 293 tcacacgtaccctcgacaagaaccttgcaacaaacttgttcaagatgcttcttaagtacc 352 Query: 333 gtcccgaagacaaagttgccaagaaggagaggcttctaaagagggcccaggctgaagccg 392 | ||||| ||||||| |||||||||||||||||| | |||||||||||||||||| || Sbjct: 353 gccccgaggacaaagctgccaagaaggagaggctcttgaagagggcccaggctgaaaacg 412 Query: 393 aagggaaaactgttgaggcaaagaagccaattgttgtgaaatatggccttaaccatgtta 452 | ||||||||||||||| ||||||| |||||||||||||| || |||||||||||||| | Sbjct: 413 aggggaaaactgttgagtcaaagaaaccaattgttgtgaagtacggccttaaccatgtga 472 Query: 453 cctacctaattgaacagagtaaagcccagctggttgtcatagctcatgatgttgatccga 512 | ||||| || || ||||| || ||||||||||||||||||||||||||||||||||||| Sbjct: 473 cttacctcatcgagcagagcaaggcccagctggttgtcatagctcatgatgttgatccga 532 Query: 513 ttgagctggttgtgtggctccctgccctttgcaggaaaatggaggtcccttactgcattg 572 | |||||||| ||||||||||| ||||||||||||||||||||||| || |||||||||| Sbjct: 533 tcgagctggtcgtgtggctcccggccctttgcaggaaaatggaggttccatactgcattg 592 Query: 573 ttaagggaaaatctcgccttggatcgat 600 | ||||||||| | |||||||||||||| Sbjct: 593 tcaagggaaaagcacgccttggatcgat 620
>dbj|AK061725.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-B03, full insert sequence Length = 1055 Score = 660 bits (333), Expect = 0.0 Identities = 507/565 (89%) Strand = Plus / Plus Query: 39 ccggcgaaatggctcctaagcgaggcggcaaggcgcctgtcccggcgaagaagaaaacgg 98 ||||||||||||| || ||||||||||||| |||||| || |||||||||||||| |||| Sbjct: 71 ccggcgaaatggcaccgaagcgaggcggcagggcgccggtgccggcgaagaagaagacgg 130 Query: 99 aaaaggtgaccaatccgctgttcgagaagaggccgaagcaatttggcatcggcggcgccc 158 | ||||||||||| |||||||||||||||||||||||||| || |||||||||||||| | Sbjct: 131 agaaggtgaccaacccgctgttcgagaagaggccgaagcagttcggcatcggcggcgcgc 190 Query: 159 tcccgcccaagaaggacctccaccgcttcgttaagtggcccaaggttgtgcgcatccagc 218 | || ||||||||||| || ||| | ||||| |||||||||||||| ||||||||||||| Sbjct: 191 tgccacccaagaaggatctgcacaggttcgtgaagtggcccaaggtggtgcgcatccagc 250 Query: 219 gccagcgccgcatcctcaagcagcgcctcaaggtgcccccggcacttcaccagttcaccc 278 |||||||||||||||||||||||||||||||||| |||||||| || |||||||||||| Sbjct: 251 gccagcgccgcatcctcaagcagcgcctcaaggttcccccggcgctcaaccagttcaccc 310 Query: 279 gcaccctcgacaagaaccttgcaacgaacttgttcaagatgcttcttaagtaccgtcccg 338 ||||||||||||||||||| ||||| ||| |||| ||||||||||| |||||||| || | Sbjct: 311 gcaccctcgacaagaacctcgcaaccaacctgtttaagatgcttctcaagtaccgccctg 370 Query: 339 aagacaaagttgccaagaaggagaggcttctaaagagggcccaggctgaagccgaaggga 398 | ||||| | ||||||||||||||||||| | ||||||||||||||||| || ||||||| Sbjct: 371 aggacaaggctgccaagaaggagaggcttttgaagagggcccaggctgaggctgaaggga 430 Query: 399 aaactgttgaggcaaagaagccaattgttgtgaaatatggccttaaccatgttacctacc 458 |||| |||||||| |||||||||||||||||||| ||||| |||||||| || || |||| Sbjct: 431 aaaccgttgaggccaagaagccaattgttgtgaagtatggtcttaaccacgtgacttacc 490 Query: 459 taattgaacagagtaaagcccagctggttgtcatagctcatgatgttgatccgattgagc 518 | ||||| ||||| || ||||||||||||||||| ||||||||||||||||| ||||||| Sbjct: 491 tcattgagcagagcaaggcccagctggttgtcatcgctcatgatgttgatccaattgagc 550 Query: 519 tggttgtgtggctccctgccctttgcaggaaaatggaggtcccttactgcattgttaagg 578 ||||||||||||| || ||||| || ||||| |||||||||||||||||||| ||||||| Sbjct: 551 tggttgtgtggcttccagccctgtgtaggaagatggaggtcccttactgcatcgttaagg 610 Query: 579 gaaaatctcgccttggatcgattgt 603 | ||| ||||||||||||||||||| Sbjct: 611 gcaaagctcgccttggatcgattgt 635
>ref|XM_481630.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1023 Score = 613 bits (309), Expect = e-172 Identities = 501/565 (88%) Strand = Plus / Plus Query: 39 ccggcgaaatggctcctaagcgaggcggcaaggcgcctgtcccggcgaagaagaaaacgg 98 ||||||||||||| || ||||||||||||| |||||| || |||||||||||||| |||| Sbjct: 82 ccggcgaaatggccccgaagcgaggcggcagggcgccggtgccggcgaagaagaagacgg 141 Query: 99 aaaaggtgaccaatccgctgttcgagaagaggccgaagcaatttggcatcggcggcgccc 158 | |||||||| || |||||||||||||||||||||||||| || || ||||||||||| | Sbjct: 142 agaaggtgacgaacccgctgttcgagaagaggccgaagcagttcggaatcggcggcgcgc 201 Query: 159 tcccgcccaagaaggacctccaccgcttcgttaagtggcccaaggttgtgcgcatccagc 218 | ||||||||||||||||| ||||| ||||| |||||||||||||| ||||||||||||| Sbjct: 202 tgccgcccaagaaggaccttcaccggttcgtcaagtggcccaaggtggtgcgcatccagc 261 Query: 219 gccagcgccgcatcctcaagcagcgcctcaaggtgcccccggcacttcaccagttcaccc 278 ||||||||||||||||||||||||||||||||||||||||||| || |||||||||| | Sbjct: 262 gccagcgccgcatcctcaagcagcgcctcaaggtgcccccggcgctcaaccagttcactc 321 Query: 279 gcaccctcgacaagaaccttgcaacgaacttgttcaagatgcttcttaagtaccgtcccg 338 ||||||||||||||||||| ||||| || |||| |||||||| || |||||||| || | Sbjct: 322 gcaccctcgacaagaacctcgcaactaatctgtttaagatgctcctcaagtaccgccctg 381 Query: 339 aagacaaagttgccaagaaggagaggcttctaaagagggcccaggctgaagccgaaggga 398 | ||||| | ||| ||||||||||||||| | ||||||||||||||||| || ||||| | Sbjct: 382 aggacaaggctgctaagaaggagaggcttttgaagagggcccaggctgaggctgaaggta 441 Query: 399 aaactgttgaggcaaagaagccaattgttgtgaaatatggccttaaccatgttacctacc 458 |||| |||||||||||||| |||||||||||||| ||||| ||||||||||| || |||| Sbjct: 442 aaaccgttgaggcaaagaaaccaattgttgtgaagtatggtcttaaccatgtcacatacc 501 Query: 459 taattgaacagagtaaagcccagctggttgtcatagctcatgatgttgatccgattgagc 518 | ||||| ||||| || ||||| ||||| ||||| ||||||||||| ||||||||||||| Sbjct: 502 tcattgagcagagcaaggcccaactggtcgtcattgctcatgatgtcgatccgattgagc 561 Query: 519 tggttgtgtggctccctgccctttgcaggaaaatggaggtcccttactgcattgttaagg 578 ||||||||||||| || ||||| |||||||| ||||||||||||||||||||||| || | Sbjct: 562 tggttgtgtggcttccagccctgtgcaggaagatggaggtcccttactgcattgtgaaag 621 Query: 579 gaaaatctcgccttggatcgattgt 603 ||||| | || |||||||| ||||| Sbjct: 622 gaaaagcccgtcttggatcaattgt 646
>ref|XM_507578.1| PREDICTED Oryza sativa (japonica cultivar-group), P0703C03.43 mRNA Length = 1041 Score = 613 bits (309), Expect = e-172 Identities = 501/565 (88%) Strand = Plus / Plus Query: 39 ccggcgaaatggctcctaagcgaggcggcaaggcgcctgtcccggcgaagaagaaaacgg 98 ||||||||||||| || ||||||||||||| |||||| || |||||||||||||| |||| Sbjct: 83 ccggcgaaatggccccgaagcgaggcggcagggcgccggtgccggcgaagaagaagacgg 142 Query: 99 aaaaggtgaccaatccgctgttcgagaagaggccgaagcaatttggcatcggcggcgccc 158 | |||||||| || |||||||||||||||||||||||||| || || ||||||||||| | Sbjct: 143 agaaggtgacgaacccgctgttcgagaagaggccgaagcagttcggaatcggcggcgcgc 202 Query: 159 tcccgcccaagaaggacctccaccgcttcgttaagtggcccaaggttgtgcgcatccagc 218 | ||||||||||||||||| ||||| ||||| |||||||||||||| ||||||||||||| Sbjct: 203 tgccgcccaagaaggaccttcaccggttcgtcaagtggcccaaggtggtgcgcatccagc 262 Query: 219 gccagcgccgcatcctcaagcagcgcctcaaggtgcccccggcacttcaccagttcaccc 278 ||||||||||||||||||||||||||||||||||||||||||| || |||||||||| | Sbjct: 263 gccagcgccgcatcctcaagcagcgcctcaaggtgcccccggcgctcaaccagttcactc 322 Query: 279 gcaccctcgacaagaaccttgcaacgaacttgttcaagatgcttcttaagtaccgtcccg 338 ||||||||||||||||||| ||||| || |||| |||||||| || |||||||| || | Sbjct: 323 gcaccctcgacaagaacctcgcaactaatctgtttaagatgctcctcaagtaccgccctg 382 Query: 339 aagacaaagttgccaagaaggagaggcttctaaagagggcccaggctgaagccgaaggga 398 | ||||| | ||| ||||||||||||||| | ||||||||||||||||| || ||||| | Sbjct: 383 aggacaaggctgctaagaaggagaggcttttgaagagggcccaggctgaggctgaaggta 442 Query: 399 aaactgttgaggcaaagaagccaattgttgtgaaatatggccttaaccatgttacctacc 458 |||| |||||||||||||| |||||||||||||| ||||| ||||||||||| || |||| Sbjct: 443 aaaccgttgaggcaaagaaaccaattgttgtgaagtatggtcttaaccatgtcacatacc 502 Query: 459 taattgaacagagtaaagcccagctggttgtcatagctcatgatgttgatccgattgagc 518 | ||||| ||||| || ||||| ||||| ||||| ||||||||||| ||||||||||||| Sbjct: 503 tcattgagcagagcaaggcccaactggtcgtcattgctcatgatgtcgatccgattgagc 562 Query: 519 tggttgtgtggctccctgccctttgcaggaaaatggaggtcccttactgcattgttaagg 578 ||||||||||||| || ||||| |||||||| ||||||||||||||||||||||| || | Sbjct: 563 tggttgtgtggcttccagccctgtgcaggaagatggaggtcccttactgcattgtgaaag 622 Query: 579 gaaaatctcgccttggatcgattgt 603 ||||| | || |||||||| ||||| Sbjct: 623 gaaaagcccgtcttggatcaattgt 647
>ref|XM_507194.2| PREDICTED Oryza sativa (japonica cultivar-group), P0703C03.43 mRNA Length = 1091 Score = 613 bits (309), Expect = e-172 Identities = 501/565 (88%) Strand = Plus / Plus Query: 39 ccggcgaaatggctcctaagcgaggcggcaaggcgcctgtcccggcgaagaagaaaacgg 98 ||||||||||||| || ||||||||||||| |||||| || |||||||||||||| |||| Sbjct: 86 ccggcgaaatggccccgaagcgaggcggcagggcgccggtgccggcgaagaagaagacgg 145 Query: 99 aaaaggtgaccaatccgctgttcgagaagaggccgaagcaatttggcatcggcggcgccc 158 | |||||||| || |||||||||||||||||||||||||| || || ||||||||||| | Sbjct: 146 agaaggtgacgaacccgctgttcgagaagaggccgaagcagttcggaatcggcggcgcgc 205 Query: 159 tcccgcccaagaaggacctccaccgcttcgttaagtggcccaaggttgtgcgcatccagc 218 | ||||||||||||||||| ||||| ||||| |||||||||||||| ||||||||||||| Sbjct: 206 tgccgcccaagaaggaccttcaccggttcgtcaagtggcccaaggtggtgcgcatccagc 265 Query: 219 gccagcgccgcatcctcaagcagcgcctcaaggtgcccccggcacttcaccagttcaccc 278 ||||||||||||||||||||||||||||||||||||||||||| || |||||||||| | Sbjct: 266 gccagcgccgcatcctcaagcagcgcctcaaggtgcccccggcgctcaaccagttcactc 325 Query: 279 gcaccctcgacaagaaccttgcaacgaacttgttcaagatgcttcttaagtaccgtcccg 338 ||||||||||||||||||| ||||| || |||| |||||||| || |||||||| || | Sbjct: 326 gcaccctcgacaagaacctcgcaactaatctgtttaagatgctcctcaagtaccgccctg 385 Query: 339 aagacaaagttgccaagaaggagaggcttctaaagagggcccaggctgaagccgaaggga 398 | ||||| | ||| ||||||||||||||| | ||||||||||||||||| || ||||| | Sbjct: 386 aggacaaggctgctaagaaggagaggcttttgaagagggcccaggctgaggctgaaggta 445 Query: 399 aaactgttgaggcaaagaagccaattgttgtgaaatatggccttaaccatgttacctacc 458 |||| |||||||||||||| |||||||||||||| ||||| ||||||||||| || |||| Sbjct: 446 aaaccgttgaggcaaagaaaccaattgttgtgaagtatggtcttaaccatgtcacatacc 505 Query: 459 taattgaacagagtaaagcccagctggttgtcatagctcatgatgttgatccgattgagc 518 | ||||| ||||| || ||||| ||||| ||||| ||||||||||| ||||||||||||| Sbjct: 506 tcattgagcagagcaaggcccaactggtcgtcattgctcatgatgtcgatccgattgagc 565 Query: 519 tggttgtgtggctccctgccctttgcaggaaaatggaggtcccttactgcattgttaagg 578 ||||||||||||| || ||||| |||||||| ||||||||||||||||||||||| || | Sbjct: 566 tggttgtgtggcttccagccctgtgcaggaagatggaggtcccttactgcattgtgaaag 625 Query: 579 gaaaatctcgccttggatcgattgt 603 ||||| | || |||||||| ||||| Sbjct: 626 gaaaagcccgtcttggatcaattgt 650
>dbj|AK121204.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023087N22, full insert sequence Length = 1091 Score = 613 bits (309), Expect = e-172 Identities = 501/565 (88%) Strand = Plus / Plus Query: 39 ccggcgaaatggctcctaagcgaggcggcaaggcgcctgtcccggcgaagaagaaaacgg 98 ||||||||||||| || ||||||||||||| |||||| || |||||||||||||| |||| Sbjct: 86 ccggcgaaatggccccgaagcgaggcggcagggcgccggtgccggcgaagaagaagacgg 145 Query: 99 aaaaggtgaccaatccgctgttcgagaagaggccgaagcaatttggcatcggcggcgccc 158 | |||||||| || |||||||||||||||||||||||||| || || ||||||||||| | Sbjct: 146 agaaggtgacgaacccgctgttcgagaagaggccgaagcagttcggaatcggcggcgcgc 205 Query: 159 tcccgcccaagaaggacctccaccgcttcgttaagtggcccaaggttgtgcgcatccagc 218 | ||||||||||||||||| ||||| ||||| |||||||||||||| ||||||||||||| Sbjct: 206 tgccgcccaagaaggaccttcaccggttcgtcaagtggcccaaggtggtgcgcatccagc 265 Query: 219 gccagcgccgcatcctcaagcagcgcctcaaggtgcccccggcacttcaccagttcaccc 278 ||||||||||||||||||||||||||||||||||||||||||| || |||||||||| | Sbjct: 266 gccagcgccgcatcctcaagcagcgcctcaaggtgcccccggcgctcaaccagttcactc 325 Query: 279 gcaccctcgacaagaaccttgcaacgaacttgttcaagatgcttcttaagtaccgtcccg 338 ||||||||||||||||||| ||||| || |||| |||||||| || |||||||| || | Sbjct: 326 gcaccctcgacaagaacctcgcaactaatctgtttaagatgctcctcaagtaccgccctg 385 Query: 339 aagacaaagttgccaagaaggagaggcttctaaagagggcccaggctgaagccgaaggga 398 | ||||| | ||| ||||||||||||||| | ||||||||||||||||| || ||||| | Sbjct: 386 aggacaaggctgctaagaaggagaggcttttgaagagggcccaggctgaggctgaaggta 445 Query: 399 aaactgttgaggcaaagaagccaattgttgtgaaatatggccttaaccatgttacctacc 458 |||| |||||||||||||| |||||||||||||| ||||| ||||||||||| || |||| Sbjct: 446 aaaccgttgaggcaaagaaaccaattgttgtgaagtatggtcttaaccatgtcacatacc 505 Query: 459 taattgaacagagtaaagcccagctggttgtcatagctcatgatgttgatccgattgagc 518 | ||||| ||||| || ||||| ||||| ||||| ||||||||||| ||||||||||||| Sbjct: 506 tcattgagcagagcaaggcccaactggtcgtcattgctcatgatgtcgatccgattgagc 565 Query: 519 tggttgtgtggctccctgccctttgcaggaaaatggaggtcccttactgcattgttaagg 578 ||||||||||||| || ||||| |||||||| ||||||||||||||||||||||| || | Sbjct: 566 tggttgtgtggcttccagccctgtgcaggaagatggaggtcccttactgcattgtgaaag 625 Query: 579 gaaaatctcgccttggatcgattgt 603 ||||| | || |||||||| ||||| Sbjct: 626 gaaaagcccgtcttggatcaattgt 650
>dbj|AK098843.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000B08, full insert sequence Length = 1022 Score = 613 bits (309), Expect = e-172 Identities = 501/565 (88%) Strand = Plus / Plus Query: 39 ccggcgaaatggctcctaagcgaggcggcaaggcgcctgtcccggcgaagaagaaaacgg 98 ||||||||||||| || ||||||||||||| |||||| || |||||||||||||| |||| Sbjct: 82 ccggcgaaatggccccgaagcgaggcggcagggcgccggtgccggcgaagaagaagacgg 141 Query: 99 aaaaggtgaccaatccgctgttcgagaagaggccgaagcaatttggcatcggcggcgccc 158 | |||||||| || |||||||||||||||||||||||||| || || ||||||||||| | Sbjct: 142 agaaggtgacgaacccgctgttcgagaagaggccgaagcagttcggaatcggcggcgcgc 201 Query: 159 tcccgcccaagaaggacctccaccgcttcgttaagtggcccaaggttgtgcgcatccagc 218 | ||||||||||||||||| ||||| ||||| |||||||||||||| ||||||||||||| Sbjct: 202 tgccgcccaagaaggaccttcaccggttcgtcaagtggcccaaggtggtgcgcatccagc 261 Query: 219 gccagcgccgcatcctcaagcagcgcctcaaggtgcccccggcacttcaccagttcaccc 278 ||||||||||||||||||||||||||||||||||||||||||| || |||||||||| | Sbjct: 262 gccagcgccgcatcctcaagcagcgcctcaaggtgcccccggcgctcaaccagttcactc 321 Query: 279 gcaccctcgacaagaaccttgcaacgaacttgttcaagatgcttcttaagtaccgtcccg 338 ||||||||||||||||||| ||||| || |||| |||||||| || |||||||| || | Sbjct: 322 gcaccctcgacaagaacctcgcaactaatctgtttaagatgctcctcaagtaccgccctg 381 Query: 339 aagacaaagttgccaagaaggagaggcttctaaagagggcccaggctgaagccgaaggga 398 | ||||| | ||| ||||||||||||||| | ||||||||||||||||| || ||||| | Sbjct: 382 aggacaaggctgctaagaaggagaggcttttgaagagggcccaggctgaggctgaaggta 441 Query: 399 aaactgttgaggcaaagaagccaattgttgtgaaatatggccttaaccatgttacctacc 458 |||| |||||||||||||| |||||||||||||| ||||| ||||||||||| || |||| Sbjct: 442 aaaccgttgaggcaaagaaaccaattgttgtgaagtatggtcttaaccatgtcacatacc 501 Query: 459 taattgaacagagtaaagcccagctggttgtcatagctcatgatgttgatccgattgagc 518 | ||||| ||||| || ||||| ||||| ||||| ||||||||||| ||||||||||||| Sbjct: 502 tcattgagcagagcaaggcccaactggtcgtcattgctcatgatgtcgatccgattgagc 561 Query: 519 tggttgtgtggctccctgccctttgcaggaaaatggaggtcccttactgcattgttaagg 578 ||||||||||||| || ||||| |||||||| ||||||||||||||||||||||| || | Sbjct: 562 tggttgtgtggcttccagccctgtgcaggaagatggaggtcccttactgcattgtgaaag 621 Query: 579 gaaaatctcgccttggatcgattgt 603 ||||| | || |||||||| ||||| Sbjct: 622 gaaaagcccgtcttggatcaattgt 646
>dbj|AK062210.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-047-A04, full insert sequence Length = 1041 Score = 613 bits (309), Expect = e-172 Identities = 501/565 (88%) Strand = Plus / Plus Query: 39 ccggcgaaatggctcctaagcgaggcggcaaggcgcctgtcccggcgaagaagaaaacgg 98 ||||||||||||| || ||||||||||||| |||||| || |||||||||||||| |||| Sbjct: 83 ccggcgaaatggccccgaagcgaggcggcagggcgccggtgccggcgaagaagaagacgg 142 Query: 99 aaaaggtgaccaatccgctgttcgagaagaggccgaagcaatttggcatcggcggcgccc 158 | |||||||| || |||||||||||||||||||||||||| || || ||||||||||| | Sbjct: 143 agaaggtgacgaacccgctgttcgagaagaggccgaagcagttcggaatcggcggcgcgc 202 Query: 159 tcccgcccaagaaggacctccaccgcttcgttaagtggcccaaggttgtgcgcatccagc 218 | ||||||||||||||||| ||||| ||||| |||||||||||||| ||||||||||||| Sbjct: 203 tgccgcccaagaaggaccttcaccggttcgtcaagtggcccaaggtggtgcgcatccagc 262 Query: 219 gccagcgccgcatcctcaagcagcgcctcaaggtgcccccggcacttcaccagttcaccc 278 ||||||||||||||||||||||||||||||||||||||||||| || |||||||||| | Sbjct: 263 gccagcgccgcatcctcaagcagcgcctcaaggtgcccccggcgctcaaccagttcactc 322 Query: 279 gcaccctcgacaagaaccttgcaacgaacttgttcaagatgcttcttaagtaccgtcccg 338 ||||||||||||||||||| ||||| || |||| |||||||| || |||||||| || | Sbjct: 323 gcaccctcgacaagaacctcgcaactaatctgtttaagatgctcctcaagtaccgccctg 382 Query: 339 aagacaaagttgccaagaaggagaggcttctaaagagggcccaggctgaagccgaaggga 398 | ||||| | ||| ||||||||||||||| | ||||||||||||||||| || ||||| | Sbjct: 383 aggacaaggctgctaagaaggagaggcttttgaagagggcccaggctgaggctgaaggta 442 Query: 399 aaactgttgaggcaaagaagccaattgttgtgaaatatggccttaaccatgttacctacc 458 |||| |||||||||||||| |||||||||||||| ||||| ||||||||||| || |||| Sbjct: 443 aaaccgttgaggcaaagaaaccaattgttgtgaagtatggtcttaaccatgtcacatacc 502 Query: 459 taattgaacagagtaaagcccagctggttgtcatagctcatgatgttgatccgattgagc 518 | ||||| ||||| || ||||| ||||| ||||| ||||||||||| ||||||||||||| Sbjct: 503 tcattgagcagagcaaggcccaactggtcgtcattgctcatgatgtcgatccgattgagc 562 Query: 519 tggttgtgtggctccctgccctttgcaggaaaatggaggtcccttactgcattgttaagg 578 ||||||||||||| || ||||| |||||||| ||||||||||||||||||||||| || | Sbjct: 563 tggttgtgtggcttccagccctgtgcaggaagatggaggtcccttactgcattgtgaaag 622 Query: 579 gaaaatctcgccttggatcgattgt 603 ||||| | || |||||||| ||||| Sbjct: 623 gaaaagcccgtcttggatcaattgt 647
>dbj|D12631.1|RICRPL7AB Oryza sativa (japonica cultivar-group) mRNA for ribosomal protein L7A, complete cds Length = 954 Score = 613 bits (309), Expect = e-172 Identities = 501/565 (88%) Strand = Plus / Plus Query: 39 ccggcgaaatggctcctaagcgaggcggcaaggcgcctgtcccggcgaagaagaaaacgg 98 ||||||||||||| || ||||||||||||| |||||| || |||||||||||||| |||| Sbjct: 13 ccggcgaaatggccccgaagcgaggcggcagggcgccggtgccggcgaagaagaagacgg 72 Query: 99 aaaaggtgaccaatccgctgttcgagaagaggccgaagcaatttggcatcggcggcgccc 158 | |||||||| || |||||||||||||||||||||||||| || || ||||||||||| | Sbjct: 73 agaaggtgacgaacccgctgttcgagaagaggccgaagcagttcggaatcggcggcgcgc 132 Query: 159 tcccgcccaagaaggacctccaccgcttcgttaagtggcccaaggttgtgcgcatccagc 218 | ||||||||||||||||| ||||| ||||| |||||||||||||| ||||||||||||| Sbjct: 133 tgccgcccaagaaggaccttcaccggttcgtcaagtggcccaaggtggtgcgcatccagc 192 Query: 219 gccagcgccgcatcctcaagcagcgcctcaaggtgcccccggcacttcaccagttcaccc 278 ||||||||||||||||||||||||||||||||||||||||||| || |||||||||| | Sbjct: 193 gccagcgccgcatcctcaagcagcgcctcaaggtgcccccggcgctcaaccagttcactc 252 Query: 279 gcaccctcgacaagaaccttgcaacgaacttgttcaagatgcttcttaagtaccgtcccg 338 ||||||||||||||||||| ||||| || |||| |||||||| || |||||||| || | Sbjct: 253 gcaccctcgacaagaacctcgcaactaatctgtttaagatgctcctcaagtaccgccctg 312 Query: 339 aagacaaagttgccaagaaggagaggcttctaaagagggcccaggctgaagccgaaggga 398 | ||||| | ||| ||||||||||||||| | ||||||||||||||||| || ||||| | Sbjct: 313 aggacaaggctgctaagaaggagaggcttttgaagagggcccaggctgaggctgaaggta 372 Query: 399 aaactgttgaggcaaagaagccaattgttgtgaaatatggccttaaccatgttacctacc 458 |||| |||||||||||||| |||||||||||||| ||||| ||||||||||| || |||| Sbjct: 373 aaaccgttgaggcaaagaaaccaattgttgtgaagtatggtcttaaccatgtcacatacc 432 Query: 459 taattgaacagagtaaagcccagctggttgtcatagctcatgatgttgatccgattgagc 518 | ||||| ||||| || ||||| ||||| ||||| ||||||||||| ||||||||||||| Sbjct: 433 tcattgagcagagcaaggcccaactggtcgtcattgctcatgatgtcgatccgattgagc 492 Query: 519 tggttgtgtggctccctgccctttgcaggaaaatggaggtcccttactgcattgttaagg 578 ||||||||||||| || ||||| |||||||| ||||||||||||||||||||||| || | Sbjct: 493 tggttgtgtggcttccagccctgtgcaggaagatggaggtcccttactgcattgtgaaag 552 Query: 579 gaaaatctcgccttggatcgattgt 603 ||||| | || |||||||| ||||| Sbjct: 553 gaaaagcccgtcttggatcaattgt 577
>gb|AY103834.1| Zea mays PCO109701 mRNA sequence Length = 1105 Score = 565 bits (285), Expect = e-158 Identities = 495/565 (87%) Strand = Plus / Plus Query: 39 ccggcgaaatggctcctaagcgaggcggcaaggcgcctgtcccggcgaagaagaaaacgg 98 ||||||||||||| || |||||||| |||| |||||| || ||||| |||||||| |||| Sbjct: 64 ccggcgaaatggcccccaagcgaggtggcagggcgccggtgccggccaagaagaagacgg 123 Query: 99 aaaaggtgaccaatccgctgttcgagaagaggccgaagcaatttggcatcggcggcgccc 158 | || ||||| || || || |||||||||||||||||||| || |||||||||||||| Sbjct: 124 ataaagtgacgaaccctctattcgagaagaggccgaagcagttcggcatcggcggcgcgt 183 Query: 159 tcccgcccaagaaggacctccaccgcttcgttaagtggcccaaggttgtgcgcatccagc 218 | ||||||||||||||||| ||||| ||||| |||||||||||||| ||||| ||||||| Sbjct: 184 tgccgcccaagaaggacctgcaccggttcgtcaagtggcccaaggtcgtgcgtatccagc 243 Query: 219 gccagcgccgcatcctcaagcagcgcctcaaggtgcccccggcacttcaccagttcaccc 278 | |||||||||||||||||||||||||||||||| || ||||| || |||||||||||| Sbjct: 244 ggcagcgccgcatcctcaagcagcgcctcaaggtaccaccggcgctcaaccagttcaccc 303 Query: 279 gcaccctcgacaagaaccttgcaacgaacttgttcaagatgcttcttaagtaccgtcccg 338 ||||||||||||||||||| || |||||| |||| ||||||||||| |||||||| || | Sbjct: 304 gcaccctcgacaagaacctcgctacgaacctgtttaagatgcttctcaagtaccggcctg 363 Query: 339 aagacaaagttgccaagaaggagaggcttctaaagagggcccaggctgaagccgaaggga 398 ||||||| | ||||||||||||||||||||| ||||||||||| ||||| ||||| | Sbjct: 364 aagacaaggctgccaagaaggagaggcttctgaagagggcccaagctgagaatgaaggaa 423 Query: 399 aaactgttgaggcaaagaagccaattgttgtgaaatatggccttaaccatgttacctacc 458 ||||||||||| | ||||| |||||||||||||| ||||||||||||||||| || |||| Sbjct: 424 aaactgttgagtcgaagaaaccaattgttgtgaagtatggccttaaccatgtgacttacc 483 Query: 459 taattgaacagagtaaagcccagctggttgtcatagctcatgatgttgatccgattgagc 518 | ||||| |||| || || ||||| |||||||| |||||||| || ||||||||||| | Sbjct: 484 tcattgagcagaacaaggctcagcttgttgtcatcgctcatgacgtggatccgattgaac 543 Query: 519 tggttgtgtggctccctgccctttgcaggaaaatggaggtcccttactgcattgttaagg 578 ||||||||||||| || ||||| |||||||| |||||||||||||||||||||||||| | Sbjct: 544 tggttgtgtggcttccagccctgtgcaggaagatggaggtcccttactgcattgttaaag 603 Query: 579 gaaaatctcgccttggatcgattgt 603 |||| ||||||||||||||||||| Sbjct: 604 gaaaggctcgccttggatcgattgt 628
>gb|BT016736.1| Zea mays clone Contig569 mRNA sequence Length = 1092 Score = 559 bits (282), Expect = e-156 Identities = 489/558 (87%) Strand = Plus / Plus Query: 43 cgaaatggctcctaagcgaggcggcaaggcgcctgtcccggcgaagaagaaaacggaaaa 102 ||||||||| || |||||||| |||| ||| || || ||||| |||||||| ||||| || Sbjct: 64 cgaaatggccccgaagcgaggtggcagggcaccggtgccggccaagaagaagacggataa 123 Query: 103 ggtgaccaatccgctgttcgagaagaggccgaagcaatttggcatcggcggcgccctccc 162 ||||| || || ||||||||||| ||||||||||| || |||||||||||||| | || Sbjct: 124 agtgacgaaccctctgttcgagaaaaggccgaagcagttcggcatcggcggcgcgttgcc 183 Query: 163 gcccaagaaggacctccaccgcttcgttaagtggcccaaggttgtgcgcatccagcgcca 222 |||||||||||||| ||||| ||||| |||||||||||||| ||||||||||||||||| Sbjct: 184 tcccaagaaggacctgcaccgattcgtcaagtggcccaaggtcgtgcgcatccagcgcca 243 Query: 223 gcgccgcatcctcaagcagcgcctcaaggtgcccccggcacttcaccagttcacccgcac 282 ||| ||||||||||||||||||||||||||||| ||||| || |||||||||||||||| Sbjct: 244 gcgtcgcatcctcaagcagcgcctcaaggtgcctccggcgctcaaccagttcacccgcac 303 Query: 283 cctcgacaagaaccttgcaacgaacttgttcaagatgcttcttaagtaccgtcccgaaga 342 ||||||||||||||| || || ||| ||||||||||||||||||||||||| |||||||| Sbjct: 304 cctcgacaagaacctcgctaccaacctgttcaagatgcttcttaagtaccggcccgaaga 363 Query: 343 caaagttgccaagaaggagaggcttctaaagagggcccaggctgaagccgaagggaaaac 402 ||| | ||||||||||||||||||||| ||||||||||||||||| ||||| ||||| Sbjct: 364 caaggctgccaagaaggagaggcttctgaagagggcccaggctgagaatgaaggaaaaac 423 Query: 403 tgttgaggcaaagaagccaattgttgtgaaatatggccttaaccatgttacctacctaat 462 |||||| | ||||| |||||||||||||| ||||||||||||||||| || ||||| || Sbjct: 424 tgttgaatccaagaaaccaattgttgtgaagtatggccttaaccatgtgacttacctcat 483 Query: 463 tgaacagagtaaagcccagctggttgtcatagctcatgatgttgatccgattgagctggt 522 ||| |||| || || ||||| |||||||| ||||||||||| ||||||||||| ||||| Sbjct: 484 tgagcagaacaaggctcagctcgttgtcatcgctcatgatgtggatccgattgaactggt 543 Query: 523 tgtgtggctccctgccctttgcaggaaaatggaggtcccttactgcattgttaagggaaa 582 ||| ||||| || ||||| |||||||| ||||||||||| |||||||||||||| ||||| Sbjct: 544 tgtttggcttccagccctgtgcaggaagatggaggtcccatactgcattgttaaaggaaa 603 Query: 583 atctcgccttggatcgat 600 |||||||||||||||| Sbjct: 604 ggctcgccttggatcgat 621
>gb|BT018084.1| Zea mays clone EL01N0552B03.c mRNA sequence Length = 849 Score = 482 bits (243), Expect = e-133 Identities = 393/443 (88%) Strand = Plus / Plus Query: 161 ccgcccaagaaggacctccaccgcttcgttaagtggcccaaggttgtgcgcatccagcgc 220 ||||||||||||||||| ||||| ||||| |||||||||||||| ||||| ||||||||| Sbjct: 9 ccgcccaagaaggacctgcaccggttcgtcaagtggcccaaggtcgtgcgtatccagcgc 68 Query: 221 cagcgccgcatcctcaagcagcgcctcaaggtgcccccggcacttcaccagttcacccgc 280 |||||||||||||||||||||||||||||||| || ||||| || |||||||||||||| Sbjct: 69 cagcgccgcatcctcaagcagcgcctcaaggtaccaccggcgctcaaccagttcacccgc 128 Query: 281 accctcgacaagaaccttgcaacgaacttgttcaagatgcttcttaagtaccgtcccgaa 340 ||||||||||||||||| || |||||| |||| ||||||||||| |||||||| || ||| Sbjct: 129 accctcgacaagaacctcgctacgaacctgtttaagatgcttctcaagtaccggcctgaa 188 Query: 341 gacaaagttgccaagaaggagaggcttctaaagagggcccaggctgaagccgaagggaaa 400 ||||| | ||||||||||||||||||||| ||||||||||| ||||| ||||| ||| Sbjct: 189 gacaaggctgccaagaaggagaggcttctgaagagggcccaagctgagaatgaaggaaaa 248 Query: 401 actgttgaggcaaagaagccaattgttgtgaaatatggccttaaccatgttacctaccta 460 ||||||||| | ||||| |||||||||||||| ||||||||||||||||| || ||||| Sbjct: 249 actgttgagtcgaagaaaccaattgttgtgaagtatggccttaaccatgtgacttacctc 308 Query: 461 attgaacagagtaaagcccagctggttgtcatagctcatgatgttgatccgattgagctg 520 ||||| |||| || || ||||| |||||||| |||||||| || ||||||||||| ||| Sbjct: 309 attgagcagaacaaggctcagcttgttgtcatcgctcatgacgtggatccgattgaactg 368 Query: 521 gttgtgtggctccctgccctttgcaggaaaatggaggtcccttactgcattgttaaggga 580 ||||||||||| || ||||| |||||||| |||||||||||||||||||||||||| ||| Sbjct: 369 gttgtgtggcttccagccctgtgcaggaagatggaggtcccttactgcattgttaaagga 428 Query: 581 aaatctcgccttggatcgattgt 603 || ||||||||||||||||||| Sbjct: 429 aaggctcgccttggatcgattgt 451
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 272 bits (137), Expect = 1e-69 Identities = 182/197 (92%) Strand = Plus / Minus Query: 101 aaggtgaccaatccgctgttcgagaagaggccgaagcaatttggcatcggcggcgccctc 160 |||||||| || |||||||||||||||||||||||||| || || ||||||||||| || Sbjct: 14335183 aaggtgacgaacccgctgttcgagaagaggccgaagcagttcggaatcggcggcgcgctg 14335124 Query: 161 ccgcccaagaaggacctccaccgcttcgttaagtggcccaaggttgtgcgcatccagcgc 220 ||||||||||||||||| ||||| ||||| |||||||||||||| ||||||||||||||| Sbjct: 14335123 ccgcccaagaaggaccttcaccggttcgtcaagtggcccaaggtggtgcgcatccagcgc 14335064 Query: 221 cagcgccgcatcctcaagcagcgcctcaaggtgcccccggcacttcaccagttcacccgc 280 ||||||||||||||||||||||||||||||||||||||||| || |||||||||| ||| Sbjct: 14335063 cagcgccgcatcctcaagcagcgcctcaaggtgcccccggcgctcaaccagttcactcgc 14335004 Query: 281 accctcgacaagaacct 297 ||||||||||||||||| Sbjct: 14335003 accctcgacaagaacct 14334987 Score = 145 bits (73), Expect = 2e-31 Identities = 136/157 (86%) Strand = Plus / Minus Query: 309 tgttcaagatgcttcttaagtaccgtcccgaagacaaagttgccaagaaggagaggcttc 368 |||| |||||||| || |||||||| || || ||||| | ||| ||||||||||||||| Sbjct: 14334380 tgtttaagatgctcctcaagtaccgccctgaggacaaggctgctaagaaggagaggcttt 14334321 Query: 369 taaagagggcccaggctgaagccgaagggaaaactgttgaggcaaagaagccaattgttg 428 | ||||||||||||||||| || ||||| ||||| |||||||||||||| |||||||||| Sbjct: 14334320 tgaagagggcccaggctgaggctgaaggtaaaaccgttgaggcaaagaaaccaattgttg 14334261 Query: 429 tgaaatatggccttaaccatgttacctacctaattga 465 |||| ||||| ||||||||||| || ||||| ||||| Sbjct: 14334260 tgaagtatggtcttaaccatgtcacatacctcattga 14334224 Score = 141 bits (71), Expect = 3e-30 Identities = 116/131 (88%) Strand = Plus / Minus Query: 467 cagagtaaagcccagctggttgtcatagctcatgatgttgatccgattgagctggttgtg 526 ||||| || ||||| ||||| ||||| ||||||||||| ||||||||||||||||||||| Sbjct: 14334108 cagagcaaggcccaactggtcgtcattgctcatgatgtcgatccgattgagctggttgtg 14334049 Query: 527 tggctccctgccctttgcaggaaaatggaggtcccttactgcattgttaagggaaaatct 586 ||||| || ||||| |||||||| ||||||||||||||||||||||| || |||||| | Sbjct: 14334048 tggcttccagccctgtgcaggaagatggaggtcccttactgcattgtgaaaggaaaagcc 14333989 Query: 587 cgccttggatc 597 || |||||||| Sbjct: 14333988 cgtcttggatc 14333978 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 56 aagcgaggcggcaaggcgcctgtcccggcgaagaagaaaacgg 98 ||||||||||||| |||||| || |||||||||||||| |||| Sbjct: 14335331 aagcgaggcggcagggcgccggtgccggcgaagaagaagacgg 14335289
>dbj|AP004637.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0703C03 Length = 162620 Score = 272 bits (137), Expect = 1e-69 Identities = 182/197 (92%) Strand = Plus / Minus Query: 101 aaggtgaccaatccgctgttcgagaagaggccgaagcaatttggcatcggcggcgccctc 160 |||||||| || |||||||||||||||||||||||||| || || ||||||||||| || Sbjct: 150739 aaggtgacgaacccgctgttcgagaagaggccgaagcagttcggaatcggcggcgcgctg 150680 Query: 161 ccgcccaagaaggacctccaccgcttcgttaagtggcccaaggttgtgcgcatccagcgc 220 ||||||||||||||||| ||||| ||||| |||||||||||||| ||||||||||||||| Sbjct: 150679 ccgcccaagaaggaccttcaccggttcgtcaagtggcccaaggtggtgcgcatccagcgc 150620 Query: 221 cagcgccgcatcctcaagcagcgcctcaaggtgcccccggcacttcaccagttcacccgc 280 ||||||||||||||||||||||||||||||||||||||||| || |||||||||| ||| Sbjct: 150619 cagcgccgcatcctcaagcagcgcctcaaggtgcccccggcgctcaaccagttcactcgc 150560 Query: 281 accctcgacaagaacct 297 ||||||||||||||||| Sbjct: 150559 accctcgacaagaacct 150543 Score = 145 bits (73), Expect = 2e-31 Identities = 136/157 (86%) Strand = Plus / Minus Query: 309 tgttcaagatgcttcttaagtaccgtcccgaagacaaagttgccaagaaggagaggcttc 368 |||| |||||||| || |||||||| || || ||||| | ||| ||||||||||||||| Sbjct: 149936 tgtttaagatgctcctcaagtaccgccctgaggacaaggctgctaagaaggagaggcttt 149877 Query: 369 taaagagggcccaggctgaagccgaagggaaaactgttgaggcaaagaagccaattgttg 428 | ||||||||||||||||| || ||||| ||||| |||||||||||||| |||||||||| Sbjct: 149876 tgaagagggcccaggctgaggctgaaggtaaaaccgttgaggcaaagaaaccaattgttg 149817 Query: 429 tgaaatatggccttaaccatgttacctacctaattga 465 |||| ||||| ||||||||||| || ||||| ||||| Sbjct: 149816 tgaagtatggtcttaaccatgtcacatacctcattga 149780 Score = 141 bits (71), Expect = 3e-30 Identities = 116/131 (88%) Strand = Plus / Minus Query: 467 cagagtaaagcccagctggttgtcatagctcatgatgttgatccgattgagctggttgtg 526 ||||| || ||||| ||||| ||||| ||||||||||| ||||||||||||||||||||| Sbjct: 149664 cagagcaaggcccaactggtcgtcattgctcatgatgtcgatccgattgagctggttgtg 149605 Query: 527 tggctccctgccctttgcaggaaaatggaggtcccttactgcattgttaagggaaaatct 586 ||||| || ||||| |||||||| ||||||||||||||||||||||| || |||||| | Sbjct: 149604 tggcttccagccctgtgcaggaagatggaggtcccttactgcattgtgaaaggaaaagcc 149545 Query: 587 cgccttggatc 597 || |||||||| Sbjct: 149544 cgtcttggatc 149534 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 56 aagcgaggcggcaaggcgcctgtcccggcgaagaagaaaacgg 98 ||||||||||||| |||||| || |||||||||||||| |||| Sbjct: 150887 aagcgaggcggcagggcgccggtgccggcgaagaagaagacgg 150845
>dbj|AP003884.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ1136_A10 Length = 101249 Score = 272 bits (137), Expect = 1e-69 Identities = 182/197 (92%) Strand = Plus / Minus Query: 101 aaggtgaccaatccgctgttcgagaagaggccgaagcaatttggcatcggcggcgccctc 160 |||||||| || |||||||||||||||||||||||||| || || ||||||||||| || Sbjct: 38263 aaggtgacgaacccgctgttcgagaagaggccgaagcagttcggaatcggcggcgcgctg 38204 Query: 161 ccgcccaagaaggacctccaccgcttcgttaagtggcccaaggttgtgcgcatccagcgc 220 ||||||||||||||||| ||||| ||||| |||||||||||||| ||||||||||||||| Sbjct: 38203 ccgcccaagaaggaccttcaccggttcgtcaagtggcccaaggtggtgcgcatccagcgc 38144 Query: 221 cagcgccgcatcctcaagcagcgcctcaaggtgcccccggcacttcaccagttcacccgc 280 ||||||||||||||||||||||||||||||||||||||||| || |||||||||| ||| Sbjct: 38143 cagcgccgcatcctcaagcagcgcctcaaggtgcccccggcgctcaaccagttcactcgc 38084 Query: 281 accctcgacaagaacct 297 ||||||||||||||||| Sbjct: 38083 accctcgacaagaacct 38067 Score = 145 bits (73), Expect = 2e-31 Identities = 136/157 (86%) Strand = Plus / Minus Query: 309 tgttcaagatgcttcttaagtaccgtcccgaagacaaagttgccaagaaggagaggcttc 368 |||| |||||||| || |||||||| || || ||||| | ||| ||||||||||||||| Sbjct: 37460 tgtttaagatgctcctcaagtaccgccctgaggacaaggctgctaagaaggagaggcttt 37401 Query: 369 taaagagggcccaggctgaagccgaagggaaaactgttgaggcaaagaagccaattgttg 428 | ||||||||||||||||| || ||||| ||||| |||||||||||||| |||||||||| Sbjct: 37400 tgaagagggcccaggctgaggctgaaggtaaaaccgttgaggcaaagaaaccaattgttg 37341 Query: 429 tgaaatatggccttaaccatgttacctacctaattga 465 |||| ||||| ||||||||||| || ||||| ||||| Sbjct: 37340 tgaagtatggtcttaaccatgtcacatacctcattga 37304 Score = 141 bits (71), Expect = 3e-30 Identities = 116/131 (88%) Strand = Plus / Minus Query: 467 cagagtaaagcccagctggttgtcatagctcatgatgttgatccgattgagctggttgtg 526 ||||| || ||||| ||||| ||||| ||||||||||| ||||||||||||||||||||| Sbjct: 37188 cagagcaaggcccaactggtcgtcattgctcatgatgtcgatccgattgagctggttgtg 37129 Query: 527 tggctccctgccctttgcaggaaaatggaggtcccttactgcattgttaagggaaaatct 586 ||||| || ||||| |||||||| ||||||||||||||||||||||| || |||||| | Sbjct: 37128 tggcttccagccctgtgcaggaagatggaggtcccttactgcattgtgaaaggaaaagcc 37069 Query: 587 cgccttggatc 597 || |||||||| Sbjct: 37068 cgtcttggatc 37058 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 56 aagcgaggcggcaaggcgcctgtcccggcgaagaagaaaacgg 98 ||||||||||||| |||||| || |||||||||||||| |||| Sbjct: 38411 aagcgaggcggcagggcgccggtgccggcgaagaagaagacgg 38369
>gb|AC108759.2| Oryza sativa (Japonica cultiva-group) chromosome 9 BAC clone OSJNBa0072P02, complete sequence Length = 157488 Score = 264 bits (133), Expect = 3e-67 Identities = 181/197 (91%) Strand = Plus / Minus Query: 101 aaggtgaccaatccgctgttcgagaagaggccgaagcaatttggcatcggcggcgccctc 160 ||||||||||| |||||||||||||||||||||||||| || |||||||||||||| || Sbjct: 109704 aaggtgaccaacccgctgttcgagaagaggccgaagcagttcggcatcggcggcgcgctg 109645 Query: 161 ccgcccaagaaggacctccaccgcttcgttaagtggcccaaggttgtgcgcatccagcgc 220 || ||||||||||| || ||| | ||||| |||||||||||||| ||||||||||||||| Sbjct: 109644 ccacccaagaaggatctgcacaggttcgtgaagtggcccaaggtggtgcgcatccagcgc 109585 Query: 221 cagcgccgcatcctcaagcagcgcctcaaggtgcccccggcacttcaccagttcacccgc 280 |||||||||||||||||||||||||||||||| |||||||| || |||||||||||||| Sbjct: 109584 cagcgccgcatcctcaagcagcgcctcaaggttcccccggcgctcaaccagttcacccgc 109525 Query: 281 accctcgacaagaacct 297 ||||||||||||||||| Sbjct: 109524 accctcgacaagaacct 109508 Score = 167 bits (84), Expect = 5e-38 Identities = 120/132 (90%) Strand = Plus / Minus Query: 467 cagagtaaagcccagctggttgtcatagctcatgatgttgatccgattgagctggttgtg 526 ||||| || ||||||||||||||||| ||||||||||||||||| ||||||||||||||| Sbjct: 108674 cagagcaaggcccagctggttgtcatcgctcatgatgttgatccaattgagctggttgtg 108615 Query: 527 tggctccctgccctttgcaggaaaatggaggtcccttactgcattgttaagggaaaatct 586 ||||| || ||||| || ||||| |||||||||||||||||||| |||||||| ||| || Sbjct: 108614 tggcttccagccctgtgtaggaagatggaggtcccttactgcatcgttaagggcaaagct 108555 Query: 587 cgccttggatcg 598 |||||||||||| Sbjct: 108554 cgccttggatcg 108543 Score = 165 bits (83), Expect = 2e-37 Identities = 146/167 (87%) Strand = Plus / Minus Query: 299 gcaacgaacttgttcaagatgcttcttaagtaccgtcccgaagacaaagttgccaagaag 358 ||||| ||| |||| ||||||||||| |||||||| || || ||||| | |||||||||| Sbjct: 108955 gcaaccaacctgtttaagatgcttctcaagtaccgccctgaggacaaggctgccaagaag 108896 Query: 359 gagaggcttctaaagagggcccaggctgaagccgaagggaaaactgttgaggcaaagaag 418 ||||||||| | ||||||||||||||||| || ||||||||||| |||||||| |||||| Sbjct: 108895 gagaggcttttgaagagggcccaggctgaggctgaagggaaaaccgttgaggccaagaag 108836 Query: 419 ccaattgttgtgaaatatggccttaaccatgttacctacctaattga 465 |||||||||||||| ||||| |||||||| || || ||||| ||||| Sbjct: 108835 ccaattgttgtgaagtatggtcttaaccacgtgacttacctcattga 108789 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 56 aagcgaggcggcaaggcgcctgtcccggcgaagaagaaaacgg 98 ||||||||||||| |||||| || |||||||||||||| |||| Sbjct: 109843 aagcgaggcggcagggcgccggtgccggcgaagaagaagacgg 109801
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 264 bits (133), Expect = 3e-67 Identities = 181/197 (91%) Strand = Plus / Minus Query: 101 aaggtgaccaatccgctgttcgagaagaggccgaagcaatttggcatcggcggcgccctc 160 ||||||||||| |||||||||||||||||||||||||| || |||||||||||||| || Sbjct: 19390478 aaggtgaccaacccgctgttcgagaagaggccgaagcagttcggcatcggcggcgcgctg 19390419 Query: 161 ccgcccaagaaggacctccaccgcttcgttaagtggcccaaggttgtgcgcatccagcgc 220 || ||||||||||| || ||| | ||||| |||||||||||||| ||||||||||||||| Sbjct: 19390418 ccacccaagaaggatctgcacaggttcgtgaagtggcccaaggtggtgcgcatccagcgc 19390359 Query: 221 cagcgccgcatcctcaagcagcgcctcaaggtgcccccggcacttcaccagttcacccgc 280 |||||||||||||||||||||||||||||||| |||||||| || |||||||||||||| Sbjct: 19390358 cagcgccgcatcctcaagcagcgcctcaaggttcccccggcgctcaaccagttcacccgc 19390299 Query: 281 accctcgacaagaacct 297 ||||||||||||||||| Sbjct: 19390298 accctcgacaagaacct 19390282 Score = 167 bits (84), Expect = 5e-38 Identities = 120/132 (90%) Strand = Plus / Minus Query: 467 cagagtaaagcccagctggttgtcatagctcatgatgttgatccgattgagctggttgtg 526 ||||| || ||||||||||||||||| ||||||||||||||||| ||||||||||||||| Sbjct: 19389448 cagagcaaggcccagctggttgtcatcgctcatgatgttgatccaattgagctggttgtg 19389389 Query: 527 tggctccctgccctttgcaggaaaatggaggtcccttactgcattgttaagggaaaatct 586 ||||| || ||||| || ||||| |||||||||||||||||||| |||||||| ||| || Sbjct: 19389388 tggcttccagccctgtgtaggaagatggaggtcccttactgcatcgttaagggcaaagct 19389329 Query: 587 cgccttggatcg 598 |||||||||||| Sbjct: 19389328 cgccttggatcg 19389317 Score = 165 bits (83), Expect = 2e-37 Identities = 146/167 (87%) Strand = Plus / Minus Query: 299 gcaacgaacttgttcaagatgcttcttaagtaccgtcccgaagacaaagttgccaagaag 358 ||||| ||| |||| ||||||||||| |||||||| || || ||||| | |||||||||| Sbjct: 19389729 gcaaccaacctgtttaagatgcttctcaagtaccgccctgaggacaaggctgccaagaag 19389670 Query: 359 gagaggcttctaaagagggcccaggctgaagccgaagggaaaactgttgaggcaaagaag 418 ||||||||| | ||||||||||||||||| || ||||||||||| |||||||| |||||| Sbjct: 19389669 gagaggcttttgaagagggcccaggctgaggctgaagggaaaaccgttgaggccaagaag 19389610 Query: 419 ccaattgttgtgaaatatggccttaaccatgttacctacctaattga 465 |||||||||||||| ||||| |||||||| || || ||||| ||||| Sbjct: 19389609 ccaattgttgtgaagtatggtcttaaccacgtgacttacctcattga 19389563 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 56 aagcgaggcggcaaggcgcctgtcccggcgaagaagaaaacgg 98 ||||||||||||| |||||| || |||||||||||||| |||| Sbjct: 19390617 aagcgaggcggcagggcgccggtgccggcgaagaagaagacgg 19390575
>ref|XM_463662.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 927 Score = 192 bits (97), Expect = 9e-46 Identities = 163/185 (88%) Strand = Plus / Plus Query: 113 ccgctgttcgagaagaggccgaagcaatttggcatcggcggcgccctcccgcccaagaag 172 ||||||||||||||| |||||||||| || || ||||||||||| |||||||| | |||| Sbjct: 265 ccgctgttcgagaagcggccgaagcagttcgggatcggcggcgcgctcccgccgaggaag 324 Query: 173 gacctccaccgcttcgttaagtggcccaaggttgtgcgcatccagcgccagcgccgcatc 232 ||| | ||||||||||| | |||||||||| ||||| |||||||||||||||||| || Sbjct: 325 gacttgcaccgcttcgtcagatggcccaaggcggtgcggatccagcgccagcgccgcgtc 384 Query: 233 ctcaagcagcgcctcaaggtgcccccggcacttcaccagttcacccgcaccctcgacaag 292 |||||||||||||||||||| || || || || |||||||||||||||||||||||||| Sbjct: 385 ctcaagcagcgcctcaaggttccacccgcgctcaaccagttcacccgcaccctcgacaag 444 Query: 293 aacct 297 ||||| Sbjct: 445 aacct 449 Score = 143 bits (72), Expect = 8e-31 Identities = 177/212 (83%) Strand = Plus / Plus Query: 392 gaagggaaaactgttgaggcaaagaagccaattgttgtgaaatatggccttaaccatgtt 451 |||||||| |||||||| || ||||| |||||||||||||| ||||| ||| ||||||| Sbjct: 496 gaagggaagactgttgaagccaagaaaccaattgttgtgaagtatggtcttgaccatgtg 555 Query: 452 acctacctaattgaacagagtaaagcccagctggttgtcatagctcatgatgttgatccg 511 ||||| | ||||||||||| || || ||||| || ||||| ||||||||||| || || Sbjct: 556 acctatttgattgaacagagcaaggcacagcttgtggtcattgctcatgatgtcgacccc 615 Query: 512 attgagctggttgtgtggctccctgccctttgcaggaaaatggaggtcccttactgcatt 571 ||||| || || || |||||||| ||| | |||||||| ||||| ||||||| |||||| Sbjct: 616 attgaactcgtcgtttggctcccagccttgtgcaggaagatggaaatcccttattgcatt 675 Query: 572 gttaagggaaaatctcgccttggatcgattgt 603 || |||||||| |||| |||||||||||||| Sbjct: 676 gtgaagggaaaggctcgtcttggatcgattgt 707
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 192 bits (97), Expect = 9e-46 Identities = 163/185 (88%) Strand = Plus / Minus Query: 113 ccgctgttcgagaagaggccgaagcaatttggcatcggcggcgccctcccgcccaagaag 172 ||||||||||||||| |||||||||| || || ||||||||||| |||||||| | |||| Sbjct: 40490478 ccgctgttcgagaagcggccgaagcagttcgggatcggcggcgcgctcccgccgaggaag 40490419 Query: 173 gacctccaccgcttcgttaagtggcccaaggttgtgcgcatccagcgccagcgccgcatc 232 ||| | ||||||||||| | |||||||||| ||||| |||||||||||||||||| || Sbjct: 40490418 gacttgcaccgcttcgtcagatggcccaaggcggtgcggatccagcgccagcgccgcgtc 40490359 Query: 233 ctcaagcagcgcctcaaggtgcccccggcacttcaccagttcacccgcaccctcgacaag 292 |||||||||||||||||||| || || || || |||||||||||||||||||||||||| Sbjct: 40490358 ctcaagcagcgcctcaaggttccacccgcgctcaaccagttcacccgcaccctcgacaag 40490299 Query: 293 aacct 297 ||||| Sbjct: 40490298 aacct 40490294 Score = 71.9 bits (36), Expect = 2e-09 Identities = 99/120 (82%) Strand = Plus / Minus Query: 479 cagctggttgtcatagctcatgatgttgatccgattgagctggttgtgtggctccctgcc 538 ||||| || ||||| ||||||||||| || || ||||| || || || |||||||| ||| Sbjct: 40489244 cagcttgtggtcattgctcatgatgtcgaccccattgaactcgtcgtttggctcccagcc 40489185 Query: 539 ctttgcaggaaaatggaggtcccttactgcattgttaagggaaaatctcgccttggatcg 598 | |||||||| ||||| ||||||| |||||||| |||||||| |||| ||||||||| Sbjct: 40489184 ttgtgcaggaagatggaaatcccttattgcattgtgaagggaaaggctcgtcttggatcg 40489125 Score = 69.9 bits (35), Expect = 9e-09 Identities = 129/159 (81%), Gaps = 1/159 (0%) Strand = Plus / Minus Query: 311 ttcaagatgcttcttaagtaccgtcccgaagacaaagttgccaagaaggagaggcttcta 370 ||||||||||| | |||||||| || ||||| || | ||||| |||||| |||||| | Sbjct: 40489536 ttcaagatgctgttgaagtaccgccctgaagataaggctgcca-gaaggaaaggcttttg 40489478 Query: 371 aagagggcccaggctgaagccgaagggaaaactgttgaggcaaagaagccaattgttgtg 430 || || || || || || || |||||||| |||||||| || ||||| |||||||||||| Sbjct: 40489477 aaaagagcgcaagcagaggctgaagggaagactgttgaagccaagaaaccaattgttgtg 40489418 Query: 431 aaatatggccttaaccatgttacctacctaattgaacag 469 || ||||| ||| ||||||| ||||| | ||||||||| Sbjct: 40489417 aagtatggtcttgaccatgtgacctatttgattgaacag 40489379 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 257 ccggcacttcaccagttcacc 277 ||||||||||||||||||||| Sbjct: 33457141 ccggcacttcaccagttcacc 33457121
>dbj|AP004672.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0592G05 Length = 146220 Score = 192 bits (97), Expect = 9e-46 Identities = 163/185 (88%) Strand = Plus / Minus Query: 113 ccgctgttcgagaagaggccgaagcaatttggcatcggcggcgccctcccgcccaagaag 172 ||||||||||||||| |||||||||| || || ||||||||||| |||||||| | |||| Sbjct: 141719 ccgctgttcgagaagcggccgaagcagttcgggatcggcggcgcgctcccgccgaggaag 141660 Query: 173 gacctccaccgcttcgttaagtggcccaaggttgtgcgcatccagcgccagcgccgcatc 232 ||| | ||||||||||| | |||||||||| ||||| |||||||||||||||||| || Sbjct: 141659 gacttgcaccgcttcgtcagatggcccaaggcggtgcggatccagcgccagcgccgcgtc 141600 Query: 233 ctcaagcagcgcctcaaggtgcccccggcacttcaccagttcacccgcaccctcgacaag 292 |||||||||||||||||||| || || || || |||||||||||||||||||||||||| Sbjct: 141599 ctcaagcagcgcctcaaggttccacccgcgctcaaccagttcacccgcaccctcgacaag 141540 Query: 293 aacct 297 ||||| Sbjct: 141539 aacct 141535 Score = 71.9 bits (36), Expect = 2e-09 Identities = 99/120 (82%) Strand = Plus / Minus Query: 479 cagctggttgtcatagctcatgatgttgatccgattgagctggttgtgtggctccctgcc 538 ||||| || ||||| ||||||||||| || || ||||| || || || |||||||| ||| Sbjct: 140485 cagcttgtggtcattgctcatgatgtcgaccccattgaactcgtcgtttggctcccagcc 140426 Query: 539 ctttgcaggaaaatggaggtcccttactgcattgttaagggaaaatctcgccttggatcg 598 | |||||||| ||||| ||||||| |||||||| |||||||| |||| ||||||||| Sbjct: 140425 ttgtgcaggaagatggaaatcccttattgcattgtgaagggaaaggctcgtcttggatcg 140366 Score = 69.9 bits (35), Expect = 9e-09 Identities = 129/159 (81%), Gaps = 1/159 (0%) Strand = Plus / Minus Query: 311 ttcaagatgcttcttaagtaccgtcccgaagacaaagttgccaagaaggagaggcttcta 370 ||||||||||| | |||||||| || ||||| || | ||||| |||||| |||||| | Sbjct: 140777 ttcaagatgctgttgaagtaccgccctgaagataaggctgcca-gaaggaaaggcttttg 140719 Query: 371 aagagggcccaggctgaagccgaagggaaaactgttgaggcaaagaagccaattgttgtg 430 || || || || || || || |||||||| |||||||| || ||||| |||||||||||| Sbjct: 140718 aaaagagcgcaagcagaggctgaagggaagactgttgaagccaagaaaccaattgttgtg 140659 Query: 431 aaatatggccttaaccatgttacctacctaattgaacag 469 || ||||| ||| ||||||| ||||| | ||||||||| Sbjct: 140658 aagtatggtcttgaccatgtgacctatttgattgaacag 140620
>dbj|AP004223.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B1033B05 Length = 138882 Score = 192 bits (97), Expect = 9e-46 Identities = 163/185 (88%) Strand = Plus / Minus Query: 113 ccgctgttcgagaagaggccgaagcaatttggcatcggcggcgccctcccgcccaagaag 172 ||||||||||||||| |||||||||| || || ||||||||||| |||||||| | |||| Sbjct: 52102 ccgctgttcgagaagcggccgaagcagttcgggatcggcggcgcgctcccgccgaggaag 52043 Query: 173 gacctccaccgcttcgttaagtggcccaaggttgtgcgcatccagcgccagcgccgcatc 232 ||| | ||||||||||| | |||||||||| ||||| |||||||||||||||||| || Sbjct: 52042 gacttgcaccgcttcgtcagatggcccaaggcggtgcggatccagcgccagcgccgcgtc 51983 Query: 233 ctcaagcagcgcctcaaggtgcccccggcacttcaccagttcacccgcaccctcgacaag 292 |||||||||||||||||||| || || || || |||||||||||||||||||||||||| Sbjct: 51982 ctcaagcagcgcctcaaggttccacccgcgctcaaccagttcacccgcaccctcgacaag 51923 Query: 293 aacct 297 ||||| Sbjct: 51922 aacct 51918 Score = 71.9 bits (36), Expect = 2e-09 Identities = 99/120 (82%) Strand = Plus / Minus Query: 479 cagctggttgtcatagctcatgatgttgatccgattgagctggttgtgtggctccctgcc 538 ||||| || ||||| ||||||||||| || || ||||| || || || |||||||| ||| Sbjct: 50868 cagcttgtggtcattgctcatgatgtcgaccccattgaactcgtcgtttggctcccagcc 50809 Query: 539 ctttgcaggaaaatggaggtcccttactgcattgttaagggaaaatctcgccttggatcg 598 | |||||||| ||||| ||||||| |||||||| |||||||| |||| ||||||||| Sbjct: 50808 ttgtgcaggaagatggaaatcccttattgcattgtgaagggaaaggctcgtcttggatcg 50749 Score = 69.9 bits (35), Expect = 9e-09 Identities = 129/159 (81%), Gaps = 1/159 (0%) Strand = Plus / Minus Query: 311 ttcaagatgcttcttaagtaccgtcccgaagacaaagttgccaagaaggagaggcttcta 370 ||||||||||| | |||||||| || ||||| || | ||||| |||||| |||||| | Sbjct: 51160 ttcaagatgctgttgaagtaccgccctgaagataaggctgcca-gaaggaaaggcttttg 51102 Query: 371 aagagggcccaggctgaagccgaagggaaaactgttgaggcaaagaagccaattgttgtg 430 || || || || || || || |||||||| |||||||| || ||||| |||||||||||| Sbjct: 51101 aaaagagcgcaagcagaggctgaagggaagactgttgaagccaagaaaccaattgttgtg 51042 Query: 431 aaatatggccttaaccatgttacctacctaattgaacag 469 || ||||| ||| ||||||| ||||| | ||||||||| Sbjct: 51041 aagtatggtcttgaccatgtgacctatttgattgaacag 51003
>ref|NM_130329.2| Arabidopsis thaliana structural constituent of ribosome AT2G47610 mRNA, complete cds Length = 1092 Score = 161 bits (81), Expect = 3e-36 Identities = 234/285 (82%) Strand = Plus / Plus Query: 311 ttcaagatgcttcttaagtaccgtcccgaagacaaagttgccaagaaggagaggcttcta 370 |||||| | ||||| |||||| | || |||||||||| ||||||||||||| | ||| || Sbjct: 326 ttcaaggtccttctgaagtacaggccagaagacaaagctgccaagaaggagcgtcttgta 385 Query: 371 aagagggcccaggctgaagccgaagggaaaactgttgaggcaaagaagccaattgttgtg 430 |||| |||||| |||||||| || || || || |||| | |||||||| ||||| || Sbjct: 386 aagaaggcccaagctgaagctgagggaaagccttctgagtctaagaagcccattgtagtc 445 Query: 431 aaatatggccttaaccatgttacctacctaattgaacagagtaaagcccagctggttgtc 490 ||||| ||||| |||||||| |||||||| ||||| |||| || ||||| || ||||| Sbjct: 446 aaatacggcctcaaccatgtgacctacctcattgagcagaacaaggcccaacttgttgtt 505 Query: 491 atagctcatgatgttgatccgattgagctggttgtgtggctccctgccctttgcaggaaa 550 || ||||||||||| || || |||||| ||||||| ||| | ||||| || |||||||| Sbjct: 506 attgctcatgatgtcgacccaattgagttggttgtctggttgcctgctctgtgcaggaag 565 Query: 551 atggaggtcccttactgcattgttaagggaaaatctcgccttgga 595 ||||| ||||| ||||||||||| ||||| |||||||| |||||| Sbjct: 566 atggaagtcccgtactgcattgtcaagggcaaatctcgtcttgga 610
>gb|BT000500.1| Arabidopsis thaliana 60S ribosomal protein L7A (At2g47610/T30B22.8) mRNA, complete cds Length = 774 Score = 161 bits (81), Expect = 3e-36 Identities = 234/285 (82%) Strand = Plus / Plus Query: 311 ttcaagatgcttcttaagtaccgtcccgaagacaaagttgccaagaaggagaggcttcta 370 |||||| | ||||| |||||| | || |||||||||| ||||||||||||| | ||| || Sbjct: 262 ttcaaggtccttctgaagtacaggccagaagacaaagctgccaagaaggagcgtcttgta 321 Query: 371 aagagggcccaggctgaagccgaagggaaaactgttgaggcaaagaagccaattgttgtg 430 |||| |||||| |||||||| || || || || |||| | |||||||| ||||| || Sbjct: 322 aagaaggcccaagctgaagctgagggaaagccttctgagtctaagaagcccattgtagtc 381 Query: 431 aaatatggccttaaccatgttacctacctaattgaacagagtaaagcccagctggttgtc 490 ||||| ||||| |||||||| |||||||| ||||| |||| || ||||| || ||||| Sbjct: 382 aaatacggcctcaaccatgtgacctacctcattgagcagaacaaggcccaacttgttgtt 441 Query: 491 atagctcatgatgttgatccgattgagctggttgtgtggctccctgccctttgcaggaaa 550 || ||||||||||| || || |||||| ||||||| ||| | ||||| || |||||||| Sbjct: 442 attgctcatgatgtcgacccaattgagttggttgtctggttgcctgctctgtgcaggaag 501 Query: 551 atggaggtcccttactgcattgttaagggaaaatctcgccttgga 595 ||||| ||||| ||||||||||| ||||| |||||||| |||||| Sbjct: 502 atggaagtcccgtactgcattgtcaagggcaaatctcgtcttgga 546
>gb|AC002535.3| Arabidopsis thaliana chromosome 2 clone T30B22 map CIC06C03, complete sequence Length = 98937 Score = 161 bits (81), Expect = 3e-36 Identities = 234/285 (82%) Strand = Plus / Minus Query: 311 ttcaagatgcttcttaagtaccgtcccgaagacaaagttgccaagaaggagaggcttcta 370 |||||| | ||||| |||||| | || |||||||||| ||||||||||||| | ||| || Sbjct: 17924 ttcaaggtccttctgaagtacaggccagaagacaaagctgccaagaaggagcgtcttgta 17865 Query: 371 aagagggcccaggctgaagccgaagggaaaactgttgaggcaaagaagccaattgttgtg 430 |||| |||||| |||||||| || || || || |||| | |||||||| ||||| || Sbjct: 17864 aagaaggcccaagctgaagctgagggaaagccttctgagtctaagaagcccattgtagtc 17805 Query: 431 aaatatggccttaaccatgttacctacctaattgaacagagtaaagcccagctggttgtc 490 ||||| ||||| |||||||| |||||||| ||||| |||| || ||||| || ||||| Sbjct: 17804 aaatacggcctcaaccatgtgacctacctcattgagcagaacaaggcccaacttgttgtt 17745 Query: 491 atagctcatgatgttgatccgattgagctggttgtgtggctccctgccctttgcaggaaa 550 || ||||||||||| || || |||||| ||||||| ||| | ||||| || |||||||| Sbjct: 17744 attgctcatgatgtcgacccaattgagttggttgtctggttgcctgctctgtgcaggaag 17685 Query: 551 atggaggtcccttactgcattgttaagggaaaatctcgccttgga 595 ||||| ||||| ||||||||||| ||||| |||||||| |||||| Sbjct: 17684 atggaagtcccgtactgcattgtcaagggcaaatctcgtcttgga 17640
>gb|AY052674.1| Arabidopsis thaliana At2g47610/T30B22.8 mRNA, complete cds Length = 984 Score = 161 bits (81), Expect = 3e-36 Identities = 234/285 (82%) Strand = Plus / Plus Query: 311 ttcaagatgcttcttaagtaccgtcccgaagacaaagttgccaagaaggagaggcttcta 370 |||||| | ||||| |||||| | || |||||||||| ||||||||||||| | ||| || Sbjct: 324 ttcaaggtccttctgaagtacaggccagaagacaaagctgccaagaaggagcgtcttgta 383 Query: 371 aagagggcccaggctgaagccgaagggaaaactgttgaggcaaagaagccaattgttgtg 430 |||| |||||| |||||||| || || || || |||| | |||||||| ||||| || Sbjct: 384 aagaaggcccaagctgaagctgagggaaagccttctgagtctaagaagcccattgtagtc 443 Query: 431 aaatatggccttaaccatgttacctacctaattgaacagagtaaagcccagctggttgtc 490 ||||| ||||| |||||||| |||||||| ||||| |||| || ||||| || ||||| Sbjct: 444 aaatacggcctcaaccatgtgacctacctcattgagcagaacaaggcccaacttgttgtt 503 Query: 491 atagctcatgatgttgatccgattgagctggttgtgtggctccctgccctttgcaggaaa 550 || ||||||||||| || || |||||| ||||||| ||| | ||||| || |||||||| Sbjct: 504 attgctcatgatgtcgacccaattgagttggttgtctggttgcctgctctgtgcaggaag 563 Query: 551 atggaggtcccttactgcattgttaagggaaaatctcgccttgga 595 ||||| ||||| ||||||||||| ||||| |||||||| |||||| Sbjct: 564 atggaagtcccgtactgcattgtcaagggcaaatctcgtcttgga 608
>gb|AF385719.1|AF385719 Arabidopsis thaliana At2g47610/T30B22.8 mRNA, complete cds Length = 999 Score = 161 bits (81), Expect = 3e-36 Identities = 234/285 (82%) Strand = Plus / Plus Query: 311 ttcaagatgcttcttaagtaccgtcccgaagacaaagttgccaagaaggagaggcttcta 370 |||||| | ||||| |||||| | || |||||||||| ||||||||||||| | ||| || Sbjct: 324 ttcaaggtccttctgaagtacaggccagaagacaaagctgccaagaaggagcgtcttgta 383 Query: 371 aagagggcccaggctgaagccgaagggaaaactgttgaggcaaagaagccaattgttgtg 430 |||| |||||| |||||||| || || || || |||| | |||||||| ||||| || Sbjct: 384 aagaaggcccaagctgaagctgagggaaagccttctgagtctaagaagcccattgtagtc 443 Query: 431 aaatatggccttaaccatgttacctacctaattgaacagagtaaagcccagctggttgtc 490 ||||| ||||| |||||||| |||||||| ||||| |||| || ||||| || ||||| Sbjct: 444 aaatacggcctcaaccatgtgacctacctcattgagcagaacaaggcccaacttgttgtt 503 Query: 491 atagctcatgatgttgatccgattgagctggttgtgtggctccctgccctttgcaggaaa 550 || ||||||||||| || || |||||| ||||||| ||| | ||||| || |||||||| Sbjct: 504 attgctcatgatgtcgacccaattgagttggttgtctggttgcctgctctgtgcaggaag 563 Query: 551 atggaggtcccttactgcattgttaagggaaaatctcgccttgga 595 ||||| ||||| ||||||||||| ||||| |||||||| |||||| Sbjct: 564 atggaagtcccgtactgcattgtcaagggcaaatctcgtcttgga 608
>emb|BX821062.1|CNS0A8OD Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH9ZF10 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 897 Score = 161 bits (81), Expect = 3e-36 Identities = 234/285 (82%) Strand = Plus / Plus Query: 311 ttcaagatgcttcttaagtaccgtcccgaagacaaagttgccaagaaggagaggcttcta 370 |||||| | ||||| |||||| | || |||||||||| ||||||||||||| | ||| || Sbjct: 260 ttcaaggtccttctgaagtacaggccagaagacaaagctgccaagaaggagcgtcttgta 319 Query: 371 aagagggcccaggctgaagccgaagggaaaactgttgaggcaaagaagccaattgttgtg 430 |||| |||||| |||||||| || || || || |||| | |||||||| ||||| || Sbjct: 320 aagaaggcccaagctgaagctgagggaaagccttctgagtctaagaagcccattgtagtc 379 Query: 431 aaatatggccttaaccatgttacctacctaattgaacagagtaaagcccagctggttgtc 490 ||||| ||||| |||||||| |||||||| ||||| |||| || ||||| || ||||| Sbjct: 380 aaatacggcctcaaccatgtgacctacctcattgagcagaacaaggcccaacttgttgtt 439 Query: 491 atagctcatgatgttgatccgattgagctggttgtgtggctccctgccctttgcaggaaa 550 || ||||||||||| || || |||||| ||||||| ||| | ||||| || |||||||| Sbjct: 440 attgctcatgatgtcgacccaattgagttggttgtctggttgcctgctctgtgcaggaag 499 Query: 551 atggaggtcccttactgcattgttaagggaaaatctcgccttgga 595 ||||| ||||| ||||||||||| ||||| |||||||| |||||| Sbjct: 500 atggaagtcccgtactgcattgtcaagggcaaatctcgtcttgga 544
>emb|BX842094.1|CNS09Y94 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL87ZH02 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 877 Score = 161 bits (81), Expect = 3e-36 Identities = 234/285 (82%) Strand = Plus / Plus Query: 311 ttcaagatgcttcttaagtaccgtcccgaagacaaagttgccaagaaggagaggcttcta 370 |||||| | ||||| |||||| | || |||||||||| ||||||||||||| | ||| || Sbjct: 301 ttcaaggtccttctgaagtacaggccagaagacaaagctgccaagaaggagcgtcttgta 360 Query: 371 aagagggcccaggctgaagccgaagggaaaactgttgaggcaaagaagccaattgttgtg 430 |||| |||||| |||||||| || || || || |||| | |||||||| ||||| || Sbjct: 361 aagaaggcccaagctgaagctgagggaaagccttctgagtctaagaagcccattgtagtc 420 Query: 431 aaatatggccttaaccatgttacctacctaattgaacagagtaaagcccagctggttgtc 490 ||||| ||||| |||||||| |||||||| ||||| |||| || ||||| || ||||| Sbjct: 421 aaatacggcctcaaccatgtgacctacctcattgagcagaacaaggcccaacttgttgtt 480 Query: 491 atagctcatgatgttgatccgattgagctggttgtgtggctccctgccctttgcaggaaa 550 || ||||||||||| || || |||||| ||||||| ||| | ||||| || |||||||| Sbjct: 481 attgctcatgatgtcgacccaattgagttggttgtctggttgcctgctctgtgcaggaag 540 Query: 551 atggaggtcccttactgcattgttaagggaaaatctcgccttgga 595 ||||| ||||| ||||||||||| ||||| |||||||| |||||| Sbjct: 541 atggaagtcccgtactgcattgtcaagggcaaatctcgtcttgga 585
>emb|BX842006.1|CNS09Y9Z Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB87ZC11 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 979 Score = 161 bits (81), Expect = 3e-36 Identities = 234/285 (82%) Strand = Plus / Plus Query: 311 ttcaagatgcttcttaagtaccgtcccgaagacaaagttgccaagaaggagaggcttcta 370 |||||| | ||||| |||||| | || |||||||||| ||||||||||||| | ||| || Sbjct: 305 ttcaaggtccttctgaagtacaggccagaagacaaagctgccaagaaggagcgtcttgta 364 Query: 371 aagagggcccaggctgaagccgaagggaaaactgttgaggcaaagaagccaattgttgtg 430 |||| |||||| |||||||| || || || || |||| | |||||||| ||||| || Sbjct: 365 aagaaggcccaagctgaagctgagggaaagccttctgagtctaagaagcccattgtagtc 424 Query: 431 aaatatggccttaaccatgttacctacctaattgaacagagtaaagcccagctggttgtc 490 ||||| ||||| |||||||| |||||||| ||||| |||| || ||||| || ||||| Sbjct: 425 aaatacggcctcaaccatgtgacctacctcattgagcagaacaaggcccaacttgttgtt 484 Query: 491 atagctcatgatgttgatccgattgagctggttgtgtggctccctgccctttgcaggaaa 550 || ||||||||||| || || |||||| ||||||||||| | ||||| || |||||||| Sbjct: 485 attgctcatgatgtcgacccaattgagttggttgtgtggttgcctgctctgtgcaggaag 544 Query: 551 atggaggtcccttactgcattgttaagggaaaatctcgccttgga 595 ||||| ||||| ||||||||||| ||||| |||| ||| |||||| Sbjct: 545 atggaagtcccgtactgcattgtgaagggcaaatgtcgtcttgga 589
>gb|AY088386.1| Arabidopsis thaliana clone 6394 mRNA, complete sequence Length = 1092 Score = 161 bits (81), Expect = 3e-36 Identities = 234/285 (82%) Strand = Plus / Plus Query: 311 ttcaagatgcttcttaagtaccgtcccgaagacaaagttgccaagaaggagaggcttcta 370 |||||| | ||||| |||||| | || |||||||||| ||||||||||||| | ||| || Sbjct: 327 ttcaaggtccttctgaagtacaggccagaagacaaagctgccaagaaggagcgtcttgta 386 Query: 371 aagagggcccaggctgaagccgaagggaaaactgttgaggcaaagaagccaattgttgtg 430 |||| |||||| |||||||| || || || || |||| | |||||||| ||||| || Sbjct: 387 aagaaggcccaagctgaagctgagggaaagccttctgagtctaagaagcccattgtagtc 446 Query: 431 aaatatggccttaaccatgttacctacctaattgaacagagtaaagcccagctggttgtc 490 ||||| ||||| |||||||| |||||||| ||||| |||| || ||||| || ||||| Sbjct: 447 aaatacggcctcaaccatgtgacctacctcattgagcagaacaaggcccaacttgttgtt 506 Query: 491 atagctcatgatgttgatccgattgagctggttgtgtggctccctgccctttgcaggaaa 550 || ||||||||||| || || |||||| ||||||| ||| | ||||| || |||||||| Sbjct: 507 attgctcatgatgtcgacccaattgagttggttgtctggttgcctgctctgtgcaggaag 566 Query: 551 atggaggtcccttactgcattgttaagggaaaatctcgccttgga 595 ||||| ||||| ||||||||||| ||||| |||||||| |||||| Sbjct: 567 atggaagtcccgtactgcattgtcaagggcaaatctcgtcttgga 611
>emb|BX819217.1|CNS0A8T4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB58ZF10 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 747 Score = 153 bits (77), Expect = 8e-34 Identities = 233/285 (81%) Strand = Plus / Plus Query: 311 ttcaagatgcttcttaagtaccgtcccgaagacaaagttgccaagaaggagaggcttcta 370 |||||| | ||||| |||||| | || |||||||||| ||||||||||||| | ||| || Sbjct: 72 ttcaaggtccttctgaagtacaggccagaagacaaagctgccaagaaggagcgtcttgta 131 Query: 371 aagagggcccaggctgaagccgaagggaaaactgttgaggcaaagaagccaattgttgtg 430 |||| |||||| |||||||| || || || || |||| | |||||||| ||||| ||| Sbjct: 132 aagaaggcccaagctgaagctgagggaaagccttctgagtctaagaagcccattgtagtg 191 Query: 431 aaatatggccttaaccatgttacctacctaattgaacagagtaaagcccagctggttgtc 490 ||||| ||||| |||||||| |||||||| ||||| |||| || ||||| || ||||| Sbjct: 192 aaatacggcctcaaccatgtgacctacctcattgagcagaacaaggcccaacttgttgtt 251 Query: 491 atagctcatgatgttgatccgattgagctggttgtgtggctccctgccctttgcaggaaa 550 || ||||||||||| || || ||| || ||||||| ||| | ||||| || |||||||| Sbjct: 252 attgctcatgatgtcgacccaattaagttggttgtctggttgcctgctctgtgcaggaag 311 Query: 551 atggaggtcccttactgcattgttaagggaaaatctcgccttgga 595 ||||| ||||| ||||||||| | ||||| |||||||| |||||| Sbjct: 312 atggaagtcccgtactgcattttcaagggcaaatctcgtcttgga 356
>gb|DQ268850.1| Solanum tuberosum clone 155G10 60S ribosomal protein L7A-like protein mRNA, complete cds Length = 1003 Score = 137 bits (69), Expect = 5e-29 Identities = 270/337 (80%) Strand = Plus / Plus Query: 267 accagttcacccgcaccctcgacaagaaccttgcaacgaacttgttcaagatgcttctta 326 ||||||||||| ||||| ||||||||||| || || ||| | |||||||||||||||| Sbjct: 235 accagttcaccaaaacccttgacaagaacctcgctacaaaccttttcaagatgcttctta 294 Query: 327 agtaccgtcccgaagacaaagttgccaagaaggagaggcttctaaagagggcccaggctg 386 ||||| | ||||| ||||||| ||| ||||||||| | ||| | || || || || |||| Sbjct: 295 agtacaggcccgaggacaaagctgcaaagaaggagcgtcttgtcaaaagagctcaagctg 354 Query: 387 aagccgaagggaaaactgttgaggcaaagaagccaattgttgtgaaatatggccttaacc 446 |||| ||||| |||||| ||| ||||||| || ||| ||||||| ||||| ||||| | Sbjct: 355 aagcagaaggaaaaactcctgaaacaaagaaacctattattgtgaagtatgggcttaagc 414 Query: 447 atgttacctacctaattgaacagagtaaagcccagctggttgtcatagctcatgatgttg 506 | | || ||||| ||||| |||| ||||| ||| |||| || || ||||||||||| | Sbjct: 415 acatcacttaccttattgagcagaacaaagctcagttggtagtgattgctcatgatgtgg 474 Query: 507 atccgattgagctggttgtgtggctccctgccctttgcaggaaaatggaggtcccttact 566 | || || ||| ||||||| ||||| ||||| || ||||| || ||||| | ||||||| Sbjct: 475 acccaatagagttggttgtctggcttcctgcgctatgcagaaagatggaaattccttact 534 Query: 567 gcattgttaagggaaaatctcgccttggatcgattgt 603 ||||||| ||||| ||| |||| | ||||||||||| Sbjct: 535 gcattgtgaagggcaaagctcgtttaggatcgattgt 571 Score = 50.1 bits (25), Expect = 0.009 Identities = 55/65 (84%) Strand = Plus / Plus Query: 110 aatccgctgttcgagaagaggccgaagcaatttggcatcggcggcgccctcccgcccaag 169 ||||| |||||||||||| |||| ||||| || || |||||||| || || ||||| ||| Sbjct: 78 aatccactgttcgagaagcggccaaagcagttcggtatcggcggggcgctgccgccgaag 137 Query: 170 aagga 174 ||||| Sbjct: 138 aagga 142
>emb|BX821934.1|CNS0A88T Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL86ZA06 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 829 Score = 129 bits (65), Expect = 1e-26 Identities = 230/285 (80%) Strand = Plus / Plus Query: 311 ttcaagatgcttcttaagtaccgtcccgaagacaaagttgccaagaaggagaggcttcta 370 |||||| | ||||| |||||| | || |||||||||| ||||||||||||| | ||| || Sbjct: 143 ttcaaggtccttctgaagtacaggccagaagacaaagctgccaagaaggagcgtcttgta 202 Query: 371 aagagggcccaggctgaagccgaagggaaaactgttgaggcaaagaagccaattgttgtg 430 |||| |||||| |||||||| || || || || |||| | || ||||| ||||| || Sbjct: 203 aagaaggcccaagctgaagctgagggaaagccttctgagtctaataagcccattgtagtt 262 Query: 431 aaatatggccttaaccatgttacctacctaattgaacagagtaaagcccagctggttgtc 490 ||||| ||||| |||||||| |||||||| ||||| |||| || ||||| || ||||| Sbjct: 263 aaatacggcctcaaccatgtgacctacctcattgagcagaacaaggcccaacttgttgtt 322 Query: 491 atagctcatgatgttgatccgattgagctggttgtgtggctccctgccctttgcaggaaa 550 || ||||||||||| || || ||| || ||||||| ||| | ||||| || |||||||| Sbjct: 323 attgctcatgatgtcgacccaattaagttggttgtctggttacctgctctgtgcaggaag 382 Query: 551 atggaggtcccttactgcattgttaagggaaaatctcgccttgga 595 ||||| ||||| |||||||| | ||||| |||||||| |||||| Sbjct: 383 atggaagtcccgaactgcattataaagggcaaatctcgtcttgga 427
>gb|DQ241858.1| Solanum tuberosum clone 014F11 60S ribosomal protein L7A-like mRNA, complete cds Length = 983 Score = 121 bits (61), Expect = 3e-24 Identities = 250/313 (79%) Strand = Plus / Plus Query: 267 accagttcacccgcaccctcgacaagaaccttgcaacgaacttgttcaagatgcttctta 326 ||||||||||| ||||| || |||||||| || || ||| | |||||||||||||||| Sbjct: 229 accagttcaccaaaacccttgataagaacctcgccaccaaccttttcaagatgcttctta 288 Query: 327 agtaccgtcccgaagacaaagttgccaagaaggagaggcttctaaagagggcccaggctg 386 ||||| | || || ||||||| ||| ||||||||| | ||| | || ||||| || |||| Sbjct: 289 agtacaggcctgaggacaaagctgcaaagaaggagcgtcttgttaaaagggctcaagctg 348 Query: 387 aagccgaagggaaaactgttgaggcaaagaagccaattgttgtgaaatatggccttaacc 446 |||| ||||| ||||| ||| ||||||| || ||| ||||||| ||||||||||| | Sbjct: 349 aagctgaaggaaaaacacctgaaacaaagaaacccattattgtgaagtatggccttaagc 408 Query: 447 atgttacctacctaattgaacagagtaaagcccagctggttgtcatagctcatgatgttg 506 || | || ||||| ||||| |||| ||||| || || || || || ||||||||||| | Sbjct: 409 atatcacttaccttattgagcagaacaaagctcaactagtagtgattgctcatgatgtgg 468 Query: 507 atccgattgagctggttgtgtggctccctgccctttgcaggaaaatggaggtcccttact 566 | || || ||| ||||||| ||||| ||||| || ||||| || ||||| | ||||||| Sbjct: 469 acccaatagagttggttgtctggcttcctgcactatgcagaaagatggaaattccttact 528 Query: 567 gcattgttaaggg 579 ||||||| ||||| Sbjct: 529 gcattgtgaaggg 541 Score = 42.1 bits (21), Expect = 2.1 Identities = 36/41 (87%) Strand = Plus / Plus Query: 110 aatccgctgttcgagaagaggccgaagcaatttggcatcgg 150 ||||| |||||||||||| |||| ||||| ||||| ||||| Sbjct: 72 aatccactgttcgagaagcggccaaagcagtttggtatcgg 112
>ref|NM_116152.2| Arabidopsis thaliana structural constituent of ribosome AT3G62870 mRNA, complete cds Length = 1048 Score = 117 bits (59), Expect = 4e-23 Identities = 152/183 (83%) Strand = Plus / Plus Query: 413 aagaagccaattgttgtgaaatatggccttaaccatgttacctacctaattgaacagagt 472 |||||||| |||||||| || ||||| || |||||||| || ||||| || || |||| Sbjct: 441 aagaagcccattgttgttaagtatggtctcaaccatgtgacttacctcatcgagcagaac 500 Query: 473 aaagcccagctggttgtcatagctcatgatgttgatccgattgagctggttgtgtggctc 532 || || ||||| || ||||| || || |||||||| || || ||| |||| || ||| | Sbjct: 501 aaggcacagcttgtggtcattgcacacgatgttgaccctatcgagttggtggtctggtta 560 Query: 533 cctgccctttgcaggaaaatggaggtcccttactgcattgttaagggaaaatctcgcctt 592 ||||| || |||||||||||||| |||||||||||||||||||||||||||||||| ||| Sbjct: 561 cctgcactctgcaggaaaatggaagtcccttactgcattgttaagggaaaatctcgtctt 620 Query: 593 gga 595 ||| Sbjct: 621 gga 623
>emb|AL162651.1|ATF26K9 Arabidopsis thaliana DNA chromosome 3, BAC clone F26K9 Length = 110257 Score = 117 bits (59), Expect = 4e-23 Identities = 152/183 (83%) Strand = Plus / Minus Query: 413 aagaagccaattgttgtgaaatatggccttaaccatgttacctacctaattgaacagagt 472 |||||||| |||||||| || ||||| || |||||||| || ||||| || || |||| Sbjct: 96453 aagaagcccattgttgttaagtatggtctcaaccatgtgacttacctcatcgagcagaac 96394 Query: 473 aaagcccagctggttgtcatagctcatgatgttgatccgattgagctggttgtgtggctc 532 || || ||||| || ||||| || || |||||||| || || ||| |||| || ||| | Sbjct: 96393 aaggcacagcttgtggtcattgcacacgatgttgaccctatcgagttggtggtctggtta 96334 Query: 533 cctgccctttgcaggaaaatggaggtcccttactgcattgttaagggaaaatctcgcctt 592 ||||| || |||||||||||||| |||||||||||||||||||||||||||||||| ||| Sbjct: 96333 cctgcactctgcaggaaaatggaagtcccttactgcattgttaagggaaaatctcgtctt 96274 Query: 593 gga 595 ||| Sbjct: 96273 gga 96271
>gb|AY114667.1| Arabidopsis thaliana 60S ribosomal protein L7A protein (At3g62870) mRNA, complete cds Length = 883 Score = 117 bits (59), Expect = 4e-23 Identities = 152/183 (83%) Strand = Plus / Plus Query: 413 aagaagccaattgttgtgaaatatggccttaaccatgttacctacctaattgaacagagt 472 |||||||| |||||||| || ||||| || |||||||| || ||||| || || |||| Sbjct: 361 aagaagcccattgttgttaagtatggtctcaaccatgtgacttacctcatcgagcagaac 420 Query: 473 aaagcccagctggttgtcatagctcatgatgttgatccgattgagctggttgtgtggctc 532 || || ||||| || ||||| || || |||||||| || || ||| |||| || ||| | Sbjct: 421 aaggcacagcttgtggtcattgcacacgatgttgaccctatcgagttggtggtctggtta 480 Query: 533 cctgccctttgcaggaaaatggaggtcccttactgcattgttaagggaaaatctcgcctt 592 ||||| || |||||||||||||| |||||||||||||||||||||||||||||||| ||| Sbjct: 481 cctgcactctgcaggaaaatggaagtcccttactgcattgttaagggaaaatctcgtctt 540 Query: 593 gga 595 ||| Sbjct: 541 gga 543
>gb|AY062758.1| Arabidopsis thaliana 60S RIBOSOMAL PROTEIN L7A protein (At3g62870; F26K9_300) mRNA, complete cds Length = 976 Score = 117 bits (59), Expect = 4e-23 Identities = 152/183 (83%) Strand = Plus / Plus Query: 413 aagaagccaattgttgtgaaatatggccttaaccatgttacctacctaattgaacagagt 472 |||||||| |||||||| || ||||| || |||||||| || ||||| || || |||| Sbjct: 397 aagaagcccattgttgttaagtatggtctcaaccatgtgacttacctcatcgagcagaac 456 Query: 473 aaagcccagctggttgtcatagctcatgatgttgatccgattgagctggttgtgtggctc 532 || || ||||| || ||||| || || |||||||| || || ||| |||| || ||| | Sbjct: 457 aaggcacagcttgtggtcattgcacacgatgttgaccctatcgagttggtggtctggtta 516 Query: 533 cctgccctttgcaggaaaatggaggtcccttactgcattgttaagggaaaatctcgcctt 592 ||||| || |||||||||||||| |||||||||||||||||||||||||||||||| ||| Sbjct: 517 cctgcactctgcaggaaaatggaagtcccttactgcattgttaagggaaaatctcgtctt 576 Query: 593 gga 595 ||| Sbjct: 577 gga 579
>gb|AY060519.1| Arabidopsis thaliana AT3g62870/F26K9_300 mRNA, complete cds Length = 771 Score = 117 bits (59), Expect = 4e-23 Identities = 152/183 (83%) Strand = Plus / Plus Query: 413 aagaagccaattgttgtgaaatatggccttaaccatgttacctacctaattgaacagagt 472 |||||||| |||||||| || ||||| || |||||||| || ||||| || || |||| Sbjct: 361 aagaagcccattgttgttaagtatggtctcaaccatgtgacttacctcatcgagcagaac 420 Query: 473 aaagcccagctggttgtcatagctcatgatgttgatccgattgagctggttgtgtggctc 532 || || ||||| || ||||| || || |||||||| || || ||| |||| || ||| | Sbjct: 421 aaggcacagcttgtggtcattgcacacgatgttgaccctatcgagttggtggtctggtta 480 Query: 533 cctgccctttgcaggaaaatggaggtcccttactgcattgttaagggaaaatctcgcctt 592 ||||| || |||||||||||||| |||||||||||||||||||||||||||||||| ||| Sbjct: 481 cctgcactctgcaggaaaatggaagtcccttactgcattgttaagggaaaatctcgtctt 540 Query: 593 gga 595 ||| Sbjct: 541 gga 543
>gb|AY052264.1| Arabidopsis thaliana AT3g62870/F26K9_300 mRNA, complete cds Length = 1013 Score = 117 bits (59), Expect = 4e-23 Identities = 152/183 (83%) Strand = Plus / Plus Query: 413 aagaagccaattgttgtgaaatatggccttaaccatgttacctacctaattgaacagagt 472 |||||||| |||||||| || ||||| || |||||||| || ||||| || || |||| Sbjct: 434 aagaagcccattgttgttaagtatggtctcaaccatgtgacttacctcatcgagcagaac 493 Query: 473 aaagcccagctggttgtcatagctcatgatgttgatccgattgagctggttgtgtggctc 532 || || ||||| || ||||| || || |||||||| || || ||| |||| || ||| | Sbjct: 494 aaggcacagcttgtggtcattgcacacgatgttgaccctatcgagttggtggtctggtta 553 Query: 533 cctgccctttgcaggaaaatggaggtcccttactgcattgttaagggaaaatctcgcctt 592 ||||| || |||||||||||||| |||||||||||||||||||||||||||||||| ||| Sbjct: 554 cctgcactctgcaggaaaatggaagtcccttactgcattgttaagggaaaatctcgtctt 613 Query: 593 gga 595 ||| Sbjct: 614 gga 616
>emb|BX825094.1|CNS0A7RE Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH9ZD11 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 835 Score = 117 bits (59), Expect = 4e-23 Identities = 152/183 (83%) Strand = Plus / Plus Query: 413 aagaagccaattgttgtgaaatatggccttaaccatgttacctacctaattgaacagagt 472 |||||||| |||||||| || ||||| || |||||||| || ||||| || || |||| Sbjct: 317 aagaagcccattgttgttaagtatggtctcaaccatgtgacttacctcatcgagcagaac 376 Query: 473 aaagcccagctggttgtcatagctcatgatgttgatccgattgagctggttgtgtggctc 532 || || ||||| || ||||| || || |||||||| || || ||| |||| || ||| | Sbjct: 377 aaggcacagcttgtggtcattgcacacgatgttgaccctatcgagttggtggtctggtta 436 Query: 533 cctgccctttgcaggaaaatggaggtcccttactgcattgttaagggaaaatctcgcctt 592 ||||| || |||||||||||||| |||||||||||||||||||||||||||||||| ||| Sbjct: 437 cctgcactctgcaggaaaatggaagtcccttactgcattgttaagggaaaatctcgtctt 496 Query: 593 gga 595 ||| Sbjct: 497 gga 499
>emb|BX823982.1|CNS0A6PP Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH12ZB02 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 946 Score = 117 bits (59), Expect = 4e-23 Identities = 152/183 (83%) Strand = Plus / Plus Query: 413 aagaagccaattgttgtgaaatatggccttaaccatgttacctacctaattgaacagagt 472 |||||||| |||||||| || ||||| || |||||||| || ||||| || || |||| Sbjct: 381 aagaagcccattgttgttaagtatggtctcaaccatgtgacttacctcatcgagcagaac 440 Query: 473 aaagcccagctggttgtcatagctcatgatgttgatccgattgagctggttgtgtggctc 532 || || ||||| || ||||| || || |||||||| || || ||| |||| || ||| | Sbjct: 441 aaggcacagcttgtggtcattgcacacgatgttgaccctatcgagttggtggtctggtta 500 Query: 533 cctgccctttgcaggaaaatggaggtcccttactgcattgttaagggaaaatctcgcctt 592 ||||| || |||||||||||||| |||||||||||||||||||||||||||||||| ||| Sbjct: 501 cctgcactctgcaggaaaatggaagtcccttactgcattgttaagggaaaatctcgtctt 560 Query: 593 gga 595 ||| Sbjct: 561 gga 563
>emb|BX824662.1|CNS0A4TO Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH63ZA03 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 940 Score = 117 bits (59), Expect = 4e-23 Identities = 152/183 (83%) Strand = Plus / Plus Query: 413 aagaagccaattgttgtgaaatatggccttaaccatgttacctacctaattgaacagagt 472 |||||||| |||||||| || ||||| || |||||||| || ||||| || || |||| Sbjct: 399 aagaagcccattgttgttaagtatggtctcaaccatgtgacttacctcatcgagcagaac 458 Query: 473 aaagcccagctggttgtcatagctcatgatgttgatccgattgagctggttgtgtggctc 532 || || ||||| || ||||| || || |||||||| || || ||| |||| || ||| | Sbjct: 459 aaggcacagcttgtggtcattgcacacgatgttgaccctatcgagttggtggtctggtta 518 Query: 533 cctgccctttgcaggaaaatggaggtcccttactgcattgttaagggaaaatctcgcctt 592 ||||| || |||||||||||||| |||||||||||||||||||||||||||||||| ||| Sbjct: 519 cctgcactctgcaggaaaatggaagtcccttactgcattgttaagggaaaatctcgtctt 578 Query: 593 gga 595 ||| Sbjct: 579 gga 581
>gb|AY086353.1| Arabidopsis thaliana clone 24272 mRNA, complete sequence Length = 1020 Score = 117 bits (59), Expect = 4e-23 Identities = 152/183 (83%) Strand = Plus / Plus Query: 413 aagaagccaattgttgtgaaatatggccttaaccatgttacctacctaattgaacagagt 472 |||||||| |||||||| || ||||| || |||||||| || ||||| || || |||| Sbjct: 441 aagaagcccattgttgttaagtatggtctcaaccatgtgacttacctcatcgagcagaac 500 Query: 473 aaagcccagctggttgtcatagctcatgatgttgatccgattgagctggttgtgtggctc 532 || || ||||| || ||||| || || |||||||| || || ||| |||| || ||| | Sbjct: 501 aaggcacagcttgtggtcattgcacacgatgttgaccctatcgagttggtggtctggtta 560 Query: 533 cctgccctttgcaggaaaatggaggtcccttactgcattgttaagggaaaatctcgcctt 592 ||||| || |||||||||||||| |||||||||||||||||||||||||||||||| ||| Sbjct: 561 cctgcactctgcaggaaaatggaagtcccttactgcattgttaagggaaaatctcgtctt 620 Query: 593 gga 595 ||| Sbjct: 621 gga 623
>gb|BT014547.1| Lycopersicon esculentum clone 133964F, mRNA sequence Length = 1092 Score = 115 bits (58), Expect = 2e-22 Identities = 256/322 (79%) Strand = Plus / Plus Query: 267 accagttcacccgcaccctcgacaagaaccttgcaacgaacttgttcaagatgcttctta 326 ||||||||||| ||||| |||||||||| || || | | | |||||||||||||||| Sbjct: 276 accagttcaccaaaacccttgacaagaaccccgctacaacccttttcaagatgcttctta 335 Query: 327 agtaccgtcccgaagacaaagttgccaagaaggagaggcttctaaagagggcccaggctg 386 ||||| | || || ||||||| ||| ||||||||| | ||| | || ||||| || |||| Sbjct: 336 agtacaggcctgaggacaaagctgcaaagaaggagcgtcttgtcaaaagggctcaagctg 395 Query: 387 aagccgaagggaaaactgttgaggcaaagaagccaattgttgtgaaatatggccttaacc 446 |||| ||||| |||||| ||| ||||||| || ||||||||||| ||||| ||||| | Sbjct: 396 aagcagaaggaaaaactcctgaaacaaagaaacccattgttgtgaagtatgggcttaagc 455 Query: 447 atgttacctacctaattgaacagagtaaagcccagctggttgtcatagctcatgatgttg 506 | | || ||||| ||||| |||| ||||| ||| |||| || || |||||||| || | Sbjct: 456 acatcacttaccttattgagcagaacaaagctcagttggtagtgattgctcatgacgtgg 515 Query: 507 atccgattgagctggttgtgtggctccctgccctttgcaggaaaatggaggtcccttact 566 | || || ||| ||||||| ||||| ||||| || ||||| || ||||| | ||||||| Sbjct: 516 acccaatagagttggttgtctggcttcctgcgctatgcagaaagatggaaattccttact 575 Query: 567 gcattgttaagggaaaatctcg 588 ||||||| ||||| ||| |||| Sbjct: 576 gcattgtgaagggcaaagctcg 597
>emb|BX824178.1|CNS0A6S9 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH28ZG05 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 983 Score = 109 bits (55), Expect = 1e-20 Identities = 151/183 (82%) Strand = Plus / Plus Query: 413 aagaagccaattgttgtgaaatatggccttaaccatgttacctacctaattgaacagagt 472 |||||||| |||||||| || ||||| | |||||||| || ||||| || || |||| Sbjct: 400 aagaagcccattgttgttaagtatggtgtaaaccatgtgacttacctcatcgagcagaac 459 Query: 473 aaagcccagctggttgtcatagctcatgatgttgatccgattgagctggttgtgtggctc 532 || || ||||| || ||||| || || |||||||| || || ||| |||| || ||| | Sbjct: 460 aaggcacagcttgtggtcattgcacacgatgttgaccctatcgagttggtggtctggtta 519 Query: 533 cctgccctttgcaggaaaatggaggtcccttactgcattgttaagggaaaatctcgcctt 592 ||||| || |||||||||||||| |||||||||||||||||||||||||||||||| ||| Sbjct: 520 cctgcactctgcaggaaaatggaagtcccttactgcattgttaagggaaaatctcgtctt 579 Query: 593 gga 595 ||| Sbjct: 580 gga 582
>emb|BX822281.1|CNS0A71I Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB26ZA10 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 870 Score = 109 bits (55), Expect = 1e-20 Identities = 151/183 (82%) Strand = Plus / Plus Query: 413 aagaagccaattgttgtgaaatatggccttaaccatgttacctacctaattgaacagagt 472 |||||||| |||||||| || ||||| || |||||||| || ||||| || || |||| Sbjct: 354 aagaagcccattgttgttaagtatggtctcaaccatgtaacttacctcatcgagcagaac 413 Query: 473 aaagcccagctggttgtcatagctcatgatgttgatccgattgagctggttgtgtggctc 532 || || ||||| || ||||| || || |||||||| || || ||| |||| || ||| | Sbjct: 414 aaggcacagcttgtggtcattgcacacgatgttgaccctatcgagttggtggtctggtta 473 Query: 533 cctgccctttgcaggaaaatggaggtcccttactgcattgttaagggaaaatctcgcctt 592 ||||| || |||||||||||||| |||||| ||||||||||||||||||||||||| ||| Sbjct: 474 cctgcactctgcaggaaaatggaagtccctaactgcattgttaagggaaaatctcgtctt 533 Query: 593 gga 595 ||| Sbjct: 534 gga 536
>gb|AY496113.1| Capsicum annuum 60S ribosomal protein L7A mRNA, partial cds Length = 737 Score = 107 bits (54), Expect = 4e-20 Identities = 258/326 (79%) Strand = Plus / Plus Query: 248 aaggtgcccccggcacttcaccagttcacccgcaccctcgacaagaaccttgcaacgaac 307 ||||| ||||| || ||| ||||||||||| || || || ||||||||||| || | | Sbjct: 229 aaggttcccccagctcttaaccagttcaccaagacacttgataagaaccttgctacaacc 288 Query: 308 ttgttcaagatgcttcttaagtaccgtcccgaagacaaagttgccaagaaggagaggctt 367 | |||||||||||||| |||||| | || || ||||||| ||| ||||||||| | ||| Sbjct: 289 cttttcaagatgcttctgaagtacaggcctgaggacaaagctgcaaagaaggagcgtctt 348 Query: 368 ctaaagagggcccaggctgaagccgaagggaaaactgttgaggcaaagaagccaattgtt 427 | || ||||| || |||||||| ||||| || ||| ||| ||||||| || ||| | Sbjct: 349 gtcaaaagggctcaagctgaagctgaaggaaagactcctgaaacaaagaaacccattatc 408 Query: 428 gtgaaatatggccttaaccatgttacctacctaattgaacagagtaaagcccagctggtt 487 ||||||||||| ||||| || | || ||||| ||||| |||| |||||| ||| | || Sbjct: 409 gtgaaatatgggcttaagcacatcacgtaccttattgagcagaataaagctcagttagta 468 Query: 488 gtcatagctcatgatgttgatccgattgagctggttgtgtggctccctgccctttgcagg 547 || || ||||||||||| || || |||||| ||||||| ||||| || ||||| ||||| Sbjct: 469 gtgattgctcatgatgtggacccaattgagttggttgtctggcttccggccctatgcaga 528 Query: 548 aaaatggaggtcccttactgcattgt 573 || ||||| | |||||||||||||| Sbjct: 529 aagatggaaattccttactgcattgt 554
>emb|BX824325.1|CNS0A7R8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH3ZF06 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 793 Score = 101 bits (51), Expect = 3e-18 Identities = 150/183 (81%) Strand = Plus / Plus Query: 413 aagaagccaattgttgtgaaatatggccttaaccatgttacctacctaattgaacagagt 472 |||||||| |||||||| || ||||| || |||||||| || ||||| || || |||| Sbjct: 311 aagaagcccattgttgttaagtatggtctcaaccatgtcacttacctcatcgagcagaac 370 Query: 473 aaagcccagctggttgtcatagctcatgatgttgatccgattgagctggttgtgtggctc 532 || || ||||| || ||||| || || |||||||| || || ||| |||| || ||| | Sbjct: 371 aaggcacagcttgtggtcattgcacacgatgttgaccctatcgagttggtggtctggtta 430 Query: 533 cctgccctttgcaggaaaatggaggtcccttactgcattgttaagggaaaatctcgcctt 592 ||||| || |||||||||||||| |||||| |||||||| |||||||||||||||| ||| Sbjct: 431 cctgcactctgcaggaaaatggaagtccctcactgcatttttaagggaaaatctcgtctt 490 Query: 593 gga 595 ||| Sbjct: 491 gga 493
>gb|AC155335.1| Brassica rapa subsp. pekinensis chromosome Cytogenetic chromosome 1 clone KBrH001H24, complete sequence Length = 118144 Score = 93.7 bits (47), Expect = 6e-16 Identities = 149/183 (81%) Strand = Plus / Minus Query: 413 aagaagccaattgttgtgaaatatggccttaaccatgttacctacctaattgaacagagt 472 |||||||| |||||||| || ||||| || ||||| || || ||| | || || |||| Sbjct: 112236 aagaagcccattgttgtcaagtatgggctcaaccacgtgacttacttgatcgagcagaac 112177 Query: 473 aaagcccagctggttgtcatagctcatgatgttgatccgattgagctggttgtgtggctc 532 || || ||||| |||||||| ||||| |||||||| || |||||||| || || ||| | Sbjct: 112176 aaggcgcagcttgttgtcattgctcacgatgttgaccccattgagcttgtcgtctggtta 112117 Query: 533 cctgccctttgcaggaaaatggaggtcccttactgcattgttaagggaaaatctcgcctt 592 ||||| ||||| ||||| ||||| || ||||||||||||||||| || |||||||| ||| Sbjct: 112116 cctgctctttgtaggaagatggaagtgccttactgcattgttaaaggcaaatctcgtctt 112057 Query: 593 gga 595 ||| Sbjct: 112056 gga 112054
>gb|BC106480.1| Xenopus laevis cDNA clone IMAGE:7211162 Length = 935 Score = 89.7 bits (45), Expect = 1e-14 Identities = 87/101 (86%) Strand = Plus / Minus Query: 479 cagctggttgtcatagctcatgatgttgatccgattgagctggttgtgtggctccctgcc 538 ||||| ||||| || ||||||||||||||||| |||||||| ||||||| ||||||||| Sbjct: 435 cagcttgttgtgatcgctcatgatgttgatccaattgagcttgttgtgttcctccctgcc 376 Query: 539 ctttgcaggaaaatggaggtcccttactgcattgttaaggg 579 | |||||||| |||| ||||| ||||||||||| ||||| Sbjct: 375 ttgtgcaggaagatgggagtcccatactgcattgtcaaggg 335
>gb|AY393839.1| Xenopus laevis ribosomal protein L7a mRNA, partial cds Length = 715 Score = 89.7 bits (45), Expect = 1e-14 Identities = 87/101 (86%) Strand = Plus / Plus Query: 479 cagctggttgtcatagctcatgatgttgatccgattgagctggttgtgtggctccctgcc 538 ||||| ||||| || ||||||||||||||||| |||||||| ||||||| ||||||||| Sbjct: 422 cagcttgttgtgatcgctcatgatgttgatccaattgagcttgttgtgttcctccctgcc 481 Query: 539 ctttgcaggaaaatggaggtcccttactgcattgttaaggg 579 | |||||||| |||| ||||| ||||||||||| ||||| Sbjct: 482 ttgtgcaggaagatgggagtcccatactgcattgtcaaggg 522
>gb|AC155339.1| Brassica rapa subsp. pekinensis chromosome Cytogenetic chromosome 1 clone KBrH015H17, complete sequence Length = 110885 Score = 79.8 bits (40), Expect = 1e-11 Identities = 149/184 (80%), Gaps = 1/184 (0%) Strand = Plus / Minus Query: 413 aagaagccaattgttgtgaaatatggccttaaccatgttacctacctaattgaacagagt 472 |||||||| |||||||| || ||||| || ||||| || || ||| | || || |||| Sbjct: 26060 aagaagcccattgttgtcaagtatgggctcaaccacgtgacttacttgatcgagcagaac 26001 Query: 473 aaagcccagctggttgtcatagctcat-gatgttgatccgattgagctggttgtgtggct 531 || || ||||| |||||||| ||||| |||||||| || |||||||| || || ||| | Sbjct: 26000 aaggcgcagcttgttgtcattgctcaacgatgttgaccccattgagcttgtcgtctggtt 25941 Query: 532 ccctgccctttgcaggaaaatggaggtcccttactgcattgttaagggaaaatctcgcct 591 ||||| ||||| ||||| ||||| || ||||||||||||||||| || |||||||| || Sbjct: 25940 acctgctctttgtaggaagatggaagtgccttactgcattgttaaaggcaaatctcgtct 25881 Query: 592 tgga 595 |||| Sbjct: 25880 tgga 25877
>dbj|AK220651.1| Arabidopsis thaliana mRNA for 60S ribosomal protein L7A, complete cds, clone: RAFL21-65-D24 Length = 498 Score = 77.8 bits (39), Expect = 4e-11 Identities = 84/99 (84%) Strand = Plus / Plus Query: 497 catgatgttgatccgattgagctggttgtgtggctccctgccctttgcaggaaaatggag 556 |||||||| || || |||||| ||||||| ||| | ||||| || |||||||| ||||| Sbjct: 1 catgatgtcgacccaattgagttggttgtctggttgcctgctctgtgcaggaagatggaa 60 Query: 557 gtcccttactgcattgttaagggaaaatctcgccttgga 595 ||||| ||||||||||| ||||| |||||||| |||||| Sbjct: 61 gtcccgtactgcattgtcaagggcaaatctcgtcttgga 99
>emb|BX821043.1|CNS0A8L9 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH94ZE02 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 764 Score = 67.9 bits (34), Expect = 4e-08 Identities = 133/166 (80%) Strand = Plus / Plus Query: 422 attgttgtgaaatatggccttaaccatgttacctacctaattgaacagagtaaagcccag 481 ||||| |||||||| ||||| ||| |||| | | |||| ||||| |||| || |||| Sbjct: 202 attgtagtgaaatacggcctaaacgatgtgagcgacctgattgagcagaagaaggcccca 261 Query: 482 ctggttgtcatagctcatgatgttgatccgattgagctggttgtgtggctccctgccctt 541 || ||||| || || |||||||| || || |||||| ||||||||||| | ||||| | Sbjct: 262 cttgttgtgattgcgcatgatgtcgacccaattgagttggttgtgtggtttcctgctatg 321 Query: 542 tgcaggaaaatggaggtcccttactgcattgttaagggaaaatctc 587 |||||||| ||||| || || ||||||||||| ||||| ||||||| Sbjct: 322 tgcaggaagatggaagtgccgtactgcattgtgaagggcaaatctc 367
>emb|AJ718619.1| Nicotiana tabacum cDNA-AFLP-fragment BSTC3-31-300, cultivar Bright Yellow 2 Length = 236 Score = 63.9 bits (32), Expect = 6e-07 Identities = 100/123 (81%) Strand = Plus / Plus Query: 281 accctcgacaagaaccttgcaacgaacttgttcaagatgcttcttaagtaccgtcccgaa 340 ||||| |||| ||||| || || ||| |||||||||||||||| |||||| | || || Sbjct: 77 accctggacanaaacctcgcgaccaacctgttcaagatgcttctcaagtacaggcctgag 136 Query: 341 gacaaagttgccaagaaggagaggcttctaaagagggcccaggctgaagccgaagggaaa 400 ||||||| ||| ||||||||| | ||| | || ||||| || |||||||| ||||| ||| Sbjct: 137 gacaaagctgcaaagaaggagcgtcttgtgaaaagggctcaagctgaagctgaaggaaaa 196 Query: 401 act 403 ||| Sbjct: 197 act 199
>gb|BC072834.1| Xenopus laevis MGC80199 protein, mRNA (cDNA clone MGC:80199 IMAGE:4970819), complete cds Length = 916 Score = 61.9 bits (31), Expect = 2e-06 Identities = 88/107 (82%) Strand = Plus / Plus Query: 473 aaagcccagctggttgtcatagctcatgatgttgatccgattgagctggttgtgtggctc 532 ||||| ||||| ||||| || || ||||| || ||||| |||||||| ||||||| ||| Sbjct: 496 aaagctcagcttgttgtgattgcccatgacgtggatcccattgagctcgttgtgttcctc 555 Query: 533 cctgccctttgcaggaaaatggaggtcccttactgcattgttaaggg 579 |||||| | ||| |||| |||| ||||| ||||||||||| ||||| Sbjct: 556 cctgccttgtgccggaagatgggagtcccatactgcattgtcaaggg 602
>gb|AY769275.1| Bombyx mori ribosomal protein L7A (RpL7A) mRNA, complete cds Length = 964 Score = 58.0 bits (29), Expect = 3e-05 Identities = 41/45 (91%) Strand = Plus / Plus Query: 479 cagctggttgtcatagctcatgatgttgatccgattgagctggtt 523 ||||| || ||||| ||||||||||||||||| |||||||||||| Sbjct: 580 cagcttgtggtcatcgctcatgatgttgatcctattgagctggtt 624
>ref|XM_846090.1| PREDICTED: Canis familiaris similar to 60S ribosomal protein L7a (Surfeit locus protein 3) (LOC490635), mRNA Length = 809 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 479 cagctggttgtcatagctcatgatgttgatccgattgagctggttgt 525 |||||||| || ||||| |||||||| ||||| |||||||||||||| Sbjct: 418 cagctggtagtgatagcacatgatgtggatcccattgagctggttgt 464
>emb|AM049005.1| Meladema coriacea mRNA for ribosomal protein L7Ae (rpL7Ae gene) Length = 807 Score = 54.0 bits (27), Expect = 5e-04 Identities = 66/79 (83%) Strand = Plus / Plus Query: 476 gcccagctggttgtcatagctcatgatgttgatccgattgagctggttgtgtggctccct 535 ||||| || ||||| || ||||||||||||||||| ||||| ||||| | | ||||| Sbjct: 460 gcccaacttgttgttattgctcatgatgttgatcctcttgagttggttctctatctccca 519 Query: 536 gccctttgcaggaaaatgg 554 ||||| ||||||||||||| Sbjct: 520 gccctgtgcaggaaaatgg 538
>gb|AY924998.1| Seculamonas ecuadoriensis Rpl7A mRNA, partial cds Length = 653 Score = 52.0 bits (26), Expect = 0.002 Identities = 71/86 (82%) Strand = Plus / Plus Query: 509 ccgattgagctggttgtgtggctccctgccctttgcaggaaaatggaggtcccttactgc 568 ||||||||||| || || |||||||| |||| |||| ||| |||| ||||| |||||| Sbjct: 452 ccgattgagctcgtcgtctggctcccgaccctctgcaagaagatgggtgtcccgtactgc 511 Query: 569 attgttaagggaaaatctcgccttgg 594 ||||| ||||| || |||||||||| Sbjct: 512 attgtcaagggcaaggctcgccttgg 537
>gb|AY439881.1| Armigeres subalbatus ASAP ID: 38933 cytosolic large ribosomal subunit L7a mRNA sequence Length = 786 Score = 50.1 bits (25), Expect = 0.009 Identities = 37/41 (90%) Strand = Plus / Plus Query: 482 ctggttgtcatagctcatgatgttgatccgattgagctggt 522 ||||||||||| |||| ||||||||||| ||||||||||| Sbjct: 531 ctggttgtcatctctcacgatgttgatccaattgagctggt 571
>ref|XM_759559.1| Theileria parva strain Muguga 60S ribosomal protein L7a (TP02_0083) partial mRNA Length = 915 Score = 50.1 bits (25), Expect = 0.009 Identities = 37/41 (90%) Strand = Plus / Plus Query: 527 tggctccctgccctttgcaggaaaatggaggtcccttactg 567 ||||||||||| || |||||||||| ||||||||| ||||| Sbjct: 595 tggctccctgcactatgcaggaaaaaggaggtcccgtactg 635
>dbj|AK108838.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-151-H01, full insert sequence Length = 983 Score = 50.1 bits (25), Expect = 0.009 Identities = 43/49 (87%) Strand = Plus / Plus Query: 181 ccgcttcgttaagtggcccaaggttgtgcgcatccagcgccagcgccgc 229 |||||| || |||||||||||| ||||||| | ||||||||||||||| Sbjct: 180 ccgctttgtgaagtggcccaagtatgtgcgcctgcagcgccagcgccgc 228
>gb|AY925011.1| Trimastix pyriformis ATCC50562 Rpl7A gene, partial cds Length = 608 Score = 48.1 bits (24), Expect = 0.034 Identities = 39/44 (88%) Strand = Plus / Plus Query: 551 atggaggtcccttactgcattgttaagggaaaatctcgccttgg 594 ||||| ||||| ||||||||||||||||| || |||||||||| Sbjct: 345 atggacgtcccctactgcattgttaagggcaaggctcgccttgg 388
>gb|DQ118092.1| Trimastix pyriformis ribosomal protein L7A mRNA, complete cds Length = 804 Score = 48.1 bits (24), Expect = 0.034 Identities = 39/44 (88%) Strand = Plus / Plus Query: 551 atggaggtcccttactgcattgttaagggaaaatctcgccttgg 594 ||||| ||||| ||||||||||||||||| || |||||||||| Sbjct: 529 atggacgtcccctactgcattgttaagggcaaggctcgccttgg 572
>emb|AL441963.7| Human DNA sequence from clone RP11-280O24 on chromosome 9 Contains a ATP synthase, H+ transporting, mitochondrial F0 complex, subunit d (ATP5H) (ATPQ, ATP5JD) pseudogene, the 3' end of the NFIB gene for nuclear factor I/B (NFIB2, NFIB3, NFI-RED) and a ribosomal protein L7a (RPL7A) pseudogene, complete sequence Length = 159476 Score = 48.1 bits (24), Expect = 0.034 Identities = 54/64 (84%) Strand = Plus / Plus Query: 506 gatccgattgagctggttgtgtggctccctgccctttgcaggaaaatggaggtcccttac 565 ||||| || ||||||||||||| || |||||||| || | ||||||| |||||||||| Sbjct: 141263 gatcccatcgagctggttgtgttcctgcctgccctgtgtcgtaaaatgggggtcccttac 141322 Query: 566 tgca 569 |||| Sbjct: 141323 tgca 141326
>emb|AM049007.1| Scarabaeus laticollis mRNA for ribosomal protein L7Ae (rpL7Ae gene) Length = 810 Score = 48.1 bits (24), Expect = 0.034 Identities = 39/44 (88%) Strand = Plus / Plus Query: 476 gcccagctggttgtcatagctcatgatgttgatccgattgagct 519 ||||| || |||||||| || ||||||||||| ||||||||||| Sbjct: 463 gcccaacttgttgtcattgcgcatgatgttgacccgattgagct 506
>gb|AY924996.1| Malawimonas jakobiformis Rpl7A mRNA, partial cds Length = 735 Score = 48.1 bits (24), Expect = 0.034 Identities = 45/52 (86%) Strand = Plus / Plus Query: 483 tggttgtcatagctcatgatgttgatccgattgagctggttgtgtggctccc 534 |||| ||||| ||||| |||||||| ||||||||||| ||| | |||||||| Sbjct: 517 tggtcgtcatcgctcacgatgttgacccgattgagcttgttctctggctccc 568
>gb|AF401560.1| Ictalurus punctatus ribosomal protein L7a mRNA, complete cds Length = 860 Score = 48.1 bits (24), Expect = 0.034 Identities = 87/108 (80%) Strand = Plus / Plus Query: 476 gcccagctggttgtcatagctcatgatgttgatccgattgagctggttgtgtggctccct 535 |||||||||||||| || ||||||||||| || || || |||||||| ||| || ||| Sbjct: 459 gcccagctggttgtgatcgctcatgatgtcgacccaatcgagctggtgttgttcctgcct 518 Query: 536 gccctttgcaggaaaatggaggtcccttactgcattgttaagggaaaa 583 || || ||| | || |||| ||||| |||||||| ||||| |||||| Sbjct: 519 gctctgtgccgtaagatgggtgtcccatactgcatcgttaaaggaaaa 566 Score = 40.1 bits (20), Expect = 8.2 Identities = 29/32 (90%) Strand = Plus / Plus Query: 116 ctgttcgagaagaggccgaagcaatttggcat 147 ||||||||||| ||||||||| | |||||||| Sbjct: 96 ctgttcgagaaaaggccgaagaactttggcat 127
>gb|AC022294.15| Homo sapiens 3 BAC RP11-4B14 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 153940 Score = 48.1 bits (24), Expect = 0.034 Identities = 30/32 (93%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaaggg 579 ||||||| |||||||||||||||| ||||||| Sbjct: 68316 aaaatgggggtcccttactgcattattaaggg 68347
>gb|AY239295.1| Homo sapiens proliferation-inducing protein 10 mRNA, complete cds Length = 3245 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Minus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 376 aaaatgggggtcccttactgcattatcaagggaaa 342
>gb|AY239294.1| Homo sapiens proliferation-inducing protein 9 mRNA, complete cds Length = 3245 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Minus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 376 aaaatgggggtcccttactgcattatcaagggaaa 342
>gb|BC059533.1| Danio rerio ribosomal protein L7a, mRNA (cDNA clone MGC:73183 IMAGE:4786870), complete cds Length = 854 Score = 46.1 bits (23), Expect = 0.13 Identities = 47/55 (85%) Strand = Plus / Plus Query: 473 aaagcccagctggttgtcatagctcatgatgttgatccgattgagctggttgtgt 527 ||||| || ||||| || || ||||||||||| ||||| ||||||||||| |||| Sbjct: 454 aaagcacaactggtcgttattgctcatgatgtggatcccattgagctggtggtgt 508
>gb|AY389942.1| Protopterus dolloi ribosomal protein L7a-like mRNA, partial sequence Length = 666 Score = 46.1 bits (23), Expect = 0.13 Identities = 41/47 (87%) Strand = Plus / Plus Query: 473 aaagcccagctggttgtcatagctcatgatgttgatccgattgagct 519 |||||||||||||| | | ||||||||||||||||| |||||||| Sbjct: 371 aaagcccagctggtcgctgttgctcatgatgttgatcctattgagct 417
>gb|BC073802.1| Homo sapiens ribosomal protein L7a, mRNA (cDNA clone MGC:88823 IMAGE:4336858), complete cds Length = 892 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 527 aaaatgggggtcccttactgcattatcaagggaaa 561
>gb|BC023624.2| Homo sapiens ribosomal protein L7a, mRNA (cDNA clone MGC:23179 IMAGE:4810336), complete cds Length = 944 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 592 aaaatgggggtcccttactgcattatcaagggaaa 626
>gb|BC023594.2| Homo sapiens ribosomal protein L7a, mRNA (cDNA clone MGC:23150 IMAGE:4841982), complete cds Length = 939 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 587 aaaatgggggtcccttactgcattatcaagggaaa 621
>gb|BC021979.2| Homo sapiens ribosomal protein L7a, mRNA (cDNA clone MGC:16547 IMAGE:4053567), complete cds Length = 882 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 528 aaaatgggggtcccttactgcattatcaagggaaa 562
>gb|BC105290.1| Homo sapiens ribosomal protein L7a, mRNA (cDNA clone MGC:104270 IMAGE:6495031), complete cds Length = 915 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 553 aaaatgggggtcccttactgcattatcaagggaaa 587
>ref|XM_535657.2| PREDICTED: Canis familiaris similar to 60S ribosomal protein L7a (LOC478479), mRNA Length = 574 Score = 46.1 bits (23), Expect = 0.13 Identities = 41/47 (87%) Strand = Plus / Plus Query: 479 cagctggttgtcatagctcatgatgttgatccgattgagctggttgt 525 |||||||| || ||||| |||||||| ||||| | |||||||||||| Sbjct: 181 cagctggtagtgatagcccatgatgtggatcccactgagctggttgt 227
>emb|X61923.1|HSSURF3 H.sapiens surf3 gene for ribosomal protein L7a Length = 3433 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 2628 aaaatgggggtcccttactgcattatcaagggaaa 2662
>gb|BC069215.1| Homo sapiens cDNA clone IMAGE:6375716, **** WARNING: chimeric clone **** Length = 1796 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 1444 aaaatgggggtcccttactgcattatcaagggaaa 1478
>gb|BC082978.1| Homo sapiens cDNA clone IMAGE:6579115, **** WARNING: chimeric clone **** Length = 1968 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 1632 aaaatgggggtcccttactgcattatcaagggaaa 1666
>gb|BC012174.2| Homo sapiens cDNA clone IMAGE:4643754, **** WARNING: chimeric clone **** Length = 1710 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Minus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 349 aaaatgggggtcccttactgcattatcaagggaaa 315
>ref|NG_000837.1| Homo sapiens surfeit locus (SURF@) on chromosome 9 Length = 45425 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 19941 aaaatgggggtcccttactgcattatcaagggaaa 19975
>ref|NM_000972.2| Homo sapiens ribosomal protein L7a (RPL7A), mRNA Length = 890 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 556 aaaatgggggtcccttactgcattatcaagggaaa 590
>emb|AL158826.23| Human DNA sequence from clone RP11-244N20 on chromosome 9 Contains the 5' end of the ABO gene for ABO blood group (transferase A alpha 1-3-N-acetylgalactosaminyltransferase; transferase B alpha 1-3-galactosyltransferase) pseudogene ABO-*O02 allele, the gene for a novel protein similar to lipocalin 1 (protein migrating faster than albumin tear prealbumin) (LCN1), a ribosomal protein L21 (RPL21) pseudogene, the RPL7A gene for ribosomal protein L7a, a novel gene (MGC43306), the XPMC2H gene for Xenopus prevents mitotic catastrophe 2 homolog, the 5' end of the ADAMTS13 gene for a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif 13, the SURF1 gene for surfeit 1, the SURF2 gene for surfeit 2, the SURF4 gene for surfeit 4, the SURF5 gene for surfeit 5, the SURF6 gene for surfeit 6 and eight CpG islands, complete sequence Length = 184513 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 84138 aaaatgggggtcccttactgcattatcaagggaaa 84172
>gb|BC005128.1| Homo sapiens ribosomal protein L7a, mRNA (cDNA clone MGC:10607 IMAGE:3938260), complete cds Length = 892 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 539 aaaatgggggtcccttactgcattatcaagggaaa 573
>emb|AJ224080.1|HSAJ4080 Homo sapiens rpL7a pseudogene, clone 10 Length = 949 Score = 46.1 bits (23), Expect = 0.13 Identities = 80/99 (80%) Strand = Plus / Plus Query: 473 aaagcccagctggttgtcatagctcatgatgttgatccgattgagctggttgtgtggctc 532 ||||| |||||||| || || || || ||||| ||||| || ||||||||||| | | Sbjct: 484 aaagctcagctggtggtgattgcacacgatgtggatcccatcgagctggttgtcttcttg 543 Query: 533 cctgccctttgcaggaaaatggaggtcccttactgcatt 571 |||||||| || | ||||||| |||||||||||||||| Sbjct: 544 cctgccctgtgtcgtaaaatgggggtcccttactgcatt 582
>emb|CR626449.1| full-length cDNA clone CS0DI008YE21 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 744 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 409 aaaatgggggtcccttactgcattatcaagggaaa 443
>emb|CR626332.1| full-length cDNA clone CS0DI072YC01 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 849 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 524 aaaatgggggtcccttactgcattatcaagggaaa 558
>emb|CR625438.1| full-length cDNA clone CS0DF028YK01 of Fetal brain of Homo sapiens (human) Length = 859 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 524 aaaatgggggtcccttactgcattatcaagggaaa 558
>emb|CR624133.1| full-length cDNA clone CS0DJ002YP23 of T cells (Jurkat cell line) Cot 10-normalized of Homo sapiens (human) Length = 859 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 524 aaaatgggggtcccttactgcattatcaagggaaa 558
>emb|CR624123.1| full-length cDNA clone CS0DI068YF02 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 868 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 524 aaaatgggggtcccttactgcattatcaagggaaa 558
>emb|CR623324.1| full-length cDNA clone CL0BB020ZB03 of Neuroblastoma of Homo sapiens (human) Length = 849 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 524 aaaatgggggtcccttactgcattatcaagggaaa 558
>emb|CR622399.1| full-length cDNA clone CS0DK005YH12 of HeLa cells Cot 25-normalized of Homo sapiens (human) Length = 859 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 524 aaaatgggggtcccttactgcattatcaagggaaa 558
>emb|CR621543.1| full-length cDNA clone CS0DF006YL14 of Fetal brain of Homo sapiens (human) Length = 611 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 276 aaaatgggggtcccttactgcattatcaagggaaa 310
>emb|CR620132.1| full-length cDNA clone CS0DA002YB17 of Neuroblastoma of Homo sapiens (human) Length = 861 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 526 aaaatgggggtcccttactgcattatcaagggaaa 560
>emb|CR620003.1| full-length cDNA clone CS0DI019YE20 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 835 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 500 aaaatgggggtcccttactgcattatcaagggaaa 534
>emb|CR619456.1| full-length cDNA clone CS0DJ008YK12 of T cells (Jurkat cell line) Cot 10-normalized of Homo sapiens (human) Length = 863 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 524 aaaatgggggtcccttactgcattatcaagggaaa 558
>emb|CR618604.1| full-length cDNA clone CS0DC017YJ22 of Neuroblastoma Cot 25-normalized of Homo sapiens (human) Length = 554 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 219 aaaatgggggtcccttactgcattatcaagggaaa 253
>emb|CR618555.1| full-length cDNA clone CS0DI032YH07 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 859 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 524 aaaatgggggtcccttactgcattatcaagggaaa 558
>emb|CR618005.1| full-length cDNA clone CS0DJ012YM08 of T cells (Jurkat cell line) Cot 10-normalized of Homo sapiens (human) Length = 828 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 523 aaaatgggggtcccttactgcattatcaagggaaa 557
>emb|CR617703.1| full-length cDNA clone CS0DC023YL20 of Neuroblastoma Cot 25-normalized of Homo sapiens (human) Length = 859 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 524 aaaatgggggtcccttactgcattatcaagggaaa 558
>emb|CR616252.1| full-length cDNA clone CS0DH002YO03 of T cells (Jurkat cell line) of Homo sapiens (human) Length = 849 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 524 aaaatgggggtcccttactgcattatcaagggaaa 558
>emb|CR612749.1| full-length cDNA clone CS0DI008YF18 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 849 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 524 aaaatgggggtcccttactgcattatcaagggaaa 558
>emb|CR612394.1| full-length cDNA clone CS0DA004YP13 of Neuroblastoma of Homo sapiens (human) Length = 859 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 524 aaaatgggggtcccttactgcattatcaagggaaa 558
>emb|CR611385.1| full-length cDNA clone CS0DA004YA15 of Neuroblastoma of Homo sapiens (human) Length = 859 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 524 aaaatgggggtcccttactgcattatcaagggaaa 558
>emb|CR611037.1| full-length cDNA clone CS0DF026YB01 of Fetal brain of Homo sapiens (human) Length = 863 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 524 aaaatgggggtcccttactgcattatcaagggaaa 558
>emb|CR609256.1| full-length cDNA clone CS0DD001YK02 of Neuroblastoma Cot 50-normalized of Homo sapiens (human) Length = 859 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 524 aaaatgggggtcccttactgcattatcaagggaaa 558
>emb|CR608942.1| full-length cDNA clone CS0DA004YF01 of Neuroblastoma of Homo sapiens (human) Length = 859 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 524 aaaatgggggtcccttactgcattatcaagggaaa 558
>emb|CR608873.1| full-length cDNA clone CS0DA002YH20 of Neuroblastoma of Homo sapiens (human) Length = 864 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 524 aaaatgggggtcccttactgcattatcaagggaaa 558
>emb|CR608089.1| full-length cDNA clone CS0DI040YM16 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 849 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 524 aaaatgggggtcccttactgcattatcaagggaaa 558
>emb|CR607087.1| full-length cDNA clone CS0DE002YC01 of Placenta of Homo sapiens (human) Length = 859 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 524 aaaatgggggtcccttactgcattatcaagggaaa 558
>emb|CR605545.1| full-length cDNA clone CS0DE005YD07 of Placenta of Homo sapiens (human) Length = 859 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 524 aaaatgggggtcccttactgcattatcaagggaaa 558
>emb|CR605232.1| full-length cDNA clone CS0DI042YI01 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 866 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 524 aaaatgggggtcccttactgcattatcaagggaaa 558
>emb|CR602650.1| full-length cDNA clone CS0DF020YM12 of Fetal brain of Homo sapiens (human) Length = 859 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 524 aaaatgggggtcccttactgcattatcaagggaaa 558
>emb|CR601819.1| full-length cDNA clone CS0DF011YI01 of Fetal brain of Homo sapiens (human) Length = 859 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 524 aaaatgggggtcccttactgcattatcaagggaaa 558
>emb|CR601499.1| full-length cDNA clone CS0DI063YH20 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 859 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 524 aaaatgggggtcccttactgcattatcaagggaaa 558
>emb|CR600454.1| full-length cDNA clone CS0DH003YI02 of T cells (Jurkat cell line) of Homo sapiens (human) Length = 859 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 524 aaaatgggggtcccttactgcattatcaagggaaa 558
>emb|CR599403.1| full-length cDNA clone CL0BB016ZC01 of Neuroblastoma of Homo sapiens (human) Length = 857 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 524 aaaatgggggtcccttactgcattatcaagggaaa 558
>emb|CR598739.1| full-length cDNA clone CS0DA006YH23 of Neuroblastoma of Homo sapiens (human) Length = 842 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 524 aaaatgggggtcccttactgcattatcaagggaaa 558
>emb|CR596222.1| full-length cDNA clone CS0DK006YL18 of HeLa cells Cot 25-normalized of Homo sapiens (human) Length = 859 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 524 aaaatgggggtcccttactgcattatcaagggaaa 558
>emb|CR595948.1| full-length cDNA clone CS0DI064YJ09 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1486 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 988 aaaatgggggtcccttactgcattatcaagggaaa 1022
>emb|CR594094.1| full-length cDNA clone CL0BB027ZC11 of Neuroblastoma of Homo sapiens (human) Length = 859 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 524 aaaatgggggtcccttactgcattatcaagggaaa 558
>emb|CR593347.1| full-length cDNA clone CS0DI039YP05 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 859 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 524 aaaatgggggtcccttactgcattatcaagggaaa 558
>emb|CR593208.1| full-length cDNA clone CS0DE003YC07 of Placenta of Homo sapiens (human) Length = 859 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 524 aaaatgggggtcccttactgcattatcaagggaaa 558
>emb|CR592716.1| full-length cDNA clone CS0DI042YK12 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 843 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 508 aaaatgggggtcccttactgcattatcaagggaaa 542
>emb|CR592304.1| full-length cDNA clone CS0DA005YN22 of Neuroblastoma of Homo sapiens (human) Length = 859 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 524 aaaatgggggtcccttactgcattatcaagggaaa 558
>emb|CR590883.1| full-length cDNA clone CS0DC024YJ24 of Neuroblastoma Cot 25-normalized of Homo sapiens (human) Length = 859 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 524 aaaatgggggtcccttactgcattatcaagggaaa 558
>emb|CR590295.1| full-length cDNA clone CS0DF023YB23 of Fetal brain of Homo sapiens (human) Length = 859 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 524 aaaatgggggtcccttactgcattatcaagggaaa 558
>gb|AC044782.6| Homo sapiens chromosome 10 clone RP11-170M17, complete sequence Length = 149041 Score = 46.1 bits (23), Expect = 0.13 Identities = 80/99 (80%) Strand = Plus / Plus Query: 473 aaagcccagctggttgtcatagctcatgatgttgatccgattgagctggttgtgtggctc 532 ||||| |||||||| || || || || ||||| ||||| || ||||||||||| | | Sbjct: 96704 aaagctcagctggtggtgattgcacacgatgtggatcccatcgagctggttgtcttcttg 96763 Query: 533 cctgccctttgcaggaaaatggaggtcccttactgcatt 571 |||||||| || | ||||||| |||||||||||||||| Sbjct: 96764 cctgccctgtgtcgtaaaatgggggtcccttactgcatt 96802
>gb|AC069543.5| Homo sapiens chromosome 10 clone RP11-393H5, complete sequence Length = 179789 Score = 46.1 bits (23), Expect = 0.13 Identities = 80/99 (80%) Strand = Plus / Minus Query: 473 aaagcccagctggttgtcatagctcatgatgttgatccgattgagctggttgtgtggctc 532 ||||| |||||||| || || || || ||||| ||||| || ||||||||||| | | Sbjct: 110625 aaagctcagctggtggtgattgcacacgatgtggatcccatcgagctggttgtcttcttg 110566 Query: 533 cctgccctttgcaggaaaatggaggtcccttactgcatt 571 |||||||| || | ||||||| |||||||||||||||| Sbjct: 110565 cctgccctgtgtcgtaaaatgggggtcccttactgcatt 110527
>ref|NG_003062.1| Homo sapiens ribosomal protein L7a pseudogene 1 (RPL7AP1) on chromosome 10 Length = 949 Score = 46.1 bits (23), Expect = 0.13 Identities = 80/99 (80%) Strand = Plus / Plus Query: 473 aaagcccagctggttgtcatagctcatgatgttgatccgattgagctggttgtgtggctc 532 ||||| |||||||| || || || || ||||| ||||| || ||||||||||| | | Sbjct: 484 aaagctcagctggtggtgattgcacacgatgtggatcccatcgagctggttgtcttcttg 543 Query: 533 cctgccctttgcaggaaaatggaggtcccttactgcatt 571 |||||||| || | ||||||| |||||||||||||||| Sbjct: 544 cctgccctgtgtcgtaaaatgggggtcccttactgcatt 582
>dbj|AK222534.1| Homo sapiens mRNA for ribosomal protein L7a variant, clone: adSE01733 Length = 904 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 553 aaaatgggggtcccttactgcattatcaagggaaa 587
>ref|NM_200047.1| Danio rerio ribosomal protein L7a (rpl7a), mRNA Length = 854 Score = 46.1 bits (23), Expect = 0.13 Identities = 47/55 (85%) Strand = Plus / Plus Query: 473 aaagcccagctggttgtcatagctcatgatgttgatccgattgagctggttgtgt 527 ||||| || ||||| || || ||||||||||| ||||| ||||||||||| |||| Sbjct: 454 aaagcacaactggtcgttattgctcatgatgtggatcccattgagctggtggtgt 508
>gb|AY892190.1| Synthetic construct Homo sapiens clone FLH029846.01L ribosomal protein L7a (RPL7A) mRNA, partial cds Length = 801 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 526 aaaatgggggtcccttactgcattatcaagggaaa 560
>gb|AY889730.1| Synthetic construct Homo sapiens clone FLH029850.01X ribosomal protein L7a (RPL7A) mRNA, complete cds Length = 801 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 526 aaaatgggggtcccttactgcattatcaagggaaa 560
>emb|BX641050.1|HSM806744 Homo sapiens mRNA; cDNA DKFZp686J0697 (from clone DKFZp686J0697) Length = 3020 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 2217 aaaatgggggtcccttactgcattatcaagggaaa 2251
>gb|BC071900.1| Homo sapiens ribosomal protein L7a, mRNA (cDNA clone MGC:88579 IMAGE:6090366), complete cds Length = 880 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 528 aaaatgggggtcccttactgcattatcaagggaaa 562
>gb|BC071901.1| Homo sapiens ribosomal protein L7a, mRNA (cDNA clone MGC:88580 IMAGE:6262332), complete cds Length = 874 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 536 aaaatgggggtcccttactgcattatcaagggaaa 570
>gb|BC071352.1| Danio rerio ribosomal protein L7a, mRNA (cDNA clone MGC:86667 IMAGE:6894731), complete cds Length = 889 Score = 46.1 bits (23), Expect = 0.13 Identities = 47/55 (85%) Strand = Plus / Plus Query: 473 aaagcccagctggttgtcatagctcatgatgttgatccgattgagctggttgtgt 527 ||||| || ||||| || || ||||||||||| ||||| ||||||||||| |||| Sbjct: 470 aaagcacaactggtcgttattgctcatgatgtggatcccattgagctggtggtgt 524
>gb|BC021052.1| Homo sapiens ribosomal protein L7a, mRNA (cDNA clone IMAGE:3505760) Length = 882 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 530 aaaatgggggtcccttactgcattatcaagggaaa 564
>gb|AC002107.1|AC002107 Genomic sequence from Human 9q34, complete sequence Length = 39265 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 31340 aaaatgggggtcccttactgcattatcaagggaaa 31374
>gb|M36072.1|HUMRPL7A Human ribosomal protein L7a (surf 3) large subunit mRNA, complete cds Length = 891 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 557 aaaatgggggtcccttactgcattatcaagggaaa 591
>emb|X06705.1|HSPLAX Human PLA-X mRNA Length = 883 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 556 aaaatgggggtcccttactgcattatcaagggaaa 590
>emb|X52138.1|HSL7A Human L7a gene for large ribosomal subunit component (L7a) Length = 5506 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 4471 aaaatgggggtcccttactgcattatcaagggaaa 4505
>dbj|AB056665.1| Homo sapiens RP-L7a mRNA for ribosomal protein L7a, partial cds Length = 502 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcattgttaagggaaa 582 ||||||| |||||||||||||||| | |||||||| Sbjct: 155 aaaatgggggtcccttactgcattatcaagggaaa 189
>gb|AY389941.1| Latimeria chalumnae ribosomal protein L7a-like mRNA, partial sequence Length = 704 Score = 44.1 bits (22), Expect = 0.53 Identities = 31/34 (91%) Strand = Plus / Plus Query: 489 tcatagctcatgatgttgatccgattgagctggt 522 |||| ||||||||||| ||||| ||||||||||| Sbjct: 431 tcattgctcatgatgtggatcccattgagctggt 464
>gb|AY925000.1| Acanthamoeba castellanii Rpl7A mRNA, partial cds Length = 1040 Score = 44.1 bits (22), Expect = 0.53 Identities = 31/34 (91%) Strand = Plus / Plus Query: 267 accagttcacccgcaccctcgacaagaaccttgc 300 ||||||||||| | ||||| |||||||||||||| Sbjct: 349 accagttcaccaggacccttgacaagaaccttgc 382
>gb|AC164880.3| Mus musculus BAC clone RP23-321G17 from chromosome 7, complete sequence Length = 210387 Score = 44.1 bits (22), Expect = 0.53 Identities = 34/38 (89%) Strand = Plus / Minus Query: 101 aaggtgaccaatccgctgttcgagaagaggccgaagca 138 ||||||| ||| || ||||||||||||||||| ||||| Sbjct: 10940 aaggtgatcaaccctctgttcgagaagaggcccaagca 10903
>gb|AC126674.3| Mus musculus BAC clone RP23-364B6 from chromosome 19, complete sequence Length = 203282 Score = 44.1 bits (22), Expect = 0.53 Identities = 22/22 (100%) Strand = Plus / Plus Query: 99 aaaaggtgaccaatccgctgtt 120 |||||||||||||||||||||| Sbjct: 130523 aaaaggtgaccaatccgctgtt 130544
>emb|AL590080.25| Human DNA sequence from clone RP11-469M1 on chromosome 10 Contains the HHEX gene for hematopoietically expressed homeobox, the 5' end of the gene for SEC15 (S. cerevisiae)-like (SEC15L), a eukaryotic translation initiation factor 2 subunit 2 (eIF-2-beta) pseudogene and four CpG islands, complete sequence Length = 190144 Score = 44.1 bits (22), Expect = 0.53 Identities = 22/22 (100%) Strand = Plus / Minus Query: 86 aagaagaaaacggaaaaggtga 107 |||||||||||||||||||||| Sbjct: 97690 aagaagaaaacggaaaaggtga 97669
>ref|XM_962142.1| PREDICTED: Tribolium castaneum similar to CG3314-PD, isoform D (LOC655581), mRNA Length = 968 Score = 44.1 bits (22), Expect = 0.53 Identities = 34/38 (89%) Strand = Plus / Plus Query: 542 tgcaggaaaatggaggtcccttactgcattgttaaggg 579 ||||||||||||| |||||| ||||| ||||| ||||| Sbjct: 626 tgcaggaaaatgggggtcccctactgtattgtcaaggg 663
>gb|AC148972.4| Mus musculus BAC clone RP24-82J4 from chromosome 7, complete sequence Length = 221912 Score = 44.1 bits (22), Expect = 0.53 Identities = 34/38 (89%) Strand = Plus / Minus Query: 101 aaggtgaccaatccgctgttcgagaagaggccgaagca 138 ||||||| ||| || ||||||||||||||||| ||||| Sbjct: 68216 aaggtgatcaaccctctgttcgagaagaggcccaagca 68179
>emb|AJ871581.1| Streptomyces achromogenes subsp. rubradiris complete rubradirin gene cluster, strain NRRL 3061 Length = 105657 Score = 44.1 bits (22), Expect = 0.53 Identities = 22/22 (100%) Strand = Plus / Minus Query: 233 ctcaagcagcgcctcaaggtgc 254 |||||||||||||||||||||| Sbjct: 59311 ctcaagcagcgcctcaaggtgc 59290
>gb|AC128703.4| Mus musculus BAC clone RP23-356E22 from 19, complete sequence Length = 221568 Score = 44.1 bits (22), Expect = 0.53 Identities = 22/22 (100%) Strand = Plus / Plus Query: 99 aaaaggtgaccaatccgctgtt 120 |||||||||||||||||||||| Sbjct: 7226 aaaaggtgaccaatccgctgtt 7247
>ref|NM_124213.3| Arabidopsis thaliana ATP binding / protein binding / protein kinase/ protein serine/threonine kinase/ protein-tyrosine kinase AT5G48380 mRNA, complete cds Length = 2706 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Plus Query: 347 gttgccaagaaggagaggcttctaa 371 |||||||| |||||||||||||||| Sbjct: 1444 gttgccaataaggagaggcttctaa 1468
>ref|XM_523914.1| PREDICTED: Pan troglodytes similar to ribosomal protein L7a; thyroid hormone receptor uncoupling protein; 60S ribosomal protein L7a; surfeit 3; surfeit locus protein 3; PLA-X polypeptide (LOC468525), mRNA Length = 1365 Score = 42.1 bits (21), Expect = 2.1 Identities = 75/93 (80%) Strand = Plus / Plus Query: 479 cagctggttgtcatagctcatgatgttgatccgattgagctggttgtgtggctccctgcc 538 |||||||| || || || ||||| || ||||| || ||||||||||| | | |||||| Sbjct: 1021 cagctggtggtgattgcacatgacgtggatcccatcgagctggttgtcttcttgcctgcc 1080 Query: 539 ctttgcaggaaaatggaggtcccttactgcatt 571 || || | ||||||| |||||||||||||||| Sbjct: 1081 ctgtgtcgtaaaatgggggtcccttactgcatt 1113
>ref|NM_190848.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 3018 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 257 ccggcacttcaccagttcacc 277 ||||||||||||||||||||| Sbjct: 52 ccggcacttcaccagttcacc 72
>ref|XM_363113.1| Magnaporthe grisea 70-15 hypothetical protein (MG08697.4) partial cds Length = 3675 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 198 ccaaggttgtgcgcatccagc 218 ||||||||||||||||||||| Sbjct: 1196 ccaaggttgtgcgcatccagc 1176
>ref|XM_848911.1| PREDICTED: Canis familiaris similar to 60S ribosomal protein L7a (LOC492106), mRNA Length = 750 Score = 42.1 bits (21), Expect = 2.1 Identities = 27/29 (93%) Strand = Plus / Plus Query: 497 catgatgttgatccgattgagctggttgt 525 |||||||| ||||| |||||||||||||| Sbjct: 424 catgatgtggatcccattgagctggttgt 452
>ref|XM_537800.2| PREDICTED: Canis familiaris Ribosomal protein L7a (RPL7A), mRNA Length = 907 Score = 42.1 bits (21), Expect = 2.1 Identities = 75/93 (80%) Strand = Plus / Plus Query: 479 cagctggttgtcatagctcatgatgttgatccgattgagctggttgtgtggctccctgcc 538 |||||||| || ||||| || || || ||||| |||||||||||||| | || |||||| Sbjct: 507 cagctggtagtgatagcccacgacgtggatcccattgagctggttgtcttcctgcctgcc 566 Query: 539 ctttgcaggaaaatggaggtcccttactgcatt 571 || || | || |||| ||| |||||||||||| Sbjct: 567 ctgtgtcgtaagatgggggttccttactgcatt 599
>gb|AF083807.1| Arabidopsis thaliana clone sps952 unknown mRNA Length = 2277 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Plus Query: 347 gttgccaagaaggagaggcttctaa 371 |||||||| |||||||||||||||| Sbjct: 1315 gttgccaataaggagaggcttctaa 1339
>gb|AC103982.10| Homo sapiens chromosome 15, clone RP11-343B18, complete sequence Length = 197370 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 57 agcgaggcggcaaggcgcctg 77 ||||||||||||||||||||| Sbjct: 17052 agcgaggcggcaaggcgcctg 17032
>gb|AY074386.1| Arabidopsis thaliana putative receptor protein kinase (At5g48380) mRNA, complete cds Length = 2404 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Plus Query: 347 gttgccaagaaggagaggcttctaa 371 |||||||| |||||||||||||||| Sbjct: 1330 gttgccaataaggagaggcttctaa 1354
>emb|BX640444.1| Bordetella bronchiseptica strain RB50, complete genome; segment 8/16 Length = 349008 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 65 ggcaaggcgcctgtcccggcg 85 ||||||||||||||||||||| Sbjct: 207076 ggcaaggcgcctgtcccggcg 207096
>gb|CP000133.1| Rhizobium etli CFN 42, complete genome Length = 4381608 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 agcgccagcgccgcatcctca 236 ||||||||||||||||||||| Sbjct: 2341288 agcgccagcgccgcatcctca 2341268
>gb|AF367312.1| Arabidopsis thaliana AT5g48380/MJE7_1 mRNA, complete cds Length = 2298 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Plus Query: 347 gttgccaagaaggagaggcttctaa 371 |||||||| |||||||||||||||| Sbjct: 1342 gttgccaataaggagaggcttctaa 1366
>gb|AY062559.1| Arabidopsis thaliana receptor-like protein kinase (At5g48380; MJE7.1) mRNA, complete cds Length = 2211 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Plus Query: 347 gttgccaagaaggagaggcttctaa 371 |||||||| |||||||||||||||| Sbjct: 1339 gttgccaataaggagaggcttctaa 1363
>gb|AY857419.1| Suberites domuncula L7a mRNA, complete cds Length = 807 Score = 42.1 bits (21), Expect = 2.1 Identities = 39/45 (86%) Strand = Plus / Plus Query: 483 tggttgtcatagctcatgatgttgatccgattgagctggttgtgt 527 |||||||||||||||| || |||||||| || ||| |||| |||| Sbjct: 470 tggttgtcatagctcacgacgttgatcccatcgaggtggtggtgt 514
>ref|NM_078162.2| Caenorhabditis elegans Temporarily Assigned Gene name family member (tag-148) (tag-148) mRNA, complete cds Length = 1567 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 341 gacaaagttgccaagaaggag 361 ||||||||||||||||||||| Sbjct: 899 gacaaagttgccaagaaggag 919
>emb|BX831030.1|CNS0A1O9 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS51ZA06 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 2381 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Plus Query: 347 gttgccaagaaggagaggcttctaa 371 |||||||| |||||||||||||||| Sbjct: 1443 gttgccaataaggagaggcttctaa 1467
>gb|AY925007.1| Reclinomonas americana Rpl7A gene, partial cds Length = 1357 Score = 42.1 bits (21), Expect = 2.1 Identities = 45/53 (84%) Strand = Plus / Plus Query: 206 gtgcgcatccagcgccagcgccgcatcctcaagcagcgcctcaaggtgccccc 258 |||||| | |||||||||||| ||||||| || | ||||| ||||||||||| Sbjct: 35 gtgcgcctgcagcgccagcgcagcatcctgaaccgccgcctgaaggtgccccc 87
>gb|AY130409.1| Scyliorhinus canicula ribosomal protein L7A-like mRNA, partial sequence Length = 796 Score = 42.1 bits (21), Expect = 2.1 Identities = 63/77 (81%) Strand = Plus / Plus Query: 497 catgatgttgatccgattgagctggttgtgtggctccctgccctttgcaggaaaatggag 556 ||||||||||| || ||||||||||| |||| || ||||| || ||| |||| |||| Sbjct: 474 catgatgttgaccccattgagctggtcgtgttcctgcctgcgctctgccggaagatggga 533 Query: 557 gtcccttactgcattgt 573 || ||||| |||||||| Sbjct: 534 gttccttattgcattgt 550
>dbj|AP003280.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0557A01 Length = 147201 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 257 ccggcacttcaccagttcacc 277 ||||||||||||||||||||| Sbjct: 2338 ccggcacttcaccagttcacc 2318
>gb|AC104259.14| Homo sapiens chromosome 15, clone CTD-2525I4, complete sequence Length = 155753 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 57 agcgaggcggcaaggcgcctg 77 ||||||||||||||||||||| Sbjct: 3586 agcgaggcggcaaggcgcctg 3606
>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome Length = 9105828 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Minus Query: 214 ccagcgccagcgccgcatcctcaag 238 |||||||||||||||||||| |||| Sbjct: 1648426 ccagcgccagcgccgcatccacaag 1648402
>dbj|AP003345.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0415A04 Length = 160669 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 257 ccggcacttcaccagttcacc 277 ||||||||||||||||||||| Sbjct: 133307 ccggcacttcaccagttcacc 133287
>dbj|AB020745.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MJE7 Length = 74298 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Minus Query: 347 gttgccaagaaggagaggcttctaa 371 |||||||| |||||||||||||||| Sbjct: 770 gttgccaataaggagaggcttctaa 746
>emb|AJ332619.1|HSA332619 Homo sapiens genomic sequence surrounding NotI site, clone NR3-BO2C Length = 613 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 57 agcgaggcggcaaggcgcctg 77 ||||||||||||||||||||| Sbjct: 9 agcgaggcggcaaggcgcctg 29
>emb|AJ326568.1|HSA326568 Homo sapiens genomic sequence surrounding NotI site, clone NR1-EL21C Length = 643 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 57 agcgaggcggcaaggcgcctg 77 ||||||||||||||||||||| Sbjct: 9 agcgaggcggcaaggcgcctg 29
>emb|AJ326566.1|HSA326566 Homo sapiens genomic sequence surrounding NotI site, clone NR1-EK21C Length = 648 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 57 agcgaggcggcaaggcgcctg 77 ||||||||||||||||||||| Sbjct: 9 agcgaggcggcaaggcgcctg 29
>emb|AL138499.4|CNS01DWU Human chromosome 14 DNA sequence BAC R-132J14 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 185713 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgc 568 ||||||||||||||||||||| Sbjct: 43059 aaaatggaggtcccttactgc 43079
>gb|AE015451.1| Pseudomonas putida KT2440 complete genome Length = 6181863 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 207 tgcgcatccagcgccagcgcc 227 ||||||||||||||||||||| Sbjct: 909942 tgcgcatccagcgccagcgcc 909922
>emb|Z99942.1|CEH13N06 Caenorhabditis elegans Fosmid H13N06, complete sequence Length = 29355 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 341 gacaaagttgccaagaaggag 361 ||||||||||||||||||||| Sbjct: 25888 gacaaagttgccaagaaggag 25868
>emb|CR382127.1| Yarrowia lipolytica chromosome A of strain CLIB122 of Yarrowia lipolytica Length = 2303261 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Minus Query: 301 aacgaacttgttcaagatgcttctt 325 |||||||||||||||||| |||||| Sbjct: 826809 aacgaacttgttcaagatacttctt 826785
>gb|AC118208.9| Mus musculus chromosome 18, clone RP24-559H7, complete sequence Length = 164565 Score = 40.1 bits (20), Expect = 8.2 Identities = 29/32 (90%) Strand = Plus / Plus Query: 116 ctgttcgagaagaggccgaagcaatttggcat 147 ||||||||||||||||| ||| | |||||||| Sbjct: 31559 ctgttcgagaagaggcccaagaactttggcat 31590
>ref|NM_105184.1| Arabidopsis thaliana cysteine-type endopeptidase/ nucleic acid binding / ubiquitin thiolesterase/ zinc ion binding AT1G65110 mRNA, complete cds Length = 3285 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 304 gaacttgttcaagatgcttcttaa 327 |||||||||||||||| ||||||| Sbjct: 679 gaacttgttcaagatgattcttaa 656
>ref|XM_510379.1| PREDICTED: Pan troglodytes LOC453407 (LOC453407), mRNA Length = 644 Score = 40.1 bits (20), Expect = 8.2 Identities = 59/72 (81%) Strand = Plus / Plus Query: 500 gatgttgatccgattgagctggttgtgtggctccctgccctttgcaggaaaatggaggtc 559 ||||| ||||| || ||||||||||| | | |||||||| || | ||||||| |||| Sbjct: 262 gatgtggatcccatcgagctggttgtcttcttgcctgccctgtgtcgtaaaatgggggtc 321 Query: 560 ccttactgcatt 571 |||||||||||| Sbjct: 322 ccttactgcatt 333
>ref|XM_507735.1| PREDICTED: Pan troglodytes similar to hypothetical protein (LOC450396), mRNA Length = 3771 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcatt 571 ||||||| |||||||||||||||| Sbjct: 526 aaaatgggggtcccttactgcatt 549
>ref|XM_528454.1| PREDICTED: Pan troglodytes similar to ribosomal protein L7a; thyroid hormone receptor uncoupling protein; 60S ribosomal protein L7a; surfeit 3; surfeit locus protein 3; PLA-X polypeptide (LOC473084), mRNA Length = 1062 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcatt 571 ||||||| |||||||||||||||| Sbjct: 787 aaaatgggggtcccttactgcatt 810
>ref|XM_517569.1| PREDICTED: Pan troglodytes similar to 60S ribosomal protein L7a (Surfeit locus protein 3) (LOC461647), mRNA Length = 580 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcatt 571 ||||||| |||||||||||||||| Sbjct: 482 aaaatgggggtcccttactgcatt 505
>gb|AC110194.11| Mus musculus chromosome 7, clone RP23-238J3, complete sequence Length = 223663 Score = 40.1 bits (20), Expect = 8.2 Identities = 29/32 (90%) Strand = Plus / Plus Query: 116 ctgttcgagaagaggccgaagcaatttggcat 147 ||||||||||||||||| ||| | |||||||| Sbjct: 160827 ctgttcgagaagaggcccaagaactttggcat 160858
>gb|AY146587.1| Triticum turgidum subsp. durum BAC 107G22, complete sequence Length = 142018 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 288 acaagaaccttgcaacgaac 307 |||||||||||||||||||| Sbjct: 59655 acaagaaccttgcaacgaac 59636
>gb|AC160473.4| Mus musculus BAC clone RP23-123N21 from chromosome 12, complete sequence Length = 198634 Score = 40.1 bits (20), Expect = 8.2 Identities = 29/32 (90%) Strand = Plus / Plus Query: 116 ctgttcgagaagaggccgaagcaatttggcat 147 ||||||||||||||||| ||| | |||||||| Sbjct: 152768 ctgttcgagaagaggcccaagaactttggcat 152799
>ref|NM_001040520.1| Bos taurus similar to 60S ribosomal protein L7a (LOC513128), mRNA Length = 1011 Score = 40.1 bits (20), Expect = 8.2 Identities = 29/32 (90%) Strand = Plus / Plus Query: 116 ctgttcgagaagaggccgaagcaatttggcat 147 ||||||||||||||||| ||| | |||||||| Sbjct: 118 ctgttcgagaagaggcccaagaattttggcat 149
>ref|XM_713880.1| Candida albicans SC5314 putative Sin3.Rpd3 histone deacetylase complex component Sin3p (CaO19_6011), mRNA Length = 3360 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 85 gaagaagaaaacggaaaaggtgac 108 ||||||||||||| |||||||||| Sbjct: 1810 gaagaagaaaacgaaaaaggtgac 1833
>ref|XM_713778.1| Candida albicans SC5314 putative Sin3.Rpd3 histone deacetylase complex component Sin3p (CaO19_13432), mRNA Length = 3360 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 85 gaagaagaaaacggaaaaggtgac 108 ||||||||||||| |||||||||| Sbjct: 1810 gaagaagaaaacgaaaaaggtgac 1833
>gb|CP000075.1| Pseudomonas syringae pv. syringae B728a, complete genome Length = 6093698 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 232 cctcaagcagcgcctcaagg 251 |||||||||||||||||||| Sbjct: 2276528 cctcaagcagcgcctcaagg 2276509
>gb|CP000058.1| Pseudomonas syringae pv. phaseolicola 1448A, complete genome Length = 5928787 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 232 cctcaagcagcgcctcaagg 251 |||||||||||||||||||| Sbjct: 2274267 cctcaagcagcgcctcaagg 2274248
>ref|XM_910353.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a (LOC635326), mRNA Length = 471 Score = 40.1 bits (20), Expect = 8.2 Identities = 29/32 (90%) Strand = Plus / Plus Query: 116 ctgttcgagaagaggccgaagcaatttggcat 147 ||||||||||||||||| ||| | |||||||| Sbjct: 91 ctgttcgagaagaggcccaagaactttggcat 122
>ref|XR_003499.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a (Surfeit locus protein 3) (LOC217924), mRNA Length = 774 Score = 40.1 bits (20), Expect = 8.2 Identities = 29/32 (90%) Strand = Plus / Plus Query: 116 ctgttcgagaagaggccgaagcaatttggcat 147 ||||||||||||||||| ||| | |||||||| Sbjct: 91 ctgttcgagaagaggcccaagaactttggcat 122
>ref|XM_991689.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a (Surfeit locus protein 3) (LOC672190), mRNA Length = 876 Score = 40.1 bits (20), Expect = 8.2 Identities = 29/32 (90%) Strand = Plus / Plus Query: 116 ctgttcgagaagaggccgaagcaatttggcat 147 ||||||||||||||||| ||| | |||||||| Sbjct: 113 ctgttcgagaagaggcccaagaactttggcat 144
>ref|XM_975817.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a (Surfeit locus protein 3) (LOC674598), mRNA Length = 876 Score = 40.1 bits (20), Expect = 8.2 Identities = 29/32 (90%) Strand = Plus / Plus Query: 116 ctgttcgagaagaggccgaagcaatttggcat 147 ||||||||||||||||| ||| | |||||||| Sbjct: 113 ctgttcgagaagaggcccaagaactttggcat 144
>ref|XM_887179.2| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a (Surfeit locus protein 3), transcript variant 1 (LOC622727), mRNA Length = 889 Score = 40.1 bits (20), Expect = 8.2 Identities = 29/32 (90%) Strand = Plus / Plus Query: 116 ctgttcgagaagaggccgaagcaatttggcat 147 ||||||||||||||||| ||| | |||||||| Sbjct: 126 ctgttcgagaagaggcccaagaactttggcat 157
>ref|XM_906238.2| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a (Surfeit locus protein 3), transcript variant 2 (LOC622727), mRNA Length = 887 Score = 40.1 bits (20), Expect = 8.2 Identities = 29/32 (90%) Strand = Plus / Plus Query: 116 ctgttcgagaagaggccgaagcaatttggcat 147 ||||||||||||||||| ||| | |||||||| Sbjct: 124 ctgttcgagaagaggcccaagaactttggcat 155
>gb|AC110262.12| Mus musculus chromosome 17, clone RP23-291L10, complete sequence Length = 210850 Score = 40.1 bits (20), Expect = 8.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 116 ctgttcgagaagaggccgaagcaatttggcat 147 ||||||||||||||||| ||| | |||||||| Sbjct: 108604 ctgttcgagaagaggcccaagaactttggcat 108573
>ref|XR_002714.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a (Surfeit locus protein 3) (LOC434227), mRNA Length = 834 Score = 40.1 bits (20), Expect = 8.2 Identities = 29/32 (90%) Strand = Plus / Plus Query: 116 ctgttcgagaagaggccgaagcaatttggcat 147 ||||||||||||||||| ||| | |||||||| Sbjct: 76 ctgttcgagaagaggcccaagaactttggcat 107
>ref|XR_004063.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a (LOC672122), mRNA Length = 822 Score = 40.1 bits (20), Expect = 8.2 Identities = 29/32 (90%) Strand = Plus / Plus Query: 101 aaggtgaccaatccgctgttcgagaagaggcc 132 ||||||| ||| || ||||||||||||||||| Sbjct: 98 aaggtgatcaaccctctgttcgagaagaggcc 129
>gb|AC127349.3| Mus musculus BAC clone RP23-62M5 from chromosome 13, complete sequence Length = 193255 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 395 gggaaaactgttgaggcaaa 414 |||||||||||||||||||| Sbjct: 103512 gggaaaactgttgaggcaaa 103493
>ref|XM_809996.1| Trypanosoma cruzi strain CL Brener reductase (Tc00.1047053503893.70) partial mRNA Length = 978 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 85 gaagaagaaaacggaaaagg 104 |||||||||||||||||||| Sbjct: 223 gaagaagaaaacggaaaagg 204
>ref|XM_809651.1| Trypanosoma cruzi strain CL Brener splicing factor 3B subunit 1 (Tc00.1047053508827.100) partial mRNA Length = 3309 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 309 tgttcaagatgcttcttaagtacc 332 ||||| |||||||||||||||||| Sbjct: 764 tgttcgagatgcttcttaagtacc 787
>gb|AC124525.3| Mus musculus BAC clone RP23-406I17 from chromosome 2, complete sequence Length = 173181 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 540 tttgcaggaaaatggaggtc 559 |||||||||||||||||||| Sbjct: 110771 tttgcaggaaaatggaggtc 110752
>ref|XM_797136.1| Trypanosoma cruzi strain CL Brener NADH-cytochrome b5 reductase (Tc00.1047053443397.9) partial mRNA Length = 888 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 85 gaagaagaaaacggaaaagg 104 |||||||||||||||||||| Sbjct: 223 gaagaagaaaacggaaaagg 204
>gb|AC121580.3| Mus musculus BAC clone RP23-255J21 from 9, complete sequence Length = 200282 Score = 40.1 bits (20), Expect = 8.2 Identities = 29/32 (90%) Strand = Plus / Plus Query: 116 ctgttcgagaagaggccgaagcaatttggcat 147 ||||||||||||||||| ||| | |||||||| Sbjct: 173705 ctgttcgagaagaggcccaagaactttggcat 173736
>ref|XM_644983.1| Entamoeba histolytica HM-1:IMSS 60S ribosomal protein L7a, putative (248.t00005) partial mRNA Length = 861 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 563 tactgcattgttaagggaaa 582 |||||||||||||||||||| Sbjct: 520 tactgcattgttaagggaaa 539
>ref|XM_850185.1| PREDICTED: Canis familiaris similar to 60S ribosomal protein L7a (LOC612456), mRNA Length = 1116 Score = 40.1 bits (20), Expect = 8.2 Identities = 35/40 (87%) Strand = Plus / Plus Query: 109 caatccgctgttcgagaagaggccgaagcaatttggcatc 148 |||||| ||||||||||| ||||| ||| | ||||||||| Sbjct: 276 caatcccctgttcgagaaaaggcctaagaactttggcatc 315
>emb|CR648468.2|CNS0EZBU Tetraodon nigroviridis full-length cDNA Length = 829 Score = 40.1 bits (20), Expect = 8.2 Identities = 29/32 (90%) Strand = Plus / Plus Query: 476 gcccagctggttgtcatagctcatgatgttga 507 ||||||||||| |||| |||||||||||||| Sbjct: 452 gcccagctggtcatcattgctcatgatgttga 483
>gb|BC109810.1| Bos taurus similar to 60S ribosomal protein L7a, mRNA (cDNA clone MGC:133961 IMAGE:8043487), complete cds Length = 1011 Score = 40.1 bits (20), Expect = 8.2 Identities = 29/32 (90%) Strand = Plus / Plus Query: 116 ctgttcgagaagaggccgaagcaatttggcat 147 ||||||||||||||||| ||| | |||||||| Sbjct: 118 ctgttcgagaagaggcccaagaattttggcat 149
>emb|AL604028.15| Human DNA sequence from clone RP11-767N6 on chromosome 1 Contains the gene for a novel protein (SP192) (DKFZp434H1428, FLJ21319), a ribosomal protein S15a (RPS15A) pseudogene, a ribosomal protein L7a (RPL7A) pseudogene, the gene for a novel protein (FLJ21029) and one CpG island, complete sequence Length = 82964 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 548 aaaatggaggtcccttactgcatt 571 ||||||| |||||||||||||||| Sbjct: 26404 aaaatgggggtcccttactgcatt 26381
>emb|AL591623.15| Human DNA sequence from clone RP11-1086F11 on chromosome 1 Contains part of the gene for a novel protein (FLJ32001), a novel gene and a ribosomal protein L7a (RPL7A) pseudogene, complete sequence Length = 82383 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 548 aaaatggaggtcccttactgcatt 571 ||||||| |||||||||||||||| Sbjct: 56802 aaaatgggggtcccttactgcatt 56779
>gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, complete sequence Length = 4895836 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 232 cctcaagcagcgcctcaagg 251 |||||||||||||||||||| Sbjct: 73734 cctcaagcagcgcctcaagg 73753
>emb|AL356378.17| Human DNA sequence from clone RP11-337C18 on chromosome 1 Contains the PRKAB2 gene for protein kinase, AMP-activated, beta 2 non-catalytic subunit protein, a FMO5 gene for the flavin containing monooxygenase 5 protein, the CHD1L gene for chromodomain helicase DNA binding protein 1-like (FLJ22530) protein, a processed pseudogene similar to glucose regulated protein, 58kDa (GRP58), a processed pseudogene similar to chaperonin containing TCP1, subunit 8 (theta) (CCT8) protein, a processed pseudogene similar to ribosomal protein L7a (RPL7A) protein, a processed pseudogene similar to leukotriene B4 12-hydroxydehydrogenase (LTB4DH) protein and three CpG islands, complete sequence Length = 202955 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcatt 571 ||||||| |||||||||||||||| Sbjct: 93655 aaaatgggggtcccttactgcatt 93678
>emb|AL162853.17| Human DNA sequence from clone RP11-363G2 on chromosome 13 Contains a ribosomal protein L7a (RPL7A) pseudogene, a pseudogene similar to part of inositol hexakisphosphate kinase 1 (IHPK1) (KIAA0263), a novel pseudogene, a novel gene and 2 CpG islands, complete sequence Length = 123693 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcatt 571 ||||||| |||||||||||||||| Sbjct: 38569 aaaatgggggtcccttactgcatt 38592
>emb|AL354681.8| Human DNA sequence from clone RP11-534L20 on chromosome 1 Contains the IKBKE gene for inhibitor of kappa light polypeptide gene enhancer in B-cells kinase epsilon, a novel gene, the 5' end of the RASSF5 gene for Ras association (RalGDS/AF-6) domain family 5, a ribosomal protein L7a (RPL7A) pseudogene and a CpG island, complete sequence Length = 107689 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcatt 571 ||||||| |||||||||||||||| Sbjct: 63069 aaaatgggggtcccttactgcatt 63092
>gb|AC073939.6| Mus musculus strain C57BL/6J chromosome 12 clone RP23-218B2, complete sequence Length = 195281 Score = 40.1 bits (20), Expect = 8.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 116 ctgttcgagaagaggccgaagcaatttggcat 147 ||||||||||||||||| ||| | |||||||| Sbjct: 70742 ctgttcgagaagaggcccaagaactttggcat 70711
>emb|AL135933.11| Human DNA sequence from clone RP4-774E4 on chromosome 11p13-14.2 Contains a pseudogene similar to ribosomal protein L7a, STSs and GSSs, complete sequence Length = 111135 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcatt 571 ||||||| |||||||||||||||| Sbjct: 33498 aaaatgggggtcccttactgcatt 33521
>emb|AL136226.9| Human DNA sequence from clone RP3-486D24 on chromosome 6 Contains a ribosomal protein L7A (RPL7A) pseudogene and a CpG island, complete sequence Length = 72553 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 556 ggtcccttactgcattgttaaggg 579 |||||||||||||||| ||||||| Sbjct: 58092 ggtcccttactgcattattaaggg 58115
>emb|AL133333.15| Human DNA sequence from clone RP11-462L8 on chromosome 10 Contains the 3' end of a novel gene, a ribosomal protein L7a (RPL7A) pseudogene and a CpG island, complete sequence Length = 47610 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 548 aaaatggaggtcccttactgcatt 571 ||||||| |||||||||||||||| Sbjct: 16021 aaaatgggggtcccttactgcatt 15998
>emb|Y15171.1|FRY15171 Fugu rubripes surf3 and surf6 genes and partial surf1 gene Length = 8902 Score = 40.1 bits (20), Expect = 8.2 Identities = 44/52 (84%) Strand = Plus / Plus Query: 99 aaaaggtgaccaatccgctgttcgagaagaggccgaagcaatttggcatcgg 150 |||||||| ||| || ||||| ||||| ||||||||| | ||||||||||| Sbjct: 2071 aaaaggtggtcaaccccctgtttgagaaaaggccgaagaattttggcatcgg 2122
>emb|CR936627.1| Homo sapiens mRNA; cDNA DKFZp781A0112 (from clone DKFZp781A0112) Length = 10778 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 548 aaaatggaggtcccttactgcatt 571 ||||||| |||||||||||||||| Sbjct: 3546 aaaatgggggtcccttactgcatt 3523
>emb|BX572595.1| Rhodopseudomonas palustris CGA009 complete genome; segment 3/16 Length = 349260 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 214 ccagcgccagcgccgcatcc 233 |||||||||||||||||||| Sbjct: 329197 ccagcgccagcgccgcatcc 329178
>gb|AC079841.10| Homo sapiens 3 BAC RP11-10G15 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 167865 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcatt 571 ||||||| |||||||||||||||| Sbjct: 152355 aaaatgggggtcccttactgcatt 152378
>emb|AJ224081.1|HSAJ4081 Homo sapiens rpL7a pseudogene, clone 34 Length = 1200 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcatt 571 ||||||| |||||||||||||||| Sbjct: 852 aaaatgggggtcccttactgcatt 875
>dbj|AP008232.1| Sodalis glossinidius str. 'morsitans' DNA, complete genome Length = 4171146 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 423 ttgttgtgaaatatggcctt 442 |||||||||||||||||||| Sbjct: 1240403 ttgttgtgaaatatggcctt 1240384
>gb|AE005872.1| Caulobacter crescentus CB15 section 198 of 359 of the complete genome Length = 12212 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 210 gcatccagcgccagcgccgc 229 |||||||||||||||||||| Sbjct: 1146 gcatccagcgccagcgccgc 1127
>gb|AC010007.4| Drosophila melanogaster 3L BAC RP98-17K17 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 175481 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 235 caagcagcgcctcaaggtgc 254 |||||||||||||||||||| Sbjct: 91844 caagcagcgcctcaaggtgc 91863
>ref|NM_176271.1| Drosophila melanogaster CG2469-RB, transcript variant B (CG2469), mRNA Length = 3777 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 235 caagcagcgcctcaaggtgc 254 |||||||||||||||||||| Sbjct: 3178 caagcagcgcctcaaggtgc 3197
>ref|NM_176270.1| Drosophila melanogaster CG2469-RA, transcript variant A (CG2469), mRNA Length = 3704 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 235 caagcagcgcctcaaggtgc 254 |||||||||||||||||||| Sbjct: 3105 caagcagcgcctcaaggtgc 3124
>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome Length = 4967148 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 agcgccagcgccgcatcctc 235 |||||||||||||||||||| Sbjct: 3684010 agcgccagcgccgcatcctc 3683991
>gb|AC093789.3| Homo sapiens BAC clone RP11-219G10 from 4, complete sequence Length = 202937 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 548 aaaatggaggtcccttactgcatt 571 ||||||| |||||||||||||||| Sbjct: 8077 aaaatgggggtcccttactgcatt 8054
>gb|AC011139.8| Homo sapiens chromosome 18, clone RP11-1I2, complete sequence Length = 180360 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 548 aaaatggaggtcccttactgcatt 571 ||||||| |||||||||||||||| Sbjct: 102222 aaaatgggggtcccttactgcatt 102199
>gb|AC068388.7| Homo sapiens chromosome 3, clone RP11-296M9, complete sequence Length = 148372 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcatt 571 ||||||| |||||||||||||||| Sbjct: 61216 aaaatgggggtcccttactgcatt 61239
>ref|XM_938181.1| PREDICTED: Homo sapiens similar to 60S ribosomal protein L7a, transcript variant 3 (LOC388474), mRNA Length = 916 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcatt 571 ||||||| |||||||||||||||| Sbjct: 556 aaaatgggggtcccttactgcatt 579
>ref|XM_371115.4| PREDICTED: Homo sapiens similar to 60S ribosomal protein L7a, transcript variant 1 (LOC388474), mRNA Length = 916 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcatt 571 ||||||| |||||||||||||||| Sbjct: 556 aaaatgggggtcccttactgcatt 579
>gb|AY069525.1| Drosophila melanogaster LD24034 full length cDNA Length = 3684 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 235 caagcagcgcctcaaggtgc 254 |||||||||||||||||||| Sbjct: 3073 caagcagcgcctcaaggtgc 3092
>ref|XM_944890.1| PREDICTED: Homo sapiens similar to 60S ribosomal protein L7a, transcript variant 2 (LOC649032), mRNA Length = 896 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcatt 571 ||||||| |||||||||||||||| Sbjct: 548 aaaatgggggtcccttactgcatt 571
>ref|XM_940934.1| PREDICTED: Homo sapiens similar to 60S ribosomal protein L7a, transcript variant 1 (LOC649032), mRNA Length = 707 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 548 aaaatggaggtcccttactgcatt 571 ||||||| |||||||||||||||| Sbjct: 361 aaaatgggggtcccttactgcatt 384 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,612,447 Number of Sequences: 3902068 Number of extensions: 4612447 Number of successful extensions: 85867 Number of sequences better than 10.0: 281 Number of HSP's better than 10.0 without gapping: 282 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 84535 Number of HSP's gapped (non-prelim): 1310 length of query: 603 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 580 effective length of database: 17,143,297,704 effective search space: 9943112668320 effective search space used: 9943112668320 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
