ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baald03
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC010045.5| Drosophila melanogaster 3L BAC RP98-17C17 (Roswel... 42 0.32
2gb|AE003522.3| Drosophila melanogaster chromosome 3L, section 63... 42 0.32
3gb|AE017353.1| Cryptococcus neoformans var. neoformans JEC21 chr... 40 1.3
4emb|AL772207.4| Mouse DNA sequence from clone RP23-91G17 on chro... 40 1.3
5gb|AF241733.2| Homo sapiens chromosome X clone RP1-123H2 map p11... 38 5.0
6emb|Z83104.1|CEF09B12 Caenorhabditis elegans Cosmid F09B12, comp... 38 5.0
7emb|AL121581.41|HS1022E24 Human DNA sequence from clone RP5-1022... 38 5.0
8gb|AC173996.2| Pan troglodytes chromosome X clone PTB-074P14 map... 38 5.0
9gb|AC175364.1| Pan troglodytes chromosome X clone CH251-210F7 ma... 38 5.0

>gb|AC010045.5| Drosophila melanogaster 3L BAC RP98-17C17 (Roswell Park Cancer
             Institute Drosophila BAC Library) complete sequence
          Length = 179649

 Score = 42.1 bits (21), Expect = 0.32
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 80    ttgttgctttcgttccatttc 100
             |||||||||||||||||||||
Sbjct: 64343 ttgttgctttcgttccatttc 64363



to top

>gb|AE003522.3| Drosophila melanogaster chromosome 3L, section 63 of 83 of the complete
              sequence
          Length = 302050

 Score = 42.1 bits (21), Expect = 0.32
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 80     ttgttgctttcgttccatttc 100
              |||||||||||||||||||||
Sbjct: 140115 ttgttgctttcgttccatttc 140095



to top

>gb|AE017353.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 13, complete
              sequence
          Length = 787999

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 81     tgttgctttcgttccatttc 100
              ||||||||||||||||||||
Sbjct: 777900 tgttgctttcgttccatttc 777919



to top

>emb|AL772207.4| Mouse DNA sequence from clone RP23-91G17 on chromosome 4, complete
             sequence
          Length = 148320

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 74    caacatttgttgctttcgttccatttcc 101
             |||||||||||| |||| ||||||||||
Sbjct: 91180 caacatttgttgatttcattccatttcc 91207



to top

>gb|AF241733.2| Homo sapiens chromosome X clone RP1-123H2 map p11.4, complete sequence
          Length = 133159

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 44    gagataactgatgtgactt 62
             |||||||||||||||||||
Sbjct: 34342 gagataactgatgtgactt 34324



to top

>emb|Z83104.1|CEF09B12 Caenorhabditis elegans Cosmid F09B12, complete sequence
          Length = 28278

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 10    tcacttgtatccgggtttg 28
             |||||||||||||||||||
Sbjct: 14748 tcacttgtatccgggtttg 14766



to top

>emb|AL121581.41|HS1022E24 Human DNA sequence from clone RP5-1022E24 on chromosome 20 Contains the
              3' end of the OPRL1 gene for opiate receptor-like 1
              protein, the GPR8 gene encoding a G protein-coupled
              receptor, the KIAA0835 gene encoding a protein similar to
              the myelin transcription factor 1 (MYT1), a novel gene, 7
              CpG islands, ESTs, STSs and GSSs, complete sequence
          Length = 179888

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 48     taactgatgtgacttgtgt 66
              |||||||||||||||||||
Sbjct: 116226 taactgatgtgacttgtgt 116244



to top

>gb|AC173996.2| Pan troglodytes chromosome X clone PTB-074P14 map human ortholog p11.4,
              complete sequence
          Length = 160565

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 44     gagataactgatgtgactt 62
              |||||||||||||||||||
Sbjct: 139898 gagataactgatgtgactt 139880



to top

>gb|AC175364.1| Pan troglodytes chromosome X clone CH251-210F7 map human ortholog
             p11.4, complete sequence
          Length = 153433

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 44    gagataactgatgtgactt 62
             |||||||||||||||||||
Sbjct: 22934 gagataactgatgtgactt 22916


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 622,888
Number of Sequences: 3902068
Number of extensions: 622888
Number of successful extensions: 39995
Number of sequences better than 10.0: 9
Number of HSP's better than 10.0 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 39980
Number of HSP's gapped (non-prelim): 15
length of query: 111
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 90
effective length of database: 17,151,101,840
effective search space: 1543599165600
effective search space used: 1543599165600
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top