ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name baak4l21
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|U37285.1|ZMU37285 Zea mays phytoene desaturase mRNA, complete... 254 1e-64
2ref|XM_470568.1| Oryza sativa (japonica cultivar-group), predic... 242 6e-61
3gb|L39266.1|MZEPTDT Zea mays phytoene desaturase (Pds) mRNA, com... 236 3e-59
4gb|AF049356.1|AF049356 Oryza sativa phytoene desaturase precurso... 234 1e-58
5gb|AY109597.1| Zea mays CL1803_1 mRNA sequence 228 8e-57
6gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 129 6e-27
7gb|AC079633.9|AC079633 Genomic Sequence for Oryza sativa, Nippon... 129 6e-27
8dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 129 6e-27
9gb|AY062039.1| Hordeum vulgare phytoene desaturase mRNA, partial... 103 3e-19
10gb|M64704.1|SOYPHYDES Soybean phytoene desaturase mRNA, complete... 86 8e-14
11gb|DQ222429.1| Daucus carota subsp. sativus phytoene desaturase ... 84 3e-13
12gb|DQ469932.1| Nicotiana benthamiana phytoene desaturase mRNA, c... 78 2e-11
13gb|AY822065.1| Prunus armeniaca phytoene desaturase mRNA, comple... 76 7e-11
14gb|AC147484.21| Medicago truncatula clone mth2-52b4, complete se... 72 1e-09
15ref|NM_117498.2| Arabidopsis thaliana PDS3 (PHYTOENE DESATURASE)... 70 5e-09
16ref|NM_202816.1| Arabidopsis thaliana PDS3 (PHYTOENE DESATURASE)... 70 5e-09
17gb|AY040007.1| Arabidopsis thaliana phytoene dehydrogenase precu... 70 5e-09
18gb|AF360196.1| Arabidopsis thaliana putative phytoene dehydrogen... 70 5e-09
19gb|AY057669.1| Arabidopsis thaliana AT4g14210/dl3145c mRNA, comp... 70 5e-09
20gb|AF364515.1|AF364515 Citrus x paradisi phytoene desaturase mRN... 70 5e-09
21emb|BX828059.1|CNS0A3WA Arabidopsis thaliana Full-length cDNA Co... 70 5e-09
22gb|DQ235261.1| Citrus sinensis phytoene desaturase mRNA, complet... 70 5e-09
23emb|AJ319761.1|CSI319761 Citrus sinensis mRNA for phytoene desat... 70 5e-09
24gb|L16237.1|ATHPHYDES Arabidopsis thaliana phytoene desaturase m... 70 5e-09
25dbj|AB046992.1| Citrus unshiu CitPDS1 mRNA for phytoene desatura... 70 5e-09
26gb|AY494790.1| Momordica charantia var. abbreviata phytoene desa... 68 2e-08
27gb|AY639658.1| Hydrilla verticillata phytoene desaturase mRNA, c... 62 1e-06
28gb|S36691.1| Lycopersicon esculentum phytoene desaturase (pds) m... 62 1e-06
29emb|X59948.1|LEPDS L.esculentum mRNA for phytoene desaturase 62 1e-06
30emb|X68058.1|CAPDS1 C.annuum pds1 mRNA for phytoene desaturase 62 1e-06
31gb|M88683.1|TOMPHYTDES Lycopersicon esculentum phytoene desatura... 62 1e-06
32dbj|AB205049.1| Chrysanthemum x morifolium PDS mRNA for phytoene... 60 4e-06
33emb|Z97335.2|ATFCA0 Arabidopsis thaliana DNA chromosome 4, ESSA ... 58 2e-05
34emb|AL161538.2|ATCHRIV38 Arabidopsis thaliana DNA chromosome 4, ... 58 2e-05
35gb|AY484445.1| Solanum tuberosum phytoene desaturase (pds) mRNA,... 54 3e-04
36emb|X78815.1|NPMPTD N.pseudonarcissus mRNA for phytoene desaturase 52 0.001
37emb|X71023.1|LEPDSG Lycopersicon esculentum pds gene for phytoen... 48 0.017
38emb|X78271.1|LEPDSGEN L.esculentum (Ailsa Craig) PDS gene 48 0.017
39ref|NM_100549.2| Arabidopsis thaliana unknown protein AT1G06720 ... 44 0.26
40gb|AY768691.1| Haematococcus pluvialis phytoene desaturase (PDS)... 44 0.26
41gb|AF251014.1|AF251014 Tagetes erecta phytoene desaturase mRNA, ... 44 0.26
42dbj|AB028666.1| Gentiana lutea HGENPDS mRNA for phytoene desatur... 44 0.26
43gb|AC011001.2|AC011001 Arabidopsis thaliana chromosome I BAC F4H... 44 0.26
44dbj|AP004940.1| Lotus japonicus genomic DNA, chromosome 3, clone... 42 1.0
45gb|CP000285.1| Chromohalobacter salexigens DSM 3043, complete ge... 40 4.1
46ref|XM_545126.2| PREDICTED: Canis familiaris similar to F-box on... 40 4.1
47emb|AL365400.19| Human DNA sequence from clone RP11-471G13 on ch... 40 4.1
48gb|AY196092.1| Lycopersicon esculentum metal transporter mRNA, c... 40 4.1
49gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome 40 4.1
50gb|AC107486.4| Homo sapiens BAC clone RP11-814I21 from 4, comple... 40 4.1
51gb|AC067940.5| Homo sapiens BAC clone RP11-818E9 from 2, complet... 40 4.1
52emb|BX470088.11| Zebrafish DNA sequence from clone DKEY-171E12 i... 40 4.1
53emb|BX957286.14| Zebrafish DNA sequence from clone CH211-119B12 ... 40 4.1
54emb|CR956367.12| Pig DNA sequence from clone PigE-122C21 on chro... 40 4.1
55dbj|AB028665.1| Gentiana lutea SGENPDS mRNA for phytoene desatur... 40 4.1 
>gb|U37285.1|ZMU37285 Zea mays phytoene desaturase mRNA, complete cds
          Length = 2264

 Score =  254 bits (128), Expect = 1e-64
 Identities = 212/240 (88%)
 Strand = Plus / Plus

                                                                       
Query: 73  tgcaggttgtttgccaagattttccaaggcctccacttgaaaacacagttaactatttgg 132
           |||||||||| ||| | ||||||||||| |||||||| |||| |||| | ||||||||||
Sbjct: 526 tgcaggttgtctgcaaggattttccaagacctccactagaaagcacaataaactatttgg 585

                                                                       
Query: 133 aagctggccagctttcttcatcgtttagaggcagtgaacgccccagtaaaccattacagg 192
           ||||||| ||||| |||||||  ||||||  ||| |||||||||||||| || || ||||
Sbjct: 586 aagctggacagctctcttcattttttagaaacagcgaacgccccagtaagccgttgcagg 645

                                                                       
Query: 193 tcgtgattgctggtgcaggactggctggtctatcaactgcaaaatacctggcagatgctg 252
           ||||| |||||||||||||| |||||||||||||||| || || || |||||||||||||
Sbjct: 646 tcgtggttgctggtgcaggattggctggtctatcaacagcgaagtatctggcagatgctg 705

                                                                       
Query: 253 gccataaacccatagtgcttgaggcaagagatgtcttgggcggaaagttagctgcttgga 312
           |||||||||||||| ||||||||||||||||||| ||||| |||||| ||||||||||||
Sbjct: 706 gccataaacccatattgcttgaggcaagagatgttttgggtggaaaggtagctgcttgga 765
to top
>ref|XM_470568.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1737

 Score =  242 bits (122), Expect = 6e-61
 Identities = 215/246 (87%)
 Strand = Plus / Plus

                                                                       
Query: 67  gtgctctgcaggttgtttgccaagattttccaaggcctccacttgaaaacacagttaact 126
           ||||||| |||||||||||||| || |||||||| |||||||| ||||||||| | ||||
Sbjct: 194 gtgctctacaggttgtttgccaggactttccaagacctccactagaaaacacaataaact 253

                                                                       
Query: 127 atttggaagctggccagctttcttcatcgtttagaggcagtgaacgccccagtaaaccat 186
            |||||||||||| || || |||||||  || |||  ||||||||  |||| ||||||||
Sbjct: 254 ttttggaagctggacaactatcttcatttttcagaaacagtgaacaacccactaaaccat 313

                                                                       
Query: 187 tacaggtcgtgattgctggtgcaggactggctggtctatcaactgcaaaatacctggcag 246
           ||||||||||||||||||| |||||| | |||||| ||||||| |||||||| |||||||
Sbjct: 314 tacaggtcgtgattgctggagcaggattagctggtttatcaacggcaaaatatctggcag 373

                                                                       
Query: 247 atgctggccataaacccatagtgcttgaggcaagagatgtcttgggcggaaagttagctg 306
           ||||||| |||||||||||| ||||||||||||| ||||| ||||| |||||| ||||||
Sbjct: 374 atgctggtcataaacccatattgcttgaggcaagggatgttttgggtggaaagatagctg 433

                 
Query: 307 cttgga 312
           ||||||
Sbjct: 434 cttgga 439
to top
>gb|L39266.1|MZEPTDT Zea mays phytoene desaturase (Pds) mRNA, complete cds
          Length = 1983

 Score =  236 bits (119), Expect = 3e-59
 Identities = 197/223 (88%)
 Strand = Plus / Plus

                                                                       
Query: 90  gattttccaaggcctccacttgaaaacacagttaactatttggaagctggccagctttct 149
           ||||||||||| |||||||| |||| |||| | ||||||||||||||||| ||||| |||
Sbjct: 238 gattttccaagtcctccactagaaagcacaataaactatttggaagctggacagctctct 297

                                                                       
Query: 150 tcatcgtttagaggcagtgaacgccccagtaaaccattacaggtcgtgattgctggtgca 209
           ||||  ||||||  ||| |||||||||||||| || || ||||||||| |||||||||||
Sbjct: 298 tcattttttagaaacagcgaacgccccagtaagccgttgcaggtcgtggttgctggtgca 357

                                                                       
Query: 210 ggactggctggtctatcaactgcaaaatacctggcagatgctggccataaacccatagtg 269
           ||| |||||||||||||||| || || || |||||||||||||| |||||||||||| ||
Sbjct: 358 ggattggctggtctatcaacagcgaagtatctggcagatgctggacataaacccatattg 417

                                                      
Query: 270 cttgaggcaagagatgtcttgggcggaaagttagctgcttgga 312
           ||||||||||||||||| ||||| |||||| ||||||||||||
Sbjct: 418 cttgaggcaagagatgttttgggtggaaaggtagctgcttgga 460
to top
>gb|AF049356.1|AF049356 Oryza sativa phytoene desaturase precursor (Pds) mRNA, complete cds
          Length = 2027

 Score =  234 bits (118), Expect = 1e-58
 Identities = 214/246 (86%)
 Strand = Plus / Plus

                                                                       
Query: 67  gtgctctgcaggttgtttgccaagattttccaaggcctccacttgaaaacacagttaact 126
           ||||||| |||||||||||||| || |||||||| |||||||| ||||||||| | ||||
Sbjct: 162 gtgctctacaggttgtttgccaggactttccaagacctccactagaaaacacaataaact 221

                                                                       
Query: 127 atttggaagctggccagctttcttcatcgtttagaggcagtgaacgccccagtaaaccat 186
            |||||||||||| || || || ||||  || |||  ||||||||  |||| ||||||||
Sbjct: 222 ttttggaagctggacaactatcctcatttttcagaaacagtgaacaacccactaaaccat 281

                                                                       
Query: 187 tacaggtcgtgattgctggtgcaggactggctggtctatcaactgcaaaatacctggcag 246
           ||||||||||||||||||| |||||| | |||||| ||||||| |||||||| |||||||
Sbjct: 282 tacaggtcgtgattgctggagcaggattagctggtttatcaacggcaaaatatctggcag 341

                                                                       
Query: 247 atgctggccataaacccatagtgcttgaggcaagagatgtcttgggcggaaagttagctg 306
           ||||||| |||||||||||| ||||||||||||| ||||| ||||| |||||| ||||||
Sbjct: 342 atgctggtcataaacccatattgcttgaggcaagggatgttttgggtggaaagatagctg 401

                 
Query: 307 cttgga 312
           ||||||
Sbjct: 402 cttgga 407



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 229 ctgcaaaatacctggcagatgctg 252
           |||||||||| |||||||||||||
Sbjct: 32  ctgcaaaatatctggcagatgctg 9
to top
>gb|AY109597.1| Zea mays CL1803_1 mRNA sequence
          Length = 2305

 Score =  228 bits (115), Expect = 8e-57
 Identities = 209/241 (86%), Gaps = 1/241 (0%)
 Strand = Plus / Plus

                                                                       
Query: 73  tgcaggttgtttgccaag-attttccaaggcctccacttgaaaacacagttaactatttg 131
           |||||||||| ||| ||| |||||||||| |||||||| |||| |||| | |||||||||
Sbjct: 526 tgcaggttgtctgcaaaggattttccaagtcctccactagaaagcacaataaactatttg 585

                                                                       
Query: 132 gaagctggccagctttcttcatcgtttagaggcagtgaacgccccagtaaaccattacag 191
           |||||||| ||||| ||||||      |||  ||| |||||||||||||| || || |||
Sbjct: 586 gaagctggacagctctcttcannnnnnagaaacagcgaacgccccagtaagccgttgcag 645

                                                                       
Query: 192 gtcgtgattgctggtgcaggactggctggtctatcaactgcaaaatacctggcagatgct 251
           |||||| |||||||||||||| |||||||||||||||| || || || ||||||||||||
Sbjct: 646 gtcgtggttgctggtgcaggattggctggtctatcaacagcgaagtatctggcagatgct 705

                                                                       
Query: 252 ggccataaacccatagtgcttgaggcaagagatgtcttgggcggaaagttagctgcttgg 311
           ||||||||||||||| ||||||||||||||||||| ||||| |||||| |||||||||||
Sbjct: 706 ggccataaacccatattgcttgaggcaagagatgttttgggtggaaaggtagctgcttgg 765

            
Query: 312 a 312
           |
Sbjct: 766 a 766
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  129 bits (65), Expect = 6e-27
 Identities = 122/141 (86%)
 Strand = Plus / Plus

                                                                           
Query: 71      tctgcaggttgtttgccaagattttccaaggcctccacttgaaaacacagttaactattt 130
               |||||||||||||||||| || |||||||| |||||||| ||||||||| | |||| |||
Sbjct: 4392033 tctgcaggttgtttgccaggactttccaagacctccactagaaaacacaataaacttttt 4392092

                                                                           
Query: 131     ggaagctggccagctttcttcatcgtttagaggcagtgaacgccccagtaaaccattaca 190
               ||||||||| || || |||||||  || |||  ||||||||  |||| ||||||||||||
Sbjct: 4392093 ggaagctggacaactatcttcatttttcagaaacagtgaacaacccactaaaccattaca 4392152

                                    
Query: 191     ggtcgtgattgctggtgcagg 211
               ||||||||||||||| |||||
Sbjct: 4392153 ggtcgtgattgctggagcagg 4392173



 Score =  103 bits (52), Expect = 3e-19
 Identities = 76/84 (90%)
 Strand = Plus / Plus

                                                                           
Query: 216     gctggtctatcaactgcaaaatacctggcagatgctggccataaacccatagtgcttgag 275
               |||||| ||||||| |||||||| |||||||||||||| |||||||||||| ||||||||
Sbjct: 4392292 gctggtttatcaacggcaaaatatctggcagatgctggtcataaacccatattgcttgag 4392351

                                       
Query: 276     gcaagagatgtcttgggcggaaag 299
               ||||| ||||| ||||| ||||||
Sbjct: 4392352 gcaagggatgttttgggtggaaag 4392375
to top
>gb|AC079633.9|AC079633 Genomic Sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBa0032G08, from Chromosome 3, complete sequence
          Length = 122052

 Score =  129 bits (65), Expect = 6e-27
 Identities = 122/141 (86%)
 Strand = Plus / Minus

                                                                         
Query: 71    tctgcaggttgtttgccaagattttccaaggcctccacttgaaaacacagttaactattt 130
             |||||||||||||||||| || |||||||| |||||||| ||||||||| | |||| |||
Sbjct: 34464 tctgcaggttgtttgccaggactttccaagacctccactagaaaacacaataaacttttt 34405

                                                                         
Query: 131   ggaagctggccagctttcttcatcgtttagaggcagtgaacgccccagtaaaccattaca 190
             ||||||||| || || |||||||  || |||  ||||||||  |||| ||||||||||||
Sbjct: 34404 ggaagctggacaactatcttcatttttcagaaacagtgaacaacccactaaaccattaca 34345

                                  
Query: 191   ggtcgtgattgctggtgcagg 211
             ||||||||||||||| |||||
Sbjct: 34344 ggtcgtgattgctggagcagg 34324



 Score =  103 bits (52), Expect = 3e-19
 Identities = 76/84 (90%)
 Strand = Plus / Minus

                                                                         
Query: 216   gctggtctatcaactgcaaaatacctggcagatgctggccataaacccatagtgcttgag 275
             |||||| ||||||| |||||||| |||||||||||||| |||||||||||| ||||||||
Sbjct: 34205 gctggtttatcaacggcaaaatatctggcagatgctggtcataaacccatattgcttgag 34146

                                     
Query: 276   gcaagagatgtcttgggcggaaag 299
             ||||| ||||| ||||| ||||||
Sbjct: 34145 gcaagggatgttttgggtggaaag 34122
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  129 bits (65), Expect = 6e-27
 Identities = 122/141 (86%)
 Strand = Plus / Plus

                                                                           
Query: 71      tctgcaggttgtttgccaagattttccaaggcctccacttgaaaacacagttaactattt 130
               |||||||||||||||||| || |||||||| |||||||| ||||||||| | |||| |||
Sbjct: 4392148 tctgcaggttgtttgccaggactttccaagacctccactagaaaacacaataaacttttt 4392207

                                                                           
Query: 131     ggaagctggccagctttcttcatcgtttagaggcagtgaacgccccagtaaaccattaca 190
               ||||||||| || || |||||||  || |||  ||||||||  |||| ||||||||||||
Sbjct: 4392208 ggaagctggacaactatcttcatttttcagaaacagtgaacaacccactaaaccattaca 4392267

                                    
Query: 191     ggtcgtgattgctggtgcagg 211
               ||||||||||||||| |||||
Sbjct: 4392268 ggtcgtgattgctggagcagg 4392288



 Score =  103 bits (52), Expect = 3e-19
 Identities = 76/84 (90%)
 Strand = Plus / Plus

                                                                           
Query: 216     gctggtctatcaactgcaaaatacctggcagatgctggccataaacccatagtgcttgag 275
               |||||| ||||||| |||||||| |||||||||||||| |||||||||||| ||||||||
Sbjct: 4392407 gctggtttatcaacggcaaaatatctggcagatgctggtcataaacccatattgcttgag 4392466

                                       
Query: 276     gcaagagatgtcttgggcggaaag 299
               ||||| ||||| ||||| ||||||
Sbjct: 4392467 gcaagggatgttttgggtggaaag 4392490
to top
>gb|AY062039.1| Hordeum vulgare phytoene desaturase mRNA, partial cds; nuclear gene
           for chromoplast product
          Length = 1215

 Score =  103 bits (52), Expect = 3e-19
 Identities = 55/56 (98%)
 Strand = Plus / Plus

                                                                   
Query: 257 taaacccatagtgcttgaggcaagagatgtcttgggcggaaagttagctgcttgga 312
           |||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   taaacccatattgcttgaggcaagagatgtcttgggcggaaagttagctgcttgga 56
to top
>gb|M64704.1|SOYPHYDES Soybean phytoene desaturase mRNA, complete cds
          Length = 2293

 Score = 85.7 bits (43), Expect = 8e-14
 Identities = 79/91 (86%)
 Strand = Plus / Plus

                                                                       
Query: 193 tcgtgattgctggtgcaggactggctggtctatcaactgcaaaatacctggcagatgctg 252
           |||| ||||| ||||||||| |||||||| ||||||||||||||||  |||| |||||||
Sbjct: 522 tcgttattgccggtgcaggattggctggtttatcaactgcaaaatatttggctgatgctg 581

                                          
Query: 253 gccataaacccatagtgcttgaggcaagaga 283
           | |||||||| ||| |||| || ||||||||
Sbjct: 582 ggcataaacctatattgctggaagcaagaga 612
to top
>gb|DQ222429.1| Daucus carota subsp. sativus phytoene desaturase (PDS) mRNA,
           complete cds
          Length = 2206

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 117/142 (82%)
 Strand = Plus / Plus

                                                                       
Query: 171 cgccccagtaaaccattacaggtcgtgattgctggtgcaggactggctggtctatcaact 230
           ||||||| |||||||||| | || || ||||||||||| ||  |||||||| |||| |||
Sbjct: 549 cgccccaataaaccattaaatgttgtcattgctggtgctggtttggctggtttatctact 608

                                                                       
Query: 231 gcaaaatacctggcagatgctggccataaacccatagtgcttgaggcaagagatgtcttg 290
           ||||||||  ||||||||||||| || || |||||| || | || || ||||||||  | 
Sbjct: 609 gcaaaatatttggcagatgctggtcacaagcccatattgttggaagcgagagatgttctt 668

                                 
Query: 291 ggcggaaagttagctgcttgga 312
           ||||||||| | ||||||||||
Sbjct: 669 ggcggaaaggtggctgcttgga 690
to top
>gb|DQ469932.1| Nicotiana benthamiana phytoene desaturase mRNA, complete cds
          Length = 1761

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 96/115 (83%)
 Strand = Plus / Plus

                                                                       
Query: 198 attgctggtgcaggactggctggtctatcaactgcaaaatacctggcagatgctggccat 257
           ||||||||||||||  ||| |||| | || || |||||||| |||||||||||||| || 
Sbjct: 343 attgctggtgcaggtttgggtggtttgtctacagcaaaatatctggcagatgctggtcac 402

                                                                  
Query: 258 aaacccatagtgcttgaggcaagagatgtcttgggcggaaagttagctgcttgga 312
           ||||| ||| |||| ||||||||||||||| | || || ||| ||||||| ||||
Sbjct: 403 aaaccgatattgctggaggcaagagatgtcctaggtgggaaggtagctgcatgga 457
to top
>gb|AY822065.1| Prunus armeniaca phytoene desaturase mRNA, complete cds
          Length = 2155

 Score = 75.8 bits (38), Expect = 7e-11
 Identities = 92/110 (83%)
 Strand = Plus / Plus

                                                                       
Query: 190 aggtcgtgattgctggtgcaggactggctggtctatcaactgcaaaatacctggcagatg 249
           ||||||||||||||||||||||  ||||||||||  |||||||||||||  |||| ||||
Sbjct: 484 aggtcgtgattgctggtgcaggtttggctggtcttgcaactgcaaaatatttggctgatg 543

                                                             
Query: 250 ctggccataaacccatagtgcttgaggcaagagatgtcttgggcggaaag 299
           | || |||||||| ||  | || || |||||||||||  | |||||||||
Sbjct: 544 caggtcataaacctatcttactggaagcaagagatgttctaggcggaaag 593
to top
>gb|AC147484.21| Medicago truncatula clone mth2-52b4, complete sequence
          Length = 119559

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 66/76 (86%)
 Strand = Plus / Minus

                                                                        
Query: 208  caggactggctggtctatcaactgcaaaatacctggcagatgctggccataaacccatag 267
            |||||||||||||| | ||||||||||||||  ||||||||||||| || || || ||| 
Sbjct: 4393 caggactggctggtttgtcaactgcaaaatatttggcagatgctggtcacaagcctatat 4334

                            
Query: 268  tgcttgaggcaagaga 283
            |||| |||||||||||
Sbjct: 4333 tgctggaggcaagaga 4318
to top
>ref|NM_117498.2| Arabidopsis thaliana PDS3 (PHYTOENE DESATURASE) AT4G14210 (PDS3)
           transcript variant AT4G14210.1 mRNA, complete cds
          Length = 1999

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 95/115 (82%)
 Strand = Plus / Plus

                                                                       
Query: 198 attgctggtgcaggactggctggtctatcaactgcaaaatacctggcagatgctggccat 257
           ||||||||||| ||| |||||||  | ||||||||||| |||||||| ||||| ||||| 
Sbjct: 422 attgctggtgctggattggctggattgtcaactgcaaagtacctggctgatgcaggccac 481

                                                                  
Query: 258 aaacccatagtgcttgaggcaagagatgtcttgggcggaaagttagctgcttgga 312
           |||||  |  ||||||| |||||||||||  | || |||||| ||||||| ||||
Sbjct: 482 aaacctctgttgcttgaagcaagagatgttcttggtggaaagatagctgcatgga 536
to top
>ref|NM_202816.1| Arabidopsis thaliana PDS3 (PHYTOENE DESATURASE) AT4G14210 (PDS3)
           transcript variant AT4G14210.2 mRNA, complete cds
          Length = 1999

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 95/115 (82%)
 Strand = Plus / Plus

                                                                       
Query: 198 attgctggtgcaggactggctggtctatcaactgcaaaatacctggcagatgctggccat 257
           ||||||||||| ||| |||||||  | ||||||||||| |||||||| ||||| ||||| 
Sbjct: 422 attgctggtgctggattggctggattgtcaactgcaaagtacctggctgatgcaggccac 481

                                                                  
Query: 258 aaacccatagtgcttgaggcaagagatgtcttgggcggaaagttagctgcttgga 312
           |||||  |  ||||||| |||||||||||  | || |||||| ||||||| ||||
Sbjct: 482 aaacctctgttgcttgaagcaagagatgttcttggtggaaagatagctgcatgga 536
to top
>gb|AY040007.1| Arabidopsis thaliana phytoene dehydrogenase precursor protein
           (At4g14210) mRNA, complete cds
          Length = 1701

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 95/115 (82%)
 Strand = Plus / Plus

                                                                       
Query: 198 attgctggtgcaggactggctggtctatcaactgcaaaatacctggcagatgctggccat 257
           ||||||||||| ||| |||||||  | ||||||||||| |||||||| ||||| ||||| 
Sbjct: 289 attgctggtgctggattggctggattgtcaactgcaaagtacctggctgatgcaggccac 348

                                                                  
Query: 258 aaacccatagtgcttgaggcaagagatgtcttgggcggaaagttagctgcttgga 312
           |||||  |  ||||||| |||||||||||  | || |||||| ||||||| ||||
Sbjct: 349 aaacctctgttgcttgaagcaagagatgttcttggtggaaagatagctgcatgga 403
to top
>gb|AF360196.1| Arabidopsis thaliana putative phytoene dehydrogenase precursor
           (At4g14210) mRNA, complete cds
          Length = 1980

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 95/115 (82%)
 Strand = Plus / Plus

                                                                       
Query: 198 attgctggtgcaggactggctggtctatcaactgcaaaatacctggcagatgctggccat 257
           ||||||||||| ||| |||||||  | ||||||||||| |||||||| ||||| ||||| 
Sbjct: 420 attgctggtgctggattggctggattgtcaactgcaaagtacctggctgatgcaggccac 479

                                                                  
Query: 258 aaacccatagtgcttgaggcaagagatgtcttgggcggaaagttagctgcttgga 312
           |||||  |  ||||||| |||||||||||  | || |||||| ||||||| ||||
Sbjct: 480 aaacctctgttgcttgaagcaagagatgttcttggtggaaagatagctgcatgga 534
to top
>gb|AY057669.1| Arabidopsis thaliana AT4g14210/dl3145c mRNA, complete cds
          Length = 1867

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 95/115 (82%)
 Strand = Plus / Plus

                                                                       
Query: 198 attgctggtgcaggactggctggtctatcaactgcaaaatacctggcagatgctggccat 257
           ||||||||||| ||| |||||||  | ||||||||||| |||||||| ||||| ||||| 
Sbjct: 308 attgctggtgctggattggctggattgtcaactgcaaagtacctggctgatgcaggccac 367

                                                                  
Query: 258 aaacccatagtgcttgaggcaagagatgtcttgggcggaaagttagctgcttgga 312
           |||||  |  ||||||| |||||||||||  | || |||||| ||||||| ||||
Sbjct: 368 aaacctctgttgcttgaagcaagagatgttcttggtggaaagatagctgcatgga 422
to top
>gb|AF364515.1|AF364515 Citrus x paradisi phytoene desaturase mRNA, complete cds
          Length = 1944

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                      
Query: 198 attgctggtgcaggactggctggtctatcaactgcaaaatacctggcagatgctggcca 256
           ||||||||||||||  |||||||| ||||||||||||||||  |||||||||| |||||
Sbjct: 418 attgctggtgcaggtttggctggtttatcaactgcaaaatatttggcagatgcaggcca 476
to top
>emb|BX828059.1|CNS0A3WA Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH49ZB06 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1901

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 95/115 (82%)
 Strand = Plus / Plus

                                                                       
Query: 198 attgctggtgcaggactggctggtctatcaactgcaaaatacctggcagatgctggccat 257
           ||||||||||| ||| |||||||  | ||||||||||| |||||||| ||||| ||||| 
Sbjct: 377 attgctggtgctggattggctggattgtcaactgcaaagtacctggctgatgcaggccac 436

                                                                  
Query: 258 aaacccatagtgcttgaggcaagagatgtcttgggcggaaagttagctgcttgga 312
           |||||  |  ||||||| |||||||||||  | || |||||| ||||||| ||||
Sbjct: 437 aaacctctgttgcttgaagcaagagatgttcttggtggaaagatagctgcatgga 491
to top
>gb|DQ235261.1| Citrus sinensis phytoene desaturase mRNA, complete cds
          Length = 1662

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                      
Query: 198 attgctggtgcaggactggctggtctatcaactgcaaaatacctggcagatgctggcca 256
           ||||||||||||||  |||||||| ||||||||||||||||  |||||||||| |||||
Sbjct: 253 attgctggtgcaggtttggctggtttatcaactgcaaaatatttggcagatgcaggcca 311
to top
>emb|AJ319761.1|CSI319761 Citrus sinensis mRNA for phytoene desaturase (pds gene)
          Length = 1919

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                      
Query: 198 attgctggtgcaggactggctggtctatcaactgcaaaatacctggcagatgctggcca 256
           ||||||||||||||  |||||||| ||||||||||||||||  |||||||||| |||||
Sbjct: 403 attgctggtgcaggtttggctggtttatcaactgcaaaatatttggcagatgcaggcca 461
to top
>gb|L16237.1|ATHPHYDES Arabidopsis thaliana phytoene desaturase mRNA, complete cds
          Length = 1952

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 95/115 (82%)
 Strand = Plus / Plus

                                                                       
Query: 198 attgctggtgcaggactggctggtctatcaactgcaaaatacctggcagatgctggccat 257
           ||||||||||| ||| |||||||  | ||||||||||| |||||||| ||||| ||||| 
Sbjct: 416 attgctggtgctggattggctggattgtcaactgcaaagtacctggctgatgcaggccac 475

                                                                  
Query: 258 aaacccatagtgcttgaggcaagagatgtcttgggcggaaagttagctgcttgga 312
           |||||  |  ||||||| |||||||||||  | || |||||| ||||||| ||||
Sbjct: 476 aaacctctgttgcttgaagcaagagatgttcttggtggaaagatagctgcatgga 530
to top
>dbj|AB046992.1| Citrus unshiu CitPDS1 mRNA for phytoene desaturase, complete cds
          Length = 2075

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                      
Query: 198 attgctggtgcaggactggctggtctatcaactgcaaaatacctggcagatgctggcca 256
           ||||||||||||||  |||||||| ||||||||||||||||  |||||||||| |||||
Sbjct: 473 attgctggtgcaggtttggctggtttatcaactgcaaaatatttggcagatgcaggcca 531
to top
>gb|AY494790.1| Momordica charantia var. abbreviata phytoene desaturase (PDS) mRNA,
           complete cds
          Length = 1731

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 195 gtgattgctggtgcaggactggctggtctatcaactgcaaaatacctggcagatgctggc 254
           ||||| |||||||||||| | |||||| ||||||| ||||||||  ||||||||||||||
Sbjct: 322 gtgatcgctggtgcaggattagctggtttatcaacagcaaaatatttggcagatgctggc 381

             
Query: 255 ca 256
           ||
Sbjct: 382 ca 383
to top
>gb|AY639658.1| Hydrilla verticillata phytoene desaturase mRNA, complete cds
          Length = 2003

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 79/95 (83%)
 Strand = Plus / Plus

                                                                       
Query: 198 attgctggtgcaggactggctggtctatcaactgcaaaatacctggcagatgctggccat 257
           ||||||||||||||  |||||||||| ||||| ||||| || || |||||||| || || 
Sbjct: 342 attgctggtgcaggtttggctggtctttcaacagcaaagtatctcgcagatgcagggcac 401

                                              
Query: 258 aaacccatagtgcttgaggcaagagatgtcttggg 292
           | ||||||| | || ||||| |||||||| |||||
Sbjct: 402 atacccatactactggaggctagagatgtattggg 436
to top
>gb|S36691.1| Lycopersicon esculentum phytoene desaturase (pds) mRNA, complete
           cds
          Length = 2391

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 94/115 (81%)
 Strand = Plus / Plus

                                                                       
Query: 198 attgctggtgcaggactggctggtctatcaactgcaaaatacctggcagatgctggccat 257
           ||||||||||||||  ||| |||| | || || ||||||||  ||||||||||||| || 
Sbjct: 790 attgctggtgcaggtttgggtggtttgtctacagcaaaatatttggcagatgctggtcac 849

                                                                  
Query: 258 aaacccatagtgcttgaggcaagagatgtcttgggcggaaagttagctgcttgga 312
           ||||| ||| |||| |||||||| |||||  | || |||||| ||||||| ||||
Sbjct: 850 aaaccgatactgctggaggcaagggatgttctaggtggaaaggtagctgcatgga 904
to top
>emb|X59948.1|LEPDS L.esculentum mRNA for phytoene desaturase
          Length = 2346

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 94/115 (81%)
 Strand = Plus / Plus

                                                                       
Query: 198 attgctggtgcaggactggctggtctatcaactgcaaaatacctggcagatgctggccat 257
           ||||||||||||||  ||| |||| | || || ||||||||  ||||||||||||| || 
Sbjct: 745 attgctggtgcaggtttgggtggtttgtctacagcaaaatatttggcagatgctggtcac 804

                                                                  
Query: 258 aaacccatagtgcttgaggcaagagatgtcttgggcggaaagttagctgcttgga 312
           ||||| ||| |||| |||||||| |||||  | || |||||| ||||||| ||||
Sbjct: 805 aaaccgatactgctggaggcaagggatgttctaggtggaaaggtagctgcatgga 859
to top
>emb|X68058.1|CAPDS1 C.annuum pds1 mRNA for phytoene desaturase
          Length = 1929

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 94/115 (81%)
 Strand = Plus / Plus

                                                                       
Query: 198 attgctggtgcaggactggctggtctatcaactgcaaaatacctggcagatgctggccat 257
           ||||||||||||||  ||| |||| | || || ||||||||  ||||||||||||| || 
Sbjct: 343 attgctggtgcaggtttgggtggtttgtctacagcaaaatatttggcagatgctggtcac 402

                                                                  
Query: 258 aaacccatagtgcttgaggcaagagatgtcttgggcggaaagttagctgcttgga 312
           ||||| ||| |||| |||||||| |||||  | || |||||| ||||||| ||||
Sbjct: 403 aaaccaatactgctggaggcaagggatgttctaggtggaaaggtagctgcatgga 457
to top
>gb|M88683.1|TOMPHYTDES Lycopersicon esculentum phytoene desaturase (pds) mRNA, complete
           cds
          Length = 2321

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 94/115 (81%)
 Strand = Plus / Plus

                                                                       
Query: 198 attgctggtgcaggactggctggtctatcaactgcaaaatacctggcagatgctggccat 257
           ||||||||||||||  ||| |||| | || || ||||||||  ||||||||||||| || 
Sbjct: 663 attgctggtgcaggtttgggtggtttgtctacagcaaaatatttggcagatgctggtcac 722

                                                                  
Query: 258 aaacccatagtgcttgaggcaagagatgtcttgggcggaaagttagctgcttgga 312
           ||||| ||| |||| |||||||| |||||  | || |||||| ||||||| ||||
Sbjct: 723 aaaccgatactgctggaggcaagggatgttctaggtggaaaggtagctgcatgga 777
to top
>dbj|AB205049.1| Chrysanthemum x morifolium PDS mRNA for phytoene desaturase,
           complete cds
          Length = 2085

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 60/70 (85%)
 Strand = Plus / Plus

                                                                       
Query: 193 tcgtgattgctggtgcaggactggctggtctatcaactgcaaaatacctggcagatgctg 252
           |||| |||||||||||||| || |||||| ||||||||||||| ||  |||| |||||||
Sbjct: 367 tcgtcattgctggtgcaggtctcgctggtttatcaactgcaaagtatttggctgatgctg 426

                     
Query: 253 gccataaacc 262
           | || |||||
Sbjct: 427 gtcacaaacc 436
to top
>emb|Z97335.2|ATFCA0 Arabidopsis thaliana DNA chromosome 4, ESSA I FCA contig fragment No. 0
          Length = 200576

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                          
Query: 206    tgcaggactggctggtctatcaactgcaaaatacctggcagatgctggccataaacccat 265
              ||||||| |||||||  | ||||||||||| |||||||| ||||| ||||| |||||  |
Sbjct: 152182 tgcaggattggctggattgtcaactgcaaagtacctggctgatgcaggccacaaacctct 152123

                                   
Query: 266    agtgcttgaggcaagagatgt 286
                ||||||| |||||||||||
Sbjct: 152122 gttgcttgaagcaagagatgt 152102
to top
>emb|AL161538.2|ATCHRIV38 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 38
          Length = 198944

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                         
Query: 206   tgcaggactggctggtctatcaactgcaaaatacctggcagatgctggccataaacccat 265
             ||||||| |||||||  | ||||||||||| |||||||| ||||| ||||| |||||  |
Sbjct: 91730 tgcaggattggctggattgtcaactgcaaagtacctggctgatgcaggccacaaacctct 91671

                                  
Query: 266   agtgcttgaggcaagagatgt 286
               ||||||| |||||||||||
Sbjct: 91670 gttgcttgaagcaagagatgt 91650
to top
>gb|AY484445.1| Solanum tuberosum phytoene desaturase (pds) mRNA, partial cds;
           nuclear gene for chromoplast product
          Length = 1614

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 93/115 (80%)
 Strand = Plus / Plus

                                                                       
Query: 198 attgctggtgcaggactggctggtctatcaactgcaaaatacctggcagatgctggccat 257
           ||||||||||||||  ||| |||| | || || ||||||||  ||||||||||||| || 
Sbjct: 347 attgctggtgcaggtttgggtggtttgtctacagcaaaatatttggcagatgctggtcac 406

                                                                  
Query: 258 aaacccatagtgcttgaggcaagagatgtcttgggcggaaagttagctgcttgga 312
           ||||| ||| | || |||||||| |||||  | || |||||| ||||||| ||||
Sbjct: 407 aaaccgatactactggaggcaagggatgttctaggtggaaaggtagctgcatgga 461
to top
>emb|X78815.1|NPMPTD N.pseudonarcissus mRNA for phytoene desaturase
          Length = 1965

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 89/110 (80%)
 Strand = Plus / Plus

                                                                       
Query: 203 tggtgcaggactggctggtctatcaactgcaaaatacctggcagatgctggccataaacc 262
           |||||||||  ||||||| ||||| ||||||||||| || || || || || ||||||||
Sbjct: 368 tggtgcaggcttggctggactatctactgcaaaatatcttgctgacgcaggtcataaacc 427

                                                             
Query: 263 catagtgcttgaggcaagagatgtcttgggcggaaagttagctgcttgga 312
            ||| | || ||| ||||||||||  |||| || ||| | ||||||||||
Sbjct: 428 gatattactggagtcaagagatgttctgggaggcaagattgctgcttgga 477
to top
>emb|X71023.1|LEPDSG Lycopersicon esculentum pds gene for phytoene desaturase
          Length = 8258

 Score = 48.1 bits (24), Expect = 0.017
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                    
Query: 231  gcaaaatacctggcagatgctggccataaacccatagtgcttgaggcaagagatgt 286
            ||||||||  ||||||||||||| || ||||| ||| |||| |||||||| |||||
Sbjct: 2275 gcaaaatatttggcagatgctggtcacaaaccgatactgctggaggcaagggatgt 2330
to top
>emb|X78271.1|LEPDSGEN L.esculentum (Ailsa Craig) PDS gene
          Length = 8943

 Score = 48.1 bits (24), Expect = 0.017
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                    
Query: 231  gcaaaatacctggcagatgctggccataaacccatagtgcttgaggcaagagatgt 286
            ||||||||  ||||||||||||| || ||||| ||| |||| |||||||| |||||
Sbjct: 2604 gcaaaatatttggcagatgctggtcacaaaccgatactgctggaggcaagggatgt 2659
to top
>ref|NM_100549.2| Arabidopsis thaliana unknown protein AT1G06720 mRNA, complete cds
          Length = 3657

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 141 cagctttcttcatcgtttagag 162
           ||||||||||||||||||||||
Sbjct: 8   cagctttcttcatcgtttagag 29
to top
>gb|AY768691.1| Haematococcus pluvialis phytoene desaturase (PDS) gene, complete
           cds
          Length = 3306

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 229 ctgcaaaatacctggcagatgc 250
           ||||||||||||||||||||||
Sbjct: 260 ctgcaaaatacctggcagatgc 281
to top
>gb|AF251014.1|AF251014 Tagetes erecta phytoene desaturase mRNA, complete cds
          Length = 1861

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 70/86 (81%)
 Strand = Plus / Plus

                                                                       
Query: 198 attgctggtgcaggactggctggtctatcaactgcaaaatacctggcagatgctggccat 257
           ||||||||||||||  |||||||| |||| ||||| || ||  |||| |||||||| || 
Sbjct: 322 attgctggtgcaggtttggctggtttatccactgctaagtatttggctgatgctggtcac 381

                                     
Query: 258 aaacccatagtgcttgaggcaagaga 283
           ||||| ||  |||||||  |||||||
Sbjct: 382 aaacctattttgcttgaatcaagaga 407
to top
>dbj|AB028666.1| Gentiana lutea HGENPDS mRNA for phytoene desaturase, complete cds
          Length = 2204

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 106/134 (79%)
 Strand = Plus / Plus

                                                                       
Query: 179 taaaccattacaggtcgtgattgctggtgcaggactggctggtctatcaactgcaaaata 238
           |||||||||| |||| || ||||| ||||||||  |||||||| |  | |||||||| ||
Sbjct: 453 taaaccattagaggtggtcattgcgggtgcaggtttggctggtttgactactgcaaagta 512

                                                                       
Query: 239 cctggcagatgctggccataaacccatagtgcttgaggcaagagatgtcttgggcggaaa 298
           | | || ||||| || |||||||| ||  || | || ||||||||||| || || |||||
Sbjct: 513 cttagcggatgcaggtcataaacctattctgttggaagcaagagatgttttaggtggaaa 572

                         
Query: 299 gttagctgcttgga 312
           | | ||||| ||||
Sbjct: 573 ggttgctgcatgga 586
to top
>gb|AC011001.2|AC011001 Arabidopsis thaliana chromosome I BAC F4H5 genomic sequence, complete
             sequence
          Length = 91608

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 141   cagctttcttcatcgtttagag 162
             ||||||||||||||||||||||
Sbjct: 67780 cagctttcttcatcgtttagag 67801
to top
>dbj|AP004940.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT48I11, TM0106,
             complete sequence
          Length = 103636

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 107   acttgaaaacacagttaacta 127
             |||||||||||||||||||||
Sbjct: 95690 acttgaaaacacagttaacta 95710
to top
>gb|CP000285.1| Chromohalobacter salexigens DSM 3043, complete genome
          Length = 3696649

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 54      cgccgtgggcttcgtgctct 73
               ||||||||||||||||||||
Sbjct: 1082476 cgccgtgggcttcgtgctct 1082457
to top
>ref|XM_545126.2| PREDICTED: Canis familiaris similar to F-box only protein 40 (Muscle
            disease-related protein) (LOC488004), mRNA
          Length = 3781

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 71   tctgcaggttgtttgccaagattttcca 98
            |||||| |||||||||||||||| ||||
Sbjct: 2938 tctgcatgttgtttgccaagattctcca 2911
to top
>emb|AL365400.19| Human DNA sequence from clone RP11-471G13 on chromosome Xq21.32-22.1
              Contains a novel pseudogene,  a heterogeneous nuclear
              ribonucleoprotein D-like (HNRPDL) pseudogene and a
              ribosomal protein S7 (RPS7) pseudogene, complete sequence
          Length = 176391

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 219    ggtctatcaactgcaaaata 238
              ||||||||||||||||||||
Sbjct: 167792 ggtctatcaactgcaaaata 167773
to top
>gb|AY196092.1| Lycopersicon esculentum metal transporter mRNA, complete cds
          Length = 1530

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 146 ttcttcatcgtttagaggca 165
           ||||||||||||||||||||
Sbjct: 21  ttcttcatcgtttagaggca 2
to top
>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome
          Length = 7074893

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 53      acgccgtgggcttcgtgctc 72
               ||||||||||||||||||||
Sbjct: 6157463 acgccgtgggcttcgtgctc 6157482
to top
>gb|AC107486.4| Homo sapiens BAC clone RP11-814I21 from 4, complete sequence
          Length = 59463

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 112   aaaacacagttaactatttg 131
             ||||||||||||||||||||
Sbjct: 56451 aaaacacagttaactatttg 56470
to top
>gb|AC067940.5| Homo sapiens BAC clone RP11-818E9 from 2, complete sequence
          Length = 148267

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 105   ccacttgaaaacacagttaa 124
             ||||||||||||||||||||
Sbjct: 78720 ccacttgaaaacacagttaa 78739
to top
>emb|BX470088.11| Zebrafish DNA sequence from clone DKEY-171E12 in linkage group 7,
             complete sequence
          Length = 102546

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 63    cttcgtgctctgcaggttgtttgc 86
             |||| |||||||||||||||||||
Sbjct: 70779 cttcctgctctgcaggttgtttgc 70756
to top
>emb|BX957286.14| Zebrafish DNA sequence from clone CH211-119B12 in linkage group 20,
             complete sequence
          Length = 161104

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 196   tgattgctggtgcaggactggctggtct 223
             |||||| ||||||||||| |||||||||
Sbjct: 61767 tgattgttggtgcaggacaggctggtct 61794
to top
>emb|CR956367.12| Pig DNA sequence from clone PigE-122C21 on chromosome 17, complete
             sequence
          Length = 124577

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 79    ttgtttgccaagattttcca 98
             ||||||||||||||||||||
Sbjct: 53029 ttgtttgccaagattttcca 53010
to top
>dbj|AB028665.1| Gentiana lutea SGENPDS mRNA for phytoene desaturase, complete cds
          Length = 2180

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 107 acttgaaaacacagttaactatttggaagctg 138
           |||||| ||||| || ||||||||||||||||
Sbjct: 375 acttgacaacactgtcaactatttggaagctg 406


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,693,795
Number of Sequences: 3902068
Number of extensions: 2693795
Number of successful extensions: 44694
Number of sequences better than 10.0: 55
Number of HSP's better than 10.0 without gapping: 55
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 44554
Number of HSP's gapped (non-prelim): 139
length of query: 312
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 290
effective length of database: 17,147,199,772
effective search space: 4972687933880
effective search space used: 4972687933880
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top