ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baak4o04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AB042069.1| Triticum aestivum rbcS gene for ribulose-1,5-bis... 232 4e-58
2gb|M37328.1|WHTRUBIAA T.aestivum ribulose-1,5-bisphosphate carbo... 176 2e-41
3emb|AJ635206.1| Triticum durum ssp. durum partial mRNA for putat... 100 4e-18
4emb|AJ131738.1|SCE131738 Secale cereale mRNA for hypothetical pr... 96 6e-17
5dbj|AB042068.1| Triticum aestivum rbcS gene for ribulose-1,5-bis... 92 1e-15
6dbj|AB042067.1| Triticum aestivum rbcS gene for ribulose-1,5-bis... 92 1e-15
7dbj|AB042065.1| Triticum aestivum rbcS gene for ribulose-1,5-bis... 92 1e-15
8emb|X00235.1|TARUB2 Wheat mRNA fragment for small subunit precur... 88 2e-14
9gb|K02324.1|WHTRBCC Wheat (T. aestivum) chloroplast ribulosebisp... 88 2e-14
10dbj|AB042066.1| Triticum aestivum rbcS gene for ribulose-1,5-bis... 84 2e-13
11dbj|AB042064.1| Triticum aestivum rbcS gene for ribulose-1,5-bis... 84 2e-13
12emb|X00234.1|TARUB1 Wheat mRNA fragment for small subunit precur... 80 4e-12
13dbj|AB020958.1| Triticum aestivum DNA for ribulose-1,5-bisphosph... 76 6e-11
14dbj|AB020955.1| Triticum timopheevii subsp. armeniacum DNA for r... 76 6e-11
15dbj|AB020954.1| Triticum urartu DNA for ribulose-1,5-bisphosphat... 76 6e-11
16dbj|AB020953.1| Aegilops squarrosa DNA for ribulose-1,5-bisphosp... 76 6e-11
17dbj|AB020952.1| Aegilops searsii DNA for ribulose-1,5-bisphospha... 76 6e-11
18dbj|AB020950.1| Aegilops sharonensis DNA for ribulose-1,5-bispho... 76 6e-11
19dbj|AB020949.1| Aegilops longissima DNA for ribulose-1,5-bisphos... 76 6e-11
20dbj|AB020946.1| Aegilops speltoides DNA for ribulose-1,5-bisphos... 76 6e-11
21dbj|AB020944.1| Agropyron intermedium DNA for ribulose-1,5-bisph... 76 6e-11
22dbj|AB020943.1| Hordeum vulgare DNA for ribulose-1,5-bisphosphat... 76 6e-11
23dbj|AB020939.1| Triticum timopheevii subsp. armeniacum DNA for r... 76 6e-11
24dbj|AB020936.1| Aegilops bicornis DNA for ribulose-1,5-bisphosph... 76 6e-11
25dbj|AB020935.1| Aegilops sharonensis DNA for ribulose-1,5-bispho... 76 6e-11
26dbj|AB020934.1| Aegilops longissima DNA for ribulose-1,5-bisphos... 76 6e-11
27dbj|AB020933.1| Aegilops longissima DNA for ribulose-1,5-bisphos... 76 6e-11
28dbj|AB020932.1| Aegilops longissima DNA for ribulose-1,5-bisphos... 76 6e-11
29emb|X83095.1|ASRBCSSS A.squarrosa mRNA for ribulose-1,5-bisphosp... 72 9e-10
30emb|AJ131737.1|SCE131737 Secale cereale mRNA for hypothetical pr... 72 9e-10
31dbj|AB020959.1| Secale cereale DNA for ribulose-1,5-bisphosphate... 68 1e-08
32dbj|AB020957.1| Triticum aestivum DNA for ribulose-1,5-bisphosph... 68 1e-08
33dbj|AB020948.1| Aegilops speltoides DNA for ribulose-1,5-bisphos... 68 1e-08
34dbj|AB020942.1| Secale cereale DNA for ribulose-1,5-bisphosphate... 68 1e-08
35dbj|AB020941.1| Triticum aestivum DNA for ribulose-1,5-bisphosph... 68 1e-08
36dbj|AB020940.1| Triticum turgidum subsp. dicoccoides DNA for rib... 68 1e-08
37dbj|AB020937.1| Aegilops searsii DNA for ribulose-1,5-bisphospha... 68 1e-08
38dbj|AB020930.1| Aegilops speltoides DNA for ribulose-1,5-bisphos... 68 1e-08
39dbj|AB020929.1| Aegilops speltoides DNA for ribulose-1,5-bisphos... 68 1e-08
40dbj|AB020928.1| Aegilops speltoides DNA for ribulose-1,5-bisphos... 68 1e-08
41dbj|AB020960.1| Bromus catharticus DNA for ribulose-1,5-bisphosp... 68 1e-08
42dbj|AB020951.1| Aegilops bicornis DNA for ribulose-1,5-bisphosph... 66 6e-08
43gb|U43493.1|HVU43493 Hordeum vulgare ribulose-1,5-bisphosphate c... 64 2e-07
44gb|AF192777.1|AF192777 Avena clauda clone Cl9 ribulose-1,5-bisph... 60 3e-06
45gb|AF192776.1|AF192776 Avena clauda clone Cl5 ribulose-1,5-bisph... 60 3e-06
46gb|AF192775.1|AF192775 Avena strigosa clone Str5 ribulose-1,5-bi... 60 3e-06
47gb|AF192774.1|AF192774 Avena strigosa clone Str3 ribulose-1,5-bi... 60 3e-06
48gb|AF097360.1|AF097360 Avena strigosa ribulose-1,5-bisphosphate ... 60 3e-06
49gb|AF104249.1|AF104249 Avena vaviloviana ribulose-1,5-bisphospha... 60 3e-06
50gb|AF096617.1|AF096617 Avena sterilis subsp. ludoviciana ribulos... 60 3e-06
51gb|M37477.1|WHTRUBIAB T.aestivum ribulose-1,5-bisphosphate carbo... 60 3e-06
52dbj|AB020956.1| Triticum turgidum subsp. dicoccoides DNA for rib... 60 3e-06
53dbj|AB020938.1| Aegilops squarrosa DNA for ribulose-1,5-bisphosp... 60 3e-06
54dbj|AB020931.1| Aegilops speltoides DNA for ribulose-1,5-bisphos... 60 3e-06
55dbj|AB020927.1| Aegilops speltoides DNA for ribulose-1,5-bisphos... 60 3e-06
56dbj|AB020926.1| Aegilops speltoides DNA for ribulose-1,5-bisphos... 60 3e-06
57gb|AF202648.1|AF202648 Avena maroccana ribulose-1,5-bisphosphate... 56 5e-05
58gb|AF202646.1|AF202646 Avena clauda clone ClG4 ribulose-1,5-bisp... 56 5e-05
59gb|AF192779.1|AF192779 Avena maroccana clone Ma4 ribulose-1,5-bi... 54 2e-04
60gb|AF202645.1|AF202645 Avena clauda clone ClG2 ribulose-1,5-bisp... 52 8e-04
61gb|AF200303.1|AF200303 Avena clauda ribulose-1,5-bisphosphate ca... 52 8e-04
62gb|AF192778.1|AF192778 Avena sterilis subsp. ludoviciana ribulos... 52 8e-04
63gb|AF097361.1|AF097361 Avena clauda ribulose-1,5-bisphosphate ca... 52 8e-04
64dbj|AB020945.1| Avena sativa DNA for ribulose-1,5-bisphosphate c... 52 8e-04
65gb|AF202647.1|AF202647 Avena agadiriana ribulose-1,5-bisphosphat... 48 0.013
66dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.051
67gb|AC092642.2| Homo sapiens BAC clone RP11-391P1 from 2, complet... 46 0.051
68dbj|AK099574.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.051
69gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 46 0.051
70emb|BX119951.3|CNS09S4U Oryza sativa chromosome 12, . BAC OJ1523... 46 0.051
71gb|AF192780.1|AF192780 Avena maroccana clone Ma7 ribulose-1,5-bi... 44 0.20
72gb|AF192773.1|AF192773 Avena agadiriana ribulose-1,5-bisphosphat... 44 0.20
73gb|AF097359.1|AF097359 Avena agadiriana ribulose-1,5-bisphosphat... 44 0.20
74gb|AF104250.1|AF104250 Avena maroccana ribulose-1,5-bisphosphate... 44 0.20
75dbj|AK070257.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 0.80
76dbj|AK068266.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 0.80
77emb|AL772245.7| Mouse DNA sequence from clone RP23-332K6 on chro... 42 0.80
78emb|AL596456.15| Mouse DNA sequence from clone RP23-353K20 on ch... 42 0.80
79gb|AC135567.3| Mus musculus BAC clone RP23-312I24 from chromosom... 40 3.2
80gb|AC133967.2| Mus musculus BAC clone RP23-14J5 from chromosome ... 40 3.2
81gb|AC139748.12| Medicago truncatula clone mth2-15o24, complete s... 40 3.2
82emb|AL139404.9| Human DNA sequence from clone RP11-376D11 on chr... 40 3.2
83emb|CR382380.5| Zebrafish DNA sequence from clone DKEY-112M3 in ... 40 3.2
84gb|AC012236.12| Homo sapiens chromosome 15, clone RP11-16E12, co... 40 3.2
85emb|BX649596.8| Zebrafish DNA sequence from clone CH211-69P4 in ... 40 3.2
86gb|AC127430.4| Homo sapiens chromosome 3 clone CTD-2563A18, comp... 40 3.2
87emb|BX465837.11| Zebrafish DNA sequence from clone DKEY-27C15 in... 40 3.2
88emb|AL935140.6| Zebrafish DNA sequence from clone DKEYP-122E7 in... 40 3.2

>dbj|AB042069.1| Triticum aestivum rbcS gene for ribulose-1,5-bisphosphate
            carboxylase/oxygenase small subunit, complete cds,
            clone:6, subclone:16
          Length = 5980

 Score =  232 bits (117), Expect = 4e-58
 Identities = 209/236 (88%), Gaps = 9/236 (3%)
 Strand = Plus / Plus

                                                                        
Query: 1    gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgaggagtccggcaaggcat 60
            |||||||||||||||||| ||| |||||||||||||||||||||||||| |||||||| |
Sbjct: 1203 gcagtgcgtcagcttcat-cgcattcaggccaccgggttgcgaggagtctggcaaggcct 1261

                                                                        
Query: 61   aaactacgaggtgaaacaatggcctatgtcgtatgaaggtcttctgtgaacttcactttt 120
            |||||||||| | ||||||||||||||   ||||||  ||||| ||||||||||||||||
Sbjct: 1262 aaactacgagttaaaacaatggcctat---gtatgattgtcttttgtgaacttcactttt 1318

                                                                        
Query: 121  gtccatgactctgctttccgactagagcataatttt-cttctctatgatctgtgtttgta 179
            ||||| |||||||||| ||||| |||||||| |||| ||||  |||||||||||||||||
Sbjct: 1319 gtccaggactctgcttcccgaccagagcatatttttccttcggtatgatctgtgtttgta 1378

                                                                    
Query: 180  cgagcattggttgtggagcatatatgcatatgtaaattctagcacggcctacacat 235
            ||| ||| |||||||||||    |||||||||||||||||||||| | ||||||||
Sbjct: 1379 cgaacataggttgtggagc----atgcatatgtaaattctagcaccggctacacat 1430



 Score =  127 bits (64), Expect = 2e-26
 Identities = 165/195 (84%), Gaps = 9/195 (4%)
 Strand = Plus / Plus

                                                                        
Query: 42   gaggagtccggcaaggcataaactacgaggtgaaacaatggcctatgtcgtatgaaggtc 101
            ||||||||||||||||| || |||| ||| ||||||||||||||||   ||| |||||||
Sbjct: 5647 gaggagtccggcaaggcctagactatgagttgaaacaatggcctat---gtacgaaggtc 5703

                                                                        
Query: 102  ttctgtgaacttcacttttgtccatgactctgctttccgactagagcataattttc-ttc 160
            || |||||||||||||||| |||| |||||||| | || || |||||||| ||||| |||
Sbjct: 5704 ttttgtgaacttcacttttctccacgactctgc-tgcctaccagagcatatttttcgttc 5762

                                                                        
Query: 161  tctatgatctgtgtttgtacgagcattggttgtggagcatatatgcatatgtaaattcta 220
            | ||| || ||||| ||||||| |||||||||||||||     ||||| |||||||||||
Sbjct: 5763 tgtataatatgtgtatgtacgaacattggttgtggagc----gtgcatgtgtaaattcta 5818

                           
Query: 221  gcacggcctacacat 235
            |||| | ||||||||
Sbjct: 5819 gcactgactacacat 5833



 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 84/96 (87%), Gaps = 1/96 (1%)
 Strand = Plus / Plus

                                                                        
Query: 106  gtgaacttcacttttgtccatgactctgctttccgactagagcataa-ttttcttctcta 164
            ||||||||||||||| |||| ||||||||||||||||   ||||||| |||| |||| ||
Sbjct: 4358 gtgaacttcacttttctccacgactctgctttccgacctaagcataatttttgttctgta 4417

                                                
Query: 165  tgatctgtgtttgtacgagcattggttgtggagcat 200
            |||||||||| ||||| | ||| |||||||||||||
Sbjct: 4418 tgatctgtgtatgtacaaacataggttgtggagcat 4453



to top

>gb|M37328.1|WHTRUBIAA T.aestivum ribulose-1,5-bisphosphate carboxylase/oxygenase (RUBISCO)
            gene, exons 1 and 2
          Length = 2205

 Score =  176 bits (89), Expect = 2e-41
 Identities = 117/125 (93%), Gaps = 1/125 (0%)
 Strand = Plus / Plus

                                                                        
Query: 1    gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgaggagtccggcaaggcat 60
            |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
Sbjct: 1449 gcagtgcgtcagcttcat-cgccttcaggccaccgggttgcgaggagtccggcaaggcct 1507

                                                                        
Query: 61   aaactacgaggtgaaacaatggcctatgtcgtatgaaggtcttctgtgaacttcactttt 120
            |||||| ||| |||||||||||||||| || ||||||| |||| ||||||||||||||||
Sbjct: 1508 aaactatgagttgaaacaatggcctatctcatatgaagatcttttgtgaacttcactttt 1567

                 
Query: 121  gtcca 125
            |||||
Sbjct: 1568 gtcca 1572



to top

>emb|AJ635206.1| Triticum durum ssp. durum partial mRNA for putative rubisco small
           subunit (rbcS gene)
          Length = 518

 Score = 99.6 bits (50), Expect = 4e-18
 Identities = 57/58 (98%), Gaps = 1/58 (1%)
 Strand = Plus / Plus

                                                                     
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgaggagtccggcaaggc 58
           |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 458 gcagtgcgtcagcttcat-cgccttcaggccaccgggttgcgaggagtccggcaaggc 514



to top

>emb|AJ131738.1|SCE131738 Secale cereale mRNA for hypothetical protein, clone 9
          Length = 875

 Score = 95.6 bits (48), Expect = 6e-17
 Identities = 61/64 (95%), Gaps = 1/64 (1%)
 Strand = Plus / Plus

                                                                       
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgaggagtccggcaaggcat 60
           |||||||||||||||||| |||||||| ||||||||| ||||||||||||||||||||||
Sbjct: 554 gcagtgcgtcagcttcat-cgccttcaagccaccgggctgcgaggagtccggcaaggcat 612

               
Query: 61  aaac 64
           ||||
Sbjct: 613 aaac 616



to top

>dbj|AB042068.1| Triticum aestivum rbcS gene for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, complete cds,
           clone:p13-1
          Length = 985

 Score = 91.7 bits (46), Expect = 1e-15
 Identities = 56/58 (96%), Gaps = 1/58 (1%)
 Strand = Plus / Plus

                                                                     
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgaggagtccggcaaggc 58
           ||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||
Sbjct: 925 gcagtgcgtcagcttcatt-gccttcaggccaccgggttgcgaggagtccggcaaggc 981



to top

>dbj|AB042067.1| Triticum aestivum rbcS gene for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, complete cds,
           clone:p10-1
          Length = 629

 Score = 91.7 bits (46), Expect = 1e-15
 Identities = 56/58 (96%), Gaps = 1/58 (1%)
 Strand = Plus / Plus

                                                                     
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgaggagtccggcaaggc 58
           |||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||
Sbjct: 569 gcagtgcgtcagcttcat-cgccttcaggccaccaggttgcgaggagtccggcaaggc 625



to top

>dbj|AB042065.1| Triticum aestivum rbcS gene for ribulose-1,5-bisphosphate
           carboxylase/oxygenase Small subunit, complete cds,
           clone:p6-1
          Length = 638

 Score = 91.7 bits (46), Expect = 1e-15
 Identities = 56/58 (96%), Gaps = 1/58 (1%)
 Strand = Plus / Plus

                                                                     
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgaggagtccggcaaggc 58
           |||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||
Sbjct: 578 gcagtgcgtcagcttcat-cgcattcaggccaccgggttgcgaggagtccggcaaggc 634



to top

>emb|X00235.1|TARUB2 Wheat mRNA fragment for small subunit precursor of RuBPCase (EC
           4.1.1.39 ribulosebisphosphate carboxylase) clones 234
           and 406
          Length = 743

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 60/64 (93%), Gaps = 1/64 (1%)
 Strand = Plus / Plus

                                                                       
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgaggagtccggcaaggcat 60
           |||||||||||||||||| |||||||| ||||||||| |||||||||||||||||||| |
Sbjct: 433 gcagtgcgtcagcttcat-cgccttcaagccaccgggctgcgaggagtccggcaaggcct 491

               
Query: 61  aaac 64
           ||||
Sbjct: 492 aaac 495



to top

>gb|K02324.1|WHTRBCC Wheat (T. aestivum) chloroplast ribulosebisphosphate carboxylase
          small subunit mRNA, clone pTS406, 3' end
          Length = 317

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 60/64 (93%), Gaps = 1/64 (1%)
 Strand = Plus / Plus

                                                                      
Query: 1  gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgaggagtccggcaaggcat 60
          |||||||||||||||||| |||||||| ||||||||| |||||||||||||||||||| |
Sbjct: 7  gcagtgcgtcagcttcat-cgccttcaagccaccgggctgcgaggagtccggcaaggcct 65

              
Query: 61 aaac 64
          ||||
Sbjct: 66 aaac 69



to top

>dbj|AB042066.1| Triticum aestivum rbcS gene for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, complete cds,
           clone:p9-1
          Length = 739

 Score = 83.8 bits (42), Expect = 2e-13
 Identities = 55/58 (94%), Gaps = 1/58 (1%)
 Strand = Plus / Plus

                                                                     
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgaggagtccggcaaggc 58
           |||||||||||||||||| |||||||| ||||||||| ||||||||||||||||||||
Sbjct: 679 gcagtgcgtcagcttcat-cgccttcaagccaccgggctgcgaggagtccggcaaggc 735



to top

>dbj|AB042064.1| Triticum aestivum rbcS gene for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, complete cds,
           clone:p2-1
          Length = 653

 Score = 83.8 bits (42), Expect = 2e-13
 Identities = 55/58 (94%), Gaps = 1/58 (1%)
 Strand = Plus / Plus

                                                                     
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgaggagtccggcaaggc 58
           |||||||||||||||||| |||||||| ||||||||| ||||||||||||||||||||
Sbjct: 593 gcagtgcgtcagcttcat-cgccttcaagccaccgggctgcgaggagtccggcaaggc 649



to top

>emb|X00234.1|TARUB1 Wheat mRNA fragment for small subunit precursor of RuBPCase (EC
           4.1.1.39) (ribulosebisphosphate carboxylase, clone 512)
          Length = 611

 Score = 79.8 bits (40), Expect = 4e-12
 Identities = 59/64 (92%), Gaps = 1/64 (1%)
 Strand = Plus / Plus

                                                                       
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgaggagtccggcaaggcat 60
           ||||||||||||||||||  ||||||| ||||||||| |||||||||||||||||||| |
Sbjct: 282 gcagtgcgtcagcttcatt-gccttcaagccaccgggctgcgaggagtccggcaaggcct 340

               
Query: 61  aaac 64
           ||||
Sbjct: 341 aaac 344



to top

>dbj|AB020958.1| Triticum aestivum DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           CS-B2
          Length = 781

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 45/46 (97%), Gaps = 1/46 (2%)
 Strand = Plus / Plus

                                                         
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgagga 46
           |||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 737 gcagtgcgtcagcttcat-cgccttcaggccaccgggttgcgagga 781



to top

>dbj|AB020955.1| Triticum timopheevii subsp. armeniacum DNA for
           ribulose-1,5-bisphosphate carboxylase/oxygenase small
           subunit, partial cds, clone Ara-B
          Length = 787

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 45/46 (97%), Gaps = 1/46 (2%)
 Strand = Plus / Plus

                                                         
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgagga 46
           |||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 743 gcagtgcgtcagcttcat-cgccttcaggccaccgggttgcgagga 787



to top

>dbj|AB020954.1| Triticum urartu DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Ura-B
          Length = 787

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 45/46 (97%), Gaps = 1/46 (2%)
 Strand = Plus / Plus

                                                         
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgagga 46
           |||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 743 gcagtgcgtcagcttcat-cgccttcaggccaccgggttgcgagga 787



to top

>dbj|AB020953.1| Aegilops squarrosa DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Squ-B
          Length = 781

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 45/46 (97%), Gaps = 1/46 (2%)
 Strand = Plus / Plus

                                                         
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgagga 46
           |||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 737 gcagtgcgtcagcttcat-cgccttcaggccaccgggttgcgagga 781



to top

>dbj|AB020952.1| Aegilops searsii DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Sea-B
          Length = 728

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 45/46 (97%), Gaps = 1/46 (2%)
 Strand = Plus / Plus

                                                         
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgagga 46
           |||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 684 gcagtgcgtcagcttcat-cgccttcaggccaccgggttgcgagga 728



to top

>dbj|AB020950.1| Aegilops sharonensis DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Sha-B
          Length = 792

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 45/46 (97%), Gaps = 1/46 (2%)
 Strand = Plus / Plus

                                                         
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgagga 46
           |||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 748 gcagtgcgtcagcttcat-cgccttcaggccaccgggttgcgagga 792



to top

>dbj|AB020949.1| Aegilops longissima DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Lon-B
          Length = 792

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 45/46 (97%), Gaps = 1/46 (2%)
 Strand = Plus / Plus

                                                         
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgagga 46
           |||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 748 gcagtgcgtcagcttcat-cgccttcaggccaccgggttgcgagga 792



to top

>dbj|AB020946.1| Aegilops speltoides DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Spe1-B
          Length = 787

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 45/46 (97%), Gaps = 1/46 (2%)
 Strand = Plus / Plus

                                                         
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgagga 46
           |||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 743 gcagtgcgtcagcttcat-cgccttcaggccaccgggttgcgagga 787



to top

>dbj|AB020944.1| Agropyron intermedium DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Agr-A
          Length = 604

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 45/46 (97%), Gaps = 1/46 (2%)
 Strand = Plus / Plus

                                                         
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgagga 46
           |||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 560 gcagtgcgtcagcttcat-cgccttcaggccaccgggttgcgagga 604



to top

>dbj|AB020943.1| Hordeum vulgare DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Hor-A
          Length = 605

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 45/46 (97%), Gaps = 1/46 (2%)
 Strand = Plus / Plus

                                                         
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgagga 46
           |||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 561 gcagtgcgtcagcttcat-cgccttcaggccaccgggttgcgagga 605



to top

>dbj|AB020939.1| Triticum timopheevii subsp. armeniacum DNA for
           ribulose-1,5-bisphosphate carboxylase/oxygenase small
           subunit, partial cds, clone Ara-A
          Length = 604

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 45/46 (97%), Gaps = 1/46 (2%)
 Strand = Plus / Plus

                                                         
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgagga 46
           |||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 560 gcagtgcgtcagcttcat-cgccttcaggccaccgggttgcgagga 604



to top

>dbj|AB020936.1| Aegilops bicornis DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Bic-A
          Length = 605

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 45/46 (97%), Gaps = 1/46 (2%)
 Strand = Plus / Plus

                                                         
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgagga 46
           |||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 561 gcagtgcgtcagcttcat-cgccttcaggccaccgggttgcgagga 605



to top

>dbj|AB020935.1| Aegilops sharonensis DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Sha-A
          Length = 605

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 45/46 (97%), Gaps = 1/46 (2%)
 Strand = Plus / Plus

                                                         
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgagga 46
           |||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 561 gcagtgcgtcagcttcat-cgccttcaggccaccgggttgcgagga 605



to top

>dbj|AB020934.1| Aegilops longissima DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Lon-A3
          Length = 605

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 45/46 (97%), Gaps = 1/46 (2%)
 Strand = Plus / Plus

                                                         
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgagga 46
           |||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 561 gcagtgcgtcagcttcat-cgccttcaggccaccgggttgcgagga 605



to top

>dbj|AB020933.1| Aegilops longissima DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Lon-A2
          Length = 605

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 45/46 (97%), Gaps = 1/46 (2%)
 Strand = Plus / Plus

                                                         
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgagga 46
           |||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 561 gcagtgcgtcagcttcat-cgccttcaggccaccgggttgcgagga 605



to top

>dbj|AB020932.1| Aegilops longissima DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Lon-A1
          Length = 605

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 45/46 (97%), Gaps = 1/46 (2%)
 Strand = Plus / Plus

                                                         
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgagga 46
           |||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 561 gcagtgcgtcagcttcat-cgccttcaggccaccgggttgcgagga 605



to top

>emb|X83095.1|ASRBCSSS A.squarrosa mRNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase, small subunit
          Length = 837

 Score = 71.9 bits (36), Expect = 9e-10
 Identities = 58/64 (90%), Gaps = 1/64 (1%)
 Strand = Plus / Plus

                                                                       
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgaggagtccggcaaggcat 60
           ||||| |||||||||||| ||||| || ||||||||| |||||||||||||||||||| |
Sbjct: 514 gcagtccgtcagcttcat-cgcctccaagccaccgggctgcgaggagtccggcaaggcct 572

               
Query: 61  aaac 64
           ||||
Sbjct: 573 aaac 576



to top

>emb|AJ131737.1|SCE131737 Secale cereale mRNA for hypothetical protein, clone 5
          Length = 845

 Score = 71.9 bits (36), Expect = 9e-10
 Identities = 57/63 (90%), Gaps = 1/63 (1%)
 Strand = Plus / Plus

                                                                       
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgaggagtccggcaaggcat 60
           ||||||||||||||||||  ||||||||||||||  | |||||||| |||||||||||||
Sbjct: 535 gcagtgcgtcagcttcatt-gccttcaggccaccangctgcgaggaatccggcaaggcat 593

              
Query: 61  aaa 63
           |||
Sbjct: 594 aaa 596



to top

>dbj|AB020959.1| Secale cereale DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Sec-B
          Length = 789

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 41/42 (97%), Gaps = 1/42 (2%)
 Strand = Plus / Plus

                                                     
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcg 42
           |||||||||||||||||| |||||||||||||||||||||||
Sbjct: 745 gcagtgcgtcagcttcat-cgccttcaggccaccgggttgcg 785



to top

>dbj|AB020957.1| Triticum aestivum DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           CS-B1
          Length = 787

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 44/46 (95%), Gaps = 1/46 (2%)
 Strand = Plus / Plus

                                                         
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgagga 46
           |||||||||||||||||| |||||| ||||||||||||||||||||
Sbjct: 743 gcagtgcgtcagcttcat-cgcctttaggccaccgggttgcgagga 787



to top

>dbj|AB020948.1| Aegilops speltoides DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Spe3-B
          Length = 772

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 44/46 (95%), Gaps = 1/46 (2%)
 Strand = Plus / Plus

                                                         
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgagga 46
           |||||||||||||||||| ||||||||||||||| |||||||||||
Sbjct: 728 gcagtgcgtcagcttcat-cgccttcaggccaccaggttgcgagga 772



to top

>dbj|AB020942.1| Secale cereale DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Sec-A
          Length = 591

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 44/46 (95%), Gaps = 1/46 (2%)
 Strand = Plus / Plus

                                                         
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgagga 46
           |||||||||||||||||| |||||| ||||||||||||||||||||
Sbjct: 547 gcagtgcgtcagcttcat-cgcctttaggccaccgggttgcgagga 591



to top

>dbj|AB020941.1| Triticum aestivum DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           CS-A
          Length = 605

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 44/46 (95%), Gaps = 1/46 (2%)
 Strand = Plus / Plus

                                                         
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgagga 46
           |||||||||||||||||| ||||||||||||||| |||||||||||
Sbjct: 561 gcagtgcgtcagcttcat-cgccttcaggccaccaggttgcgagga 605



to top

>dbj|AB020940.1| Triticum turgidum subsp. dicoccoides DNA for
           ribulose-1,5-bisphosphate carboxylase/oxygenase small
           subunit, partial cds, clone Dic-A
          Length = 605

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 44/46 (95%), Gaps = 1/46 (2%)
 Strand = Plus / Plus

                                                         
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgagga 46
           |||||||||||||||||| ||||||||||||||| |||||||||||
Sbjct: 561 gcagtgcgtcagcttcat-cgccttcaggccaccaggttgcgagga 605



to top

>dbj|AB020937.1| Aegilops searsii DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Sea-A
          Length = 611

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 44/46 (95%), Gaps = 1/46 (2%)
 Strand = Plus / Plus

                                                         
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgagga 46
           |||||||||||||||||| |||||| ||||||||||||||||||||
Sbjct: 567 gcagtgcgtcagcttcat-cgcctttaggccaccgggttgcgagga 611



to top

>dbj|AB020930.1| Aegilops speltoides DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Spe3-A2
          Length = 604

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 44/46 (95%), Gaps = 1/46 (2%)
 Strand = Plus / Plus

                                                         
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgagga 46
           |||||||||||||||||| ||||||||||||||| |||||||||||
Sbjct: 560 gcagtgcgtcagcttcat-cgccttcaggccaccaggttgcgagga 604



to top

>dbj|AB020929.1| Aegilops speltoides DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Spe3-A1
          Length = 604

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 44/46 (95%), Gaps = 1/46 (2%)
 Strand = Plus / Plus

                                                         
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgagga 46
           |||||||||||||||||| ||||||||||||||| |||||||||||
Sbjct: 560 gcagtgcgtcagcttcat-cgccttcaggccaccaggttgcgagga 604



to top

>dbj|AB020928.1| Aegilops speltoides DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Spe2-A
          Length = 604

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 44/46 (95%), Gaps = 1/46 (2%)
 Strand = Plus / Plus

                                                         
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgagga 46
           |||||||||||||||||  |||||||||||||||||||||||||||
Sbjct: 560 gcagtgcgtcagcttcag-cgccttcaggccaccgggttgcgagga 604



to top

>dbj|AB020960.1| Bromus catharticus DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Bro-B
          Length = 784

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 44/46 (95%), Gaps = 1/46 (2%)
 Strand = Plus / Plus

                                                         
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgagga 46
           |||||||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 740 gcagtgcgtcagcttcat-cgccttcaagccaccgggttgcgagga 784



to top

>dbj|AB020951.1| Aegilops bicornis DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Bic-B
          Length = 783

 Score = 65.9 bits (33), Expect = 6e-08
 Identities = 40/41 (97%), Gaps = 1/41 (2%)
 Strand = Plus / Plus

                                                    
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgc 41
           |||||||||||||||||| ||||||||||||||||||||||
Sbjct: 744 gcagtgcgtcagcttcat-cgccttcaggccaccgggttgc 783



to top

>gb|U43493.1|HVU43493 Hordeum vulgare ribulose-1,5-bisphosphate carboxylase small subunit
           mRNA, complete cds
          Length = 816

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 57/64 (89%), Gaps = 1/64 (1%)
 Strand = Plus / Plus

                                                                       
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgaggagtccggcaaggcat 60
           |||||||||||||||||| ||| |||| |||||| || ||| ||||||| ||||||||||
Sbjct: 488 gcagtgcgtcagcttcat-cgctttcaagccaccaggctgccaggagtcgggcaaggcat 546

               
Query: 61  aaac 64
           ||||
Sbjct: 547 aaac 550



to top

>gb|AF192777.1|AF192777 Avena clauda clone Cl9 ribulose-1,5-bisphosphate carboxylase small
           subunit (rbcS) mRNA, nuclear gene encoding chloroplast
           protein, partial cds
          Length = 504

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 43/46 (93%), Gaps = 1/46 (2%)
 Strand = Plus / Plus

                                                         
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgagga 46
           |||||||||||||||||| |||||||| ||||||||| ||||||||
Sbjct: 453 gcagtgcgtcagcttcat-cgccttcaagccaccgggctgcgagga 497



to top

>gb|AF192776.1|AF192776 Avena clauda clone Cl5 ribulose-1,5-bisphosphate carboxylase small
           subunit (rbcS) mRNA, nuclear gene encoding chloroplast
           protein, partial cds
          Length = 504

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 43/46 (93%), Gaps = 1/46 (2%)
 Strand = Plus / Plus

                                                         
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgagga 46
           |||||||||||||||||| |||||||| ||||||||| ||||||||
Sbjct: 453 gcagtgcgtcagcttcat-cgccttcaagccaccgggctgcgagga 497



to top

>gb|AF192775.1|AF192775 Avena strigosa clone Str5 ribulose-1,5-bisphosphate carboxylase
           small subunit (rbcS) mRNA, nuclear gene encoding
           chloroplast protein, partial cds
          Length = 504

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 43/46 (93%), Gaps = 1/46 (2%)
 Strand = Plus / Plus

                                                         
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgagga 46
           |||||||||||||||||| |||||||| ||||||||| ||||||||
Sbjct: 453 gcagtgcgtcagcttcat-cgccttcaagccaccgggctgcgagga 497



to top

>gb|AF192774.1|AF192774 Avena strigosa clone Str3 ribulose-1,5-bisphosphate carboxylase
           small subunit (rbcS) mRNA, nuclear gene encoding
           chloroplast protein, partial cds
          Length = 504

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 43/46 (93%), Gaps = 1/46 (2%)
 Strand = Plus / Plus

                                                         
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgagga 46
           |||||||||||||||||| |||||||| ||||||||| ||||||||
Sbjct: 453 gcagtgcgtcagcttcat-cgccttcaagccaccgggctgcgagga 497



to top

>gb|AF097360.1|AF097360 Avena strigosa ribulose-1,5-bisphosphate carboxylase small subunit
           (rbcS) mRNA, nuclear gene encoding chloroplast protein,
           partial cds
          Length = 504

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 43/46 (93%), Gaps = 1/46 (2%)
 Strand = Plus / Plus

                                                         
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgagga 46
           |||||||||||||||||| |||||||| ||||||||| ||||||||
Sbjct: 453 gcagtgcgtcagcttcat-cgccttcaagccaccgggctgcgagga 497



to top

>gb|AF104249.1|AF104249 Avena vaviloviana ribulose-1,5-bisphosphate carboxylase small
           subunit (rbcS) mRNA, nuclear gene encoding chloroplast
           protein, partial cds
          Length = 504

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 43/46 (93%), Gaps = 1/46 (2%)
 Strand = Plus / Plus

                                                         
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgagga 46
           |||||||||||||||||| |||||||| ||||||||| ||||||||
Sbjct: 453 gcagtgcgtcagcttcat-cgccttcaagccaccgggctgcgagga 497



to top

>gb|AF096617.1|AF096617 Avena sterilis subsp. ludoviciana ribulose-1,5-bisphosphate
           carboxylase small subunit (rbcS) mRNA, partial cds
          Length = 504

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 43/46 (93%), Gaps = 1/46 (2%)
 Strand = Plus / Plus

                                                         
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgagga 46
           |||||||||||||||||| |||||||| ||||||||| ||||||||
Sbjct: 453 gcagtgcgtcagcttcat-cgccttcaagccaccgggctgcgagga 497



to top

>gb|M37477.1|WHTRUBIAB T.aestivum ribulose-1,5-bisphosphate carboxylase/oxygenase
           (RUBISCO) gene, complete cds
          Length = 779

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 49/54 (90%), Gaps = 1/54 (1%)
 Strand = Plus / Plus

                                                                 
Query: 5   tgcgtcagcttcatacgccttcaggccaccgggttgcgaggagtccggcaaggc 58
           ||||||||||||||  |||||||||||||| || |||||||| |||||||||||
Sbjct: 529 tgcgtcagcttcatt-gccttcaggccaccaggctgcgaggaatccggcaaggc 581



to top

>dbj|AB020956.1| Triticum turgidum subsp. dicoccoides DNA for
           ribulose-1,5-bisphosphate carboxylase/oxygenase small
           subunit, partial cds, clone Dic-B
          Length = 787

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 43/46 (93%), Gaps = 1/46 (2%)
 Strand = Plus / Plus

                                                         
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgagga 46
           |||||||||||||||||| |||||  ||||||||||||||||||||
Sbjct: 743 gcagtgcgtcagcttcat-cgcctataggccaccgggttgcgagga 787



to top

>dbj|AB020938.1| Aegilops squarrosa DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Squ-A
          Length = 607

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 43/46 (93%), Gaps = 1/46 (2%)
 Strand = Plus / Plus

                                                         
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgagga 46
           |||||||||||||||||| |||||| |||||||| |||||||||||
Sbjct: 563 gcagtgcgtcagcttcat-cgcctttaggccaccaggttgcgagga 607



to top

>dbj|AB020931.1| Aegilops speltoides DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Spe3-A3
          Length = 604

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 43/46 (93%), Gaps = 1/46 (2%)
 Strand = Plus / Plus

                                                         
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgagga 46
           |||||||||||||||||| ||||||||||||||| ||||| |||||
Sbjct: 560 gcagtgcgtcagcttcat-cgccttcaggccaccaggttgggagga 604



to top

>dbj|AB020927.1| Aegilops speltoides DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Spe1-A1
          Length = 604

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 43/46 (93%), Gaps = 1/46 (2%)
 Strand = Plus / Plus

                                                         
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgagga 46
           |||||||||||| ||||| ||||||||||||||| |||||||||||
Sbjct: 560 gcagtgcgtcagtttcat-cgccttcaggccaccaggttgcgagga 604



to top

>dbj|AB020926.1| Aegilops speltoides DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds
          Length = 604

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 43/46 (93%), Gaps = 1/46 (2%)
 Strand = Plus / Plus

                                                         
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgagga 46
           |||||||||||| ||||| ||||||||||||||| |||||||||||
Sbjct: 560 gcagtgcgtcagtttcat-cgccttcaggccaccaggttgcgagga 604



to top

>gb|AF202648.1|AF202648 Avena maroccana ribulose-1,5-bisphosphate carboxylase small subunit
           (rbcS) gene, partial cds
          Length = 620

 Score = 56.0 bits (28), Expect = 5e-05
 Identities = 47/52 (90%), Gaps = 1/52 (1%)
 Strand = Plus / Plus

                                                               
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgaggagtccgg 52
           |||||||||||||||||| ||| |||| ||||||||| |||||||| |||||
Sbjct: 569 gcagtgcgtcagcttcat-cgcattcaagccaccgggctgcgaggaatccgg 619



to top

>gb|AF202646.1|AF202646 Avena clauda clone ClG4 ribulose-1,5-bisphosphate carboxylase small
           subunit (rbcS) gene, partial cds
          Length = 586

 Score = 56.0 bits (28), Expect = 5e-05
 Identities = 47/52 (90%), Gaps = 1/52 (1%)
 Strand = Plus / Plus

                                                               
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgaggagtccgg 52
           |||||||||||||||||| |||||||| |||||| || |||||||| |||||
Sbjct: 535 gcagtgcgtcagcttcat-cgccttcaagccaccaggctgcgaggaatccgg 585



to top

>gb|AF192779.1|AF192779 Avena maroccana clone Ma4 ribulose-1,5-bisphosphate carboxylase
           small subunit (rbcS) mRNA, nuclear gene encoding
           chloroplast protein, partial cds
          Length = 504

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 40/43 (93%), Gaps = 1/43 (2%)
 Strand = Plus / Plus

                                                      
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcga 43
           |||||||||||||||||| |||||||| ||||||||| |||||
Sbjct: 453 gcagtgcgtcagcttcat-cgccttcaagccaccgggctgcga 494



to top

>gb|AF202645.1|AF202645 Avena clauda clone ClG2 ribulose-1,5-bisphosphate carboxylase small
           subunit (rbcS) gene, partial cds
          Length = 600

 Score = 52.0 bits (26), Expect = 8e-04
 Identities = 42/46 (91%), Gaps = 1/46 (2%)
 Strand = Plus / Plus

                                                         
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgagga 46
           |||||||||||||||||| |||||||| |||||| || ||||||||
Sbjct: 549 gcagtgcgtcagcttcat-cgccttcaagccaccaggctgcgagga 593



to top

>gb|AF200303.1|AF200303 Avena clauda ribulose-1,5-bisphosphate carboxylase small subunit
           (rbcS) gene, nuclear gene encoding chloroplast protein,
           partial cds
          Length = 594

 Score = 52.0 bits (26), Expect = 8e-04
 Identities = 42/46 (91%), Gaps = 1/46 (2%)
 Strand = Plus / Plus

                                                         
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgagga 46
           |||||||||||||||||| |||||||| |||||| || ||||||||
Sbjct: 543 gcagtgcgtcagcttcat-cgccttcaagccaccaggctgcgagga 587



to top

>gb|AF192778.1|AF192778 Avena sterilis subsp. ludoviciana ribulose-1,5-bisphosphate
           carboxylase small subunit (rbcS) mRNA, nuclear gene
           encoding chloroplast protein, partial cds
          Length = 504

 Score = 52.0 bits (26), Expect = 8e-04
 Identities = 42/46 (91%), Gaps = 1/46 (2%)
 Strand = Plus / Plus

                                                         
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgagga 46
           |||||||||||| ||||| |||||||| ||||||||| ||||||||
Sbjct: 453 gcagtgcgtcagtttcat-cgccttcaagccaccgggctgcgagga 497



to top

>gb|AF097361.1|AF097361 Avena clauda ribulose-1,5-bisphosphate carboxylase small subunit
           (rbcS) mRNA, nuclear gene encoding chloroplast protein,
           partial cds
          Length = 504

 Score = 52.0 bits (26), Expect = 8e-04
 Identities = 42/46 (91%), Gaps = 1/46 (2%)
 Strand = Plus / Plus

                                                         
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgagga 46
           |||||| ||||||||||| |||||||| ||||||||| ||||||||
Sbjct: 453 gcagtgtgtcagcttcat-cgccttcaagccaccgggctgcgagga 497



to top

>dbj|AB020945.1| Avena sativa DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Ave-A
          Length = 590

 Score = 52.0 bits (26), Expect = 8e-04
 Identities = 42/46 (91%), Gaps = 1/46 (2%)
 Strand = Plus / Plus

                                                         
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgagga 46
           |||||||||||||||||| |||||||| |||||| || ||||||||
Sbjct: 546 gcagtgcgtcagcttcat-cgccttcaagccaccaggctgcgagga 590



to top

>gb|AF202647.1|AF202647 Avena agadiriana ribulose-1,5-bisphosphate carboxylase small
           subunit (rbcS) gene, partial cds
          Length = 593

 Score = 48.1 bits (24), Expect = 0.013
 Identities = 46/52 (88%), Gaps = 1/52 (1%)
 Strand = Plus / Plus

                                                               
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgaggagtccgg 52
           |||||||||||||||||| ||| |||| |||||| || |||||||| |||||
Sbjct: 542 gcagtgcgtcagcttcat-cgcattcaagccaccaggctgcgaggaatccgg 592



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 46.1 bits (23), Expect = 0.051
 Identities = 39/43 (90%), Gaps = 1/43 (2%)
 Strand = Plus / Plus

                                                           
Query: 11       agcttcatacgccttcaggccaccgggttgcgaggagtccggc 53
                |||||||| ||||| || ||| |||||||||||||||||||||
Sbjct: 11276924 agcttcat-cgcctacaagcccccgggttgcgaggagtccggc 11276965



 Score = 42.1 bits (21), Expect = 0.80
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 29       gccaccgggttgcgaggagtc 49
                |||||||||||||||||||||
Sbjct: 11320088 gccaccgggttgcgaggagtc 11320108



to top

>gb|AC092642.2| Homo sapiens BAC clone RP11-391P1 from 2, complete sequence
          Length = 152251

 Score = 46.1 bits (23), Expect = 0.051
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 197    gcatatatgcatatgtaaattct 219
              |||||||||||||||||||||||
Sbjct: 124198 gcatatatgcatatgtaaattct 124176



to top

>dbj|AK099574.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013036G21, full
           insert sequence
          Length = 947

 Score = 46.1 bits (23), Expect = 0.051
 Identities = 39/43 (90%), Gaps = 1/43 (2%)
 Strand = Plus / Plus

                                                      
Query: 11  agcttcatacgccttcaggccaccgggttgcgaggagtccggc 53
           |||||||| ||||| || ||| |||||||||||||||||||||
Sbjct: 546 agcttcat-cgcctacaagcccccgggttgcgaggagtccggc 587



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 46.1 bits (23), Expect = 0.051
 Identities = 39/43 (90%), Gaps = 1/43 (2%)
 Strand = Plus / Plus

                                                           
Query: 11       agcttcatacgccttcaggccaccgggttgcgaggagtccggc 53
                |||||||| ||||| || ||| |||||||||||||||||||||
Sbjct: 11276595 agcttcat-cgcctacaagcccccgggttgcgaggagtccggc 11276636



 Score = 42.1 bits (21), Expect = 0.80
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 29       gccaccgggttgcgaggagtc 49
                |||||||||||||||||||||
Sbjct: 11319759 gccaccgggttgcgaggagtc 11319779



to top

>emb|BX119951.3|CNS09S4U Oryza sativa chromosome 12, . BAC OJ1523_A01 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 127267

 Score = 46.1 bits (23), Expect = 0.051
 Identities = 39/43 (90%), Gaps = 1/43 (2%)
 Strand = Plus / Minus

                                                        
Query: 11    agcttcatacgccttcaggccaccgggttgcgaggagtccggc 53
             |||||||| ||||| || ||| |||||||||||||||||||||
Sbjct: 95130 agcttcat-cgcctacaagcccccgggttgcgaggagtccggc 95089



 Score = 42.1 bits (21), Expect = 0.80
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 29    gccaccgggttgcgaggagtc 49
             |||||||||||||||||||||
Sbjct: 51966 gccaccgggttgcgaggagtc 51946



to top

>gb|AF192780.1|AF192780 Avena maroccana clone Ma7 ribulose-1,5-bisphosphate carboxylase
           small subunit (rbcS) mRNA, nuclear gene encoding
           chloroplast protein, partial cds
          Length = 504

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 41/46 (89%), Gaps = 1/46 (2%)
 Strand = Plus / Plus

                                                         
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgagga 46
           |||||||||||||||||| ||| |||| |||||| || ||||||||
Sbjct: 453 gcagtgcgtcagcttcat-cgcattcaagccaccaggctgcgagga 497



to top

>gb|AF192773.1|AF192773 Avena agadiriana ribulose-1,5-bisphosphate carboxylase small
           subunit (rbcS) mRNA, nuclear gene encoding chloroplast
           protein, partial cds
          Length = 504

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 41/46 (89%), Gaps = 1/46 (2%)
 Strand = Plus / Plus

                                                         
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgagga 46
           |||||| ||||||||||| |||||||| |||||| || ||||||||
Sbjct: 453 gcagtgtgtcagcttcat-cgccttcaagccaccaggctgcgagga 497



to top

>gb|AF097359.1|AF097359 Avena agadiriana ribulose-1,5-bisphosphate carboxylase small
           subunit (rbcS) mRNA, nuclear gene encoding chloroplast
           protein, partial cds
          Length = 504

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 41/46 (89%), Gaps = 1/46 (2%)
 Strand = Plus / Plus

                                                         
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgagga 46
           |||||| ||||||||||| |||||||| |||||| || ||||||||
Sbjct: 453 gcagtgtgtcagcttcat-cgccttcaagccaccaggctgcgagga 497



to top

>gb|AF104250.1|AF104250 Avena maroccana ribulose-1,5-bisphosphate carboxylase small subunit
           (rbcS) mRNA, nuclear gene encoding chloroplast protein,
           partial cds
          Length = 504

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 41/46 (89%), Gaps = 1/46 (2%)
 Strand = Plus / Plus

                                                         
Query: 1   gcagtgcgtcagcttcatacgccttcaggccaccgggttgcgagga 46
           |||||||||||||||||| ||| |||| |||||| || ||||||||
Sbjct: 453 gcagtgcgtcagcttcat-cgcattcaagccaccaggctgcgagga 497



to top

>dbj|AK070257.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023042N11, full
           insert sequence
          Length = 845

 Score = 42.1 bits (21), Expect = 0.80
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 29  gccaccgggttgcgaggagtc 49
           |||||||||||||||||||||
Sbjct: 559 gccaccgggttgcgaggagtc 579



to top

>dbj|AK068266.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013149A10, full
           insert sequence
          Length = 1999

 Score = 42.1 bits (21), Expect = 0.80
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 29  gccaccgggttgcgaggagtc 49
           |||||||||||||||||||||
Sbjct: 561 gccaccgggttgcgaggagtc 581



to top

>emb|AL772245.7| Mouse DNA sequence from clone RP23-332K6 on chromosome 4, complete
             sequence
          Length = 70508

 Score = 42.1 bits (21), Expect = 0.80
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 197   gcatatatgcatatgtaaatt 217
             |||||||||||||||||||||
Sbjct: 46393 gcatatatgcatatgtaaatt 46373



to top

>emb|AL596456.15| Mouse DNA sequence from clone RP23-353K20 on chromosome 11, complete
              sequence
          Length = 228428

 Score = 42.1 bits (21), Expect = 0.80
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 198    catatatgcatatgtaaattc 218
              |||||||||||||||||||||
Sbjct: 158764 catatatgcatatgtaaattc 158744



to top

>gb|AC135567.3| Mus musculus BAC clone RP23-312I24 from chromosome 16, complete
             sequence
          Length = 208603

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 197   gcatatatgcatatgtaaat 216
             ||||||||||||||||||||
Sbjct: 85748 gcatatatgcatatgtaaat 85767



to top

>gb|AC133967.2| Mus musculus BAC clone RP23-14J5 from chromosome 16, complete sequence
          Length = 195446

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 197    gcatatatgcatatgtaaat 216
              ||||||||||||||||||||
Sbjct: 152885 gcatatatgcatatgtaaat 152904



to top

>gb|AC139748.12| Medicago truncatula clone mth2-15o24, complete sequence
          Length = 144217

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 27    aggccaccgggttgcgagga 46
             ||||||||||||||||||||
Sbjct: 57944 aggccaccgggttgcgagga 57925



to top

>emb|AL139404.9| Human DNA sequence from clone RP11-376D11 on chromosome 10 Contains the
              5' end of the SSH3BP gene for spectrin SH3 domain binding
              protein 1, complete sequence
          Length = 122913

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 157    cttctctatgatctgtgttt 176
              ||||||||||||||||||||
Sbjct: 101619 cttctctatgatctgtgttt 101638



to top

>emb|CR382380.5| Zebrafish DNA sequence from clone DKEY-112M3 in linkage group 14,
             complete sequence
          Length = 84200

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 149   ataattttcttctctatgat 168
             ||||||||||||||||||||
Sbjct: 30560 ataattttcttctctatgat 30579



to top

>gb|AC012236.12| Homo sapiens chromosome 15, clone RP11-16E12, complete sequence
          Length = 173729

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 190   ttgtggagcatatatgcatatgta 213
             |||||||| |||||||||||||||
Sbjct: 56427 ttgtggagaatatatgcatatgta 56450



to top

>emb|BX649596.8| Zebrafish DNA sequence from clone CH211-69P4 in linkage group 14,
             complete sequence
          Length = 181055

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 195   gagcatatatgcatatgtaa 214
             ||||||||||||||||||||
Sbjct: 42651 gagcatatatgcatatgtaa 42670



to top

>gb|AC127430.4| Homo sapiens chromosome 3 clone CTD-2563A18, complete sequence
          Length = 181750

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 140    gactagagcataattttcttctct 163
              ||||||| ||||||||||||||||
Sbjct: 134581 gactagaacataattttcttctct 134558



to top

>emb|BX465837.11| Zebrafish DNA sequence from clone DKEY-27C15 in linkage group 19,
              complete sequence
          Length = 206154

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 112    ttcacttttgtccatgactc 131
              ||||||||||||||||||||
Sbjct: 165538 ttcacttttgtccatgactc 165557



to top

>emb|AL935140.6| Zebrafish DNA sequence from clone DKEYP-122E7 in linkage group 9,
             complete sequence
          Length = 83763

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 111   cttcacttttgtccatgact 130
             ||||||||||||||||||||
Sbjct: 18433 cttcacttttgtccatgact 18452


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,935,096
Number of Sequences: 3902068
Number of extensions: 1935096
Number of successful extensions: 42265
Number of sequences better than 10.0: 88
Number of HSP's better than 10.0 without gapping: 66
Number of HSP's successfully gapped in prelim test: 22
Number of HSP's that attempted gapping in prelim test: 42101
Number of HSP's gapped (non-prelim): 130
length of query: 245
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 223
effective length of database: 17,147,199,772
effective search space: 3823825549156
effective search space used: 3823825549156
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top