Clone Name | baak4j08 |
---|---|
Clone Library Name | barley_pub |
>emb|X15692.1|HVLP90 Barley mRNA for chloroplast low molecular mass early light-inducible protein (ELIP) (clone HV90) Length = 660 Score = 327 bits (165), Expect = 1e-86 Identities = 248/276 (89%) Strand = Plus / Plus Query: 74 aatggcgactatgatggccatgagctccttcgtcggcgccgccgtcctgcctcgtggctc 133 ||||||||| |||||| ||||||||||||||| ||| || |||||| |||| || |||| Sbjct: 30 aatggcgaccatgatgtccatgagctccttcgccggtgcggccgtcgtgccgcgcagctc 89 Query: 134 agctggccgcttcggcgcccgttcagtgccggcgctgggccggcgcgctcttgtcgtcag 193 || || ||||||||||||| || |||| ||||||||||| ||||| || |||||||| Sbjct: 90 ggccagcagcttcggcgcccggtctctgccagcgctgggccgacgcgccctcgtcgtcag 149 Query: 194 ggcacagaccgagggcccgagtgcaccaccgccaaacaaacccaaggcgagcacctcgat 253 ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 150 ggcacagaccgagggcccgagcgcaccaccgccaaacaaacccaaggcgagcacctcgat 209 Query: 254 ctgggacgcgatggcgttcagcggcccggcgccggagcgcatcaacgggcggntagccat 313 |||||||| |||||||||||||||||| |||||||||||||||||||||||| ||||||| Sbjct: 210 ctgggacgagatggcgttcagcggccctgcgccggagcgcatcaacgggcggctagccat 269 Query: 314 ggtaggcttcgaaacggcacttgcggtggaggcagg 349 ||| ||||||| ||||| ||||||||||||||||| Sbjct: 270 ggtgggcttcgtgacggcgcttgcggtggaggcagg 305
>dbj|AB019617.1| Triticum aestivum wcr (wheat cold-regulated) 12 mRNA for early light-inducible protein (ELIP), complete cds Length = 818 Score = 248 bits (125), Expect = 1e-62 Identities = 243/283 (85%), Gaps = 6/283 (2%) Strand = Plus / Plus Query: 73 taatggcgactatgatggccatgagctcctt------cgtcggcgccgccgtcctgcctc 126 ||||||||| |||||||||||||||||||| || |||||||||||||||||| | Sbjct: 113 taatggcgatcatgatggccatgagctcctttgccggcgccggcgccgccgtcctgccgc 172 Query: 127 gtggctcagctggccgcttcggcgcccgttcagtgccggcgctgggccggcgcgctcttg 186 | |||| ||| ||||||||||||||| || |||| ||||||||| | ||||| || | Sbjct: 173 gctgctcggctagccgcttcggcgcccagtctctgccagcgctgggcagacgcgccctcg 232 Query: 187 tcgtcagggcacagaccgagggcccgagtgcaccaccgccaaacaaacccaaggcgagca 246 |||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||| Sbjct: 233 tcgtcagggcacagaccgggggcccgagcgcaccaccgccaaacaaacccaaggcgagca 292 Query: 247 cctcgatctgggacgcgatggcgttcagcggcccggcgccggagcgcatcaacgggcggn 306 |||| |||||||||||| |||||||||||||||| |||||||||||||| || ||||| Sbjct: 293 cctctatctgggacgcgctggcgttcagcggccctgcgccggagcgcattaatgggcgcc 352 Query: 307 tagccatggtaggcttcgaaacggcacttgcggtggaggcagg 349 | |||||||| || |||| ||||| || || ||||||||||| Sbjct: 353 tggccatggtgggtttcgtgacggcgctcgccgtggaggcagg 395
>emb|X15691.1|HVLP60 Barley mRNA for chloroplast low molecular mass early light-inducible protein (ELIP) (clone HV60) Length = 764 Score = 244 bits (123), Expect = 2e-61 Identities = 173/190 (91%) Strand = Plus / Plus Query: 160 tgccggcgctgggccggcgcgctcttgtcgtcagggcacagaccgagggcccgagtgcac 219 |||| ||||||||||| || | || |||||||||||||||||||||||||||| |||| Sbjct: 197 tgccagcgctgggccgacgtaccctcgtcgtcagggcacagaccgagggcccgaacgcac 256 Query: 220 caccgccaaacaaacccaaggcgagcacctcgatctgggacgcgatggcgttcagcggcc 279 ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| Sbjct: 257 caccgccaaacaaacccaaggcgagcacctccatctgggacgcgatggcgttcagcggcc 316 Query: 280 cggcgccggagcgcatcaacgggcggntagccatggtaggcttcgaaacggcacttgcgg 339 | |||||||||||||||||||||||| |||||||||| ||||||| ||||| || || | Sbjct: 317 ctgcgccggagcgcatcaacgggcggctagccatggtgggcttcgtgacggcgctggctg 376 Query: 340 tggaggcagg 349 |||||||||| Sbjct: 377 tggaggcagg 386 Score = 65.9 bits (33), Expect = 8e-08 Identities = 54/61 (88%) Strand = Plus / Plus Query: 73 taatggcgactatgatggccatgagctccttcgtcggcgccgccgtcctgcctcgtggct 132 |||||||||| |||||||||||||||||||||| ||| || |||||| |||| || |||| Sbjct: 125 taatggcgaccatgatggccatgagctccttcgccggtgcggccgtcttgccgcgcggct 184 Query: 133 c 133 | Sbjct: 185 c 185
>emb|X15693.1|HVLP58 Barley mRNA for chloroplast high molecular mass early light-inducible protein (ELIP) (clone HV58) Length = 860 Score = 109 bits (55), Expect = 6e-21 Identities = 72/78 (92%) Strand = Plus / Plus Query: 247 cctcgatctgggacgcgatggcgttcagcggcccggcgccggagcgcatcaacgggcggn 306 ||||| ||||||||||| | ||||||||||||||||||||||||||||||||||| ||| Sbjct: 429 cctcggtctgggacgcgctcgcgttcagcggcccggcgccggagcgcatcaacggccggc 488 Query: 307 tagccatggtaggcttcg 324 | |||||||||||||||| Sbjct: 489 tggccatggtaggcttcg 506 Score = 40.1 bits (20), Expect = 4.7 Identities = 32/36 (88%) Strand = Plus / Plus Query: 172 gccggcgcgctcttgtcgtcagggcacagaccgagg 207 |||||||| | || ||||||||||| |||||||||| Sbjct: 159 gccggcgcaccctcgtcgtcagggcccagaccgagg 194
>gb|AF365951.1|AF365951 Zea mays early light-inducible protein ELIP mRNA, complete cds; nuclear gene for chloroplast product Length = 852 Score = 81.8 bits (41), Expect = 1e-12 Identities = 64/72 (88%) Strand = Plus / Plus Query: 253 tctgggacgcgatggcgttcagcggcccggcgccggagcgcatcaacgggcggntagcca 312 ||||||||||| ||||||||||||| || ||||||||||| |||||||||||| | || | Sbjct: 316 tctgggacgcgctggcgttcagcgggcccgcgccggagcggatcaacgggcggctggcga 375 Query: 313 tggtaggcttcg 324 |||| ||||||| Sbjct: 376 tggtgggcttcg 387
>ref|NM_188763.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 609 Score = 69.9 bits (35), Expect = 5e-09 Identities = 47/51 (92%) Strand = Plus / Plus Query: 255 tgggacgcgatggcgttcagcggcccggcgccggagcgcatcaacgggcgg 305 ||||||| | ||||||||||||| |||||||||||||| |||||||||||| Sbjct: 271 tgggacgtgctggcgttcagcgggccggcgccggagcggatcaacgggcgg 321
>ref|XM_476845.1| Oryza sativa (japonica cultivar-group), mRNA Length = 564 Score = 69.9 bits (35), Expect = 5e-09 Identities = 47/51 (92%) Strand = Plus / Plus Query: 255 tgggacgcgatggcgttcagcggcccggcgccggagcgcatcaacgggcgg 305 ||||||| | ||||||||||||| |||||||||||||| |||||||||||| Sbjct: 226 tgggacgtgctggcgttcagcgggccggcgccggagcggatcaacgggcgg 276
>ref|XM_476844.1| Oryza sativa (japonica cultivar-group), mRNA Length = 603 Score = 69.9 bits (35), Expect = 5e-09 Identities = 47/51 (92%) Strand = Plus / Plus Query: 255 tgggacgcgatggcgttcagcggcccggcgccggagcgcatcaacgggcgg 305 ||||||| | ||||||||||||| |||||||||||||| |||||||||||| Sbjct: 265 tgggacgtgctggcgttcagcgggccggcgccggagcggatcaacgggcgg 315
>gb|AC007789.1| Oryza sativa BAC OSJNBa0049B20 genomic sequence, complete sequence Length = 182756 Score = 69.9 bits (35), Expect = 5e-09 Identities = 47/51 (92%) Strand = Plus / Plus Query: 255 tgggacgcgatggcgttcagcggcccggcgccggagcgcatcaacgggcgg 305 ||||||| | ||||||||||||| |||||||||||||| |||||||||||| Sbjct: 25483 tgggacgtgctggcgttcagcgggccggcgccggagcggatcaacgggcgg 25533
>dbj|AP003074.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJNBa0004G10 Length = 150379 Score = 69.9 bits (35), Expect = 5e-09 Identities = 47/51 (92%) Strand = Plus / Plus Query: 255 tgggacgcgatggcgttcagcggcccggcgccggagcgcatcaacgggcgg 305 ||||||| | ||||||||||||| |||||||||||||| |||||||||||| Sbjct: 58021 tgggacgtgctggcgttcagcgggccggcgccggagcggatcaacgggcgg 58071
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 69.9 bits (35), Expect = 5e-09 Identities = 47/51 (92%) Strand = Plus / Plus Query: 255 tgggacgcgatggcgttcagcggcccggcgccggagcgcatcaacgggcgg 305 ||||||| | ||||||||||||| |||||||||||||| |||||||||||| Sbjct: 4178496 tgggacgtgctggcgttcagcgggccggcgccggagcggatcaacgggcgg 4178546 Score = 69.9 bits (35), Expect = 5e-09 Identities = 47/51 (92%) Strand = Plus / Plus Query: 255 tgggacgcgatggcgttcagcggcccggcgccggagcgcatcaacgggcgg 305 ||||||| | ||||||||||||| |||||||||||||| |||||||||||| Sbjct: 4176055 tgggacgtgctggcgttcagcgggccggcgccggagcggatcaacgggcgg 4176105 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 250 cgatctgggacgcgatggcg 269 |||||||||||||||||||| Sbjct: 3291267 cgatctgggacgcgatggcg 3291286
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 69.9 bits (35), Expect = 5e-09 Identities = 47/51 (92%) Strand = Plus / Plus Query: 255 tgggacgcgatggcgttcagcggcccggcgccggagcgcatcaacgggcgg 305 ||||||| | ||||||||||||| |||||||||||||| |||||||||||| Sbjct: 8061370 tgggacgtgctggcgttcagcgggccggcgccggagcggatcaacgggcgg 8061420
>dbj|AP003826.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1361_E02 Length = 100168 Score = 69.9 bits (35), Expect = 5e-09 Identities = 47/51 (92%) Strand = Plus / Plus Query: 255 tgggacgcgatggcgttcagcggcccggcgccggagcgcatcaacgggcgg 305 ||||||| | ||||||||||||| |||||||||||||| |||||||||||| Sbjct: 62118 tgggacgtgctggcgttcagcgggccggcgccggagcggatcaacgggcgg 62168 Score = 69.9 bits (35), Expect = 5e-09 Identities = 47/51 (92%) Strand = Plus / Plus Query: 255 tgggacgcgatggcgttcagcggcccggcgccggagcgcatcaacgggcgg 305 ||||||| | ||||||||||||| |||||||||||||| |||||||||||| Sbjct: 59677 tgggacgtgctggcgttcagcgggccggcgccggagcggatcaacgggcgg 59727
>dbj|AK062972.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-109-E06, full insert sequence Length = 942 Score = 69.9 bits (35), Expect = 5e-09 Identities = 47/51 (92%) Strand = Plus / Plus Query: 255 tgggacgcgatggcgttcagcggcccggcgccggagcgcatcaacgggcgg 305 ||||||| | ||||||||||||| |||||||||||||| |||||||||||| Sbjct: 420 tgggacgtgctggcgttcagcgggccggcgccggagcggatcaacgggcgg 470
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 61.9 bits (31), Expect = 1e-06 Identities = 46/51 (90%) Strand = Plus / Minus Query: 255 tgggacgcgatggcgttcagcggcccggcgccggagcgcatcaacgggcgg 305 ||||||| | ||||||||||||| ||||||||||||| |||||||||||| Sbjct: 9470816 tgggacgtgctggcgttcagcgggccggcgccggagccgatcaacgggcgg 9470766
>dbj|AP004683.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0006C08 Length = 151987 Score = 61.9 bits (31), Expect = 1e-06 Identities = 46/51 (90%) Strand = Plus / Minus Query: 255 tgggacgcgatggcgttcagcggcccggcgccggagcgcatcaacgggcgg 305 ||||||| | ||||||||||||| ||||||||||||| |||||||||||| Sbjct: 84377 tgggacgtgctggcgttcagcgggccggcgccggagccgatcaacgggcgg 84327
>ref|XM_468708.1| Oryza sativa (japonica cultivar-group), mRNA Length = 669 Score = 54.0 bits (27), Expect = 3e-04 Identities = 45/51 (88%) Strand = Plus / Plus Query: 255 tgggacgcgatggcgttcagcggcccggcgccggagcgcatcaacgggcgg 305 ||||||| | ||||||||||||| ||||| ||||||| |||||||||||| Sbjct: 250 tgggacgtgctggcgttcagcgggccggcaacggagcggatcaacgggcgg 300
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 54.0 bits (27), Expect = 3e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 255 tgggacgcgatggcgttcagcggcccggcgccggagcgcatcaacgggcgg 305 ||||||| | ||||||||||||| ||||| ||||||| |||||||||||| Sbjct: 17148521 tgggacgtgctggcgttcagcgggccggcaacggagcggatcaacgggcgg 17148471
>gb|AC137992.2| Oryza sativa chromosome 3 BAC OSJNBb0056B16 genomic sequence, complete sequence Length = 153247 Score = 54.0 bits (27), Expect = 3e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 255 tgggacgcgatggcgttcagcggcccggcgccggagcgcatcaacgggcgg 305 ||||||| | ||||||||||||| ||||| ||||||| |||||||||||| Sbjct: 39914 tgggacgtgctggcgttcagcgggccggcaacggagcggatcaacgggcgg 39864
>emb|AL731611.2|OSJN00253 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0072D08, complete sequence Length = 142814 Score = 54.0 bits (27), Expect = 3e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 255 tgggacgcgatggcgttcagcggcccggcgccggagcgcatcaacgggcgg 305 ||||||| | ||||||||||||| ||||||||||||| |||||| ||||| Sbjct: 137716 tgggacgtgctggcgttcagcgggccggcgccggagccgatcaacaggcgg 137666
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 54.0 bits (27), Expect = 3e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 255 tgggacgcgatggcgttcagcggcccggcgccggagcgcatcaacgggcgg 305 ||||||| | ||||||||||||| ||||||||||||| |||||| ||||| Sbjct: 11129061 tgggacgtgctggcgttcagcgggccggcgccggagccgatcaacaggcgg 11129011
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 54.0 bits (27), Expect = 3e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 255 tgggacgcgatggcgttcagcggcccggcgccggagcgcatcaacgggcgg 305 ||||||| | ||||||||||||| ||||| ||||||| |||||||||||| Sbjct: 17142090 tgggacgtgctggcgttcagcgggccggcaacggagcggatcaacgggcgg 17142040
>gb|AF017356.1|AF017356 Oryza sativa low molecular early light-inducible protein mRNA, complete cds Length = 818 Score = 54.0 bits (27), Expect = 3e-04 Identities = 45/51 (88%) Strand = Plus / Plus Query: 255 tgggacgcgatggcgttcagcggcccggcgccggagcgcatcaacgggcgg 305 ||||||| | ||||||||| ||| ||||||||||| || |||||||||||| Sbjct: 330 tgggacgtgctggcgttcaacgggccggcgccggaacggatcaacgggcgg 380
>gb|AF017357.1|AF017357 Oryza sativa low molecular early light-inducible protein mRNA, complete cds Length = 883 Score = 46.1 bits (23), Expect = 0.076 Identities = 45/51 (88%), Gaps = 1/51 (1%) Strand = Plus / Plus Query: 255 tgggacgcgatggcgttcagcggcccggcgccggagcgcatcaacgggcgg 305 ||||||| | ||||||||| ||| ||||||||||| || |||||||||||| Sbjct: 395 tgggacgtgctggcgttca-cgggccggcgccggaacggatcaacgggcgg 444
>gb|AY546021.1| Fungal endophyte WMS28 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence Length = 465 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 161 gccggcgctgggccggcgcgc 181 ||||||||||||||||||||| Sbjct: 79 gccggcgctgggccggcgcgc 59
>gb|CP000157.1| Erythrobacter litoralis HTCC2594, complete genome Length = 3052398 Score = 42.1 bits (21), Expect = 1.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 100 ccttcgtcggcgccgccgtcctgcc 124 |||||||||||||||||| |||||| Sbjct: 2592286 ccttcgtcggcgccgccgccctgcc 2592262
>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome Length = 7036071 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 139 gccgcttcggcgcccgttcag 159 ||||||||||||||||||||| Sbjct: 2442046 gccgcttcggcgcccgttcag 2442066
>ref|XM_476698.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1902 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 250 cgatctgggacgcgatggcg 269 |||||||||||||||||||| Sbjct: 780 cgatctgggacgcgatggcg 799
>ref|XM_506171.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1714_H10.127 mRNA Length = 1913 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 250 cgatctgggacgcgatggcg 269 |||||||||||||||||||| Sbjct: 792 cgatctgggacgcgatggcg 811
>gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome Length = 3345170 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 102 ttcgtcggcgccgccgtcct 121 |||||||||||||||||||| Sbjct: 1000498 ttcgtcggcgccgccgtcct 1000517
>gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete sequence Length = 3806533 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 162 ccggcgctgggccggcgcgc 181 |||||||||||||||||||| Sbjct: 527740 ccggcgctgggccggcgcgc 527721
>dbj|AK098844.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000B24, full insert sequence Length = 1902 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 250 cgatctgggacgcgatggcg 269 |||||||||||||||||||| Sbjct: 780 cgatctgggacgcgatggcg 799
>dbj|AK065047.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013001I08, full insert sequence Length = 1915 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 250 cgatctgggacgcgatggcg 269 |||||||||||||||||||| Sbjct: 792 cgatctgggacgcgatggcg 811
>dbj|AP003847.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1714_H10 Length = 191580 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 250 cgatctgggacgcgatggcg 269 |||||||||||||||||||| Sbjct: 100960 cgatctgggacgcgatggcg 100979 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,685,330 Number of Sequences: 3902068 Number of extensions: 1685330 Number of successful extensions: 37100 Number of sequences better than 10.0: 34 Number of HSP's better than 10.0 without gapping: 33 Number of HSP's successfully gapped in prelim test: 1 Number of HSP's that attempted gapping in prelim test: 36647 Number of HSP's gapped (non-prelim): 454 length of query: 352 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 330 effective length of database: 17,147,199,772 effective search space: 5658575924760 effective search space used: 5658575924760 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)