Clone Name | baald19 |
---|---|
Clone Library Name | barley_pub |
No. | Definition | Score (bits) |
E Value |
1 | ref|XM_855609.1| PREDICTED: Canis familiaris hypothetical protei... | 44 | 0.089 | 2 | dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ... | 40 | 1.4 | 3 | gb|CP000248.1| Novosphingobium aromaticivorans DSM 12444, comple... | 38 | 5.5 | 4 | gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome | 38 | 5.5 |
---|
>ref|XM_855609.1| PREDICTED: Canis familiaris hypothetical protein LOC608111 (LOC608111), mRNA Length = 780 Score = 44.1 bits (22), Expect = 0.089 Identities = 22/22 (100%) Strand = Plus / Plus Query: 37 gcgcctcccccttggaggcccc 58 |||||||||||||||||||||| Sbjct: 536 gcgcctcccccttggaggcccc 557
>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome Length = 9105828 Score = 40.1 bits (20), Expect = 1.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 90 atggcggcagcgccgctctc 109 |||||||||||||||||||| Sbjct: 7235504 atggcggcagcgccgctctc 7235523
>gb|CP000248.1| Novosphingobium aromaticivorans DSM 12444, complete genome Length = 3561584 Score = 38.2 bits (19), Expect = 5.5 Identities = 22/23 (95%) Strand = Plus / Minus Query: 88 gaatggcggcagcgccgctctcg 110 ||||||||||||||||| ||||| Sbjct: 3290188 gaatggcggcagcgccgatctcg 3290166
>gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome Length = 4352825 Score = 38.2 bits (19), Expect = 5.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 99 gcgccgctctcgccgctcc 117 ||||||||||||||||||| Sbjct: 311099 gcgccgctctcgccgctcc 311117 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 427,499 Number of Sequences: 3902068 Number of extensions: 427499 Number of successful extensions: 29191 Number of sequences better than 10.0: 4 Number of HSP's better than 10.0 without gapping: 4 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 29067 Number of HSP's gapped (non-prelim): 124 length of query: 119 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 98 effective length of database: 17,151,101,840 effective search space: 1680807980320 effective search space used: 1680807980320 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)