ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | baak4o17 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_471731.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 828 Score = 194 bits (98), Expect = 2e-46 Identities = 149/166 (89%) Strand = Plus / Plus Query: 56 tcaccgacaacggcaactacatcgtcgagatgttcttcgacgacggcatacacggcaacc 115 |||||||||||||||||||||||||||||||||||||||| || ||||||| |||| ||| Sbjct: 638 tcaccgacaacggcaactacatcgtcgagatgttcttcgaggatggcatacgcggcgacc 697 Query: 116 tgcgcgacatcagcgacagcctgctgcgcatcacgggcgtcgtcgagcacggcatgttcc 175 | ||| ||||||||| |||| || || ||||| ||||||||||||||||||||||||| Sbjct: 698 tcaacgagatcagcgaccgcctcctacggatcaccggcgtcgtcgagcacggcatgttcc 757 Query: 176 tcggcatggccaccaaggtcatcgtcgccaagaaggacggcaccgt 221 |||||||||||||| ||| ||||||||||||||||||||||||| Sbjct: 758 tcggcatggccacctcggtggtcgtcgccaagaaggacggcaccgt 803
>emb|AL731597.3|OSJN00237 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0023J03, complete sequence Length = 175555 Score = 194 bits (98), Expect = 2e-46 Identities = 149/166 (89%) Strand = Plus / Plus Query: 56 tcaccgacaacggcaactacatcgtcgagatgttcttcgacgacggcatacacggcaacc 115 |||||||||||||||||||||||||||||||||||||||| || ||||||| |||| ||| Sbjct: 69054 tcaccgacaacggcaactacatcgtcgagatgttcttcgaggatggcatacgcggcgacc 69113 Query: 116 tgcgcgacatcagcgacagcctgctgcgcatcacgggcgtcgtcgagcacggcatgttcc 175 | ||| ||||||||| |||| || || ||||| ||||||||||||||||||||||||| Sbjct: 69114 tcaacgagatcagcgaccgcctcctacggatcaccggcgtcgtcgagcacggcatgttcc 69173 Query: 176 tcggcatggccaccaaggtcatcgtcgccaagaaggacggcaccgt 221 |||||||||||||| ||| ||||||||||||||||||||||||| Sbjct: 69174 tcggcatggccacctcggtggtcgtcgccaagaaggacggcaccgt 69219
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 194 bits (98), Expect = 2e-46 Identities = 149/166 (89%) Strand = Plus / Plus Query: 56 tcaccgacaacggcaactacatcgtcgagatgttcttcgacgacggcatacacggcaacc 115 |||||||||||||||||||||||||||||||||||||||| || ||||||| |||| ||| Sbjct: 13855395 tcaccgacaacggcaactacatcgtcgagatgttcttcgaggatggcatacgcggcgacc 13855454 Query: 116 tgcgcgacatcagcgacagcctgctgcgcatcacgggcgtcgtcgagcacggcatgttcc 175 | ||| ||||||||| |||| || || ||||| ||||||||||||||||||||||||| Sbjct: 13855455 tcaacgagatcagcgaccgcctcctacggatcaccggcgtcgtcgagcacggcatgttcc 13855514 Query: 176 tcggcatggccaccaaggtcatcgtcgccaagaaggacggcaccgt 221 |||||||||||||| ||| ||||||||||||||||||||||||| Sbjct: 13855515 tcggcatggccacctcggtggtcgtcgccaagaaggacggcaccgt 13855560
>dbj|AK103443.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033129E13, full insert sequence Length = 1182 Score = 194 bits (98), Expect = 2e-46 Identities = 149/166 (89%) Strand = Plus / Plus Query: 56 tcaccgacaacggcaactacatcgtcgagatgttcttcgacgacggcatacacggcaacc 115 |||||||||||||||||||||||||||||||||||||||| || ||||||| |||| ||| Sbjct: 748 tcaccgacaacggcaactacatcgtcgagatgttcttcgaggatggcatacgcggcgacc 807 Query: 116 tgcgcgacatcagcgacagcctgctgcgcatcacgggcgtcgtcgagcacggcatgttcc 175 | ||| ||||||||| |||| || || ||||| ||||||||||||||||||||||||| Sbjct: 808 tcaacgagatcagcgaccgcctcctacggatcaccggcgtcgtcgagcacggcatgttcc 867 Query: 176 tcggcatggccaccaaggtcatcgtcgccaagaaggacggcaccgt 221 |||||||||||||| ||| ||||||||||||||||||||||||| Sbjct: 868 tcggcatggccacctcggtggtcgtcgccaagaaggacggcaccgt 913
>gb|AY826894.1| Isochrysis galbana clone IGRPI1 chloroplast ribose-5-phosphate isomerase mRNA, partial cds; nuclear gene for chloroplast product Length = 689 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 58 accgacaacggcaactacatcgtcga 83 |||||||||||||||||||||||||| Sbjct: 327 accgacaacggcaactacatcgtcga 352
>gb|CP000232.1| Moorella thermoacetica ATCC 39073, complete genome Length = 2628784 Score = 44.1 bits (22), Expect = 0.39 Identities = 25/26 (96%) Strand = Plus / Minus Query: 203 ccaagaaggacggcaccgtggcggtc 228 |||||||||||||||||||| ||||| Sbjct: 2379832 ccaagaaggacggcaccgtgacggtc 2379807
>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome Length = 6021225 Score = 44.1 bits (22), Expect = 0.39 Identities = 25/26 (96%) Strand = Plus / Plus Query: 57 caccgacaacggcaactacatcgtcg 82 |||||||||||||| ||||||||||| Sbjct: 1437197 caccgacaacggcatctacatcgtcg 1437222
>gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete sequence Length = 2648638 Score = 44.1 bits (22), Expect = 0.39 Identities = 25/26 (96%) Strand = Plus / Minus Query: 58 accgacaacggcaactacatcgtcga 83 ||||||||||||||||||||| |||| Sbjct: 858709 accgacaacggcaactacatcttcga 858684
>gb|AY541063.1| Nocardia uniformis subsp. tsuyamanensis monocyclic beta-lactam antibiotic nocardicin A biosynthesis gene cluster, partial sequence Length = 33451 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 82 gagatgttcttcgacgacggc 102 ||||||||||||||||||||| Sbjct: 32953 gagatgttcttcgacgacggc 32973
>emb|AL360176.22| Human DNA sequence from clone RP11-124H7 on chromosome 10 Contains the 5' end of the MMP21 gene for matrix metalloproteinase 21, the UROS gene for uroporphyrinogen III synthase (congenital erythropoietic porphyria), the BCCIP gene for BRCA2 and CDKN1A interacting protein (TOK-1), the DDX32 gene for DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 32 (FLJ10694, FLJ10889), the 5' UTR of a novel gene (LOC92565) and three CpG islands, complete sequence Length = 155699 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 168 catgttcctcggcatggccaccaag 192 ||||||||||||||||||| ||||| Sbjct: 18303 catgttcctcggcatggcctccaag 18279
>gb|AY858556.1| Homo sapiens RAS guanyl releasing protein 1 splice variant A mRNA, complete cds, alternatively spliced Length = 1910 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 259 tctgcagaggagatgacaat 278 |||||||||||||||||||| Sbjct: 309 tctgcagaggagatgacaat 290
>gb|AE005674.1| Shigella flexneri 2a str. 301, complete genome Length = 4607203 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 gacggcaccgtggcggtcct 230 |||||||||||||||||||| Sbjct: 4553841 gacggcaccgtggcggtcct 4553822
>gb|AC091775.10| Oryza sativa chromosome 3 BAC OSJNBa0004G17 genomic sequence, complete sequence Length = 139074 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 42 ggaggacctcttcctcaccg 61 |||||||||||||||||||| Sbjct: 86352 ggaggacctcttcctcaccg 86333
>gb|AY907424.1| Rhizobium etli bv. phaseoli strain IE2755 glutamine synthetase II (glnII) gene, partial cds Length = 540 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 79 gtcgagatgttcttcgacga 98 |||||||||||||||||||| Sbjct: 390 gtcgagatgttcttcgacga 371
>gb|AY907423.1| Rhizobium etli bv. mimosae strain IE4771 glutamine synthetase II (glnII) gene, partial cds Length = 540 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 79 gtcgagatgttcttcgacga 98 |||||||||||||||||||| Sbjct: 390 gtcgagatgttcttcgacga 371
>gb|AY907422.1| Rhizobium etli bv. phaseoli strain IE4837 glutamine synthetase II (glnII) gene, partial cds Length = 540 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 79 gtcgagatgttcttcgacga 98 |||||||||||||||||||| Sbjct: 390 gtcgagatgttcttcgacga 371
>gb|AY907421.1| Rhizobium etli bv. phaseoli strain IE4874 glutamine synthetase II (glnII) gene, partial cds Length = 540 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 79 gtcgagatgttcttcgacga 98 |||||||||||||||||||| Sbjct: 390 gtcgagatgttcttcgacga 371
>gb|AY907420.1| Rhizobium etli bv. phaseoli strain IE1004 glutamine synthetase II (glnII) gene, partial cds Length = 540 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 79 gtcgagatgttcttcgacga 98 |||||||||||||||||||| Sbjct: 390 gtcgagatgttcttcgacga 371
>gb|AY907419.1| Rhizobium etli bv. phaseoli strain IE2704 glutamine synthetase II (glnII) gene, partial cds Length = 540 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 79 gtcgagatgttcttcgacga 98 |||||||||||||||||||| Sbjct: 390 gtcgagatgttcttcgacga 371
>gb|AY907418.1| Rhizobium etli bv. phaseoli strain IE950 glutamine synthetase II (glnII) gene, partial cds Length = 540 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 79 gtcgagatgttcttcgacga 98 |||||||||||||||||||| Sbjct: 390 gtcgagatgttcttcgacga 371
>gb|AY907415.1| Rhizobium etli bv. phaseoli strain IE1009 glutamine synthetase II (glnII) gene, partial cds Length = 540 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 79 gtcgagatgttcttcgacga 98 |||||||||||||||||||| Sbjct: 390 gtcgagatgttcttcgacga 371
>gb|AY907414.1| Rhizobium etli bv. phaseoli strain IE4877 glutamine synthetase II (glnII) gene, partial cds Length = 540 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 79 gtcgagatgttcttcgacga 98 |||||||||||||||||||| Sbjct: 390 gtcgagatgttcttcgacga 371
>gb|AY907413.1| Rhizobium etli bv. phaseoli strain IE4804 glutamine synthetase II (glnII) gene, partial cds Length = 540 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 79 gtcgagatgttcttcgacga 98 |||||||||||||||||||| Sbjct: 390 gtcgagatgttcttcgacga 371
>gb|AY907412.1| Rhizobium etli bv. phaseoli strain IE2730 glutamine synthetase II (glnII) gene, partial cds Length = 540 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 79 gtcgagatgttcttcgacga 98 |||||||||||||||||||| Sbjct: 390 gtcgagatgttcttcgacga 371
>gb|AY907411.1| Rhizobium etli bv. phaseoli strain IE963 glutamine synthetase II (glnII) gene, partial cds Length = 540 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 79 gtcgagatgttcttcgacga 98 |||||||||||||||||||| Sbjct: 390 gtcgagatgttcttcgacga 371
>gb|AY907410.1| Rhizobium etli bv. phaseoli strain IE4777 glutamine synthetase II (glnII) gene, partial cds Length = 540 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 79 gtcgagatgttcttcgacga 98 |||||||||||||||||||| Sbjct: 390 gtcgagatgttcttcgacga 371
>gb|AY907409.1| Rhizobium etli bv. phaseoli strain IE954 glutamine synthetase II (glnII) gene, partial cds Length = 540 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 79 gtcgagatgttcttcgacga 98 |||||||||||||||||||| Sbjct: 390 gtcgagatgttcttcgacga 371
>gb|AY907408.1| Rhizobium etli bv. phaseoli strain IE4876 glutamine synthetase II (glnII) gene, partial cds Length = 540 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 79 gtcgagatgttcttcgacga 98 |||||||||||||||||||| Sbjct: 390 gtcgagatgttcttcgacga 371
>gb|AY907407.1| Rhizobium etli bv. phaseoli strain IE4815 glutamine synthetase II (glnII) gene, partial cds Length = 540 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 79 gtcgagatgttcttcgacga 98 |||||||||||||||||||| Sbjct: 390 gtcgagatgttcttcgacga 371
>gb|AY907405.1| Rhizobium etli bv. phaseoli strain IE4794 glutamine synthetase II (glnII) gene, partial cds Length = 540 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 79 gtcgagatgttcttcgacga 98 |||||||||||||||||||| Sbjct: 390 gtcgagatgttcttcgacga 371
>gb|AY907404.1| Rhizobium etli bv. phaseoli strain IE4813 glutamine synthetase II (glnII) gene, partial cds Length = 540 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 79 gtcgagatgttcttcgacga 98 |||||||||||||||||||| Sbjct: 390 gtcgagatgttcttcgacga 371
>gb|AY907403.1| Rhizobium etli bv. phaseoli strain IE4810 glutamine synthetase II (glnII) gene, partial cds Length = 540 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 79 gtcgagatgttcttcgacga 98 |||||||||||||||||||| Sbjct: 390 gtcgagatgttcttcgacga 371
>gb|AY929465.1| Rhizobium etli bv. phaseoli strain 4PR-2 glutamine synthetase II (glnII) gene, partial cds Length = 540 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 79 gtcgagatgttcttcgacga 98 |||||||||||||||||||| Sbjct: 390 gtcgagatgttcttcgacga 371
>gb|AY929464.1| Rhizobium etli bv. phaseoli strain GR-12 glutamine synthetase II (glnII) gene, partial cds Length = 540 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 79 gtcgagatgttcttcgacga 98 |||||||||||||||||||| Sbjct: 390 gtcgagatgttcttcgacga 371
>gb|AY929463.1| Rhizobium etli bv. phaseoli strain KIM5S glutamine synthetase II (glnII) gene, partial cds Length = 540 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 79 gtcgagatgttcttcgacga 98 |||||||||||||||||||| Sbjct: 390 gtcgagatgttcttcgacga 371
>ref|XM_469458.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2973 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 42 ggaggacctcttcctcaccg 61 |||||||||||||||||||| Sbjct: 930 ggaggacctcttcctcaccg 911
>ref|NM_005739.2| Homo sapiens RAS guanyl releasing protein 1 (calcium and DAG-regulated) (RASGRP1), mRNA Length = 5021 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 259 tctgcagaggagatgacaat 278 |||||||||||||||||||| Sbjct: 405 tctgcagaggagatgacaat 386
>gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, complete genome Length = 3188609 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 81 cgagatgttcttcgacgacg 100 |||||||||||||||||||| Sbjct: 2989860 cgagatgttcttcgacgacg 2989879
>gb|AY634315.1| Homo sapiens RAS guanyl releasing protein 1 splice variant D mRNA, complete cds, alternatively spliced Length = 2651 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 259 tctgcagaggagatgacaat 278 |||||||||||||||||||| Sbjct: 315 tctgcagaggagatgacaat 296
>gb|BC067298.1| Homo sapiens RAS guanyl releasing protein 1 (calcium and DAG-regulated), mRNA (cDNA clone IMAGE:30377671), partial cds Length = 2379 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 259 tctgcagaggagatgacaat 278 |||||||||||||||||||| Sbjct: 385 tctgcagaggagatgacaat 366
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 42 ggaggacctcttcctcaccg 61 |||||||||||||||||||| Sbjct: 28066753 ggaggacctcttcctcaccg 28066772
>gb|CP000319.1| Nitrobacter hamburgensis X14, complete genome Length = 4406967 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 151 ggcgtcgtcgagcacggcatgttc 174 |||||||||||||||||| ||||| Sbjct: 1681560 ggcgtcgtcgagcacggcctgttc 1681583
>gb|AY954625.3| Homo sapiens Ras guanyl releasing protein 1 delta 11 mRNA, complete cds, alternatively spliced Length = 2296 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 259 tctgcagaggagatgacaat 278 |||||||||||||||||||| Sbjct: 309 tctgcagaggagatgacaat 290
>emb|Z37980.2|EC4HPADNA E.coli hpa[G,R,E,D,F,H,I,X,A,B,C] genes Length = 14852 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 211 gacggcaccgtggcggtcct 230 |||||||||||||||||||| Sbjct: 4118 gacggcaccgtggcggtcct 4137
>gb|AC116158.5| Homo sapiens chromosome , clone RP11-102L12, complete sequence Length = 159236 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 259 tctgcagaggagatgacaat 278 |||||||||||||||||||| Sbjct: 154211 tctgcagaggagatgacaat 154230
>gb|DQ118643.1| Pavlova lutheri isolate 3028 chloroplast ribulose phosphate isomerase mRNA, partial cds; nuclear gene for chloroplast product Length = 1069 Score = 40.1 bits (20), Expect = 6.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 56 tcaccgacaacggcaactacatcgtcga 83 |||||||||||| ||| ||||||||||| Sbjct: 658 tcaccgacaacgacaattacatcgtcga 685
>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome Length = 7074893 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 80 tcgagatgttcttcgacgac 99 |||||||||||||||||||| Sbjct: 2992165 tcgagatgttcttcgacgac 2992184
>gb|AC124306.4| Homo sapiens chromosome 15, clone RP11-275I4, complete sequence Length = 160846 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 259 tctgcagaggagatgacaat 278 |||||||||||||||||||| Sbjct: 6979 tctgcagaggagatgacaat 6998
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 42 ggaggacctcttcctcaccg 61 |||||||||||||||||||| Sbjct: 28158077 ggaggacctcttcctcaccg 28158096
>gb|AY826893.1| Heterocapsa triquetra clone HTRPI1 chloroplast ribose-5-phosphate isomerase mRNA, complete cds; nuclear gene for chloroplast product Length = 1177 Score = 40.1 bits (20), Expect = 6.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 56 tcaccgacaacggcaactacatcgtcga 83 |||| |||||| |||||||||||||||| Sbjct: 816 tcacggacaacagcaactacatcgtcga 843
>gb|AY167561.1| Hordeum vulgare subsp. vulgare GAMYB-binding protein (kgm) mRNA, complete cds Length = 2320 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 284 aagattgaagcagaacctct 303 |||||||||||||||||||| Sbjct: 979 aagattgaagcagaacctct 960
>gb|AF529014.1| Rhizobium etli bv. phaseoli IE2730 glutamine synthetase II (glnII) gene, partial cds Length = 540 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 79 gtcgagatgttcttcgacga 98 |||||||||||||||||||| Sbjct: 390 gtcgagatgttcttcgacga 371
>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome Length = 9025608 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 157 gtcgagcacggcatgttcctcggc 180 ||||||||||||| |||||||||| Sbjct: 7492411 gtcgagcacggcacgttcctcggc 7492388
>gb|AE014073.1| Shigella flexneri 2a str. 2457T, complete genome Length = 4599354 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 gacggcaccgtggcggtcct 230 |||||||||||||||||||| Sbjct: 4545994 gacggcaccgtggcggtcct 4545975
>gb|AY966005.1| Homo sapiens RAS guanyl releasing protein 1 splice variant B mRNA, complete cds, alternatively spliced Length = 2151 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 259 tctgcagaggagatgacaat 278 |||||||||||||||||||| Sbjct: 309 tctgcagaggagatgacaat 290
>dbj|AK120249.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013045D05, full insert sequence Length = 2962 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 42 ggaggacctcttcctcaccg 61 |||||||||||||||||||| Sbjct: 932 ggaggacctcttcctcaccg 913
>gb|AF169587.1|AF169587 Rhizobium galegae glutamine synthetase II (glnII) gene, partial cds Length = 828 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 79 gtcgagatgttcttcgacga 98 |||||||||||||||||||| Sbjct: 351 gtcgagatgttcttcgacga 332
>gb|AF169586.1|AF169586 Rhizobium leguminosarum bv. viciae glutamine synthetase II (glnII) gene, partial cds Length = 828 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 79 gtcgagatgttcttcgacga 98 |||||||||||||||||||| Sbjct: 351 gtcgagatgttcttcgacga 332
>dbj|AK102312.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033090E08, full insert sequence Length = 2458 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 42 ggaggacctcttcctcaccg 61 |||||||||||||||||||| Sbjct: 422 ggaggacctcttcctcaccg 403
>gb|AF081197.1|AF081197 Homo sapiens calcium and DAG-regulated guanine nucleotide exchange factor II mRNA, partial cds Length = 4877 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 259 tctgcagaggagatgacaat 278 |||||||||||||||||||| Sbjct: 259 tctgcagaggagatgacaat 240
>gb|AF063974.1|AF063974 Rhizobium sp. 2M164 glutamine synthetase II gene, partial cds Length = 888 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 79 gtcgagatgttcttcgacga 98 |||||||||||||||||||| Sbjct: 411 gtcgagatgttcttcgacga 392
>gb|AF063960.1|AF063960 Rhizobium sp. CIAM540 glutamine synthetase II gene, partial cds Length = 884 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 79 gtcgagatgttcttcgacga 98 |||||||||||||||||||| Sbjct: 411 gtcgagatgttcttcgacga 392
>gb|AF063956.1|AF063956 Rhizobium sp. CIAM1141 glutamine synthetase II gene, partial cds Length = 875 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 79 gtcgagatgttcttcgacga 98 |||||||||||||||||||| Sbjct: 410 gtcgagatgttcttcgacga 391
>gb|AF106071.1|AF106071 Homo sapiens ras activator RasGRP (RASGRP) mRNA, complete cds Length = 2412 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 259 tctgcagaggagatgacaat 278 |||||||||||||||||||| Sbjct: 314 tctgcagaggagatgacaat 295
>gb|AF081195.1|AF081195 Homo sapiens calcium and DAG-regulated guanine nucleotide exchange factor II mRNA, complete cds Length = 5075 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 259 tctgcagaggagatgacaat 278 |||||||||||||||||||| Sbjct: 405 tctgcagaggagatgacaat 386
>gb|BC109296.1| Homo sapiens RAS guanyl releasing protein 1 (calcium and DAG-regulated), mRNA (cDNA clone MGC:129998 IMAGE:40034427), complete cds Length = 2494 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 259 tctgcagaggagatgacaat 278 |||||||||||||||||||| Sbjct: 352 tctgcagaggagatgacaat 333
>gb|BC109297.1| Homo sapiens RAS guanyl releasing protein 1 (calcium and DAG-regulated), mRNA (cDNA clone MGC:129999 IMAGE:40034428), complete cds Length = 2494 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 259 tctgcagaggagatgacaat 278 |||||||||||||||||||| Sbjct: 352 tctgcagaggagatgacaat 333
>gb|BC032849.1| Homo sapiens cDNA clone IMAGE:5266308, containing frame-shift errors Length = 3248 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 259 tctgcagaggagatgacaat 278 |||||||||||||||||||| Sbjct: 382 tctgcagaggagatgacaat 363
>gb|AE014295.3| Bifidobacterium longum NCC2705, complete genome Length = 2256640 Score = 40.1 bits (20), Expect = 6.2 Identities = 44/52 (84%) Strand = Plus / Minus Query: 151 ggcgtcgtcgagcacggcatgttcctcggcatggccaccaaggtcatcgtcg 202 ||||| || ||||||||| |||||||| ||||| | |||||||||||||| Sbjct: 2030614 ggcgtggtggagcacggcctgttcctcaacatggtcgacaaggtcatcgtcg 2030563
>gb|AY494799.1| Bradyrhizobium sp. ICMP 12835 glutamine synthetase II (glnII) gene, partial cds Length = 828 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 79 gtcgagatgttcttcgacga 98 |||||||||||||||||||| Sbjct: 351 gtcgagatgttcttcgacga 332
>gb|AY494795.1| Rhizobium leguminosarum ICMP 14642 glutamine synthetase II (glnII) gene, partial cds Length = 828 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 79 gtcgagatgttcttcgacga 98 |||||||||||||||||||| Sbjct: 351 gtcgagatgttcttcgacga 332
>gb|CP000036.1| Shigella boydii Sb227, complete genome Length = 4519823 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 gacggcaccgtggcggtcct 230 |||||||||||||||||||| Sbjct: 4464254 gacggcaccgtggcggtcct 4464235
>gb|CP000038.1| Shigella sonnei Ss046, complete genome Length = 4825265 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 gacggcaccgtggcggtcct 230 |||||||||||||||||||| Sbjct: 4770397 gacggcaccgtggcggtcct 4770378 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,197,955 Number of Sequences: 3902068 Number of extensions: 3197955 Number of successful extensions: 58941 Number of sequences better than 10.0: 73 Number of HSP's better than 10.0 without gapping: 73 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 58215 Number of HSP's gapped (non-prelim): 726 length of query: 457 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 435 effective length of database: 17,147,199,772 effective search space: 7459031900820 effective search space used: 7459031900820 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
