ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baak4h23
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|CP000013.1| Borrelia garinii PBi, complete genome 38 9.2
2gb|AE017347.1| Cryptococcus neoformans var. neoformans JEC21 chr... 38 9.2
3gb|DQ149987.1| Streptomyces neyagawaensis concanamycin A biosynt... 38 9.2
4gb|AC146394.3| Pan troglodytes BAC clone RP43-55L17 from 7, comp... 38 9.2
5emb|BX510935.28| Zebrafish DNA sequence from clone DKEY-207L24 i... 38 9.2
6gb|AC091650.4| Homo sapiens BAC clone RP13-496E15 from 7, comple... 38 9.2
7gb|AC145768.1| Pan troglodytes BAC clone RP43-5G4 from 7, comple... 38 9.2
8gb|AF440781.1| Streptomyces cinnamonensis polyether antibiotic m... 38 9.2
9emb|AL662903.10| Mouse DNA sequence from clone RP23-419P16 on ch... 38 9.2
10emb|AJ437001.1|PPU437001 Pseudomonas putida phnR gene, phnW gene... 38 9.2
11emb|BX901980.12| Zebrafish DNA sequence from clone CH211-258F1 i... 38 9.2
12gb|AC008618.7| Homo sapiens chromosome 5 clone CTB-146E17, compl... 38 9.2
13gb|AC092458.5| Homo sapiens BAC clone RP13-612N21 from 4, comple... 38 9.2
14gb|AC008565.6|AC008565 Homo sapiens chromosome 5 clone CTC-538F1... 38 9.2
15gb|AE016753.1| Mus musculus chromosome 10 high-growth region, se... 38 9.2
16emb|AL954387.17| Zebrafish DNA sequence from clone CH211-288B20 ... 38 9.2
17dbj|BS000218.1| Pan troglodytes chromosome 22 clone:PTB-414O06, ... 38 9.2
18gb|AC153366.7| Mus musculus 10 BAC RP23-243B24 (Roswell Park Can... 38 9.2
19emb|AL805930.16| Mouse DNA sequence from clone RP23-455B8 on chr... 38 9.2

>gb|CP000013.1| Borrelia garinii PBi, complete genome
          Length = 904246

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 32     tttataagtttttattaga 50
              |||||||||||||||||||
Sbjct: 561869 tttataagtttttattaga 561887



to top

>gb|AE017347.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 7, complete
              sequence
          Length = 1347793

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 92     agttcgaggtgttttgatc 110
              |||||||||||||||||||
Sbjct: 964364 agttcgaggtgttttgatc 964382



to top

>gb|DQ149987.1| Streptomyces neyagawaensis concanamycin A biosynthetic gene cluster,
             complete sequence
          Length = 99892

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 1     gcccgcatcgtcgccgtac 19
             |||||||||||||||||||
Sbjct: 57894 gcccgcatcgtcgccgtac 57912



to top

>gb|AC146394.3| Pan troglodytes BAC clone RP43-55L17 from 7, complete sequence
          Length = 157809

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 42     tttattagatctgttactt 60
              |||||||||||||||||||
Sbjct: 145458 tttattagatctgttactt 145476



to top

>emb|BX510935.28| Zebrafish DNA sequence from clone DKEY-207L24 in linkage group 14,
             complete sequence
          Length = 128666

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 28    atgctttataagtttttat 46
             |||||||||||||||||||
Sbjct: 73496 atgctttataagtttttat 73478



to top

>gb|AC091650.4| Homo sapiens BAC clone RP13-496E15 from 7, complete sequence
          Length = 45819

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 42    tttattagatctgttactt 60
             |||||||||||||||||||
Sbjct: 31600 tttattagatctgttactt 31582



to top

>gb|AC145768.1| Pan troglodytes BAC clone RP43-5G4 from 7, complete sequence
          Length = 154325

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 42     tttattagatctgttactt 60
              |||||||||||||||||||
Sbjct: 116495 tttattagatctgttactt 116477



to top

>gb|AF440781.1| Streptomyces cinnamonensis polyether antibiotic monensin biosynthesis
             gene cluster, partial sequence
          Length = 103450

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 1     gcccgcatcgtcgccgtac 19
             |||||||||||||||||||
Sbjct: 44548 gcccgcatcgtcgccgtac 44566



to top

>emb|AL662903.10| Mouse DNA sequence from clone RP23-419P16 on chromosome 11 Contain the
              gene for olfactory receptor MOR278-1,  an olfactory
              receptor pseudogene, three novel genes,  the gene for
              olfactory receptor MOR222-2, an olfactory receptor
              pseudogene (MOR222-4P), the gene for olfactory receptor
              MOR222-1, part of a novel gene, a novel gene
              (2810021J22Rik) and a novel zinc finger gene, complete
              sequence
          Length = 146349

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 116    atggtggacatgatctgtt 134
              |||||||||||||||||||
Sbjct: 125862 atggtggacatgatctgtt 125844



to top

>emb|AJ437001.1|PPU437001 Pseudomonas putida phnR gene, phnW gene and phnX gene
          Length = 2962

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 124 catgatctgtttatccaac 142
           |||||||||||||||||||
Sbjct: 298 catgatctgtttatccaac 316



to top

>emb|BX901980.12| Zebrafish DNA sequence from clone CH211-258F1 in linkage group 22,
              complete sequence
          Length = 163109

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 28     atgctttataagtttttat 46
              |||||||||||||||||||
Sbjct: 151567 atgctttataagtttttat 151585



to top

>gb|AC008618.7| Homo sapiens chromosome 5 clone CTB-146E17, complete sequence
          Length = 139029

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 43    ttattagatctgttacttg 61
             |||||||||||||||||||
Sbjct: 66642 ttattagatctgttacttg 66624



to top

>gb|AC092458.5| Homo sapiens BAC clone RP13-612N21 from 4, complete sequence
          Length = 126619

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 131  tgtttatccaaccgttaat 149
            |||||||||||||||||||
Sbjct: 9789 tgtttatccaaccgttaat 9807



to top

>gb|AC008565.6|AC008565 Homo sapiens chromosome 5 clone CTC-538F12, complete sequence
          Length = 167086

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 43    ttattagatctgttacttg 61
             |||||||||||||||||||
Sbjct: 56632 ttattagatctgttacttg 56650



to top

>gb|AE016753.1| Mus musculus chromosome 10 high-growth region, section 1 of 2 of the
              complete sequence
          Length = 350029

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 72     tattttgaactcagctctt 90
              |||||||||||||||||||
Sbjct: 266086 tattttgaactcagctctt 266104



to top

>emb|AL954387.17| Zebrafish DNA sequence from clone CH211-288B20 in linkage group 18,
              complete sequence
          Length = 125744

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 31     ctttataagtttttattag 49
              |||||||||||||||||||
Sbjct: 113899 ctttataagtttttattag 113881



to top

>dbj|BS000218.1| Pan troglodytes chromosome 22 clone:PTB-414O06, map 22, complete
            sequences
          Length = 92059

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                       
Query: 37   aagtttttattagatctgttacttgtg 63
            ||||| |||||||| ||||||||||||
Sbjct: 2357 aagttgttattagacctgttacttgtg 2331



to top

>gb|AC153366.7| Mus musculus 10 BAC RP23-243B24 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 184707

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 72    tattttgaactcagctctt 90
             |||||||||||||||||||
Sbjct: 61801 tattttgaactcagctctt 61783



to top

>emb|AL805930.16| Mouse DNA sequence from clone RP23-455B8 on chromosome 4, complete
             sequence
          Length = 174746

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 35    ataagtttttattagatct 53
             |||||||||||||||||||
Sbjct: 59762 ataagtttttattagatct 59780


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,448,806
Number of Sequences: 3902068
Number of extensions: 1448806
Number of successful extensions: 107582
Number of sequences better than 10.0: 19
Number of HSP's better than 10.0 without gapping: 19
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 107520
Number of HSP's gapped (non-prelim): 62
length of query: 186
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 164
effective length of database: 17,147,199,772
effective search space: 2812140762608
effective search space used: 2812140762608
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top