ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baak4j20
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC118240.8| Mus musculus chromosome 16, clone RP23-186J5, com... 44 0.50
2gb|AC145600.6| Mus musculus BAC clone RP24-220P24 from chromosom... 42 2.0
3gb|AC186631.1| Mus musculus chromosome Y clone RP24-297J24, comp... 42 2.0
4gb|AC185132.1| Mus musculus BAC clone RP24-109C1 from chromosome... 42 2.0
5gb|AC183977.3| Mus musculus BAC clone RP24-70E20 from chromosome... 42 2.0
6gb|AC175388.3| Mus musculus BAC clone RP24-128B7 from chromosome... 42 2.0
7gb|AC145588.3| Mus musculus BAC clone RP24-170B7 from chromosome... 42 2.0
8gb|AC147257.5| Mus musculus BAC clone RP24-169I1 from chromosome... 42 2.0
9gb|AC140341.5| Mus musculus BAC clone RP24-261P21 from chromosom... 42 2.0
10gb|AC145598.5| Mus musculus BAC clone RP24-324I11 from chromosom... 42 2.0
11gb|AC134531.3| Mus musculus BAC clone RP24-528F18 from chromosom... 42 2.0
12gb|AC131783.4| Mus musculus BAC clone RP24-377P12 from chromosom... 42 2.0
13gb|AC145582.4| Mus musculus BAC clone RP24-357M16 from chromosom... 42 2.0
14gb|AC129209.4| Mus musculus BAC clone RP24-318B5 from chromosome... 42 2.0
15gb|AC148322.2| Mus musculus BAC clone RP24-467F9 from chromosome... 42 2.0
16gb|AC131763.4| Mus musculus BAC clone RP24-231M1 from chromosome... 42 2.0
17gb|AC127572.3| Mus musculus BAC clone RP24-231A11 from chromosom... 42 2.0
18gb|AC134850.5| Mus musculus BAC clone RP24-218A17 from chromosom... 42 2.0
19gb|AC147105.2| Mus musculus BAC clone RP24-66E5 from chromosome ... 42 2.0
20gb|AC147253.3| Mus musculus BAC clone RP24-134K1 from chromosome... 42 2.0
21gb|AC147111.2| Mus musculus BAC clone RP24-111K19 from chromosom... 42 2.0
22gb|AC140401.4| Mus musculus BAC clone RP24-89O8 from chromosome ... 42 2.0
23gb|AC145569.3| Mus musculus BAC clone RP24-89N16 from chromosome... 42 2.0
24gb|AC145602.3| Mus musculus BAC clone RP24-240M7 from chromosome... 42 2.0
25gb|AC147265.2| Mus musculus BAC clone RP24-233K2 from chromosome... 42 2.0
26gb|AC144937.3| Mus musculus BAC clone RP24-295J2 from chromosome... 42 2.0
27gb|AC129210.3| Mus musculus BAC clone RP24-331P3 from chromosome... 42 2.0
28gb|AC144934.3| Mus musculus BAC clone RP24-327C7 from chromosome... 42 2.0
29gb|AC148325.2| Mus musculus BAC clone RP24-407P18 from chromosom... 42 2.0
30gb|AC129289.4| Mus musculus BAC clone RP24-482E11 from chromosom... 42 2.0
31gb|AC182487.1| Mus musculus BAC clone RP24-104A17 from chromosom... 42 2.0
32gb|AC175390.2| Mus musculus BAC clone RP24-108F5 from chromosome... 42 2.0
33gb|AC182456.2| Mus musculus BAC clone RP24-65H21 from chromosome... 42 2.0
34gb|AC185964.1| Mus musculus chromosome UNK clone CH33-204D11, co... 42 2.0
35gb|AC185963.1| Mus musculus chromosome UNK clone CH26-87M2, comp... 42 2.0
36gb|AC140335.3| Mus musculus BAC clone RP24-64C18 from chromosome... 42 2.0
37gb|AC145299.3| Mus musculus BAC clone RP24-129J23 from chromosom... 42 2.0
38gb|AC140435.3| Mus musculus BAC clone RP24-172H21 from chromosom... 42 2.0
39gb|AC140255.4| Mus musculus BAC clone RP24-291E19 from chromosom... 42 2.0
40gb|AC144650.2| Mus musculus BAC clone RP24-241E24 from chromosom... 42 2.0
41gb|AC131768.4| Mus musculus BAC clone RP24-289C2 from chromosome... 42 2.0
42gb|AC142226.3| Mus musculus BAC clone RP24-243A16 from chromosom... 42 2.0
43gb|AC144647.3| Mus musculus BAC clone RP24-369F17 from chromosom... 42 2.0
44gb|AC140423.2| Mus musculus BAC clone RP24-446B23 from chromosom... 42 2.0
45gb|AC145561.4| Mus musculus BAC clone RP24-61J10 from chromosome... 42 2.0
46gb|AC145292.2| Mus musculus BAC clone RP24-84H20 from chromosome... 42 2.0
47gb|AC145302.4| Mus musculus BAC clone RP24-89K13 from chromosome... 42 2.0
48gb|AC130834.4| Mus musculus BAC clone RP24-119M1 from chromosome... 42 2.0
49gb|AC130836.4| Mus musculus BAC clone RP24-147P10 from chromosom... 42 2.0
50gb|AC145268.3| Mus musculus BAC clone RP24-147I6 from chromosome... 42 2.0
51gb|AC140450.4| Mus musculus BAC clone RP24-164A12 from chromosom... 42 2.0
52gb|AC140405.4| Mus musculus BAC clone RP24-176I18 from chromosom... 42 2.0
53gb|AC144626.3| Mus musculus BAC clone RP24-187E8 from chromosome... 42 2.0
54gb|AC144856.2| Mus musculus BAC clone RP24-185C22 from chromosom... 42 2.0
55gb|AC140390.1| Mus musculus BAC clone RP24-207C7 from chromosome... 42 2.0
56gb|AC134568.3| Mus musculus BAC clone RP24-217M17 from chromosom... 42 2.0
57gb|AC131188.4| Mus musculus BAC clone RP24-272N18 from chromosom... 42 2.0
58gb|AC132301.4| Mus musculus BAC clone RP24-277F20 from chromosom... 42 2.0
59gb|AC133603.3| Mus musculus BAC clone RP24-282H21 from chromosom... 42 2.0
60gb|AC141877.3| Mus musculus BAC clone RP24-280M5 from chromosome... 42 2.0
61gb|AC125127.4| Mus musculus BAC clone RP24-286E4 from chromosome... 42 2.0
62gb|AC136975.2| Mus musculus BAC clone RP24-403M20 from chromosom... 42 2.0
63gb|AC132309.4| Mus musculus BAC clone RP24-294K17 from chromosom... 42 2.0
64gb|AC133082.3| Mus musculus BAC clone RP24-298C1 from chromosome... 42 2.0
65gb|AC135807.3| Mus musculus BAC clone RP24-303J7 from chromosome... 42 2.0
66gb|AC144851.3| Mus musculus BAC clone RP24-329H15 from chromosom... 42 2.0
67gb|AC141470.4| Mus musculus BAC clone RP24-566E24 from chromosom... 42 2.0
68gb|AC142253.3| Mus musculus BAC clone RP24-555O3 from chromosome... 42 2.0
69gb|AC141472.4| Mus musculus BAC clone RP24-335E13 from chromosom... 42 2.0
70ref|XM_743698.1| Aspergillus fumigatus Af293 hypothetical protei... 42 2.0
71gb|AC004605.1|HUAC004605 Homo sapiens Chromosome 16 BAC clone CI... 42 2.0
72gb|AC177804.3| Mus musculus BAC clone RP24-223C7 from chromosome... 42 2.0
73gb|AC184108.1| Mus musculus chromosome UNK clone CH26-73N11, com... 42 2.0
74gb|AC181981.2| Mus musculus BAC clone RP24-56E16 from chromosome... 42 2.0
75gb|AC177805.2| Mus musculus BAC clone RP24-82J12 from chromosome... 42 2.0
76gb|AC175387.3| Mus musculus BAC clone RP24-166B21 from chromosom... 42 2.0
77gb|AC182488.3| Mus musculus BAC clone RP24-65I16 from chromosome... 42 2.0
78gb|AC182040.3| Mus musculus BAC clone RP24-26M10 from chromosome... 42 2.0
79gb|AC182038.2| Mus musculus BAC clone RP24-95H15 from chromosome... 42 2.0
80gb|AC173705.5| Mus musculus BAC clone RP24-244N11 from chromosom... 42 2.0
81gb|AC181982.2| Mus musculus BAC clone RP24-36K1 from chromosome ... 42 2.0
82gb|AC181978.2| Mus musculus BAC clone RP24-394P22 from chromosom... 42 2.0
83gb|AC174478.3| Mus musculus BAC clone RP24-72B9 from chromosome ... 42 2.0
84emb|AL954772.23| Zebrafish DNA sequence from clone CH211-262E4, ... 42 2.0
85gb|AC182426.3| Mus musculus BAC clone RP24-81E19 from chromosome... 42 2.0
86gb|AC182366.4| Mus musculus BAC clone RP24-360I14 from chromosom... 42 2.0
87gb|AC175382.3| Mus musculus BAC clone RP24-188F12 from chromosom... 42 2.0
88gb|AC179923.2| Mus musculus BAC clone RP24-358L1 from chromosome... 42 2.0
89gb|AC182761.2| Mus musculus BAC clone RP24-91P5 from chromosome ... 42 2.0
90gb|AC182555.2| Mus musculus BAC clone RP24-89D11 from chromosome... 42 2.0
91gb|AC175491.3| Mus musculus BAC clone RP24-90O21 from chromosome... 42 2.0
92gb|AC182447.2| Mus musculus BAC clone RP24-476M3 from chromosome... 42 2.0
93gb|AC182036.2| Mus musculus BAC clone RP24-120L13 from chromosom... 42 2.0
94gb|AC175666.3| Mus musculus BAC clone RP24-350M1 from chromosome... 42 2.0
95gb|AC182446.2| Mus musculus BAC clone RP24-518O14 from chromosom... 42 2.0
96gb|AC182554.2| Mus musculus BAC clone RP24-307C8 from chromosome... 42 2.0
97gb|AC175386.3| Mus musculus BAC clone RP24-165A24 from chromosom... 42 2.0
98gb|AC174475.4| Mus musculus BAC clone RP24-169K6 from chromosome... 42 2.0
99gb|AC182034.2| Mus musculus BAC clone RP24-188M3 from chromosome... 42 2.0
100gb|AC182230.1| Mus musculus BAC clone RP24-72K10 from chromosome... 42 2.0
101gb|AC182111.1| Mus musculus BAC clone RP24-415L2 from chromosome... 42 2.0
102gb|AC174234.4| Mus musculus BAC clone RP24-50H9 from chromosome ... 42 2.0
103gb|AC175391.3| Mus musculus BAC clone RP24-92G16 from chromosome... 42 2.0
104gb|AF157290.1|AF157290 Rhizopus stolonifer translation elongatio... 42 2.0
105gb|AC175317.3| Mus musculus BAC clone RP24-65G8 from chromosome ... 42 2.0
106gb|AC175672.2| Mus musculus BAC clone RP24-254K21 from chromosom... 42 2.0
107gb|AC175817.2| Mus musculus BAC clone RP24-518C3 from chromosome... 42 2.0
108gb|AC145567.5| Mus musculus BAC clone RP24-89I11 from chromosome... 42 2.0
109gb|AC073909.25| Homo sapiens X BAC RP11-759L5 (Roswell Park Canc... 42 2.0
110gb|AC175384.2| Mus musculus BAC clone RP24-168P1 from chromosome... 42 2.0
111gb|AC174381.2| Mus musculus BAC clone RP24-206F6 from chromosome... 42 2.0
112gb|AC138627.1| Homo sapiens chromosome 16 clone RP11-42H13, comp... 42 2.0
113gb|AC175708.2| Mus musculus BAC clone RP24-136K15 from chromosom... 42 2.0
114gb|AC175383.2| Mus musculus BAC clone RP24-194E10 from chromosom... 42 2.0
115gb|AC175748.1| Mus musculus chromosome Y clone RP24-269D6, compl... 42 2.0
116gb|AC175316.1| Mus musculus BAC clone RP24-346L16 from chromosom... 42 2.0
117gb|AC127548.4| Mus musculus BAC clone RP24-505K1 from chromosome... 42 2.0
118gb|AC148320.3| Mus musculus BAC clone RP24-555B2 from chromosome... 42 2.0
119gb|AC173997.2| Mus musculus BAC clone RP24-190A13 from chromosom... 42 2.0
120gb|AC145584.4| Mus musculus BAC clone RP24-355G24 from Y, comple... 42 2.0
121gb|AC145594.5| Mus musculus BAC clone RP24-188N2 from Y, complet... 42 2.0
122gb|AC145265.2| Mus musculus BAC clone RP24-209D17 from Y, comple... 42 2.0
123gb|AC145514.3| Mus musculus BAC clone RP24-254D6 from Y, complet... 42 2.0
124gb|AC147167.3| Mus musculus BAC clone RP24-291I16 from Y, comple... 42 2.0
125gb|AC142269.4| Mus musculus BAC clone RP24-112B7 from Y, complet... 42 2.0
126gb|AC147630.4| Mus musculus BAC clone RP24-530L22 from Y, comple... 42 2.0
127gb|AC147249.3| Mus musculus BAC clone RP24-85J13 from Y, complet... 42 2.0
128gb|AC004087.1|AC004087 Homo sapiens Xp22 GSHB-314C4 (Genome Syst... 42 2.0
129gb|AC156161.3| Mus musculus BAC clone RP24-403M10 from chromosom... 42 2.0
130ref|NM_120349.2| Arabidopsis thaliana unknown protein AT5G02710 ... 40 7.7
131gb|AC152821.5| Mus musculus BAC clone RP24-366H21 from chromosom... 40 7.7
132gb|AC150658.7| Mus musculus BAC clone RP24-474E20 from chromosom... 40 7.7
133gb|AC140680.4| Mus musculus BAC clone RP24-548A12 from chromosom... 40 7.7
134gb|AC132276.4| Mus musculus BAC clone RP24-344B8 from chromosome... 40 7.7
135gb|AC147260.3| Mus musculus BAC clone RP24-186L11 from chromosom... 40 7.7
136ref|XM_881232.1| PREDICTED: Bos taurus similar to dynamin 2 isof... 40 7.7
137ref|XM_881213.1| PREDICTED: Bos taurus similar to dynamin 2 isof... 40 7.7
138ref|XM_881199.1| PREDICTED: Bos taurus similar to dynamin 2 isof... 40 7.7
139ref|XM_868043.1| PREDICTED: Bos taurus similar to dynamin 2 isof... 40 7.7
140ref|XM_881170.1| PREDICTED: Bos taurus similar to dynamin 2 isof... 40 7.7
141ref|XM_589076.2| PREDICTED: Bos taurus similar to dynamin 2 isof... 40 7.7
142ref|XM_881134.1| PREDICTED: Bos taurus similar to dynamin 2 isof... 40 7.7
143ref|XM_881115.1| PREDICTED: Bos taurus similar to dynamin 2 isof... 40 7.7
144ref|XM_881098.1| PREDICTED: Bos taurus similar to dynamin 2 isof... 40 7.7
145ref|XM_881084.1| PREDICTED: Bos taurus similar to dynamin 2 isof... 40 7.7
146ref|XM_881069.1| PREDICTED: Bos taurus similar to dynamin 2 isof... 40 7.7
147ref|XM_881051.1| PREDICTED: Bos taurus similar to dynamin 2 isof... 40 7.7
148ref|XM_881031.1| PREDICTED: Bos taurus similar to dynamin 2 isof... 40 7.7
149ref|XM_881016.1| PREDICTED: Bos taurus similar to dynamin 2 isof... 40 7.7
150ref|XM_880999.1| PREDICTED: Bos taurus similar to dynamin 2 isof... 40 7.7
151ref|XM_880979.1| PREDICTED: Bos taurus similar to dynamin 2 isof... 40 7.7
152ref|XM_880959.1| PREDICTED: Bos taurus similar to dynamin 2 isof... 40 7.7
153ref|XM_880938.1| PREDICTED: Bos taurus similar to dynamin 2 isof... 40 7.7
154ref|XM_880920.1| PREDICTED: Bos taurus similar to dynamin 2 isof... 40 7.7
155ref|XM_880900.1| PREDICTED: Bos taurus similar to dynamin 2 isof... 40 7.7
156ref|XM_880880.1| PREDICTED: Bos taurus similar to dynamin 2 isof... 40 7.7
157ref|XM_880862.1| PREDICTED: Bos taurus similar to dynamin 2 isof... 40 7.7
158ref|XM_880844.1| PREDICTED: Bos taurus similar to dynamin 2 isof... 40 7.7
159ref|XM_880823.1| PREDICTED: Bos taurus similar to dynamin 2 isof... 40 7.7
160ref|XM_880804.1| PREDICTED: Bos taurus similar to dynamin 2 isof... 40 7.7
161ref|XM_880786.1| PREDICTED: Bos taurus similar to dynamin 2 isof... 40 7.7
162ref|XM_880770.1| PREDICTED: Bos taurus similar to dynamin 2 isof... 40 7.7
163ref|XM_880755.1| PREDICTED: Bos taurus similar to dynamin 2 isof... 40 7.7
164ref|XM_880733.1| PREDICTED: Bos taurus similar to dynamin 2 isof... 40 7.7
165ref|XM_880709.1| PREDICTED: Bos taurus similar to dynamin 2 isof... 40 7.7
166ref|XM_880687.1| PREDICTED: Bos taurus similar to dynamin 2 isof... 40 7.7
167ref|XM_880660.1| PREDICTED: Bos taurus similar to dynamin 2 isof... 40 7.7
168ref|XM_880637.1| PREDICTED: Bos taurus similar to dynamin 2 isof... 40 7.7
169ref|XM_880611.1| PREDICTED: Bos taurus similar to dynamin 2 isof... 40 7.7
170ref|XM_880590.1| PREDICTED: Bos taurus similar to dynamin 2 isof... 40 7.7
171ref|XM_880569.1| PREDICTED: Bos taurus similar to dynamin 2 isof... 40 7.7
172ref|XM_880550.1| PREDICTED: Bos taurus similar to dynamin 2 isof... 40 7.7
173ref|XM_880525.1| PREDICTED: Bos taurus similar to dynamin 2 isof... 40 7.7
174ref|XM_880510.1| PREDICTED: Bos taurus similar to dynamin 2 isof... 40 7.7
175ref|XM_880486.1| PREDICTED: Bos taurus similar to dynamin 2 isof... 40 7.7
176gb|AC158704.3| Microcebus murinus clone CH257-434D18, complete s... 40 7.7
177gb|AC145562.5| Mus musculus BAC clone RP24-67L21 from chromosome... 40 7.7
178gb|AC147268.5| Mus musculus BAC clone RP24-263J19 from chromosom... 40 7.7
179gb|AC147109.2| Mus musculus BAC clone RP24-75P8 from chromosome ... 40 7.7
180gb|AC147107.2| Mus musculus BAC clone RP24-69F17 from chromosome... 40 7.7
181gb|AC147252.4| Mus musculus BAC clone RP24-116A5 from chromosome... 40 7.7
182gb|AC145570.3| Mus musculus BAC clone RP24-95K23 from chromosome... 40 7.7
183gb|AC147372.3| Mus musculus BAC clone RP24-212L10 from chromosom... 40 7.7
184gb|AC144849.2| Mus musculus BAC clone RP24-482B19 from chromosom... 40 7.7
185gb|AC147135.2| Mus musculus BAC clone RP24-475E12 from chromosom... 40 7.7
186gb|AC175743.2| Mus musculus BAC clone RP24-44F3 from chromosome ... 40 7.7
187gb|AC183975.1| Mus musculus BAC clone RP24-352C21 from chromosom... 40 7.7
188gb|AY811942.1| Schistosoma japonicum SJCHGC05212 protein mRNA, p... 40 7.7
189gb|AC141875.4| Mus musculus BAC clone RP24-316O22 from chromosom... 40 7.7
190gb|AC132283.4| Mus musculus BAC clone RP24-351L16 from chromosom... 40 7.7
191gb|AC140678.2| Mus musculus BAC clone RP24-553I16 from chromosom... 40 7.7
192gb|AC145552.3| Mus musculus BAC clone RP24-573I22 from chromosom... 40 7.7
193gb|AC139297.4| Mus musculus BAC clone RP24-62H18 from chromosome... 40 7.7
194gb|AC140348.4| Mus musculus BAC clone RP24-66K20 from chromosome... 40 7.7
195gb|AC129191.4| Mus musculus BAC clone RP24-81F10 from chromosome... 40 7.7
196gb|AC140386.4| Mus musculus BAC clone RP24-88H19 from chromosome... 40 7.7
197gb|AC145270.3| Mus musculus BAC clone RP24-97H23 from chromosome... 40 7.7
198gb|AC134567.4| Mus musculus BAC clone RP24-199C24 from chromosom... 40 7.7
199gb|AC140473.3| Mus musculus BAC clone RP24-405H7 from chromosome... 40 7.7
200gb|AC135808.4| Mus musculus BAC clone RP24-316N5 from chromosome... 40 7.7
201gb|AC147156.2| Mus musculus BAC clone RP24-343M19 from chromosom... 40 7.7
202gb|AC132336.3| Mus musculus BAC clone RP24-230N9 from chromosome... 40 7.7
203gb|AC125400.4| Mus musculus BAC clone RP24-380E10 from chromosom... 40 7.7
204emb|Z92808.2|CEM04C3 Caenorhabditis elegans Cosmid M04C3, comple... 40 7.7
205ref|XM_949884.1| Theileria annulata strain Ankara sporozoite sur... 40 7.7
206gb|AC011294.3| Homo sapiens BAC clone RP11-95J15 from 7, complet... 40 7.7
207ref|XM_727891.1| Plasmodium chabaudi chabaudi hypothetical prote... 40 7.7
208ref|XM_731038.1| Plasmodium chabaudi chabaudi structure specific... 40 7.7
209ref|XM_668809.1| Plasmodium berghei strain ANKA hypothetical pro... 40 7.7
210ref|XM_675282.1| Plasmodium berghei strain ANKA structure specif... 40 7.7
211emb|CR391962.5| Zebrafish DNA sequence from clone CH211-215K15 i... 40 7.7
212gb|AC184149.2| Mus musculus BAC clone RP24-143K6 from chromosome... 40 7.7
213emb|AL132775.29|HSDJ46C2 Human DNA sequence from clone RP1-46C2 ... 40 7.7
214gb|AC158946.4| Mus musculus chromosome 1, clone RP24-267F8, comp... 40 7.7
215gb|AC182483.3| Mus musculus BAC clone RP24-458L18 from chromosom... 40 7.7
216emb|AL162971.1|ATT22P11 Arabidopsis thaliana DNA chromosome 5, B... 40 7.7
217emb|AL162973.1|ATF9G14 Arabidopsis thaliana DNA chromosome 5, BA... 40 7.7
218emb|AJ246003.1|HSA246003 Homo sapiens Spast gene for spastin pro... 40 7.7
219gb|AC184107.1| Mus musculus chromosome UNK clone CH33-213P12, co... 40 7.7
220gb|DQ301694.1| Thanatephorus cucumeris strain TO4 translation el... 40 7.7
221gb|DQ301693.1| Thanatephorus cucumeris strain TO1 translation el... 40 7.7
222gb|DQ301689.1| Thanatephorus cucumeris strain SJ07 translation e... 40 7.7
223gb|DQ301688.1| Thanatephorus cucumeris strain SJ02 translation e... 40 7.7
224gb|DQ301673.1| Thanatephorus cucumeris strain AG-7 translation e... 40 7.7
225gb|DQ301672.1| Thanatephorus cucumeris strain AG-6HGI translatio... 40 7.7
226gb|DQ301669.1| Thanatephorus cucumeris strain AG-4HGII translati... 40 7.7
227gb|DQ301668.1| Thanatephorus cucumeris strain AG-4HGI translatio... 40 7.7
228gb|DQ301656.1| Ceratobasidium sp. CBS 438.80 translation elongat... 40 7.7
229gb|DQ301654.1| Ceratobasidium sp. CBS 189.90 translation elongat... 40 7.7
230gb|DQ301650.1| Ceratobasidium sp. CBS 139.82 translation elongat... 40 7.7
231gb|DQ301648.1| Ceratobasidium sp. CBS 136.82 translation elongat... 40 7.7
232gb|DQ301647.1| Ceratobasidium sp. CBS 135.82 translation elongat... 40 7.7
233gb|DQ301646.1| Ceratobasidium sp. CBS 133.82 translation elongat... 40 7.7
234gb|DQ301640.1| Ceratobasidium sp. AG-P translation elongation fa... 40 7.7
235gb|AC142261.5| Mus musculus BAC clone RP24-469C3 from chromosome... 40 7.7
236gb|AC182449.4| Mus musculus BAC clone RP24-361G20 from chromosom... 40 7.7
237gb|AC175056.3| Mus musculus BAC clone RP24-212M24 from chromosom... 40 7.7
238gb|AC183526.2| Mus musculus BAC clone RP24-121M8 from chromosome... 40 7.7
239gb|AC177798.3| Mus musculus BAC clone RP24-456H11 from chromosom... 40 7.7
240gb|AC182763.2| Mus musculus BAC clone RP24-56N19 from chromosome... 40 7.7
241gb|AC175671.2| Mus musculus BAC clone RP24-313O14 from chromosom... 40 7.7
242gb|AC177800.3| Mus musculus BAC clone RP24-323K10 from chromosom... 40 7.7
243dbj|AP007169.1| Aspergillus oryzae RIB40 genomic DNA, SC038 40 7.7
244gb|AC174806.2| Mus musculus BAC clone RP24-526I8 from chromosome... 40 7.7
245gb|AC183416.2| Mus musculus BAC clone RP24-68E17 from chromosome... 40 7.7
246gb|AC177799.3| Mus musculus BAC clone RP24-374O22 from chromosom... 40 7.7
247gb|AC175120.3| Mus musculus BAC clone RP24-26J9 from chromosome ... 40 7.7
248gb|AC175526.4| Mus musculus BAC clone RP24-84E22 from chromosome... 40 7.7
249gb|BC104493.1| Bos taurus cDNA clone IMAGE:7957075, partial cds 40 7.7
250gb|AC090744.5| Homo sapiens chromosome 11, clone RP11-660K15, co... 40 7.7
251gb|AC174641.3| Mus musculus BAC clone RP24-406C15 from chromosom... 40 7.7
252dbj|AK220584.1| Arabidopsis thaliana mRNA for hypothetical prote... 40 7.7
253gb|AY054553.1| Arabidopsis thaliana putative protein (At5g02710;... 40 7.7
254gb|AC068329.8| Homo sapiens chromosome 11, clone RP11-82N10, com... 40 7.7
255gb|AC175462.3| Mus musculus BAC clone RP24-24E12 from chromosome... 40 7.7
256gb|AC175053.3| Mus musculus BAC clone RP24-272H23 from chromosom... 40 7.7
257gb|AC147264.5| Mus musculus BAC clone RP24-225P12 from chromosom... 40 7.7
258ref|NM_001020972.1| Schizosaccharomyces pombe 972h- hypothetical... 40 7.7
259gb|AC175662.3| Mus musculus BAC clone RP24-425D4 from chromosome... 40 7.7
260gb|AF157269.1|AF157269 Mucor ramosissimus translation elongation... 40 7.7
261gb|AF157265.1|AF157265 Mucor hiemalis f. hiemalis translation el... 40 7.7
262gb|AF157304.1|AF157304 Zygorhynchus heterogamus translation elon... 40 7.7
263gb|AF157297.1|AF157297 Thamnidium elegans translation elongation... 40 7.7
264gb|AF157293.1|AF157293 Sporodiniella umbellata translation elong... 40 7.7
265gb|AF157292.1|AF157292 Spinellus fusiger translation elongation ... 40 7.7
266gb|AF157278.1|AF157278 Pirella circinans translation elongation ... 40 7.7
267gb|AF157276.1|AF157276 Pilaira anomala translation elongation fa... 40 7.7
268gb|AF157270.1|AF157270 Mucor recurvus var. indicus translation e... 40 7.7
269gb|AF157268.1|AF157268 Mucor racemosus translation elongation fa... 40 7.7
270gb|AF157267.1|AF157267 Mucor mucedo translation elongation facto... 40 7.7
271gb|AF157257.1|AF157257 Kirkomyces cordense translation elongatio... 40 7.7
272gb|AF157256.1|AF157256 Hyphomucor assamensis translation elongat... 40 7.7
273gb|AF157254.1|AF157254 Helicostylum elegans translation elongati... 40 7.7
274gb|AF157246.1|AF157246 Dicranophora fulva translation elongation... 40 7.7
275gb|AF157242.1|AF157242 Cokeromyces recurvatus translation elonga... 40 7.7
276gb|AF157234.1|AF157234 Benjaminiella poitrasii translation elong... 40 7.7
277gb|AF157232.1|AF157232 Backusella circina translation elongation... 40 7.7
278gb|AF157225.1|AF157225 Absidia blakesleeana translation elongati... 40 7.7
279ref|NM_075383.4| Caenorhabditis elegans M04C3.2 (M04C3.2) mRNA, ... 40 7.7
280gb|AC174442.3| Mus musculus BAC clone RP24-542K12 from chromosom... 40 7.7
281gb|AC175247.2| Mus musculus BAC clone RP24-217L22 from chromosom... 40 7.7
282emb|BX832970.1|CNS0A1R2 Arabidopsis thaliana Full-length cDNA Co... 40 7.7
283gb|AY743665.1| Ambomucor seriatoinflatus translation elongation ... 40 7.7
284gb|AC145558.5| Mus musculus BAC clone RP24-502L18 from Y, comple... 40 7.7
285gb|AC007564.10| Homo sapiens 12 BAC RP11-513P18 (Roswell Park Ca... 40 7.7
286gb|AC012364.7| Homo sapiens BAC clone RP11-444D15 from 2, comple... 40 7.7
287gb|AC133041.3| Homo sapiens 3 BAC CTD-2026G6 (Cal Tech Human BAC... 40 7.7
288gb|AC048380.12| Homo sapiens chromosome 18, clone RP11-426J5, co... 40 7.7
289gb|AC175709.2| Mus musculus BAC clone RP24-7D4 from chromosome y... 40 7.7
290gb|AC174451.3| Mus musculus BAC clone RP23-182A1 from chromosome... 40 7.7
291gb|AC142166.6| Mus musculus BAC clone RP24-455G9 from chromosome... 40 7.7
292gb|AC134255.4| Mus musculus BAC clone RP24-81J5 from chromosome ... 40 7.7
293dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ... 40 7.7
294gb|AC147627.6| Mus musculus BAC clone RP24-382F19 from Y, comple... 40 7.7
295emb|AL121658.4|CNS01DS8 BAC sequence from the SPG4 candidate reg... 40 7.7
296emb|AL355920.1|SPBC1683 Schizosaccharomyces pombe cosmids c1683 40 7.7
297dbj|AP006196.1| Homo sapiens genomic DNA, chromosome 6, clone:RP... 40 7.7
298dbj|AP006195.1| Homo sapiens genomic DNA, chromosome 6, clone:RP... 40 7.7
299gb|AC145373.4| Mus musculus BAC clone RP24-155N24 from Y, comple... 40 7.7
300gb|AC150659.3| Mus musculus BAC clone RP24-147D24 from Y, comple... 40 7.7
301gb|AC148329.3| Mus musculus BAC clone RP24-176F13 from Y, comple... 40 7.7
302gb|AE017221.1| Thermus thermophilus HB27, complete genome 40 7.7
303gb|AC140215.2| Mus musculus BAC clone RP24-268F7 from Y, complet... 40 7.7
304gb|AC140296.4| Mus musculus BAC clone RP24-313K7 from Y, complet... 40 7.7
305gb|AC137982.3| Mus musculus BAC clone RP24-313G24 from Y, comple... 40 7.7
306gb|AC147183.3| Mus musculus BAC clone RP24-373J6 from Y, complet... 40 7.7
307gb|AC140434.3| Mus musculus BAC clone RP24-105G15 from 3, comple... 40 7.7
308gb|AC149597.4| Mus musculus BAC clone RP24-90B12 from Y, complet... 40 7.7
309gb|DP000022.1| Microcebus murinus target 1 genomic scaffold 40 7.7
310gb|AC165336.4| Mus musculus BAC clone RP24-470O8 from chromosome... 40 7.7
311gb|U33010.1|SPU33010 Schizosaccharomyces pombe cosmids 359, 1198... 40 7.7
312gb|U33009.1|SPU33009 Schizosaccharomyces pombe cosmid 1683 40 7.7
313gb|U33008.1|SPU33008 Schizosaccharomyces pombe cosmid 1198 40 7.7
314emb|AL356438.15| Human DNA sequence from clone RP11-347H8 on chr... 40 7.7
315emb|AL606536.13| Mouse DNA sequence from clone RP23-93C9 on chro... 40 7.7
316gb|J02605.1|MRATEF1A M.racemosus TEF-1 gene encoding elongation ... 40 7.7
317gb|M63017.1|THESPAGI Theileria annulata sporozoite surface antig... 40 7.7
318gb|AC167358.2| Mus musculus BAC clone RP24-406G23 from chromosom... 40 7.7
319dbj|AP002529.1| Homo sapiens genomic DNA, chromosome 6q21, anti-... 40 7.7
320dbj|AB042031.1| Homo sapiens genomic DNA, chromosome 6q21, BAC c... 40 7.7
321emb|AL121655.1|CNS01DS5 BAC sequence from the SPG4 candidate reg... 40 7.7

>gb|AC118240.8| Mus musculus chromosome 16, clone RP23-186J5, complete sequence
          Length = 222869

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 440    caataaaccatcctccttggga 461
              ||||||||||||||||||||||
Sbjct: 132808 caataaaccatcctccttggga 132829



to top

>gb|AC145600.6| Mus musculus BAC clone RP24-220P24 from chromosome y, complete
            sequence
          Length = 171542

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 412  actctccagatatagaggatg 432
            |||||||||||||||||||||
Sbjct: 7696 actctccagatatagaggatg 7676



to top

>gb|AC186631.1| Mus musculus chromosome Y clone RP24-297J24, complete sequence
          Length = 162588

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 99720 actctccagatatagaggatg 99740



to top

>gb|AC185132.1| Mus musculus BAC clone RP24-109C1 from chromosome y, complete
            sequence
          Length = 169136

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 412  actctccagatatagaggatg 432
            |||||||||||||||||||||
Sbjct: 2216 actctccagatatagaggatg 2196



to top

>gb|AC183977.3| Mus musculus BAC clone RP24-70E20 from chromosome y, complete sequence
          Length = 210508

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 13482 actctccagatatagaggatg 13462



to top

>gb|AC175388.3| Mus musculus BAC clone RP24-128B7 from chromosome y, complete sequence
          Length = 145957

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 25464 actctccagatatagaggatg 25444



to top

>gb|AC145588.3| Mus musculus BAC clone RP24-170B7 from chromosome Y, complete sequence
          Length = 189141

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 127882 actctccagatatagaggatg 127902



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 412    actctccagatatagaggat 431
              ||||||||||||||||||||
Sbjct: 172518 actctccagatatagaggat 172499



to top

>gb|AC147257.5| Mus musculus BAC clone RP24-169I1 from chromosome Y, complete
            sequence
          Length = 170420

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 412  actctccagatatagaggatg 432
            |||||||||||||||||||||
Sbjct: 3875 actctccagatatagaggatg 3895



to top

>gb|AC140341.5| Mus musculus BAC clone RP24-261P21 from chromosome Y, complete sequence
          Length = 167722

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 79523 actctccagatatagaggatg 79543



to top

>gb|AC145598.5| Mus musculus BAC clone RP24-324I11 from chromosome Y, complete sequence
          Length = 225035

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 106514 actctccagatatagaggatg 106494



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 412   actctccagatatagaggat 431
             ||||||||||||||||||||
Sbjct: 61992 actctccagatatagaggat 62011



to top

>gb|AC134531.3| Mus musculus BAC clone RP24-528F18 from chromosome Y, complete sequence
          Length = 130027

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 107883 actctccagatatagaggatg 107903



to top

>gb|AC131783.4| Mus musculus BAC clone RP24-377P12 from chromosome Y, complete sequence
          Length = 223801

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 140142 actctccagatatagaggatg 140162



to top

>gb|AC145582.4| Mus musculus BAC clone RP24-357M16 from chromosome Y, complete sequence
          Length = 165663

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 137757 actctccagatatagaggatg 137777



to top

>gb|AC129209.4| Mus musculus BAC clone RP24-318B5 from chromosome Y, complete sequence
          Length = 177935

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 140382 actctccagatatagaggatg 140402



to top

>gb|AC148322.2| Mus musculus BAC clone RP24-467F9 from chromosome Y, complete sequence
          Length = 140999

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 23167 actctccagatatagaggatg 23147



to top

>gb|AC131763.4| Mus musculus BAC clone RP24-231M1 from chromosome Y, complete sequence
          Length = 152276

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 124994 actctccagatatagaggatg 124974



to top

>gb|AC127572.3| Mus musculus BAC clone RP24-231A11 from chromosome Y, complete sequence
          Length = 134145

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 20752 actctccagatatagaggatg 20772



to top

>gb|AC134850.5| Mus musculus BAC clone RP24-218A17 from chromosome Y, complete sequence
          Length = 144592

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 133545 actctccagatatagaggatg 133565



to top

>gb|AC147105.2| Mus musculus BAC clone RP24-66E5 from chromosome Y, complete sequence
          Length = 223344

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 208111 actctccagatatagaggatg 208091



to top

>gb|AC147253.3| Mus musculus BAC clone RP24-134K1 from chromosome Y, complete sequence
          Length = 183653

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 35727 actctccagatatagaggatg 35747



to top

>gb|AC147111.2| Mus musculus BAC clone RP24-111K19 from chromosome Y, complete sequence
          Length = 181226

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 65596 actctccagatatagaggatg 65616



to top

>gb|AC140401.4| Mus musculus BAC clone RP24-89O8 from chromosome Y, complete sequence
          Length = 244637

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 48373 actctccagatatagaggatg 48353



to top

>gb|AC145569.3| Mus musculus BAC clone RP24-89N16 from chromosome Y, complete sequence
          Length = 204741

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 153045 actctccagatatagaggatg 153025



to top

>gb|AC145602.3| Mus musculus BAC clone RP24-240M7 from chromosome Y, complete sequence
          Length = 160337

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 99555 actctccagatatagaggatg 99575



to top

>gb|AC147265.2| Mus musculus BAC clone RP24-233K2 from chromosome Y, complete sequence
          Length = 171430

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 75653 actctccagatatagaggatg 75673



to top

>gb|AC144937.3| Mus musculus BAC clone RP24-295J2 from chromosome Y, complete sequence
          Length = 149196

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 106113 actctccagatatagaggatg 106133



to top

>gb|AC129210.3| Mus musculus BAC clone RP24-331P3 from chromosome Y, complete sequence
          Length = 151295

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 91172 actctccagatatagaggatg 91192



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 412    actctccagatatagaggat 431
              ||||||||||||||||||||
Sbjct: 135718 actctccagatatagaggat 135699



to top

>gb|AC144934.3| Mus musculus BAC clone RP24-327C7 from chromosome Y, complete sequence
          Length = 194335

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 118207 actctccagatatagaggatg 118227



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 412    actctccagatatagaggat 431
              ||||||||||||||||||||
Sbjct: 162844 actctccagatatagaggat 162825



to top

>gb|AC148325.2| Mus musculus BAC clone RP24-407P18 from chromosome Y, complete sequence
          Length = 133083

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 92699 actctccagatatagaggatg 92719



to top

>gb|AC129289.4| Mus musculus BAC clone RP24-482E11 from chromosome Y, complete sequence
          Length = 181755

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 113622 actctccagatatagaggatg 113642



to top

>gb|AC182487.1| Mus musculus BAC clone RP24-104A17 from chromosome y, complete sequence
          Length = 190120

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 174313 actctccagatatagaggatg 174333



to top

>gb|AC175390.2| Mus musculus BAC clone RP24-108F5 from chromosome y, complete sequence
          Length = 179677

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 60297 actctccagatatagaggatg 60317



to top

>gb|AC182456.2| Mus musculus BAC clone RP24-65H21 from chromosome y, complete sequence
          Length = 194102

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 144034 actctccagatatagaggatg 144014



to top

>gb|AC185964.1| Mus musculus chromosome UNK clone CH33-204D11, complete sequence
          Length = 209635

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 35909 actctccagatatagaggatg 35889



to top

>gb|AC185963.1| Mus musculus chromosome UNK clone CH26-87M2, complete sequence
          Length = 196014

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 171359 actctccagatatagaggatg 171339



to top

>gb|AC140335.3| Mus musculus BAC clone RP24-64C18 from chromosome Y, complete sequence
          Length = 179371

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 40193 actctccagatatagaggatg 40213



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 412    actctccagatatagaggat 431
              ||||||||||||||||||||
Sbjct: 162092 actctccagatatagaggat 162111



to top

>gb|AC145299.3| Mus musculus BAC clone RP24-129J23 from chromosome Y, complete
            sequence
          Length = 152085

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 412  actctccagatatagaggatg 432
            |||||||||||||||||||||
Sbjct: 2815 actctccagatatagaggatg 2795



to top

>gb|AC140435.3| Mus musculus BAC clone RP24-172H21 from chromosome Y, complete sequence
          Length = 191085

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 143850 actctccagatatagaggatg 143870



to top

>gb|AC140255.4| Mus musculus BAC clone RP24-291E19 from chromosome Y, complete sequence
          Length = 187268

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 50979 actctccagatatagaggatg 50999



to top

>gb|AC144650.2| Mus musculus BAC clone RP24-241E24 from chromosome Y, complete sequence
          Length = 163678

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 117578 actctccagatatagaggatg 117598



to top

>gb|AC131768.4| Mus musculus BAC clone RP24-289C2 from chromosome Y, complete sequence
          Length = 163284

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 11672 actctccagatatagaggatg 11652



to top

>gb|AC142226.3| Mus musculus BAC clone RP24-243A16 from chromosome Y, complete sequence
          Length = 155805

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 133786 actctccagatatagaggatg 133806



to top

>gb|AC144647.3| Mus musculus BAC clone RP24-369F17 from chromosome Y, complete sequence
          Length = 199733

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 101981 actctccagatatagaggatg 102001



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 412    actctccagatatagaggat 431
              ||||||||||||||||||||
Sbjct: 146577 actctccagatatagaggat 146558



to top

>gb|AC140423.2| Mus musculus BAC clone RP24-446B23 from chromosome Y, complete sequence
          Length = 203358

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 143058 actctccagatatagaggatg 143078



to top

>gb|AC145561.4| Mus musculus BAC clone RP24-61J10 from chromosome Y, complete sequence
          Length = 169791

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 62475 actctccagatatagaggatg 62455



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 412   actctccagatatagaggat 431
             ||||||||||||||||||||
Sbjct: 18015 actctccagatatagaggat 18034



to top

>gb|AC145292.2| Mus musculus BAC clone RP24-84H20 from chromosome Y, complete sequence
          Length = 203944

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 106234 actctccagatatagaggatg 106254



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 412    actctccagatatagaggat 431
              ||||||||||||||||||||
Sbjct: 150781 actctccagatatagaggat 150762



to top

>gb|AC145302.4| Mus musculus BAC clone RP24-89K13 from chromosome Y, complete sequence
          Length = 168641

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 60899 actctccagatatagaggatg 60879



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 412   actctccagatatagaggat 431
             ||||||||||||||||||||
Sbjct: 16217 actctccagatatagaggat 16236



to top

>gb|AC130834.4| Mus musculus BAC clone RP24-119M1 from chromosome Y, complete sequence
          Length = 189883

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 12844 actctccagatatagaggatg 12824



to top

>gb|AC130836.4| Mus musculus BAC clone RP24-147P10 from chromosome Y, complete sequence
          Length = 199089

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 70475 actctccagatatagaggatg 70455



to top

>gb|AC145268.3| Mus musculus BAC clone RP24-147I6 from chromosome Y, complete sequence
          Length = 144870

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 43433 actctccagatatagaggatg 43413



to top

>gb|AC140450.4| Mus musculus BAC clone RP24-164A12 from chromosome Y, complete sequence
          Length = 158839

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 78514 actctccagatatagaggatg 78494



to top

>gb|AC140405.4| Mus musculus BAC clone RP24-176I18 from chromosome Y, complete sequence
          Length = 197287

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 74814 actctccagatatagaggatg 74834



to top

>gb|AC144626.3| Mus musculus BAC clone RP24-187E8 from chromosome Y, complete sequence
          Length = 175009

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 119567 actctccagatatagaggatg 119587



to top

>gb|AC144856.2| Mus musculus BAC clone RP24-185C22 from chromosome Y, complete sequence
          Length = 163609

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 57160 actctccagatatagaggatg 57140



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 412   actctccagatatagaggat 431
             ||||||||||||||||||||
Sbjct: 16193 actctccagatatagaggat 16212



to top

>gb|AC140390.1| Mus musculus BAC clone RP24-207C7 from chromosome Y, complete sequence
          Length = 121757

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 30319 actctccagatatagaggatg 30339



to top

>gb|AC134568.3| Mus musculus BAC clone RP24-217M17 from chromosome Y, complete sequence
          Length = 134145

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 122022 actctccagatatagaggatg 122042



to top

>gb|AC131188.4| Mus musculus BAC clone RP24-272N18 from chromosome Y, complete sequence
          Length = 161415

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 72375 actctccagatatagaggatg 72355



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 412   actctccagatatagaggat 431
             ||||||||||||||||||||
Sbjct: 21081 actctccagatatagaggat 21100



to top

>gb|AC132301.4| Mus musculus BAC clone RP24-277F20 from chromosome Y, complete sequence
          Length = 138638

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 56766 actctccagatatagaggatg 56746



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 412   actctccagatatagaggat 431
             ||||||||||||||||||||
Sbjct: 12299 actctccagatatagaggat 12318



to top

>gb|AC133603.3| Mus musculus BAC clone RP24-282H21 from chromosome Y, complete sequence
          Length = 167448

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 165964 actctccagatatagaggatg 165984



to top

>gb|AC141877.3| Mus musculus BAC clone RP24-280M5 from chromosome Y, complete sequence
          Length = 143283

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 77175 actctccagatatagaggatg 77155



to top

>gb|AC125127.4| Mus musculus BAC clone RP24-286E4 from chromosome Y, complete sequence
          Length = 168835

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 140508 actctccagatatagaggatg 140528



to top

>gb|AC136975.2| Mus musculus BAC clone RP24-403M20 from chromosome Y, complete sequence
          Length = 189490

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 20887 actctccagatatagaggatg 20907



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 412    actctccagatatagaggat 431
              ||||||||||||||||||||
Sbjct: 105662 actctccagatatagaggat 105643



to top

>gb|AC132309.4| Mus musculus BAC clone RP24-294K17 from chromosome Y, complete sequence
          Length = 145060

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 118947 actctccagatatagaggatg 118967



to top

>gb|AC133082.3| Mus musculus BAC clone RP24-298C1 from chromosome Y, complete sequence
          Length = 152853

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 75386 actctccagatatagaggatg 75366



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 412   actctccagatatagaggat 431
             ||||||||||||||||||||
Sbjct: 30830 actctccagatatagaggat 30849



to top

>gb|AC135807.3| Mus musculus BAC clone RP24-303J7 from chromosome Y, complete
            sequence
          Length = 158904

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 412  actctccagatatagaggatg 432
            |||||||||||||||||||||
Sbjct: 1606 actctccagatatagaggatg 1586



to top

>gb|AC144851.3| Mus musculus BAC clone RP24-329H15 from chromosome Y, complete sequence
          Length = 171646

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 89333 actctccagatatagaggatg 89313



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 412   actctccagatatagaggat 431
             ||||||||||||||||||||
Sbjct: 44570 actctccagatatagaggat 44589



to top

>gb|AC141470.4| Mus musculus BAC clone RP24-566E24 from chromosome Y, complete
            sequence
          Length = 197634

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 412  actctccagatatagaggatg 432
            |||||||||||||||||||||
Sbjct: 3967 actctccagatatagaggatg 3947



to top

>gb|AC142253.3| Mus musculus BAC clone RP24-555O3 from chromosome Y, complete sequence
          Length = 153917

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 85356 actctccagatatagaggatg 85336



to top

>gb|AC141472.4| Mus musculus BAC clone RP24-335E13 from chromosome Y, complete sequence
          Length = 185021

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 26863 actctccagatatagaggatg 26843



to top

>ref|XM_743698.1| Aspergillus fumigatus Af293 hypothetical protein (Afu7g08240)
           partial mRNA
          Length = 1851

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 311 ctcttgggcaccaggttcgtc 331
           |||||||||||||||||||||
Sbjct: 621 ctcttgggcaccaggttcgtc 601



to top

>gb|AC004605.1|HUAC004605 Homo sapiens Chromosome 16 BAC clone CIT987SK-A-248F7, complete sequence
          Length = 259474

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 244    tgtaaatagaaagatttcctg 264
              |||||||||||||||||||||
Sbjct: 179587 tgtaaatagaaagatttcctg 179607



to top

>gb|AC177804.3| Mus musculus BAC clone RP24-223C7 from chromosome y, complete sequence
          Length = 160566

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 93107 actctccagatatagaggatg 93087



to top

>gb|AC184108.1| Mus musculus chromosome UNK clone CH26-73N11, complete sequence
          Length = 204663

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 73348 actctccagatatagaggatg 73328



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 412   actctccagatatagaggat 431
             ||||||||||||||||||||
Sbjct: 28305 actctccagatatagaggat 28324



to top

>gb|AC181981.2| Mus musculus BAC clone RP24-56E16 from chromosome y, complete
            sequence
          Length = 212637

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 412  actctccagatatagaggatg 432
            |||||||||||||||||||||
Sbjct: 9796 actctccagatatagaggatg 9816



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 412   actctccagatatagaggat 431
             ||||||||||||||||||||
Sbjct: 54270 actctccagatatagaggat 54251



to top

>gb|AC177805.2| Mus musculus BAC clone RP24-82J12 from chromosome y, complete sequence
          Length = 205800

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 160640 actctccagatatagaggatg 160620



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 412   actctccagatatagaggat 431
             ||||||||||||||||||||
Sbjct: 89398 actctccagatatagaggat 89417



to top

>gb|AC175387.3| Mus musculus BAC clone RP24-166B21 from chromosome y, complete sequence
          Length = 163736

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 48710 actctccagatatagaggatg 48730



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 412    actctccagatatagaggat 431
              ||||||||||||||||||||
Sbjct: 113371 actctccagatatagaggat 113352



to top

>gb|AC182488.3| Mus musculus BAC clone RP24-65I16 from chromosome y, complete sequence
          Length = 219054

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 215269 actctccagatatagaggatg 215289



to top

>gb|AC182040.3| Mus musculus BAC clone RP24-26M10 from chromosome y, complete sequence
          Length = 242066

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 140601 actctccagatatagaggatg 140581



to top

>gb|AC182038.2| Mus musculus BAC clone RP24-95H15 from chromosome y, complete sequence
          Length = 183498

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 100921 actctccagatatagaggatg 100901



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 412   actctccagatatagaggat 431
             ||||||||||||||||||||
Sbjct: 49627 actctccagatatagaggat 49646



to top

>gb|AC173705.5| Mus musculus BAC clone RP24-244N11 from chromosome y, complete sequence
          Length = 157985

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 120582 actctccagatatagaggatg 120562



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 412   actctccagatatagaggat 431
             ||||||||||||||||||||
Sbjct: 76316 actctccagatatagaggat 76335



to top

>gb|AC181982.2| Mus musculus BAC clone RP24-36K1 from chromosome y, complete sequence
          Length = 209549

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 59693 actctccagatatagaggatg 59713



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 412    actctccagatatagaggat 431
              ||||||||||||||||||||
Sbjct: 104066 actctccagatatagaggat 104047



to top

>gb|AC181978.2| Mus musculus BAC clone RP24-394P22 from chromosome y, complete sequence
          Length = 165800

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 88898 actctccagatatagaggatg 88918



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 412    actctccagatatagaggat 431
              ||||||||||||||||||||
Sbjct: 133270 actctccagatatagaggat 133251



to top

>gb|AC174478.3| Mus musculus BAC clone RP24-72B9 from chromosome y, complete sequence
          Length = 186313

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 118523 actctccagatatagaggatg 118503



to top

>emb|AL954772.23| Zebrafish DNA sequence from clone CH211-262E4, complete sequence
          Length = 174414

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 338   aacagaaaacaagagaacgcagcat 362
             |||||||||||||||||| ||||||
Sbjct: 24295 aacagaaaacaagagaactcagcat 24271



to top

>gb|AC182426.3| Mus musculus BAC clone RP24-81E19 from chromosome y, complete sequence
          Length = 219905

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 12615 actctccagatatagaggatg 12635



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 412   actctccagatatagaggat 431
             ||||||||||||||||||||
Sbjct: 57205 actctccagatatagaggat 57186



to top

>gb|AC182366.4| Mus musculus BAC clone RP24-360I14 from chromosome y, complete sequence
          Length = 154476

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 132962 actctccagatatagaggatg 132942



to top

>gb|AC175382.3| Mus musculus BAC clone RP24-188F12 from chromosome y, complete sequence
          Length = 163669

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 20747 actctccagatatagaggatg 20727



to top

>gb|AC179923.2| Mus musculus BAC clone RP24-358L1 from chromosome y, complete sequence
          Length = 148977

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 87220 actctccagatatagaggatg 87240



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 412    actctccagatatagaggat 431
              ||||||||||||||||||||
Sbjct: 128203 actctccagatatagaggat 128184



to top

>gb|AC182761.2| Mus musculus BAC clone RP24-91P5 from chromosome y, complete sequence
          Length = 212528

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 12960 actctccagatatagaggatg 12940



to top

>gb|AC182555.2| Mus musculus BAC clone RP24-89D11 from chromosome y, complete sequence
          Length = 257364

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 130390 actctccagatatagaggatg 130370



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 412   actctccagatatagaggat 431
             ||||||||||||||||||||
Sbjct: 85754 actctccagatatagaggat 85773



to top

>gb|AC175491.3| Mus musculus BAC clone RP24-90O21 from chromosome y, complete sequence
          Length = 202657

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 141709 actctccagatatagaggatg 141689



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 412   actctccagatatagaggat 431
             ||||||||||||||||||||
Sbjct: 96938 actctccagatatagaggat 96957



to top

>gb|AC182447.2| Mus musculus BAC clone RP24-476M3 from chromosome y, complete sequence
          Length = 175402

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 133296 actctccagatatagaggatg 133316



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 20650 actctccagatatagaggatg 20670



to top

>gb|AC182036.2| Mus musculus BAC clone RP24-120L13 from chromosome y, complete
            sequence
          Length = 185554

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 412  actctccagatatagaggatg 432
            |||||||||||||||||||||
Sbjct: 6121 actctccagatatagaggatg 6141



to top

>gb|AC175666.3| Mus musculus BAC clone RP24-350M1 from chromosome y, complete sequence
          Length = 196535

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 70977 actctccagatatagaggatg 70957



to top

>gb|AC182446.2| Mus musculus BAC clone RP24-518O14 from chromosome y, complete sequence
          Length = 155144

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 135924 actctccagatatagaggatg 135904



to top

>gb|AC182554.2| Mus musculus BAC clone RP24-307C8 from chromosome y, complete sequence
          Length = 138532

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 43220 actctccagatatagaggatg 43240



to top

>gb|AC175386.3| Mus musculus BAC clone RP24-165A24 from chromosome y, complete
           sequence
          Length = 188252

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 412 actctccagatatagaggatg 432
           |||||||||||||||||||||
Sbjct: 363 actctccagatatagaggatg 343



to top

>gb|AC174475.4| Mus musculus BAC clone RP24-169K6 from chromosome y, complete sequence
          Length = 199928

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 124048 actctccagatatagaggatg 124028



to top

>gb|AC182034.2| Mus musculus BAC clone RP24-188M3 from chromosome y, complete sequence
          Length = 164621

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 162297 actctccagatatagaggatg 162317



to top

>gb|AC182230.1| Mus musculus BAC clone RP24-72K10 from chromosome y, complete sequence
          Length = 164341

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 31600 actctccagatatagaggatg 31620



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 412   actctccagatatagaggat 431
             ||||||||||||||||||||
Sbjct: 76252 actctccagatatagaggat 76233



to top

>gb|AC182111.1| Mus musculus BAC clone RP24-415L2 from chromosome y, complete sequence
          Length = 162320

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 81661 actctccagatatagaggatg 81641



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 412   actctccagatatagaggat 431
             ||||||||||||||||||||
Sbjct: 22561 actctccagatatagaggat 22580



to top

>gb|AC174234.4| Mus musculus BAC clone RP24-50H9 from chromosome y, complete sequence
          Length = 200919

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 181840 actctccagatatagaggatg 181820



to top

>gb|AC175391.3| Mus musculus BAC clone RP24-92G16 from chromosome y, complete sequence
          Length = 239400

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 121076 actctccagatatagaggatg 121056



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 412   actctccagatatagaggat 431
             ||||||||||||||||||||
Sbjct: 36366 actctccagatatagaggat 36385



to top

>gb|AF157290.1|AF157290 Rhizopus stolonifer translation elongation factor 1-alpha
          (EF-1alpha) gene, partial cds
          Length = 1252

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 39 tgagaaggaagctgctgaact 59
          |||||||||||||||||||||
Sbjct: 72 tgagaaggaagctgctgaact 92



to top

>gb|AC175317.3| Mus musculus BAC clone RP24-65G8 from chromosome y, complete sequence
          Length = 199276

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 37384 actctccagatatagaggatg 37404



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 412   actctccagatatagaggat 431
             ||||||||||||||||||||
Sbjct: 81850 actctccagatatagaggat 81831



to top

>gb|AC175672.2| Mus musculus BAC clone RP24-254K21 from chromosome y, complete sequence
          Length = 189044

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 112395 actctccagatatagaggatg 112375



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 412   actctccagatatagaggat 431
             ||||||||||||||||||||
Sbjct: 29891 actctccagatatagaggat 29910



to top

>gb|AC175817.2| Mus musculus BAC clone RP24-518C3 from chromosome y, complete sequence
          Length = 140334

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 31180 actctccagatatagaggatg 31160



to top

>gb|AC145567.5| Mus musculus BAC clone RP24-89I11 from chromosome y, complete sequence
          Length = 228314

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 13700 actctccagatatagaggatg 13680



to top

>gb|AC073909.25| Homo sapiens X BAC RP11-759L5 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 156411

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 433   taagaaacaataaaccatcct 453
             |||||||||||||||||||||
Sbjct: 15149 taagaaacaataaaccatcct 15169



to top

>gb|AC175384.2| Mus musculus BAC clone RP24-168P1 from chromosome y, complete sequence
          Length = 183854

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 79849 actctccagatatagaggatg 79869



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 412    actctccagatatagaggat 431
              ||||||||||||||||||||
Sbjct: 121144 actctccagatatagaggat 121125



to top

>gb|AC174381.2| Mus musculus BAC clone RP24-206F6 from chromosome y, complete sequence
          Length = 172601

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 110343 actctccagatatagaggatg 110323



to top

>gb|AC138627.1| Homo sapiens chromosome 16 clone RP11-42H13, complete sequence
          Length = 170920

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 244    tgtaaatagaaagatttcctg 264
              |||||||||||||||||||||
Sbjct: 117873 tgtaaatagaaagatttcctg 117893



to top

>gb|AC175708.2| Mus musculus BAC clone RP24-136K15 from chromosome y, complete sequence
          Length = 175131

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 173287 actctccagatatagaggatg 173307



to top

>gb|AC175383.2| Mus musculus BAC clone RP24-194E10 from chromosome y, complete sequence
          Length = 172691

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 50475 actctccagatatagaggatg 50455



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 412  actctccagatatagaggat 431
            ||||||||||||||||||||
Sbjct: 5942 actctccagatatagaggat 5961



to top

>gb|AC175748.1| Mus musculus chromosome Y clone RP24-269D6, complete sequence
          Length = 145592

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 45206 actctccagatatagaggatg 45226



to top

>gb|AC175316.1| Mus musculus BAC clone RP24-346L16 from chromosome y, complete sequence
          Length = 154685

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 19596 actctccagatatagaggatg 19576



to top

>gb|AC127548.4| Mus musculus BAC clone RP24-505K1 from chromosome unknown, complete
             sequence
          Length = 123175

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 53179 actctccagatatagaggatg 53159



to top

>gb|AC148320.3| Mus musculus BAC clone RP24-555B2 from chromosome y, complete sequence
          Length = 192936

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 177865 actctccagatatagaggatg 177885



to top

>gb|AC173997.2| Mus musculus BAC clone RP24-190A13 from chromosome y, complete sequence
          Length = 156779

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 122641 actctccagatatagaggatg 122621



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 412   actctccagatatagaggat 431
             ||||||||||||||||||||
Sbjct: 78339 actctccagatatagaggat 78358



to top

>gb|AC145584.4| Mus musculus BAC clone RP24-355G24 from Y, complete sequence
          Length = 166158

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 130717 actctccagatatagaggatg 130737



to top

>gb|AC145594.5| Mus musculus BAC clone RP24-188N2 from Y, complete sequence
          Length = 137625

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 19128 actctccagatatagaggatg 19108



to top

>gb|AC145265.2| Mus musculus BAC clone RP24-209D17 from Y, complete sequence
          Length = 143657

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 141921 actctccagatatagaggatg 141941



to top

>gb|AC145514.3| Mus musculus BAC clone RP24-254D6 from Y, complete sequence
          Length = 164006

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 42101 actctccagatatagaggatg 42081



to top

>gb|AC147167.3| Mus musculus BAC clone RP24-291I16 from Y, complete sequence
          Length = 144051

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 139991 actctccagatatagaggatg 140011



to top

>gb|AC142269.4| Mus musculus BAC clone RP24-112B7 from Y, complete sequence
          Length = 185622

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 123344 actctccagatatagaggatg 123364



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 412    actctccagatatagaggat 431
              ||||||||||||||||||||
Sbjct: 167929 actctccagatatagaggat 167910



to top

>gb|AC147630.4| Mus musculus BAC clone RP24-530L22 from Y, complete sequence
          Length = 180127

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 116433 actctccagatatagaggatg 116413



to top

>gb|AC147249.3| Mus musculus BAC clone RP24-85J13 from Y, complete sequence
          Length = 197408

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 412   actctccagatatagaggatg 432
             |||||||||||||||||||||
Sbjct: 54711 actctccagatatagaggatg 54731



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 412   actctccagatatagaggat 431
             ||||||||||||||||||||
Sbjct: 99306 actctccagatatagaggat 99287



to top

>gb|AC004087.1|AC004087 Homo sapiens Xp22 GSHB-314C4 (Genome Systems Human BAC library)
             complete sequence
          Length = 124791

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 433   taagaaacaataaaccatcct 453
             |||||||||||||||||||||
Sbjct: 52454 taagaaacaataaaccatcct 52474



to top

>gb|AC156161.3| Mus musculus BAC clone RP24-403M10 from chromosome y, complete sequence
          Length = 155529

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 412    actctccagatatagaggatg 432
              |||||||||||||||||||||
Sbjct: 100706 actctccagatatagaggatg 100686



to top

>ref|NM_120349.2| Arabidopsis thaliana unknown protein AT5G02710 mRNA, complete cds
          Length = 908

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 508 tgtatttatccatgttatta 527
           ||||||||||||||||||||
Sbjct: 836 tgtatttatccatgttatta 855



to top

>gb|AC152821.5| Mus musculus BAC clone RP24-366H21 from chromosome y, complete
            sequence
          Length = 179613

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 412  actctccagatatagaggat 431
            ||||||||||||||||||||
Sbjct: 8537 actctccagatatagaggat 8518



to top

>gb|AC150658.7| Mus musculus BAC clone RP24-474E20 from chromosome y, complete sequence
          Length = 204836

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 412    actctccagatatagaggat 431
              ||||||||||||||||||||
Sbjct: 142896 actctccagatatagaggat 142877



to top

>gb|AC140680.4| Mus musculus BAC clone RP24-548A12 from chromosome Y, complete sequence
          Length = 222176

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 412    actctccagatatagaggat 431
              ||||||||||||||||||||
Sbjct: 216002 actctccagatatagaggat 216021



to top

>gb|AC132276.4| Mus musculus BAC clone RP24-344B8 from chromosome Y, complete sequence
          Length = 168601

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 412   actctccagatatagaggat 431
             ||||||||||||||||||||
Sbjct: 19622 actctccagatatagaggat 19603



to top

>gb|AC147260.3| Mus musculus BAC clone RP24-186L11 from chromosome Y, complete sequence
          Length = 137361

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 412   actctccagatatagaggat 431
             ||||||||||||||||||||
Sbjct: 64502 actctccagatatagaggat 64483



to top

>ref|XM_881232.1| PREDICTED: Bos taurus similar to dynamin 2 isoform 2, transcript
            variant 41 (LOC511691), mRNA
          Length = 3694

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 33   gggcgctgagaaggaagctg 52
            ||||||||||||||||||||
Sbjct: 2491 gggcgctgagaaggaagctg 2472



to top

>ref|XM_881213.1| PREDICTED: Bos taurus similar to dynamin 2 isoform 2, transcript
            variant 40 (LOC511691), mRNA
          Length = 3682

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 33   gggcgctgagaaggaagctg 52
            ||||||||||||||||||||
Sbjct: 2479 gggcgctgagaaggaagctg 2460



to top

>ref|XM_881199.1| PREDICTED: Bos taurus similar to dynamin 2 isoform 2, transcript
            variant 39 (LOC511691), mRNA
          Length = 3694

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 33   gggcgctgagaaggaagctg 52
            ||||||||||||||||||||
Sbjct: 2491 gggcgctgagaaggaagctg 2472



to top

>ref|XM_868043.1| PREDICTED: Bos taurus similar to dynamin 2 isoform 2, transcript
            variant 3 (LOC511691), mRNA
          Length = 3330

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 33   gggcgctgagaaggaagctg 52
            ||||||||||||||||||||
Sbjct: 2491 gggcgctgagaaggaagctg 2472



to top

>ref|XM_881170.1| PREDICTED: Bos taurus similar to dynamin 2 isoform 2, transcript
            variant 38 (LOC511691), mRNA
          Length = 3636

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 33   gggcgctgagaaggaagctg 52
            ||||||||||||||||||||
Sbjct: 2433 gggcgctgagaaggaagctg 2414



to top

>ref|XM_589076.2| PREDICTED: Bos taurus similar to dynamin 2 isoform 2, transcript
            variant 1 (LOC511691), mRNA
          Length = 3318

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 33   gggcgctgagaaggaagctg 52
            ||||||||||||||||||||
Sbjct: 2479 gggcgctgagaaggaagctg 2460



to top

>ref|XM_881134.1| PREDICTED: Bos taurus similar to dynamin 2 isoform 2, transcript
            variant 37 (LOC511691), mRNA
          Length = 3330

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 33   gggcgctgagaaggaagctg 52
            ||||||||||||||||||||
Sbjct: 2491 gggcgctgagaaggaagctg 2472



to top

>ref|XM_881115.1| PREDICTED: Bos taurus similar to dynamin 2 isoform 2, transcript
            variant 36 (LOC511691), mRNA
          Length = 3606

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 33   gggcgctgagaaggaagctg 52
            ||||||||||||||||||||
Sbjct: 2403 gggcgctgagaaggaagctg 2384



to top

>ref|XM_881098.1| PREDICTED: Bos taurus similar to dynamin 2 isoform 2, transcript
            variant 35 (LOC511691), mRNA
          Length = 3642

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 33   gggcgctgagaaggaagctg 52
            ||||||||||||||||||||
Sbjct: 2439 gggcgctgagaaggaagctg 2420



to top

>ref|XM_881084.1| PREDICTED: Bos taurus similar to dynamin 2 isoform 2, transcript
            variant 34 (LOC511691), mRNA
          Length = 3666

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 33   gggcgctgagaaggaagctg 52
            ||||||||||||||||||||
Sbjct: 2463 gggcgctgagaaggaagctg 2444



to top

>ref|XM_881069.1| PREDICTED: Bos taurus similar to dynamin 2 isoform 2, transcript
            variant 33 (LOC511691), mRNA
          Length = 3687

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 33   gggcgctgagaaggaagctg 52
            ||||||||||||||||||||
Sbjct: 2484 gggcgctgagaaggaagctg 2465



to top

>ref|XM_881051.1| PREDICTED: Bos taurus similar to dynamin 2 isoform 2, transcript
            variant 32 (LOC511691), mRNA
          Length = 3618

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 33   gggcgctgagaaggaagctg 52
            ||||||||||||||||||||
Sbjct: 2415 gggcgctgagaaggaagctg 2396



to top

>ref|XM_881031.1| PREDICTED: Bos taurus similar to dynamin 2 isoform 2, transcript
            variant 31 (LOC511691), mRNA
          Length = 3675

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 33   gggcgctgagaaggaagctg 52
            ||||||||||||||||||||
Sbjct: 2472 gggcgctgagaaggaagctg 2453



to top

>ref|XM_881016.1| PREDICTED: Bos taurus similar to dynamin 2 isoform 2, transcript
            variant 30 (LOC511691), mRNA
          Length = 3657

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 33   gggcgctgagaaggaagctg 52
            ||||||||||||||||||||
Sbjct: 2454 gggcgctgagaaggaagctg 2435



to top

>ref|XM_880999.1| PREDICTED: Bos taurus similar to dynamin 2 isoform 2, transcript
            variant 29 (LOC511691), mRNA
          Length = 3642

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 33   gggcgctgagaaggaagctg 52
            ||||||||||||||||||||
Sbjct: 2439 gggcgctgagaaggaagctg 2420



to top

>ref|XM_880979.1| PREDICTED: Bos taurus similar to dynamin 2 isoform 2, transcript
            variant 28 (LOC511691), mRNA
          Length = 3666

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 33   gggcgctgagaaggaagctg 52
            ||||||||||||||||||||
Sbjct: 2463 gggcgctgagaaggaagctg 2444



to top

>ref|XM_880959.1| PREDICTED: Bos taurus similar to dynamin 2 isoform 2, transcript
            variant 27 (LOC511691), mRNA
          Length = 3729

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 33   gggcgctgagaaggaagctg 52
            ||||||||||||||||||||
Sbjct: 2526 gggcgctgagaaggaagctg 2507



to top

>ref|XM_880938.1| PREDICTED: Bos taurus similar to dynamin 2 isoform 2, transcript
            variant 26 (LOC511691), mRNA
          Length = 3618

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 33   gggcgctgagaaggaagctg 52
            ||||||||||||||||||||
Sbjct: 2415 gggcgctgagaaggaagctg 2396



to top

>ref|XM_880920.1| PREDICTED: Bos taurus similar to dynamin 2 isoform 2, transcript
            variant 25 (LOC511691), mRNA
          Length = 3600

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 33   gggcgctgagaaggaagctg 52
            ||||||||||||||||||||
Sbjct: 2397 gggcgctgagaaggaagctg 2378



to top

>ref|XM_880900.1| PREDICTED: Bos taurus similar to dynamin 2 isoform 2, transcript
            variant 24 (LOC511691), mRNA
          Length = 3690

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 33   gggcgctgagaaggaagctg 52
            ||||||||||||||||||||
Sbjct: 2487 gggcgctgagaaggaagctg 2468



to top

>ref|XM_880880.1| PREDICTED: Bos taurus similar to dynamin 2 isoform 2, transcript
            variant 23 (LOC511691), mRNA
          Length = 3654

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 33   gggcgctgagaaggaagctg 52
            ||||||||||||||||||||
Sbjct: 2451 gggcgctgagaaggaagctg 2432



to top

>ref|XM_880862.1| PREDICTED: Bos taurus similar to dynamin 2 isoform 2, transcript
            variant 22 (LOC511691), mRNA
          Length = 3672

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 33   gggcgctgagaaggaagctg 52
            ||||||||||||||||||||
Sbjct: 2469 gggcgctgagaaggaagctg 2450



to top

>ref|XM_880844.1| PREDICTED: Bos taurus similar to dynamin 2 isoform 2, transcript
            variant 21 (LOC511691), mRNA
          Length = 3618

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 33   gggcgctgagaaggaagctg 52
            ||||||||||||||||||||
Sbjct: 2415 gggcgctgagaaggaagctg 2396



to top

>ref|XM_880823.1| PREDICTED: Bos taurus similar to dynamin 2 isoform 2, transcript
            variant 20 (LOC511691), mRNA
          Length = 3714

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 33   gggcgctgagaaggaagctg 52
            ||||||||||||||||||||
Sbjct: 2511 gggcgctgagaaggaagctg 2492



to top

>ref|XM_880804.1| PREDICTED: Bos taurus similar to dynamin 2 isoform 2, transcript
            variant 19 (LOC511691), mRNA
          Length = 3708

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 33   gggcgctgagaaggaagctg 52
            ||||||||||||||||||||
Sbjct: 2505 gggcgctgagaaggaagctg 2486



to top

>ref|XM_880786.1| PREDICTED: Bos taurus similar to dynamin 2 isoform 2, transcript
            variant 18 (LOC511691), mRNA
          Length = 3678

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 33   gggcgctgagaaggaagctg 52
            ||||||||||||||||||||
Sbjct: 2475 gggcgctgagaaggaagctg 2456



to top

>ref|XM_880770.1| PREDICTED: Bos taurus similar to dynamin 2 isoform 2, transcript
            variant 17 (LOC511691), mRNA
          Length = 3499

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 33   gggcgctgagaaggaagctg 52
            ||||||||||||||||||||
Sbjct: 2296 gggcgctgagaaggaagctg 2277



to top

>ref|XM_880755.1| PREDICTED: Bos taurus similar to dynamin 2 isoform 2, transcript
            variant 16 (LOC511691), mRNA
          Length = 3721

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 33   gggcgctgagaaggaagctg 52
            ||||||||||||||||||||
Sbjct: 2518 gggcgctgagaaggaagctg 2499



to top

>ref|XM_880733.1| PREDICTED: Bos taurus similar to dynamin 2 isoform 2, transcript
            variant 15 (LOC511691), mRNA
          Length = 3709

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 33   gggcgctgagaaggaagctg 52
            ||||||||||||||||||||
Sbjct: 2506 gggcgctgagaaggaagctg 2487



to top

>ref|XM_880709.1| PREDICTED: Bos taurus similar to dynamin 2 isoform 2, transcript
            variant 14 (LOC511691), mRNA
          Length = 3612

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 33   gggcgctgagaaggaagctg 52
            ||||||||||||||||||||
Sbjct: 2409 gggcgctgagaaggaagctg 2390



to top

>ref|XM_880687.1| PREDICTED: Bos taurus similar to dynamin 2 isoform 2, transcript
            variant 13 (LOC511691), mRNA
          Length = 3651

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 33   gggcgctgagaaggaagctg 52
            ||||||||||||||||||||
Sbjct: 2448 gggcgctgagaaggaagctg 2429



to top

>ref|XM_880660.1| PREDICTED: Bos taurus similar to dynamin 2 isoform 2, transcript
            variant 12 (LOC511691), mRNA
          Length = 3697

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 33   gggcgctgagaaggaagctg 52
            ||||||||||||||||||||
Sbjct: 2494 gggcgctgagaaggaagctg 2475



to top

>ref|XM_880637.1| PREDICTED: Bos taurus similar to dynamin 2 isoform 2, transcript
            variant 11 (LOC511691), mRNA
          Length = 3675

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 33   gggcgctgagaaggaagctg 52
            ||||||||||||||||||||
Sbjct: 2472 gggcgctgagaaggaagctg 2453



to top

>ref|XM_880611.1| PREDICTED: Bos taurus similar to dynamin 2 isoform 2, transcript
            variant 10 (LOC511691), mRNA
          Length = 3639

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 33   gggcgctgagaaggaagctg 52
            ||||||||||||||||||||
Sbjct: 2436 gggcgctgagaaggaagctg 2417



to top

>ref|XM_880590.1| PREDICTED: Bos taurus similar to dynamin 2 isoform 2, transcript
            variant 9 (LOC511691), mRNA
          Length = 3642

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 33   gggcgctgagaaggaagctg 52
            ||||||||||||||||||||
Sbjct: 2439 gggcgctgagaaggaagctg 2420



to top

>ref|XM_880569.1| PREDICTED: Bos taurus similar to dynamin 2 isoform 2, transcript
            variant 8 (LOC511691), mRNA
          Length = 3642

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 33   gggcgctgagaaggaagctg 52
            ||||||||||||||||||||
Sbjct: 2439 gggcgctgagaaggaagctg 2420



to top

>ref|XM_880550.1| PREDICTED: Bos taurus similar to dynamin 2 isoform 2, transcript
            variant 7 (LOC511691), mRNA
          Length = 3666

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 33   gggcgctgagaaggaagctg 52
            ||||||||||||||||||||
Sbjct: 2463 gggcgctgagaaggaagctg 2444



to top

>ref|XM_880525.1| PREDICTED: Bos taurus similar to dynamin 2 isoform 2, transcript
            variant 6 (LOC511691), mRNA
          Length = 3708

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 33   gggcgctgagaaggaagctg 52
            ||||||||||||||||||||
Sbjct: 2505 gggcgctgagaaggaagctg 2486



to top

>ref|XM_880510.1| PREDICTED: Bos taurus similar to dynamin 2 isoform 2, transcript
            variant 5 (LOC511691), mRNA
          Length = 3682

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 33   gggcgctgagaaggaagctg 52
            ||||||||||||||||||||
Sbjct: 2479 gggcgctgagaaggaagctg 2460



to top

>ref|XM_880486.1| PREDICTED: Bos taurus similar to dynamin 2 isoform 2, transcript
            variant 4 (LOC511691), mRNA
          Length = 3318

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 33   gggcgctgagaaggaagctg 52
            ||||||||||||||||||||
Sbjct: 2479 gggcgctgagaaggaagctg 2460



to top

>gb|AC158704.3| Microcebus murinus clone CH257-434D18, complete sequence
          Length = 257333

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 380    atctcataactaaaaatact 399
              ||||||||||||||||||||
Sbjct: 134067 atctcataactaaaaatact 134086



to top

>gb|AC145562.5| Mus musculus BAC clone RP24-67L21 from chromosome Y, complete sequence
          Length = 156048

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 412    actctccagatatagaggat 431
              ||||||||||||||||||||
Sbjct: 138029 actctccagatatagaggat 138048



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 412   actctccagatatagaggat 431
             ||||||||||||||||||||
Sbjct: 68175 actctccagatatagaggat 68194



to top

>gb|AC147268.5| Mus musculus BAC clone RP24-263J19 from chromosome Y, complete sequence
          Length = 129831

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 412   actctccagatatagaggat 431
             ||||||||||||||||||||
Sbjct: 95985 actctccagatatagaggat 95966



to top

>gb|AC147109.2| Mus musculus BAC clone RP24-75P8 from chromosome Y, complete sequence
          Length = 216878

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 412    actctccagatatagaggat 431
              ||||||||||||||||||||
Sbjct: 173287 actctccagatatagaggat 173306



to top

>gb|AC147107.2| Mus musculus BAC clone RP24-69F17 from chromosome Y, complete sequence
          Length = 202338

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 412   actctccagatatagaggat 431
             ||||||||||||||||||||
Sbjct: 40699 actctccagatatagaggat 40680



to top

>gb|AC147252.4| Mus musculus BAC clone RP24-116A5 from chromosome Y, complete sequence
          Length = 197602

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 412   actctccagatatagaggat 431
             ||||||||||||||||||||
Sbjct: 23359 actctccagatatagaggat 23340



to top

>gb|AC145570.3| Mus musculus BAC clone RP24-95K23 from chromosome Y, complete sequence
          Length = 168764

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 412   actctccagatatagaggat 431
             ||||||||||||||||||||
Sbjct: 99313 actctccagatatagaggat 99294



to top

>gb|AC147372.3| Mus musculus BAC clone RP24-212L10 from chromosome Y, complete sequence
          Length = 187032

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 412   actctccagatatagaggat 431
             ||||||||||||||||||||
Sbjct: 10300 actctccagatatagaggat 10281



to top

>gb|AC144849.2| Mus musculus BAC clone RP24-482B19 from chromosome Y, complete
            sequence
          Length = 184015

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 412  actctccagatatagaggat 431
            ||||||||||||||||||||
Sbjct: 4268 actctccagatatagaggat 4287



to top

>gb|AC147135.2| Mus musculus BAC clone RP24-475E12 from chromosome Y, complete sequence
          Length = 222469

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 412    actctccagatatagaggat 431
              ||||||||||||||||||||
Sbjct: 158445 actctccagatatagaggat 158464



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 412   actctccagatatagaggat 431
             ||||||||||||||||||||
Sbjct: 46136 actctccagatatagaggat 46155



to top

>gb|AC175743.2| Mus musculus BAC clone RP24-44F3 from chromosome y, complete sequence
          Length = 176317

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 412    actctccagatatagaggat 431
              ||||||||||||||||||||
Sbjct: 101062 actctccagatatagaggat 101043



to top

>gb|AC183975.1| Mus musculus BAC clone RP24-352C21 from chromosome y, complete sequence
          Length = 129948

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 412   actctccagatatagaggat 431
             ||||||||||||||||||||
Sbjct: 35071 actctccagatatagaggat 35090



to top

>gb|AY811942.1| Schistosoma japonicum SJCHGC05212 protein mRNA, partial cds
          Length = 1409

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 192  tattctcattgatatttctt 211
            ||||||||||||||||||||
Sbjct: 1088 tattctcattgatatttctt 1107



to top

>gb|AC141875.4| Mus musculus BAC clone RP24-316O22 from chromosome Y, complete sequence
          Length = 170988

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 412    actctccagatatagaggat 431
              ||||||||||||||||||||
Sbjct: 153877 actctccagatatagaggat 153896



to top

>gb|AC132283.4| Mus musculus BAC clone RP24-351L16 from chromosome Y, complete sequence
          Length = 165828

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 412    actctccagatatagaggat 431
              ||||||||||||||||||||
Sbjct: 137787 actctccagatatagaggat 137806



to top

>gb|AC140678.2| Mus musculus BAC clone RP24-553I16 from chromosome Y, complete sequence
          Length = 161612

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 412    actctccagatatagaggat 431
              ||||||||||||||||||||
Sbjct: 128048 actctccagatatagaggat 128067



to top

>gb|AC145552.3| Mus musculus BAC clone RP24-573I22 from chromosome Y, complete sequence
          Length = 146775

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 412    actctccagatatagaggat 431
              ||||||||||||||||||||
Sbjct: 134922 actctccagatatagaggat 134941



to top

>gb|AC139297.4| Mus musculus BAC clone RP24-62H18 from chromosome Y, complete sequence
          Length = 206783

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 412    actctccagatatagaggat 431
              ||||||||||||||||||||
Sbjct: 174567 actctccagatatagaggat 174586



to top

>gb|AC140348.4| Mus musculus BAC clone RP24-66K20 from chromosome Y, complete sequence
          Length = 214393

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 412   actctccagatatagaggat 431
             ||||||||||||||||||||
Sbjct: 64535 actctccagatatagaggat 64554



to top

>gb|AC129191.4| Mus musculus BAC clone RP24-81F10 from chromosome Y, complete sequence
          Length = 241616

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 412   actctccagatatagaggat 431
             ||||||||||||||||||||
Sbjct: 51607 actctccagatatagaggat 51588



to top

>gb|AC140386.4| Mus musculus BAC clone RP24-88H19 from chromosome Y, complete sequence
          Length = 222469

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 412    actctccagatatagaggat 431
              ||||||||||||||||||||
Sbjct: 158445 actctccagatatagaggat 158464



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 412   actctccagatatagaggat 431
             ||||||||||||||||||||
Sbjct: 46136 actctccagatatagaggat 46155



to top

>gb|AC145270.3| Mus musculus BAC clone RP24-97H23 from chromosome Y, complete sequence
          Length = 165410

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 412   actctccagatatagaggat 431
             ||||||||||||||||||||
Sbjct: 10954 actctccagatatagaggat 10935



to top

>gb|AC134567.4| Mus musculus BAC clone RP24-199C24 from chromosome Y, complete sequence
          Length = 163892

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 412    actctccagatatagaggat 431
              ||||||||||||||||||||
Sbjct: 139365 actctccagatatagaggat 139384



to top

>gb|AC140473.3| Mus musculus BAC clone RP24-405H7 from chromosome Y, complete sequence
          Length = 133519

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 412    actctccagatatagaggat 431
              ||||||||||||||||||||
Sbjct: 116848 actctccagatatagaggat 116867



to top

>gb|AC135808.4| Mus musculus BAC clone RP24-316N5 from chromosome Y, complete sequence
          Length = 149744

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 412    actctccagatatagaggat 431
              ||||||||||||||||||||
Sbjct: 108837 actctccagatatagaggat 108856



to top

>gb|AC147156.2| Mus musculus BAC clone RP24-343M19 from chromosome Y, complete sequence
          Length = 214399

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 412    actctccagatatagaggat 431
              ||||||||||||||||||||
Sbjct: 176565 actctccagatatagaggat 176584



to top

>gb|AC132336.3| Mus musculus BAC clone RP24-230N9 from chromosome 12, complete sequence
          Length = 149020

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 192   tattctcattgatatttctttgtt 215
             |||| |||||||||||||||||||
Sbjct: 63883 tattgtcattgatatttctttgtt 63860



to top

>gb|AC125400.4| Mus musculus BAC clone RP24-380E10 from chromosome 10, complete sequence
          Length = 154681

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 378    atatctcataactaaaaatactaagaag 405
              |||||| ||||||||||||||| |||||
Sbjct: 118142 atatctaataactaaaaatactcagaag 118169



to top

>emb|Z92808.2|CEM04C3 Caenorhabditis elegans Cosmid M04C3, complete sequence
          Length = 13469

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 10    tacaattgctactgctacaa 29
             ||||||||||||||||||||
Sbjct: 10426 tacaattgctactgctacaa 10407



to top

>ref|XM_949884.1| Theileria annulata strain Ankara sporozoite surface antigen (TA03755)
            partial mRNA
          Length = 2754

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 68   aggagaaaggtttgctgtac 87
            ||||||||||||||||||||
Sbjct: 1593 aggagaaaggtttgctgtac 1612



to top

>gb|AC011294.3| Homo sapiens BAC clone RP11-95J15 from 7, complete sequence
          Length = 166715

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 3      ctgctcctacaattgctactgcta 26
              |||||||||| |||||||||||||
Sbjct: 125569 ctgctcctactattgctactgcta 125592



to top

>ref|XM_727891.1| Plasmodium chabaudi chabaudi hypothetical protein (PC300891.00.0)
           partial mRNA
          Length = 606

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 525 ttattagtacccaaaactaa 544
           ||||||||||||||||||||
Sbjct: 238 ttattagtacccaaaactaa 257



to top

>ref|XM_731038.1| Plasmodium chabaudi chabaudi structure specific recognition protein
           (PC000453.01.0) partial mRNA
          Length = 819

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 525 ttattagtacccaaaactaa 544
           ||||||||||||||||||||
Sbjct: 517 ttattagtacccaaaactaa 536



to top

>ref|XM_668809.1| Plasmodium berghei strain ANKA hypothetical protein (PB300791.00.0)
           partial mRNA
          Length = 1245

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 525 ttattagtacccaaaactaa 544
           ||||||||||||||||||||
Sbjct: 778 ttattagtacccaaaactaa 797



to top

>ref|XM_675282.1| Plasmodium berghei strain ANKA structure specific recognition
           protein (PB001100.02.0) partial mRNA
          Length = 1482

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 525 ttattagtacccaaaactaa 544
           ||||||||||||||||||||
Sbjct: 778 ttattagtacccaaaactaa 797



to top

>emb|CR391962.5| Zebrafish DNA sequence from clone CH211-215K15 in linkage group 16,
              complete sequence
          Length = 144859

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 233    tgacatttaaatgtaaatag 252
              ||||||||||||||||||||
Sbjct: 139638 tgacatttaaatgtaaatag 139619



to top

>gb|AC184149.2| Mus musculus BAC clone RP24-143K6 from chromosome y, complete sequence
          Length = 150268

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 412   actctccagatatagaggat 431
             ||||||||||||||||||||
Sbjct: 92299 actctccagatatagaggat 92318



to top

>emb|AL132775.29|HSDJ46C2 Human DNA sequence from clone RP1-46C2 on chromosome 6p22.2-23
            Contains the 5' end of the E2F3 gene for E2F
            transcription factor 3 (E2F-3, KIAA0075) and two CpG
            islands, complete sequence
          Length = 109902

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 420  gatatagaggatgtaagaaacaat 443
            |||||| |||||||||||||||||
Sbjct: 7452 gatataaaggatgtaagaaacaat 7429



to top

>gb|AC158946.4| Mus musculus chromosome 1, clone RP24-267F8, complete sequence
          Length = 137800

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 255   agatttcctggaccttccac 274
             ||||||||||||||||||||
Sbjct: 19810 agatttcctggaccttccac 19829



to top

>gb|AC182483.3| Mus musculus BAC clone RP24-458L18 from chromosome y, complete sequence
          Length = 132653

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 412   actctccagatatagaggat 431
             ||||||||||||||||||||
Sbjct: 48738 actctccagatatagaggat 48719



to top

>emb|AL162971.1|ATT22P11 Arabidopsis thaliana DNA chromosome 5, BAC clone T22P11 (ESSA project)
          Length = 96424

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 508   tgtatttatccatgttatta 527
             ||||||||||||||||||||
Sbjct: 95278 tgtatttatccatgttatta 95297



to top

>emb|AL162973.1|ATF9G14 Arabidopsis thaliana DNA chromosome 5, BAC clone F9G14 (ESSA project)
          Length = 104769

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 508  tgtatttatccatgttatta 527
            ||||||||||||||||||||
Sbjct: 9824 tgtatttatccatgttatta 9843



to top

>emb|AJ246003.1|HSA246003 Homo sapiens Spast gene for spastin protein
          Length = 110000

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 390   taaaaatactaagaagttat 409
             ||||||||||||||||||||
Sbjct: 33577 taaaaatactaagaagttat 33596



to top

>gb|AC184107.1| Mus musculus chromosome UNK clone CH33-213P12, complete sequence
          Length = 185346

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 412  actctccagatatagaggat 431
            ||||||||||||||||||||
Sbjct: 3236 actctccagatatagaggat 3255



to top

>gb|DQ301694.1| Thanatephorus cucumeris strain TO4 translation elongation factor
           1-alpha (EF) gene, partial sequence
          Length = 433

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 40  gagaaggaagctgctgaact 59
           ||||||||||||||||||||
Sbjct: 349 gagaaggaagctgctgaact 330



to top

>gb|DQ301693.1| Thanatephorus cucumeris strain TO1 translation elongation factor
           1-alpha (EF) gene, partial sequence
          Length = 458

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 40  gagaaggaagctgctgaact 59
           ||||||||||||||||||||
Sbjct: 358 gagaaggaagctgctgaact 339



to top

>gb|DQ301689.1| Thanatephorus cucumeris strain SJ07 translation elongation factor
           1-alpha (EF) gene, partial sequence
          Length = 444

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 40  gagaaggaagctgctgaact 59
           ||||||||||||||||||||
Sbjct: 343 gagaaggaagctgctgaact 324



to top

>gb|DQ301688.1| Thanatephorus cucumeris strain SJ02 translation elongation factor
           1-alpha (EF) gene, partial sequence
          Length = 448

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 40  gagaaggaagctgctgaact 59
           ||||||||||||||||||||
Sbjct: 348 gagaaggaagctgctgaact 329



to top

>gb|DQ301673.1| Thanatephorus cucumeris strain AG-7 translation elongation factor
           1-alpha (EF) gene, partial sequence
          Length = 448

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 40  gagaaggaagctgctgaact 59
           ||||||||||||||||||||
Sbjct: 346 gagaaggaagctgctgaact 327



to top

>gb|DQ301672.1| Thanatephorus cucumeris strain AG-6HGI translation elongation
           factor 1-alpha (EF) gene, partial sequence
          Length = 431

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 40  gagaaggaagctgctgaact 59
           ||||||||||||||||||||
Sbjct: 347 gagaaggaagctgctgaact 328



to top

>gb|DQ301669.1| Thanatephorus cucumeris strain AG-4HGII translation elongation
           factor 1-alpha (EF) gene, partial sequence
          Length = 456

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 40  gagaaggaagctgctgaact 59
           ||||||||||||||||||||
Sbjct: 355 gagaaggaagctgctgaact 336



to top

>gb|DQ301668.1| Thanatephorus cucumeris strain AG-4HGI translation elongation
           factor 1-alpha (EF) gene, partial sequence
          Length = 447

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 40  gagaaggaagctgctgaact 59
           ||||||||||||||||||||
Sbjct: 347 gagaaggaagctgctgaact 328



to top

>gb|DQ301656.1| Ceratobasidium sp. CBS 438.80 translation elongation factor 1-alpha
           (EF) gene, partial sequence
          Length = 365

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 40  gagaaggaagctgctgaact 59
           ||||||||||||||||||||
Sbjct: 352 gagaaggaagctgctgaact 333



to top

>gb|DQ301654.1| Ceratobasidium sp. CBS 189.90 translation elongation factor 1-alpha
           (EF) gene, partial sequence
          Length = 362

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 40  gagaaggaagctgctgaact 59
           ||||||||||||||||||||
Sbjct: 351 gagaaggaagctgctgaact 332



to top

>gb|DQ301650.1| Ceratobasidium sp. CBS 139.82 translation elongation factor 1-alpha
           (EF) gene, partial sequence
          Length = 429

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 40  gagaaggaagctgctgaact 59
           ||||||||||||||||||||
Sbjct: 347 gagaaggaagctgctgaact 328



to top

>gb|DQ301648.1| Ceratobasidium sp. CBS 136.82 translation elongation factor 1-alpha
           (EF) gene, partial sequence
          Length = 335

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 40  gagaaggaagctgctgaact 59
           ||||||||||||||||||||
Sbjct: 325 gagaaggaagctgctgaact 306



to top

>gb|DQ301647.1| Ceratobasidium sp. CBS 135.82 translation elongation factor 1-alpha
           (EF) gene, partial sequence
          Length = 330

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 40  gagaaggaagctgctgaact 59
           ||||||||||||||||||||
Sbjct: 321 gagaaggaagctgctgaact 302



to top

>gb|DQ301646.1| Ceratobasidium sp. CBS 133.82 translation elongation factor 1-alpha
           (EF) gene, partial sequence
          Length = 420

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 40  gagaaggaagctgctgaact 59
           ||||||||||||||||||||
Sbjct: 373 gagaaggaagctgctgaact 354



to top

>gb|DQ301640.1| Ceratobasidium sp. AG-P translation elongation factor 1-alpha (EF)
           gene, partial sequence
          Length = 446

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 40  gagaaggaagctgctgaact 59
           ||||||||||||||||||||
Sbjct: 345 gagaaggaagctgctgaact 326



to top

>gb|AC142261.5| Mus musculus BAC clone RP24-469C3 from chromosome unknown, complete
              sequence
          Length = 179858

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 412    actctccagatatagaggat 431
              ||||||||||||||||||||
Sbjct: 179263 actctccagatatagaggat 179282



to top

>gb|AC182449.4| Mus musculus BAC clone RP24-361G20 from chromosome y, complete sequence
          Length = 156599

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 412    actctccagatatagaggat 431
              ||||||||||||||||||||
Sbjct: 117497 actctccagatatagaggat 117516



to top

>gb|AC175056.3| Mus musculus BAC clone RP24-212M24 from chromosome y, complete sequence
          Length = 166788

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 412    actctccagatatagaggat 431
              ||||||||||||||||||||
Sbjct: 153910 actctccagatatagaggat 153929



to top

>gb|AC183526.2| Mus musculus BAC clone RP24-121M8 from chromosome y, complete sequence
          Length = 175230

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 412    actctccagatatagaggat 431
              ||||||||||||||||||||
Sbjct: 132141 actctccagatatagaggat 132160



to top

>gb|AC177798.3| Mus musculus BAC clone RP24-456H11 from chromosome y, complete sequence
          Length = 171533

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 412    actctccagatatagaggat 431
              ||||||||||||||||||||
Sbjct: 105017 actctccagatatagaggat 105036



to top

>gb|AC182763.2| Mus musculus BAC clone RP24-56N19 from chromosome y, complete sequence
          Length = 175755

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 412    actctccagatatagaggat 431
              ||||||||||||||||||||
Sbjct: 148078 actctccagatatagaggat 148097



to top

>gb|AC175671.2| Mus musculus BAC clone RP24-313O14 from chromosome y, complete sequence
          Length = 176687

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 412    actctccagatatagaggat 431
              ||||||||||||||||||||
Sbjct: 147860 actctccagatatagaggat 147879



to top

>gb|AC177800.3| Mus musculus BAC clone RP24-323K10 from chromosome y, complete sequence
          Length = 168735

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 412   actctccagatatagaggat 431
             ||||||||||||||||||||
Sbjct: 43112 actctccagatatagaggat 43093



to top

>dbj|AP007169.1| Aspergillus oryzae RIB40 genomic DNA, SC038
          Length = 1725576

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 373    cccatatatctcataactaa 392
              ||||||||||||||||||||
Sbjct: 798484 cccatatatctcataactaa 798503



to top

>gb|AC174806.2| Mus musculus BAC clone RP24-526I8 from chromosome y, complete sequence
          Length = 155247

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 412    actctccagatatagaggat 431
              ||||||||||||||||||||
Sbjct: 125204 actctccagatatagaggat 125223



to top

>gb|AC183416.2| Mus musculus BAC clone RP24-68E17 from chromosome y, complete sequence
          Length = 177325

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 412    actctccagatatagaggat 431
              ||||||||||||||||||||
Sbjct: 117796 actctccagatatagaggat 117777



to top

>gb|AC177799.3| Mus musculus BAC clone RP24-374O22 from chromosome y, complete sequence
          Length = 128487

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 412   actctccagatatagaggat 431
             ||||||||||||||||||||
Sbjct: 94913 actctccagatatagaggat 94894



to top

>gb|AC175120.3| Mus musculus BAC clone RP24-26J9 from chromosome y, complete sequence
          Length = 212433

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 412    actctccagatatagaggat 431
              ||||||||||||||||||||
Sbjct: 174238 actctccagatatagaggat 174257



to top

>gb|AC175526.4| Mus musculus BAC clone RP24-84E22 from chromosome y, complete sequence
          Length = 206636

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 412   actctccagatatagaggat 431
             ||||||||||||||||||||
Sbjct: 25477 actctccagatatagaggat 25458



to top

>gb|BC104493.1| Bos taurus cDNA clone IMAGE:7957075, partial cds
          Length = 2375

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 33   gggcgctgagaaggaagctg 52
            ||||||||||||||||||||
Sbjct: 1245 gggcgctgagaaggaagctg 1226



to top

>gb|AC090744.5| Homo sapiens chromosome 11, clone RP11-660K15, complete sequence
          Length = 195434

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 390   taaaaatactaagaagttat 409
             ||||||||||||||||||||
Sbjct: 14558 taaaaatactaagaagttat 14577


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,867,236
Number of Sequences: 3902068
Number of extensions: 6867236
Number of successful extensions: 121706
Number of sequences better than 10.0: 322
Number of HSP's better than 10.0 without gapping: 322
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 120957
Number of HSP's gapped (non-prelim): 749
length of query: 570
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 547
effective length of database: 17,143,297,704
effective search space: 9377383844088
effective search space used: 9377383844088
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top