>gb|DP000022.1| Microcebus murinus target 1 genomic scaffold
          Length = 1595145

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 418    taatggtgttcatatcttatt 438
              |||||||||||||||||||||
Sbjct: 554202 taatggtgttcatatcttatt 554222

>gb|AC145439.4| Microcebus murinus clone CH257-441K3, complete sequence
          Length = 215533

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 418    taatggtgttcatatcttatt 438
              |||||||||||||||||||||
Sbjct: 196243 taatggtgttcatatcttatt 196263

>ref|NM_192546.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 3243

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Plus

                                        
Query: 361  cgccgccggag-tgctccgggcgcgcta 387
            ||||||||||| ||||||||||||||||
Sbjct: 2927 cgccgccggaggtgctccgggcgcgcta 2954

>emb|AJ557546.1|MLI557546 Melittangium lichenicola melithiazol gene cluster
          Length = 51855

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 377   cgggcgcgctaggcgtcgcc 396
             ||||||||||||||||||||
Sbjct: 30895 cgggcgcgctaggcgtcgcc 30876

>gb|AE006470.1| Chlorobium tepidum TLS, complete genome
          Length = 2154946

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 116     tcgcttcgagcgtggcttcg 135
               ||||||||||||||||||||
Sbjct: 1165629 tcgcttcgagcgtggcttcg 1165610

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Minus

                                            
Query: 361      cgccgccggag-tgctccgggcgcgcta 387
                ||||||||||| ||||||||||||||||
Sbjct: 22864973 cgccgccggaggtgctccgggcgcgcta 22864946

>dbj|AP003300.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0700A11
          Length = 136321

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Minus

                                         
Query: 361   cgccgccggag-tgctccgggcgcgcta 387
             ||||||||||| ||||||||||||||||
Sbjct: 68530 cgccgccggaggtgctccgggcgcgcta 68503


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,129,946
Number of Sequences: 3902068
Number of extensions: 3129946
Number of successful extensions: 49690
Number of sequences better than 10.0: 7
Number of HSP's better than 10.0 without gapping: 4
Number of HSP's successfully gapped in prelim test: 3
Number of HSP's that attempted gapping in prelim test: 49641
Number of HSP's gapped (non-prelim): 54
length of query: 588
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 565
effective length of database: 17,143,297,704
effective search space: 9685963202760
effective search space used: 9685963202760
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)