>emb|AL136164.8| Human DNA sequence from clone RP3-331H24 on chromosome 6 Contains the
             5' end of a novel gene, the gene for a novel protein
             similar to opioid growth factor receptor and a CpG island,
             complete sequence
          Length = 108253

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 125   tgtcagttttgcatccactttagaa 149
             |||| ||||||||||||||||||||
Sbjct: 83716 tgtctgttttgcatccactttagaa 83740

>gb|AC005813.13|AC005813 Drosophila melanogaster, chromosome 3R, region 97B2-97B9, BAC clone
              BACR48G23, complete sequence
          Length = 166543

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 200    tattatattattatcttgtgt 220
              |||||||||||||||||||||
Sbjct: 158270 tattatattattatcttgtgt 158290

>gb|AC008214.4|AC008214 Drosophila melanogaster, chromosome 3R, region 97B-97C, BAC clone
             BACR13P17, complete sequence
          Length = 170403

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 200   tattatattattatcttgtgt 220
             |||||||||||||||||||||
Sbjct: 17773 tattatattattatcttgtgt 17793

>gb|AE003756.3| Drosophila melanogaster chromosome 3R, section 94 of 118 of the complete
              sequence
          Length = 322332

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 200    tattatattattatcttgtgt 220
              |||||||||||||||||||||
Sbjct: 262030 tattatattattatcttgtgt 262050

>emb|AL929132.9| Mouse DNA sequence from clone RP23-346G8 on chromosome 2, complete
             sequence
          Length = 129438

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 200   tattatattattatcttgtgtctca 224
             ||||||||||||||||||| |||||
Sbjct: 86450 tattatattattatcttgtatctca 86426

>ref|XM_633680.1| Dictyostelium discoideum hypothetical protein (DDB0185867), partial
           mRNA
          Length = 1230

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 197 tagtattatattattatctt 216
           ||||||||||||||||||||
Sbjct: 393 tagtattatattattatctt 374

>gb|AE017335.3| Bacillus anthracis str. 'Ames Ancestor' plasmid pXO2, complete sequence
          Length = 94830

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 117   aatttggctgtcagttttgc 136
             ||||||||||||||||||||
Sbjct: 40450 aatttggctgtcagttttgc 40431

>gb|AF188935.1| Bacillus anthracis plasmid pXO2, complete sequence
          Length = 96231

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 117   aatttggctgtcagttttgc 136
             ||||||||||||||||||||
Sbjct: 40948 aatttggctgtcagttttgc 40929

>gb|AC105910.10| Homo sapiens chromosome 8, clone CTD-2036J7, complete sequence
          Length = 190836

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 200   tattatattattatcttgtg 219
             ||||||||||||||||||||
Sbjct: 74642 tattatattattatcttgtg 74661

>gb|AE011191.1| Bacillus anthracis str. A2012 plasmid pXO2, complete sequence
          Length = 94829

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 117   aatttggctgtcagttttgc 136
             ||||||||||||||||||||
Sbjct: 40450 aatttggctgtcagttttgc 40431

>emb|AL121767.6|CNS01DSC Human chromosome 14 DNA sequence BAC C-2593I21 of library CalTech-D from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 208309

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 194    atgtagtattatattattat 213
              ||||||||||||||||||||
Sbjct: 184661 atgtagtattatattattat 184642

>emb|AL133233.2|CNS01DUA Human chromosome 14 DNA sequence BAC R-34O18 of library RPCI-11
           from chromosome 14 of Homo sapiens (Human), complete
           sequence
          Length = 168991

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 194 atgtagtattatattattat 213
           ||||||||||||||||||||
Sbjct: 447 atgtagtattatattattat 428

>emb|AL807234.6| Mouse DNA sequence from clone RP23-293E12 on chromosome 4, complete
              sequence
          Length = 226546

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 217    gtgtctcataaacagctgtt 236
              ||||||||||||||||||||
Sbjct: 163297 gtgtctcataaacagctgtt 163278


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,467,552
Number of Sequences: 3902068
Number of extensions: 2467552
Number of successful extensions: 51424
Number of sequences better than 10.0: 13
Number of HSP's better than 10.0 without gapping: 13
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 51406
Number of HSP's gapped (non-prelim): 18
length of query: 308
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 286
effective length of database: 17,147,199,772
effective search space: 4904099134792
effective search space used: 4904099134792
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)