Clone Information

BLAST Search Result

Clone Name	rbasdp12
Clone Library Name	barley_pub

No.	Definition	Score (bits)	E Value
1	emb\|AJ488508.1\|TAE488508 Triticum aestivum mRNA for triacylglyce...	430	e-117
2	emb\|AJ488507.1\|TAE488507 Triticum aestivum mRNA for triacylglyce...	365	1e-97
3	ref\|NM_190064.1\| Oryza sativa (japonica cultivar-group), predic...	90	1e-14
4	dbj\|AP008207.1\| Oryza sativa (japonica cultivar-group) genomic D...	90	1e-14
5	dbj\|AP003266.3\| Oryza sativa (japonica cultivar-group) genomic D...	90	1e-14
6	dbj\|AK101890.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	90	1e-14
7	gb\|AC109145.11\| Mus musculus chromosome 1, clone RP23-109O14, co...	46	0.16
8	gb\|AC147514.12\| Mus musculus chromosome 1, clone RP23-442A6, com...	46	0.16
9	gb\|AC161520.6\| Mus musculus chromosome 7, clone RP24-282D19, com...	46	0.16
10	gb\|AF037036.1\|AF037036 Zea mays 6-phosphogluconate dehydrogenase...	46	0.16
11	emb\|CT030656.7\| Mouse DNA sequence from clone RP23-271O7 on chro...	46	0.16
12	emb\|AL807245.17\| Mouse DNA sequence from clone RP23-102B2 on chr...	46	0.16
13	gb\|AC137848.31\| Mus musculus chromosome 9, clone RP24-118I23, co...	44	0.63
14	gb\|AC158148.5\| Mus musculus chromosome 1, clone RP24-353B6, comp...	44	0.63
15	gb\|AE014850.1\| Plasmodium falciparum 3D7 chromosome 12, section ...	44	0.63
16	gb\|AC114619.9\| Mus musculus chromosome 5, clone RP24-86I23, comp...	44	0.63
17	gb\|AC106595.9\| Rattus norvegicus 7 BAC CH230-237N20 (Children's ...	44	0.63
18	gb\|AC129576.11\| Mus musculus chromosome 10, clone RP24-343D9, co...	44	0.63
19	ref\|XM_591758.2\| PREDICTED: Bos taurus similar to pleckstrin hom...	44	0.63
20	gb\|AC124806.11\| Mus musculus chromosome 1, clone RP24-282F20, co...	44	0.63
21	gb\|AC124549.5\| Mus musculus BAC clone RP23-284E24 from 13, compl...	44	0.63
22	gb\|CP000091.1\| Ralstonia eutropha JMP134 chromosome 2, complete ...	44	0.63
23	emb\|AL137161.24\| Human DNA sequence from clone RP1-130L23 on chr...	44	0.63
24	gb\|AC160970.7\| Mus musculus BAC clone RP24-492D11 from chromosom...	44	0.63
25	gb\|AC154747.2\| Mus musculus BAC clone RP23-116N15 from chromosom...	44	0.63
26	gb\|AC068907.53\| Mus musculus strain C57BL/6J clone rp23-347f7 ma...	44	0.63
27	gb\|AC012417.13\| Homo sapiens chromosome 18, clone RP11-408H20, c...	44	0.63
28	gb\|AC159314.3\| Mus musculus BAC clone RP23-110E20 from chromosom...	44	0.63
29	gb\|AC154535.2\| Mus musculus BAC clone RP23-447M9 from chromosome...	44	0.63
30	gb\|AC154430.3\| Mus musculus BAC clone RP24-208K8 from chromosome...	44	0.63
31	gb\|AY157846.2\| Chlamydomonas reinhardtii putative nucleic acid b...	44	0.63
32	emb\|AL772264.8\| Mouse DNA sequence from clone RP23-15I21 on chro...	44	0.63
33	emb\|AL772190.6\| Mouse DNA sequence from clone RP23-124P7 on chro...	44	0.63
34	gb\|AC101706.9\| Mus musculus chromosome 15, clone RP23-256L18, co...	42	2.5
35	gb\|AC100927.11\| Mus musculus chromosome 3, clone RP23-72A21, com...	42	2.5
36	ref\|NM_032427.1\| Homo sapiens mastermind-like 2 (Drosophila) (MA...	42	2.5
37	gb\|AC161581.3\| Mus musculus chromosome 15, clone RP24-75A19, com...	42	2.5
38	gb\|AC005737.1\| Homo sapiens chromosome 16, BAC clone 97H22 (LANL...	42	2.5
39	gb\|BC042213.1\| Mus musculus a disintegrin-like and metallopeptid...	42	2.5
40	gb\|AC118640.8\| Mus musculus chromosome 15, clone RP24-112A20, co...	42	2.5
41	gb\|AC147098.2\| Mus musculus BAC clone RP23-452E7 from chromosome...	42	2.5
42	ref\|NM_131359.1\| Danio rerio bone morphogenetic protein 2a (bmp2...	42	2.5
43	gb\|AC121296.7\| Mus musculus chromosome 14, clone RP23-286K8, com...	42	2.5
44	gb\|AC118249.11\| Mus musculus chromosome 19, clone RP23-397G23, c...	42	2.5
45	gb\|AC131039.7\| Mus musculus chromosome 1, clone RP23-274I23, com...	42	2.5
46	gb\|AC124987.9\| Mus musculus chromosome 3, clone RP24-364E17, com...	42	2.5
47	gb\|AC126935.3\| Mus musculus BAC clone RP24-186K24 from chromosom...	42	2.5
48	gb\|AC122909.2\| Mus musculus BAC clone RP23-53K17 from 10, comple...	42	2.5
49	gb\|AC118006.9\| Mus musculus chromosome 14, clone RP23-344J14, co...	42	2.5
50	gb\|AC115751.6\| Mus musculus chromosome 1, clone RP23-16I21, comp...	42	2.5
51	gb\|AC109214.6\| Mus musculus chromosome 10, clone RP23-352E22, co...	42	2.5
52	gb\|AC158914.4\| Mus musculus chromosome 5, clone RP24-249F11, com...	42	2.5
53	emb\|AL161944.22\| Human DNA sequence from clone RP5-1079N22 on ch...	42	2.5
54	emb\|AL138894.11\| Human DNA sequence from clone RP11-28O4 on chro...	42	2.5
55	gb\|AC158907.2\| Mus musculus chromosome 15, clone RP24-266D22, co...	42	2.5
56	gb\|AC105586.5\| Rattus norvegicus 3 BAC CH230-239D4 (Children's H...	42	2.5
57	emb\|AL596122.14\| Mouse DNA sequence from clone RP23-320E6 on chr...	42	2.5
58	gb\|AC159616.2\| Mus musculus BAC clone RP24-497G20 from chromosom...	42	2.5
59	gb\|AC096888.2\| Homo sapiens chromosome 3 clone RP11-14D22, compl...	42	2.5
60	dbj\|AK142854.1\| Mus musculus 15 days embryo head cDNA, RIKEN ful...	42	2.5
61	gb\|AC104301.2\| Homo sapiens chromosome 3 clone RP11-150N22, comp...	42	2.5
62	gb\|AC122754.13\| Mus musculus chromosome 1, clone RP24-510K10, co...	42	2.5
63	gb\|AY040322.1\| Homo sapiens nuclear transcription factor/notch r...	42	2.5
64	gb\|AY135688.1\| Mus musculus argonaute 2 protein (Ago2) gene, par...	42	2.5
65	emb\|AL928932.14\| Mouse DNA sequence from clone RP24-235B14 on ch...	42	2.5
66	dbj\|AP000929.6\| Homo sapiens genomic DNA, chromosome 11 clone:RP...	42	2.5
67	dbj\|AP000848.5\| Homo sapiens genomic DNA, chromosome 11 clone:RP...	42	2.5
68	gb\|AC121944.4\| Mus musculus BAC clone RP24-211H19 from chromosom...	42	2.5
69	gb\|U82233.1\|DRU82233 Danio rerio BMP2 mRNA, complete cds	42	2.5
70	gb\|AC174648.2\| Mus musculus BAC clone CH36-236I19 from chromosom...	42	2.5
71	gb\|AC111202.5\| Mus musculus BAC clone RP23-338I3 from 9, complet...	42	2.5
72	emb\|CT033847.5\| Mouse DNA sequence from clone RP24-225N8 on chro...	42	2.5
73	gb\|AC154142.24\| Mus musculus chromosome 1, clone RP23-187M7, com...	42	2.5
74	emb\|AL671275.11\| Mouse DNA sequence from clone RP23-344J21 on ch...	42	2.5
75	emb\|AL844495.6\| Mouse DNA sequence from clone RP23-252L9 on chro...	42	2.5
76	emb\|AL805951.6\| Mouse DNA sequence from clone RP23-326P3 on chro...	42	2.5
77	gb\|AC016586.9\| Homo sapiens chromosome 19 clone CTD-2622I13, com...	42	2.5
78	dbj\|AB058722.1\| Homo sapiens mRNA for KIAA1819 protein, partial cds	42	2.5
79	gb\|AC133860.5\| Oryza sativa chromosome 3 BAC OSJNBa0091E13 genom...	40	9.8
80	gb\|AC009749.9\| Drosophila melanogaster clone BACR40I04, complete...	40	9.8
81	ref\|NM_125992.3\| Arabidopsis thaliana unknown protein AT5G65950 ...	40	9.8
82	ref\|NM_001037079.1\| Arabidopsis thaliana unknown protein AT5G659...	40	9.8
83	gb\|AC138671.16\| Mus musculus chromosome 5, clone RP23-443N7, com...	40	9.8
84	gb\|AC101807.12\| Mus musculus chromosome 18, clone RP24-251J22, c...	40	9.8
85	gb\|AY602221.1\| Petromyzon marinus bone morphogenetic protein 24B...	40	9.8
86	gb\|AY602220.1\| Petromyzon marinus bone morphogenetic protein 24A...	40	9.8
87	gb\|AC150430.3\| Branchiostoma floridae clone CH302-99K22, complet...	40	9.8
88	gb\|AC144767.4\| Mus musculus BAC clone RP23-82F8 from chromosome ...	40	9.8
89	gb\|AC154520.3\| Mus musculus BAC clone RP23-471P16 from chromosom...	40	9.8
90	gb\|AC166158.3\| Mus musculus BAC clone RP24-244P14 from chromosom...	40	9.8
91	ref\|XM_470485.1\| Oryza sativa (japonica cultivar-group), mRNA	40	9.8
92	ref\|NM_057101.1\| Rattus norvegicus cytochrome P450, subfamily 21...	40	9.8
93	gb\|AC153147.7\| Mus musculus BAC clone RP23-205D14 from chromosom...	40	9.8
94	gb\|AC160028.9\| Mus musculus 10 BAC RP24-570M12 (Roswell Park Can...	40	9.8
95	gb\|AY542940.1\| Cyrtodiopsis dalmanni clone ms-361A microsatellit...	40	9.8
96	gb\|AC145508.3\| Dasypus novemcinctus clone VMRC5-464O17, complete...	40	9.8
97	gb\|AC137110.11\| Mus musculus chromosome 7, clone RP23-399P8, com...	40	9.8
98	ref\|NM_181819.1\| Mus musculus WAP, follistatin/kazal, immunoglob...	40	9.8
99	gb\|AC158308.4\| Mus musculus chromosome 3, clone RP23-182M12, com...	40	9.8
100	gb\|CP000081.1\| Leishmania major chromosome 35, complete sequence	40	9.8
101	gb\|AF050737.1\| Homo sapiens dopamine D2 receptor (DRD2) gene, co...	40	9.8
102	gb\|AC119857.10\| Mus musculus chromosome 3, clone RP23-257A18, co...	40	9.8
103	gb\|AC165357.4\| Mus musculus BAC clone RP23-114G24 from chromosom...	40	9.8
104	gb\|AC153878.11\| Mus musculus 6 BAC RP23-229B22 (Roswell Park Can...	40	9.8
105	gb\|AF040661.4\| Caenorhabditis elegans cosmid W10G11, complete se...	40	9.8
106	gb\|AC103632.8\| Mus musculus chromosome 1, clone RP24-555D5, comp...	40	9.8
107	gb\|AC099628.7\| Mus musculus chromosome 1, clone RP24-82L18, comp...	40	9.8
108	gb\|AC150281.1\| Xenopus tropicalis BAC clone ISB1-110D7 containin...	40	9.8
109	gb\|AC007890.6\| Drosophila melanogaster clone BACR02G21, complete...	40	9.8
110	gb\|AC118934.9\| Mus musculus chromosome 19, clone RP24-172J14, co...	40	9.8
111	ref\|XM_589529.2\| PREDICTED: Bos taurus similar to small nuclear ...	40	9.8
112	ref\|NM_001001392.1\| Homo sapiens CD44 molecule (Indian blood gro...	40	9.8
113	ref\|NM_001001390.1\| Homo sapiens CD44 molecule (Indian blood gro...	40	9.8
114	ref\|NM_000610.3\| Homo sapiens CD44 molecule (Indian blood group)...	40	9.8
115	ref\|NM_001001389.1\| Homo sapiens CD44 molecule (Indian blood gro...	40	9.8
116	ref\|NM_001001391.1\| Homo sapiens CD44 molecule (Indian blood gro...	40	9.8
117	ref\|XM_960532.1\| Neurospora crassa OR74A hypothetical protein (N...	40	9.8
118	ref\|XM_590721.2\| PREDICTED: Bos taurus similar to Nuclear mitoti...	40	9.8
119	ref\|XM_960050.1\| Neurospora crassa OR74A hypothetical protein (N...	40	9.8
120	ref\|XM_325129.1\| Neurospora crassa OR74A hypothetical protein (N...	40	9.8
121	ref\|XM_330130.1\| Neurospora crassa OR74A hypothetical protein (N...	40	9.8
122	gb\|DQ504427.1\| Homo sapiens DNA cross-link repair 1C (PSO2 homol...	40	9.8
123	ref\|XM_868267.1\| PREDICTED: Bos taurus similar to trinucleotide ...	40	9.8
124	ref\|XM_881454.1\| PREDICTED: Bos taurus similar to trinucleotide ...	40	9.8
125	ref\|XM_583430.2\| PREDICTED: Bos taurus similar to trinucleotide ...	40	9.8
126	gb\|AC147132.3\| Mus musculus BAC clone RP24-189K3 from chromosome...	40	9.8
127	ref\|XM_676394.1\| Aspergillus nidulans FGSC A4 hypothetical prote...	40	9.8
128	gb\|BT014632.1\| Drosophila melanogaster SD12316 full insert cDNA	40	9.8
129	gb\|AC147638.2\| Mus musculus BAC clone RP23-181L5 from chromosome...	40	9.8
130	gb\|AY494871.1\| Ceratocystis fimbriata microsatellite CAG-15 sequ...	40	9.8
131	gb\|AC158215.3\| Mus musculus chromosome 7, clone RP24-180E12, com...	40	9.8
132	gb\|AC087252.3\| Papio anubis clone RP41-265N24, complete sequence	40	9.8
133	gb\|AC151982.4\| Mus musculus BAC clone RP23-445J16 from chromosom...	40	9.8
134	gb\|AF220262.1\| Drosophila virilis TATA box-binding protein (TBP)...	40	9.8
135	gb\|AC153378.4\| Mus musculus 6 BAC RP23-106C18 (Roswell Park Canc...	40	9.8
136	gb\|AC113475.12\| Mus musculus chromosome 12, clone RP23-304B1, co...	40	9.8
137	gb\|AC164002.4\| Mus musculus chromosome 3, clone RP24-114A9, comp...	40	9.8
138	gb\|AC115860.9\| Mus musculus chromosome 1, clone RP24-290C11, com...	40	9.8
139	gb\|DP000009.1\| Oryza sativa (japonica cultivar-group) chromosome 3	40	9.8
140	gb\|AC154726.2\| Mus musculus BAC clone RP24-373I6 from chromosome...	40	9.8
141	gb\|AY190956.1\| Drosophila virilis clone DVIF01_06_H02 (D1438) ge...	40	9.8
142	gb\|AC115073.9\| Mus musculus chromosome 8, clone RP24-417J18, com...	40	9.8
143	gb\|AC099735.47\| Mus musculus chromosome 1, clone RP23-218I9, com...	40	9.8
144	gb\|AC131756.3\| Mus musculus BAC clone RP24-199J23 from chromosom...	40	9.8
145	gb\|AC102734.11\| Mus musculus chromosome 6, clone RP24-222N4, com...	40	9.8
146	gb\|AC107865.7\| Mus musculus chromosome 1, clone RP23-389C9, comp...	40	9.8
147	gb\|AC101542.19\| Mus musculus chromosome 19, clone RP23-456B17, c...	40	9.8
148	gb\|AC141478.3\| Mus musculus BAC clone RP24-82N16 from chromosome...	40	9.8
149	emb\|AJ131894.1\|HSA131894 Homo sapiens genomic CAG repeat element...	40	9.8
150	gb\|AC055873.8\| Homo sapiens chromosome 15, clone RP11-339F1, com...	40	9.8
151	gb\|AC118000.14\| Mus musculus chromosome 3, clone RP23-33M9, comp...	40	9.8
152	gb\|AC131765.3\| Mus musculus BAC clone RP24-240I9 from chromosome...	40	9.8
153	gb\|AC131700.3\| Mus musculus BAC clone RP24-67N3 from chromosome ...	40	9.8
154	gb\|AC124728.5\| Mus musculus BAC clone RP23-470C22 from chromosom...	40	9.8
155	ref\|XM_853603.1\| PREDICTED: Canis familiaris similar to HLA-B as...	40	9.8
156	ref\|XM_844311.1\| PREDICTED: Canis familiaris similar to HLA-B as...	40	9.8
157	ref\|XM_538834.2\| PREDICTED: Canis familiaris similar to HLA-B as...	40	9.8
158	gb\|AC127552.3\| Mus musculus BAC clone RP24-550N13 from chromosom...	40	9.8
159	gb\|AC124694.3\| Mus musculus BAC clone RP24-171H8 from chromosome...	40	9.8
160	gb\|AC125486.4\| Mus musculus BAC clone RP23-21G7 from chromosome ...	40	9.8
161	gb\|AC140436.3\| Mus musculus BAC clone RP23-85O2 from chromosome ...	40	9.8
162	gb\|AC124571.5\| Mus musculus BAC clone RP23-155I21 from chromosom...	40	9.8
163	gb\|AC122342.4\| Mus musculus BAC clone RP23-357O17 from chromosom...	40	9.8
164	gb\|AC122367.4\| Mus musculus BAC clone RP23-449L24 from chromosom...	40	9.8
165	ref\|XM_805955.1\| Trypanosoma cruzi strain CL Brener kinesin (Tc0...	40	9.8
166	gb\|AC124352.2\| Mus musculus BAC clone RP24-477C23 from chromosom...	40	9.8
167	gb\|AC124682.4\| Mus musculus BAC clone RP24-336O24 from chromosom...	40	9.8
168	gb\|AC123053.4\| Mus musculus BAC clone RP24-374O20 from chromosom...	40	9.8
169	gb\|AC122026.3\| Mus musculus BAC clone RP24-390D21 from chromosom...	40	9.8
170	gb\|AC122522.4\| Mus musculus BAC clone RP24-486D23 from chromosom...	40	9.8
171	gb\|AC117259.3\| Mus musculus BAC clone RP24-492O19 from chromosom...	40	9.8
172	gb\|AC129192.4\| Mus musculus BAC clone RP24-113B19 from chromosom...	40	9.8
173	gb\|AC121862.3\| Mus musculus BAC clone RP24-110E10 from chromosom...	40	9.8
174	gb\|AC124200.4\| Mus musculus BAC clone RP23-328F5 from chromosome...	40	9.8
175	gb\|AE014304.1\| Homo sapiens chromosome 13q34 schizophrenia regio...	40	9.8
176	gb\|AC018688.9\| Homo sapiens BAC clone RP11-462H3 from UL, comple...	40	9.8
177	gb\|AC098738.2\| Mus musculus BAC clone RP23-122F7 from 8, complet...	40	9.8
178	gb\|AC117213.3\| Mus musculus BAC clone RP23-305J6 from 6, complet...	40	9.8
179	gb\|AC104920.10\| Mus musculus chromosome 10, clone RP23-360H23, c...	40	9.8
180	gb\|AC098887.4\| Mus musculus BAC clone RP23-122N6 from 10, comple...	40	9.8
181	gb\|AC121600.2\| Mus musculus BAC clone RP23-302K1 from 17, comple...	40	9.8
182	gb\|AC146200.2\| Pan troglodytes BAC clone RP43-34F23 from 7, comp...	40	9.8
183	gb\|AC072063.5\| Homo sapiens BAC clone RP11-697B15 from 7, comple...	40	9.8
184	gb\|AC107830.10\| Mus musculus chromosome 16, clone RP23-230L20, c...	40	9.8
185	gb\|AC164516.2\| Dasypus novemcinctus clone VMRC5-470I13, complete...	40	9.8
186	gb\|AC165347.4\| Mus musculus BAC clone RP23-348B21 from chromosom...	40	9.8
187	gb\|AC160462.6\| Mus musculus chromosome 1, clone RP23-225K21, com...	40	9.8
188	gb\|AC163638.2\| Mus musculus BAC clone RP23-188H10 from chromosom...	40	9.8
189	gb\|AC154352.2\| Mus musculus BAC clone RP24-545J11 from chromosom...	40	9.8
190	gb\|AY167905.1\| Drosophila melanogaster clone F scribbled (scrib)...	40	9.8
191	emb\|AL133330.14\| Human DNA sequence from clone RP1-68D18 on chro...	40	9.8
192	emb\|Z95114.19\|HS212A2 Human DNA sequence from clone CTA-212A2 on...	40	9.8
193	emb\|AL691482.16\| Human DNA sequence from clone RP11-510N19 on ch...	40	9.8
194	emb\|AL603783.14\| Human DNA sequence from clone RP11-216B13 on ch...	40	9.8
195	emb\|AL589725.6\| Human DNA sequence from clone RP11-280I21 on chr...	40	9.8
196	gb\|DQ471716.1\| Isoplexis canariensis CYCLOIDEA-like protein (cyc...	40	9.8
197	emb\|AL392043.21\| Human DNA sequence from clone RP11-288G11 on ch...	40	9.8
198	emb\|AL392163.8\| Human DNA sequence from clone RP11-43M11 on chro...	40	9.8
199	emb\|AL359918.43\| Human DNA sequence from clone RP11-567G24 on ch...	40	9.8
200	emb\|AL360083.27\| Human DNA sequence from clone RP11-2K17 on chro...	40	9.8
201	ref\|XM_504405.1\| Yarrowia lipolytica CLIB122, YALI0E25960g predi...	40	9.8
202	ref\|NM_131360.1\| Danio rerio bone morphogenetic protein 2b (bmp2...	40	9.8
203	gb\|AY100450.1\| Mus musculus novel secreted protein precursor, mR...	40	9.8
204	emb\|AL357508.10\| Human DNA sequence from clone RP11-457K6 on chr...	40	9.8
205	emb\|AL356098.10\| Human DNA sequence from clone RP11-457L23 on ch...	40	9.8
206	gb\|AC137971.4\| Mus musculus, clone RP23-135B1, complete sequence	40	9.8
207	emb\|AL139821.9\| Human DNA sequence from clone RP11-80K21 on chro...	40	9.8
208	emb\|AL136991.26\| Human DNA sequence from clone RP11-189J1 on chr...	40	9.8
209	emb\|AL137246.16\| Human DNA sequence from clone RP11-255P5 on chr...	40	9.8
210	emb\|AL031577.1\|HS391O22 Human DNA sequence from clone RP3-391O22...	40	9.8
211	gb\|AY308804.1\| Mus musculus growth and differentiation factor-as...	40	9.8
212	gb\|AC093176.6\| Mus musculus Strain C57BL6/J chromosome 6 BAC, RP...	40	9.8
213	gb\|BT000263.1\| Arabidopsis thaliana unknown protein (At5g65950) ...	40	9.8
214	gb\|AC163627.4\| Mus musculus BAC clone RP23-341E13 from chromosom...	40	9.8
215	emb\|X07134.1\|DMSHAKE4 D. melanogaster larval Shaker ShE mRNA for...	40	9.8
216	emb\|X07131.1\|DMSHAKE1 D. melanogaster adult Shaker ShA mRNA for ...	40	9.8
217	emb\|X06742.1\|DMSHB1MR D.melanogaster ShB1 mRNA for Shaker gene	40	9.8
218	gb\|AC166324.1\| Mus musculus BAC clone RP24-500J7 from chromosome...	40	9.8
219	gb\|AC118283.5\| Homo sapiens BAC clone RP11-1398P2 from 4, comple...	40	9.8
220	emb\|BX883044.1\| Rattus norvegicus chromosome 20, major histocomp...	40	9.8
221	emb\|BX842629.1\| Neurospora crassa DNA linkage group I BAC contig...	40	9.8
222	gb\|AC162948.4\| Mus musculus BAC clone RP23-14N2 from chromosome ...	40	9.8
223	gb\|AC164558.2\| Mus musculus BAC clone RP23-238F5 from chromosome...	40	9.8
224	gb\|AC151830.3\| Mus musculus BAC clone RP24-76I23 from chromosome...	40	9.8
225	ref\|NM_001015963.2\| Xenopus tropicalis bone morphogenetic protei...	40	9.8
226	gb\|AC153495.10\| Mus musculus 10 BAC RP23-468D5 (Roswell Park Can...	40	9.8
227	gb\|AC162382.8\| Mus musculus 6 BAC RP24-398M13 (Roswell Park Canc...	40	9.8
228	emb\|AL939113.1\|SCO939113 Streptomyces coelicolor A3(2) complete ...	40	9.8
229	emb\|AL672141.12\| Mouse DNA sequence from clone RP23-219C18 on ch...	40	9.8
230	emb\|AL832642.2\|HSM803952 Homo sapiens mRNA; cDNA DKFZp451K1918 (...	40	9.8
231	gb\|AC129555.29\| Mus musculus chromosome 5, clone RP24-90F19, com...	40	9.8
232	emb\|AJ315160.1\|XTR315160 Xenopus tropicalis BMP-2 gene for bone ...	40	9.8
233	emb\|AL645842.15\| Mouse DNA sequence from clone RP23-20A9 on chro...	40	9.8
234	emb\|AL645844.18\| Mouse DNA sequence from clone RP23-82B4 on chro...	40	9.8
235	emb\|AL663055.13\| Mouse DNA sequence from clone RP23-102H8 on chr...	40	9.8
236	emb\|AL645846.12\| Mouse DNA sequence from clone RP23-244C22 on ch...	40	9.8
237	gb\|AC156982.8\| Mus musculus chromosome 19, clone RP23-183N3, com...	40	9.8
238	gb\|AC161570.6\| Mus musculus chromosome 5, clone RP23-36O9, compl...	40	9.8
239	gb\|AC154795.2\| Mus musculus BAC clone RP24-486D21 from chromosom...	40	9.8
240	gb\|AC154642.2\| Mus musculus BAC clone RP23-277C14 from chromosom...	40	9.8
241	emb\|BX601648.7\| Zebrafish DNA sequence from clone DKEY-14F19 in ...	40	9.8
242	gb\|AC098642.5\| Genomic sequence for Mus musculus, clone RP23-270...	40	9.8
243	gb\|AC008761.8\| Homo sapiens chromosome 19 clone CTD-3149D2, comp...	40	9.8
244	gb\|AC013564.7\| Homo sapiens chromosome 15, clone RP11-321F6, com...	40	9.8
245	gb\|AC099676.2\| Homo sapiens chromosome 1 clone RP11-465N4, compl...	40	9.8
246	gb\|AC084823.11\| Mus Musculus Strain C57BL6/J chromosome 8 BAC, R...	40	9.8
247	emb\|CR749525.1\| Homo sapiens mRNA; cDNA DKFZp686F1792 (from clon...	40	9.8
248	dbj\|AK127622.1\| Homo sapiens cDNA FLJ45720 fis, clone HCASM2000363	40	9.8
249	gb\|AC010057.7\| Drosophila melanogaster 3L BAC RP98-26C18 (Roswel...	40	9.8
250	gb\|AC023686.4\| Drosophila melanogaster X BAC RP98-30C1 (Roswell ...	40	9.8
251	dbj\|AK123949.1\| Homo sapiens cDNA FLJ41955 fis, clone PROST2019398	40	9.8
252	gb\|AC135802.4\| Pan troglodytes clone rp43-9f16, complete sequence	40	9.8
253	emb\|CR611618.1\| full-length cDNA clone CS0CAP005YK02 of Thymus o...	40	9.8
254	gb\|AC010574.5\| Drosophila melanogaster 3L BAC RP98-7L7 (Roswell ...	40	9.8
255	gb\|AC108107.2\| Homo sapiens chromosome 5 clone RP11-217L10, comp...	40	9.8
256	gb\|AC084407.10\| Mus Musculus Strain C57BL6/J Chromosome 11 Clone...	40	9.8
257	gb\|AC009990.9\| Homo sapiens chromosome 05 clone RP11-94N1, compl...	40	9.8
258	ref\|NM_206775.1\| Drosophila melanogaster Shaker CG12348-RG, tran...	40	9.8
259	ref\|NM_206774.1\| Drosophila melanogaster Shaker CG12348-RF, tran...	40	9.8
260	gb\|AY099672.1\| Arabidopsis thaliana unknown protein (At5g65950) ...	40	9.8
261	ref\|NM_168629.2\| Drosophila melanogaster RhoGAP71E CG32149-RC, t...	40	9.8
262	ref\|NM_167595.3\| Drosophila melanogaster Shaker CG12348-RE, tran...	40	9.8
263	ref\|NM_166627.1\| Drosophila melanogaster within bgcn CG30176-RA ...	40	9.8
264	ref\|NM_166319.1\| Drosophila melanogaster CG30126-RA (CG30126), mRNA	40	9.8
265	ref\|NM_142597.2\| Drosophila melanogaster Mediator complex subuni...	40	9.8
266	gb\|AC153924.8\| Mus musculus 10 BAC RP23-74P12 (Roswell Park Canc...	40	9.8
267	ref\|NM_138202.2\| Drosophila melanogaster Mediator complex subuni...	40	9.8
268	dbj\|AB073901.1\| Homo sapiens primary neuroblastoma cDNA, clone:N...	40	9.8
269	ref\|NM_134552.3\| Drosophila melanogaster RhoGAP19D CG1412-RA (Rh...	40	9.8
270	ref\|NM_078669.3\| Drosophila melanogaster Shaker CG12348-RB, tran...	40	9.8
271	gb\|AC009222.4\| Homo sapiens chromosome 17, clone RP11-429O1, com...	40	9.8
272	gb\|AC010279.5\| Homo sapiens chromosome 5 clone CTC-533D18, compl...	40	9.8
273	dbj\|AK148808.1\| Mus musculus 2 days neonate sympathetic ganglion...	40	9.8
274	dbj\|AK144950.1\| Mus musculus mammary gland RCB-0526 Jyg-MC(A) cD...	40	9.8
275	gb\|BC114256.1\| Danio rerio bone morphogenetic protein 2b, mRNA (...	40	9.8
276	gb\|AC020704.5\| Homo sapiens BAC clone RP11-315L6 from 15, comple...	40	9.8
277	gb\|AC025125.15\| Homo sapiens, clone RP11-147K16, complete sequence	40	9.8
278	gb\|AY071704.1\| Drosophila melanogaster RH19892 full length cDNA	40	9.8
279	gb\|AY070957.1\| Drosophila melanogaster RE05806 full length cDNA	40	9.8
280	ref\|XM_701669.1\| PREDICTED: Danio rerio similar to bone morphoge...	40	9.8
281	ref\|XM_701668.1\| PREDICTED: Danio rerio similar to bone morphoge...	40	9.8
282	ref\|XM_677807.1\| PREDICTED: Danio rerio similar to bone morphoge...	40	9.8
283	ref\|XM_701667.1\| PREDICTED: Danio rerio similar to bone morphoge...	40	9.8
284	ref\|XM_701666.1\| PREDICTED: Danio rerio similar to bone morphoge...	40	9.8
285	gb\|AY069370.1\| Drosophila melanogaster LD07688 full length cDNA	40	9.8
286	gb\|AC092271.3\| Homo sapiens chromosome 5 clone CTC-305H13, compl...	40	9.8
287	ref\|XM_703409.1\| PREDICTED: Danio rerio similar to bone morphoge...	40	9.8
288	ref\|XM_703408.1\| PREDICTED: Danio rerio similar to bone morphoge...	40	9.8
289	ref\|XM_681630.1\| PREDICTED: Danio rerio similar to bone morphoge...	40	9.8
290	gb\|AC024918.5\| Homo sapiens chromosome 17, clone RP11-254J21, co...	40	9.8
291	ref\|XM_686791.1\| PREDICTED: Danio rerio similar to cGMP-inhibite...	40	9.8
292	ref\|XM_686530.1\| PREDICTED: Danio rerio similar to cGMP-inhibite...	40	9.8
293	gb\|AY058603.1\| Drosophila melanogaster LD29482 full length cDNA	40	9.8
294	gb\|AC160062.6\| Mus musculus 6 BAC RP23-427I18 (Roswell Park Canc...	40	9.8
295	gb\|AC159887.2\| Mus musculus BAC clone RP24-249O13 from chromosom...	40	9.8
296	gb\|DP000005.1\| Macaca mulatta target 1 genomic scaffold	40	9.8
297	gb\|AC010259.7\| Homo sapiens chromosome 5 clone CTC-454M9, comple...	40	9.8
298	emb\|AL391686.10\| Human DNA sequence from clone CTB-BR164I22 on c...	40	9.8
299	gb\|AC012097.8\| Drosophila melanogaster, chromosome X, region 16F...	40	9.8
300	gb\|AC159966.5\| Mus musculus chromosome 1, clone RP23-287P12, com...	40	9.8
301	gb\|U80023.1\| Caenorhabditis elegans cosmid F07C4, complete sequence	40	9.8
302	gb\|AC096690.5\| Oryza sativa chromosome 3 BAC OSJNBa0059G06 genom...	40	9.8
303	gb\|BC076076.1\| Danio rerio bone morphogenetic protein 2b, mRNA (...	40	9.8
304	gb\|AC154596.2\| Mus musculus BAC clone RP23-354C17 from chromosom...	40	9.8
305	gb\|AC160053.2\| Mus musculus BAC clone RP23-339M18 from chromosom...	40	9.8
306	gb\|AC154450.3\| Mus musculus BAC clone RP24-169J2 from chromosome...	40	9.8
307	gb\|AC091219.2\| Drosophila melanogaster 3L BAC RP98-4C3 (Roswell ...	40	9.8
308	gb\|AC154261.2\| Mus musculus BAC clone RP24-303N7 from chromosome...	40	9.8
309	gb\|AC153646.3\| Mus musculus BAC clone RP24-493K8 from chromosome...	40	9.8
310	gb\|U53564.1\|MMU53564 Mus musculus brm mRNA, partial cds	40	9.8
311	gb\|AC023263.4\|AC023263 Homo sapiens, clone RP11-590E14, complete...	40	9.8
312	gb\|AF072456.1\|AF072456 Danio rerio bone morphogenetic protein 2 ...	40	9.8
313	gb\|AY319415.2\| Odontesthes bonariensis transcription factor SOX9...	40	9.8
314	gb\|AC006549.28\| Homo sapiens chromosome 22 clone p215k21 map 22q...	40	9.8
315	gb\|AC000097.1\| Homo sapiens Chromosome 22q11.2 PAC Clone p201m18...	40	9.8
316	gb\|AC006547.9\| Homo sapiens chromosome 22 clone p158l19 map 22q1...	40	9.8
317	gb\|AC058790.14\| Homo sapiens chromosome 22 clone b518b9 map 22q1...	40	9.8
318	gb\|AC007663.29\| Homo sapiens chromosome 22 clone b444p24 map 22q...	40	9.8
319	ref\|NM_072577.1\| Caenorhabditis elegans F07C4.10 (F07C4.10) mRNA...	40	9.8
320	gb\|AC011758.6\|AC011758 Drosophila melanogaster, chromosome X, re...	40	9.8
321	gb\|BC113144.1\| Mus musculus WAP, follistatin/kazal, immunoglobul...	40	9.8
322	gb\|AC153876.8\| Mus musculus 10 BAC RP23-218D7 (Roswell Park Canc...	40	9.8
323	gb\|AC160409.6\| Mus musculus 10 BAC RP23-184O11 (Roswell Park Can...	40	9.8
324	gb\|AF225494.1\|AF225494 Eustenogaster fraterna clone EF293CAG mic...	40	9.8
325	gb\|AF225493.1\|AF225493 Eustenogaster fraterna clone EF280GAC mic...	40	9.8
326	gb\|AC008188.4\|AC008188 Drosophila melanogaster, chromosome 2R, r...	40	9.8
327	gb\|AC009182.4\|AC009182 Drosophila melanogaster, chromosome 2R, r...	40	9.8
328	gb\|AC012163.13\|AC012163 Drosophila melanogaster, chromosome X, r...	40	9.8
329	dbj\|AP008213.1\| Oryza sativa (japonica cultivar-group) genomic D...	40	9.8
330	dbj\|AP008209.1\| Oryza sativa (japonica cultivar-group) genomic D...	40	9.8
331	gb\|AC009460.4\|AC009460 Drosophila melanogaster, chromosome 2R, r...	40	9.8
332	gb\|AC102600.11\| Mus musculus chromosome 3, clone RP23-376E16, co...	40	9.8
333	gb\|AC007816.7\|AC007816 Drosophila melanogaster, chromosome 3R, r...	40	9.8
334	gb\|AC009845.7\|AC009845 Drosophila melanogaster, chromosome 2L, r...	40	9.8
335	gb\|AC093628.3\| Homo sapiens BAC clone RP11-98N20 from 4, complet...	40	9.8
336	emb\|BX830842.1\|CNS09ZI9 Arabidopsis thaliana Full-length cDNA Co...	40	9.8
337	gb\|DP000029.1\| Cercopithecus aethiops target 1 genomic scaffold	40	9.8
338	gb\|AC019118.7\| Homo sapiens BAC clone RP11-513H7 from 2, complet...	40	9.8
339	gb\|AC147212.4\| Pan troglodytes BAC clone RP43-126P16 from chromo...	40	9.8
340	gb\|AC154254.2\| Mus musculus BAC clone RP24-201L14 from chromosom...	40	9.8
341	gb\|AC154665.2\| Mus musculus BAC clone RP24-284M11 from chromosom...	40	9.8
342	gb\|AC116738.25\| Mus musculus chromosome 5, clone RP23-418D19, co...	40	9.8
343	gb\|AY254323.1\| Homo sapiens replication factor C (activator 1) 5...	40	9.8
344	gb\|AC138303.4\| Mus musculus BAC clone RP23-43G12 from chromosome...	40	9.8
345	gb\|AC129176.6\| Mus musculus BAC clone RP23-124D10 from chromosom...	40	9.8
346	gb\|AC147067.4\| Homo sapiens BAC clone RP13-1016M1 from 4, comple...	40	9.8
347	gb\|AC069019.8\|AC069019 Mus musculus BAC RP23-455N13 (Roswell Pa...	40	9.8
348	gb\|AC130184.4\| Macaca mulatta clone CH250-513J21, complete sequence	40	9.8
349	gb\|AY188754.1\| Neurospora crassa TIM50 (tim50) mRNA, complete cd...	40	9.8
350	gb\|AC099522.3\| Homo sapiens chromosome 5 clone RP11-79P5, comple...	40	9.8
351	gb\|AY061627.1\| Drosophila melanogaster SD10560 full insert cDNA	40	9.8
352	gb\|AC012178.5\| Homo sapiens chromosome 16 clone RP11-243A14, com...	40	9.8
353	gb\|AC023701.4\| Drosophila melanogaster X BAC RP98-29B16 (Roswell...	40	9.8
354	gb\|AF293388.1\|AF293388 Drosophila melanogaster WIBG (wibg) mRNA,...	40	9.8
355	gb\|AF110982.1\| Gallus gallus T-cell receptor beta chain constant...	40	9.8
356	dbj\|AP005810.4\| Oryza sativa (japonica cultivar-group) genomic D...	40	9.8
357	emb\|BX470229.4\| Zebrafish DNA sequence from clone DKEY-193B15 in...	40	9.8
358	gb\|AC155653.4\| Mus musculus 6 BAC RP24-503P15 (Roswell Park Canc...	40	9.8
359	emb\|AL670597.18\| Mouse DNA sequence from clone RP23-235P16 on ch...	40	9.8
360	emb\|BX005175.8\| Zebrafish DNA sequence from clone DKEY-14H17 in ...	40	9.8
361	dbj\|BS000070.1\| Pan troglodytes chromosome 22 clone:RP43-073J16,...	40	9.8
362	emb\|AL591075.11\| Mouse DNA sequence from clone RP23-159O6 on chr...	40	9.8
363	dbj\|AB011474.1\| Arabidopsis thaliana genomic DNA, chromosome 5, ...	40	9.8
364	emb\|AL772311.19\| Mouse DNA sequence from clone RP23-87P16 on chr...	40	9.8
365	dbj\|AP002840.3\| Homo sapiens genomic DNA, chromosome 11 clone:RP...	40	9.8
366	dbj\|AB115561.1\| Cynops pyrrhogaster BMP mRNA for bone morphogene...	40	9.8
367	dbj\|AK110320.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	40	9.8
368	gb\|AY551178.1\| Thaumasioscolex didelphidis 5.8S ribosomal RNA ge...	40	9.8
369	gb\|AC157016.3\| Mus musculus 10 BAC RP24-505M19 (Roswell Park Can...	40	9.8
370	emb\|AL954331.8\| Zebrafish DNA sequence from clone CH211-79E4 in ...	40	9.8
371	gb\|AC132147.4\| Mus musculus BAC clone RP23-2F11 from 8, complete...	40	9.8
372	gb\|AC155812.2\| Mus musculus BAC clone RP24-139G23 from 12, compl...	40	9.8
373	gb\|AC127686.4\| Mus musculus BAC clone RP24-188G23 from 3, comple...	40	9.8
374	gb\|AC151009.3\| Macaca mulatta clone CH250-569F1, complete sequence	40	9.8
375	emb\|AL592289.22\| Zebrafish DNA sequence from clone XX-1CSE, comp...	40	9.8
376	emb\|AL929237.17\| Zebrafish DNA sequence from clone CH211-213I16 ...	40	9.8
377	emb\|BX000521.7\| Zebrafish DNA sequence from clone CH211-137C8 in...	40	9.8
378	gb\|AC131159.5\| Homo sapiens 12 BAC RP11-33N14 (Roswell Park Canc...	40	9.8
379	gb\|AC110041.13\| Mus musculus chromosome 8, clone RP23-276O15, co...	40	9.8
380	emb\|CT573000.9\| Mouse DNA sequence from clone RP24-326F11 on chr...	40	9.8
381	emb\|AJ893560.1\| Elephas maximus partial ar gene for androgen rec...	40	9.8
382	emb\|CT025155.9\| Mouse DNA sequence from clone RP23-228F18 on chr...	40	9.8
383	gb\|AE003728.3\| Drosophila melanogaster chromosome 3R, section 66...	40	9.8
384	gb\|AE003722.4\| Drosophila melanogaster chromosome 3R, section 60...	40	9.8
385	emb\|CR848433.2\| Xenopus tropicalis finished cDNA, clone TEgg062o06	40	9.8
386	gb\|AE003797.3\| Drosophila melanogaster chromosome 2R, section 53...	40	9.8
387	gb\|AF071234.1\|AF071234 Petromyzon marinus homeobox protein (hoxw...	40	9.8
388	gb\|AE003575.5\| Drosophila melanogaster chromosome 2L, section 16...	40	9.8
389	gb\|AE003571.4\| Drosophila melanogaster chromosome X, section 68 ...	40	9.8
390	gb\|AE003530.3\| Drosophila melanogaster chromosome 3L, section 55...	40	9.8
391	gb\|AE003507.3\| Drosophila melanogaster chromosome X, section 59 ...	40	9.8
392	gb\|AE003469.3\| Drosophila melanogaster chromosome 3L, section 3 ...	40	9.8
393	gb\|AE003463.2\| Drosophila melanogaster chromosome 2R, section 70...	40	9.8
394	gb\|AE003461.3\| Drosophila melanogaster chromosome 2R, section 69...	40	9.8
395	gb\|AE003433.3\| Drosophila melanogaster chromosome X, section 17 ...	40	9.8
396	gb\|AC107689.7\| Mus musculus chromosome 3, clone RP24-283F19, com...	40	9.8
397	gb\|U56854.1\|RNU56854 Rattus norvegicus 21-hydroxylase alternativ...	40	9.8
398	gb\|U56853.1\|RNU56853 Rattus norvegicus 21-hydroxylase mRNA, comp...	40	9.8
399	dbj\|AP001681.1\| Homo sapiens genomic DNA, chromosome 21q, sectio...	40	9.8
400	emb\|AL772232.18\| Mouse DNA sequence from clone RP23-119F15 on ch...	40	9.8
401	gb\|AC101349.8\| Mus musculus chromosome 6, clone RP23-111E12, com...	40	9.8
402	gb\|AC120425.12\| Mus musculus chromosome 14, clone RP24-510K2, co...	40	9.8
403	gb\|AC121114.10\| Mus musculus chromosome 15, clone RP23-63M19, co...	40	9.8
404	gb\|AC116863.6\| Mus musculus chromosome 19, clone RP24-408G9, com...	40	9.8
405	gb\|AC110254.11\| Mus musculus chromosome 5, clone RP23-271B12, co...	40	9.8
406	emb\|CT571268.7\| Mouse DNA sequence from clone RP23-275M21 on chr...	40	9.8
407	dbj\|AP000769.5\| Homo sapiens genomic DNA, chromosome 11 clone:CM...	40	9.8
408	emb\|CT030659.8\| Mouse DNA sequence from clone RP23-125F8 on chro...	40	9.8
409	emb\|AJ459405.1\|DME459405 Drosophila melanogaster mRNA for PYM pr...	40	9.8
410	gb\|AC117640.14\| Mus musculus chromosome 5, clone RP23-228I1, com...	40	9.8
411	dbj\|AB010261.1\| Drosophila melanogaster genes at 60A locus in ch...	40	9.8
412	gb\|U82232.1\|DRU82232 Danio rerio BMP2-4 mRNA, complete cds	40	9.8
413	gb\|AE016825.1\| Chromobacterium violaceum ATCC 12472, complete ge...	40	9.8
414	emb\|CT030149.9\| Mouse DNA sequence from clone RP24-394D13 on chr...	40	9.8
415	gb\|AC157563.12\| Mus musculus chromosome 7, clone RP23-414I24, co...	40	9.8
416	gb\|U65949.1\|MMU65949 Mus musculus hepatocyte growth factor-like ...	40	9.8
417	emb\|AL806525.23\| Mouse DNA sequence from clone RP23-254N4 on chr...	40	9.8
418	emb\|BX572639.11\| Zebrafish DNA sequence from clone CH211-209J5 i...	40	9.8
419	gb\|AC153073.3\| Cercopithecus aethiops clone CH252-228B1, complet...	40	9.8
420	emb\|AL772172.18\| Mouse DNA sequence from clone RP23-478A2 on chr...	40	9.8
421	emb\|AL929334.12\| Zebrafish DNA sequence from clone DKEY-24F15, c...	40	9.8
422	gb\|AC005267.1\|AC005267 Drosophila melanogaster DNA sequence (P1s...	40	9.8
423	emb\|AL935326.13\| Mouse DNA sequence from clone RP23-10L17 on chr...	40	9.8
424	gb\|AC147558.3\| Mus musculus BAC clone RP23-470N2 from 8, complet...	40	9.8
425	emb\|BX284626.3\| Mouse DNA sequence from clone RP23-76P19 on chro...	40	9.8
426	gb\|AC108825.15\| Mus musculus chromosome 19, clone RP23-103N22, c...	40	9.8
427	gb\|AC134542.3\| Mus musculus BAC clone RP24-441E15 from 6, comple...	40	9.8
428	gb\|AC140224.4\| Mus musculus BAC clone RP24-483E8 from 1, complet...	40	9.8
429	emb\|CT030645.4\| Mouse DNA sequence from clone RP23-413E24 on chr...	40	9.8
430	gb\|AC154362.1\| Mus musculus BAC clone RP23-154E1 from 14, comple...	40	9.8
431	gb\|AC149062.3\| Mus musculus BAC clone RP23-183E20 from 7, comple...	40	9.8
432	gb\|AC125380.4\| Mus musculus BAC clone RP23-204N23 from 1, comple...	40	9.8
433	emb\|CT025642.13\| Mouse DNA sequence from clone RP23-471B6 on chr...	40	9.8
434	emb\|CT033752.6\| Mouse DNA sequence from clone RP23-140I20 on chr...	40	9.8
435	emb\|BX005046.9\| Mouse DNA sequence from clone RP23-462J6 on chro...	40	9.8
436	emb\|AL935331.9\| Mouse DNA sequence from clone RP24-264J19 on chr...	40	9.8
437	emb\|AL928943.9\| Mouse DNA sequence from clone RP23-435J15 on chr...	40	9.8
438	emb\|AL928626.10\| Mouse DNA sequence from clone RP23-365O18 on ch...	40	9.8
439	gb\|AC153422.5\| Mus musculus 10 BAC RP23-427I15 (Roswell Park Can...	40	9.8
440	emb\|CR382131.1\| Yarrowia lipolytica chromosome E of strain CLIB ...	40	9.8
441	gb\|AC114988.21\| Mus musculus chromosome 7, clone RP23-207N5, com...	40	9.8
442	gb\|AC154774.2\| Mus musculus BAC clone RP24-455C12 from chromosom...	40	9.8
443	gb\|AC154433.2\| Mus musculus BAC clone RP24-182L23 from chromosom...	40	9.8
444	gb\|AC170913.2\| Mus musculus BAC clone RP23-197F6 from chromosome...	40	9.8
445	gb\|AC161527.18\| Mus musculus chromosome 3, clone RP23-174B21, co...	40	9.8
446	emb\|AL731808.26\| Mouse DNA sequence from clone RP23-286E6 on chr...	40	9.8
447	gb\|AC153922.6\| Mus musculus 6 BAC RP23-81P16 (Roswell Park Cance...	40	9.8
448	emb\|AL683847.12\| Mouse DNA sequence from clone RP23-109A3 on chr...	40	9.8
449	emb\|AL713991.13\| Mouse DNA sequence from clone RP23-132C16 on ch...	40	9.8
450	emb\|AL645740.6\| Mouse DNA sequence from clone RP23-411H13 on chr...	40	9.8
451	emb\|AL806521.9\| Mouse DNA sequence from clone RP23-385N7 on chro...	40	9.8
452	emb\|AL669911.16\| Mouse DNA sequence from clone RP23-65G8 on chro...	40	9.8
453	emb\|AL591826.2\|CNS07EGP BAC 13C18 of library CITB 129-Sv from ch...	40	9.8
454	emb\|AL732475.6\| Mouse DNA sequence from clone RP23-202H24 on chr...	40	9.8
455	gb\|AC117789.17\| Mus musculus chromosome 1, clone RP24-548D18, co...	40	9.8
456	gb\|AC164629.14\| Mus musculus 10 BAC RP23-16N3 (Roswell Park Canc...	40	9.8
457	gb\|M17211.1\|DROCHAB D.melanogaster potassium channel (Shaker) mR...	40	9.8
458	dbj\|AB071891.1\| Lethenteron japonicum mRNA for LjBmp2/4b, partia...	40	9.8
459	dbj\|AB071890.1\| Lethenteron japonicum mRNA for LjBmp2/4a, partia...	40	9.8
460	dbj\|D49971.1\| Danio rerio mRNA for bone morphogenetic protein, c...	40	9.8
461	dbj\|AP001137.2\| Homo sapiens genomic DNA, chromosome 21q21.1-q21...	40	9.8
462	emb\|AL606704.20\| Mouse DNA sequence from clone RP23-375B1 on chr...	40	9.8
463	dbj\|AP001362.5\| Homo sapiens genomic DNA, chromosome 11, clone:R...	40	9.8
464	emb\|AL731805.8\| Mouse DNA sequence from clone RP23-358E19 on chr...	40	9.8
465	emb\|AL606664.17\| Mouse DNA sequence from clone RP23-428N4 on chr...	40	9.8

>emb|AJ488508.1|TAE488508 Triticum aestivum mRNA for triacylglycerol lipase (lipase gene),
            cultivar Cadenza
          Length = 1186

 Score =  430 bits (217), Expect = e-117
 Identities = 291/315 (92%), Gaps = 3/315 (0%)
 Strand = Plus / Minus

                                                                        
Query: 30   gcgtggtggtgttatcccatctctgaatgcagaaacaatgaagcagtgaggggaatgaca 89
            |||||||||||||||||| |||||| |||||||||||||||||||| | |||||| ||||
Sbjct: 1164 gcgtggtggtgttatcccctctctggatgcagaaacaatgaagcagagtggggaaggaca 1105

                                                                        
Query: 90   ggctgcgtgcgtggtgctactatgataatacataacttatttacatgggtttcactgggc 149
             | ||||||||||||||||||||||| | ||| ||||| |||||||||||||||||||||
Sbjct: 1104 tgttgcgtgcgtggtgctactatgatgacacagaacttctttacatgggtttcactgggc 1045

                                                                        
Query: 150  gctgtgtcttcttcgctcgtccgacagaccgggctgctgttgctgctgcttcgacaagac 209
            ||||||||||||||||||||  |||||||| | ||||||   ||||||||||||||||||
Sbjct: 1044 gctgtgtcttcttcgctcgttggacagaccagactgctg---ctgctgcttcgacaagac 988

                                                                        
Query: 210  gacgtttccatggaggtccatcttgtaccgcagctcggcgtagtccataacgatcctgca 269
            ||||||||||||||||||||||||||||||||| ||||| |||||||| || ||||||||
Sbjct: 987  gacgtttccatggaggtccatcttgtaccgcagttcggcatagtccatgacaatcctgca 928

                                                                        
Query: 270  gctgctccaggcctccgcgtgcatgctcacgcccaggtaggttatgtggtcttgaatgct 329
            ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 927  gctgctccaggcctccgcgtgcatgctcacgcccaggtaggttatgtggtcctgaatgct 868

                           
Query: 330  gttgccgctcacaga 344
            ||| |||||||||||
Sbjct: 867  gttaccgctcacaga 853



 Score =  139 bits (70), Expect = 1e-29
 Identities = 88/94 (93%)
 Strand = Plus / Minus

                                                                       
Query: 459 gacctgctgcatgcagggtcttctccggagtcgtcgcagatcttctcaaccgtgtatacc 518
           |||||||||||||| |||||||| ||||||||||||||||||| ||||||||||||||||
Sbjct: 854 gacctgctgcatgccgggtcttcgccggagtcgtcgcagatctgctcaaccgtgtatacc 795

                                             
Query: 519 aggctcccgagcccgacattgtggacccatacct 552
           || ||||||||||||||||  |||||||||||||
Sbjct: 794 agactcccgagcccgacatcatggacccatacct 761

to top

>emb|AJ488507.1|TAE488507 Triticum aestivum mRNA for triacylglycerol lipase (lipase gene),
            cultivar Hereward
          Length = 1053

 Score =  365 bits (184), Expect = 1e-97
 Identities = 199/204 (97%)
 Strand = Plus / Minus

                                                                        
Query: 141  tcactgggcgctgtgtcttcttcgctcgtccgacagaccgggctgctgttgctgctgctt 200
            |||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||
Sbjct: 1053 tcactgggcgctgtgtcttcttcgctggtccgacagaccgggctgctgctgctgctgctt 994

                                                                        
Query: 201  cgacaagacgacgtttccatggaggtccatcttgtaccgcagctcggcgtagtccataac 260
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 993  cgacaagacgacgtttccatggaggtccatcttgtaccgcagctcggcgtagtccatgac 934

                                                                        
Query: 261  gatcctgcagctgctccaggcctccgcgtgcatgctcacgcccaggtaggttatgtggtc 320
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 933  gatcctgcagctgctccaggcctccgcgtgcatgctcacgcccaggtaggttatgtgatc 874

                                    
Query: 321  ttgaatgctgttgccgctcacaga 344
            |||||||||||| |||||||||||
Sbjct: 873  ttgaatgctgttaccgctcacaga 850



 Score =  147 bits (74), Expect = 6e-32
 Identities = 89/94 (94%)
 Strand = Plus / Minus

                                                                       
Query: 459 gacctgctgcatgcagggtcttctccggagtcgtcgcagatcttctcaaccgtgtatacc 518
           |||||||||||||| |||||||| ||||||||||||||||||| ||||||||||||||||
Sbjct: 851 gacctgctgcatgccgggtcttcgccggagtcgtcgcagatctgctcaaccgtgtatacc 792

                                             
Query: 519 aggctcccgagcccgacattgtggacccatacct 552
           |||||||||||||||||||  |||||||||||||
Sbjct: 791 aggctcccgagcccgacatcatggacccatacct 758

to top

>ref|NM_190064.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 816

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 123/149 (82%)
 Strand = Plus / Minus

                                                                       
Query: 196 tgcttcgacaagacgacgtttccatggaggtccatcttgtaccgcagctcggcgtagtcc 255
           ||||| |||||||||| ||| |||| || |||||||  ||| ||||||| |  |||||||
Sbjct: 776 tgctttgacaagacgatgttgccattgatgtccatccggtaacgcagcttgctgtagtcc 717

                                                                       
Query: 256 ataacgatcctgcagctgctccaggcctccgcgtgcatgctcacgcccaggtaggttatg 315
           || ||||||||||||  |||||| ||||| ||||||||||| ||||| || |||  ||||
Sbjct: 716 atgacgatcctgcaggagctccatgcctcggcgtgcatgctgacgccgagatagtatatg 657

                                        
Query: 316 tggtcttgaatgctgttgccgctcacaga 344
           |||||||| | |||| | || ||||||||
Sbjct: 656 tggtcttgcacgctgctcccactcacaga 628

to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 123/149 (82%)
 Strand = Plus / Plus

                                                                            
Query: 196      tgcttcgacaagacgacgtttccatggaggtccatcttgtaccgcagctcggcgtagtcc 255
                ||||| |||||||||| ||| |||| || |||||||  ||| ||||||| |  |||||||
Sbjct: 41093082 tgctttgacaagacgatgttgccattgatgtccatccggtaacgcagcttgctgtagtcc 41093141

                                                                            
Query: 256      ataacgatcctgcagctgctccaggcctccgcgtgcatgctcacgcccaggtaggttatg 315
                || ||||||||||||  |||||| ||||| ||||||||||| ||||| || |||  ||||
Sbjct: 41093142 atgacgatcctgcaggagctccatgcctcggcgtgcatgctgacgccgagatagtatatg 41093201

                                             
Query: 316      tggtcttgaatgctgttgccgctcacaga 344
                |||||||| | |||| | || ||||||||
Sbjct: 41093202 tggtcttgcacgctgctcccactcacaga 41093230

to top

>dbj|AP003266.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0492G09
          Length = 142239

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 123/149 (82%)
 Strand = Plus / Plus

                                                                          
Query: 196    tgcttcgacaagacgacgtttccatggaggtccatcttgtaccgcagctcggcgtagtcc 255
              ||||| |||||||||| ||| |||| || |||||||  ||| ||||||| |  |||||||
Sbjct: 130012 tgctttgacaagacgatgttgccattgatgtccatccggtaacgcagcttgctgtagtcc 130071

                                                                          
Query: 256    ataacgatcctgcagctgctccaggcctccgcgtgcatgctcacgcccaggtaggttatg 315
              || ||||||||||||  |||||| ||||| ||||||||||| ||||| || |||  ||||
Sbjct: 130072 atgacgatcctgcaggagctccatgcctcggcgtgcatgctgacgccgagatagtatatg 130131

                                           
Query: 316    tggtcttgaatgctgttgccgctcacaga 344
              |||||||| | |||| | || ||||||||
Sbjct: 130132 tggtcttgcacgctgctcccactcacaga 130160

to top

>dbj|AK101890.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033070N06, full
            insert sequence
          Length = 2752

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 123/149 (82%)
 Strand = Plus / Minus

                                                                        
Query: 196  tgcttcgacaagacgacgtttccatggaggtccatcttgtaccgcagctcggcgtagtcc 255
            ||||| |||||||||| ||| |||| || |||||||  ||| ||||||| |  |||||||
Sbjct: 2525 tgctttgacaagacgatgttgccattgatgtccatccggtaacgcagcttgctgtagtcc 2466

                                                                        
Query: 256  ataacgatcctgcagctgctccaggcctccgcgtgcatgctcacgcccaggtaggttatg 315
            || ||||||||||||  |||||| ||||| ||||||||||| ||||| || |||  ||||
Sbjct: 2465 atgacgatcctgcaggagctccatgcctcggcgtgcatgctgacgccgagatagtatatg 2406

                                         
Query: 316  tggtcttgaatgctgttgccgctcacaga 344
            |||||||| | |||| | || ||||||||
Sbjct: 2405 tggtcttgcacgctgctcccactcacaga 2377

to top

>gb|AC109145.11| Mus musculus chromosome 1, clone RP23-109O14, complete sequence
          Length = 186661

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 442    ggagggagagagggagggacctg 464
              |||||||||||||||||||||||
Sbjct: 108436 ggagggagagagggagggacctg 108414

to top

>gb|AC147514.12| Mus musculus chromosome 1, clone RP23-442A6, complete sequence
          Length = 187725

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 442   ggagggagagagggagggacctg 464
             |||||||||||||||||||||||
Sbjct: 30846 ggagggagagagggagggacctg 30868

to top

>gb|AC161520.6| Mus musculus chromosome 7, clone RP24-282D19, complete sequence
          Length = 165232

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 442   ggagggagagagggagggacctg 464
             |||||||||||||||||||||||
Sbjct: 67038 ggagggagagagggagggacctg 67060

to top

>gb|AF037036.1|AF037036 Zea mays 6-phosphogluconate dehydrogenase gene, partial cds
          Length = 1599

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                           
Query: 249  gtagtccataacgatcctgcagctgctccag 279
            ||||||||| ||||| |||||||||||||||
Sbjct: 1112 gtagtccatgacgattctgcagctgctccag 1142

to top

>emb|CT030656.7| Mouse DNA sequence from clone RP23-271O7 on chromosome 9, complete
              sequence
          Length = 215427

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 442    ggagggagagagggagggacctg 464
              |||||||||||||||||||||||
Sbjct: 160983 ggagggagagagggagggacctg 161005

to top

>emb|AL807245.17| Mouse DNA sequence from clone RP23-102B2 on chromosome 11, complete
             sequence
          Length = 114581

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                            
Query: 434   atggtggtggagggagagagggagggacctg 464
             |||| ||||||||||| ||||||||||||||
Sbjct: 97960 atggaggtggagggagggagggagggacctg 97990

to top

>gb|AC137848.31| Mus musculus chromosome 9, clone RP24-118I23, complete sequence
          Length = 190317

 Score = 44.1 bits (22), Expect = 0.63
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 439   ggtggagggagagagggaggga 460
             ||||||||||||||||||||||
Sbjct: 48188 ggtggagggagagagggaggga 48167

to top

>gb|AC158148.5| Mus musculus chromosome 1, clone RP24-353B6, complete sequence
          Length = 158895

 Score = 44.1 bits (22), Expect = 0.63
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 443    gagggagagagggagggacctg 464
              ||||||||||||||||||||||
Sbjct: 111788 gagggagagagggagggacctg 111767

to top

>gb|AE014850.1| Plasmodium falciparum 3D7 chromosome 12, section 7 of 9 of the complete
             sequence
          Length = 250713

 Score = 44.1 bits (22), Expect = 0.63
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 114   ataatacataacttatttacat 135
             ||||||||||||||||||||||
Sbjct: 29885 ataatacataacttatttacat 29864

to top

>gb|AC114619.9| Mus musculus chromosome 5, clone RP24-86I23, complete sequence
          Length = 204468

 Score = 44.1 bits (22), Expect = 0.63
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 440    gtggagggagagagggagggac 461
              ||||||||||||||||||||||
Sbjct: 107414 gtggagggagagagggagggac 107435

to top

>gb|AC106595.9| Rattus norvegicus 7 BAC CH230-237N20 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 214961

 Score = 44.1 bits (22), Expect = 0.63
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 439   ggtggagggagagagggaggga 460
             ||||||||||||||||||||||
Sbjct: 51718 ggtggagggagagagggaggga 51739



 Score = 44.1 bits (22), Expect = 0.63
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 439   ggtggagggagagagggaggga 460
             ||||||||||||||||||||||
Sbjct: 51381 ggtggagggagagagggaggga 51402



 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 441   tggagggagagagggaggga 460
             ||||||||||||||||||||
Sbjct: 51339 tggagggagagagggaggga 51358

to top

>gb|AC129576.11| Mus musculus chromosome 10, clone RP24-343D9, complete sequence
          Length = 136276

 Score = 44.1 bits (22), Expect = 0.63
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 439   ggtggagggagagagggaggga 460
             ||||||||||||||||||||||
Sbjct: 15264 ggtggagggagagagggaggga 15243



 Score = 44.1 bits (22), Expect = 0.63
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 439   ggtggagggagagagggaggga 460
             ||||||||||||||||||||||
Sbjct: 15196 ggtggagggagagagggaggga 15175



 Score = 44.1 bits (22), Expect = 0.63
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 439   ggtggagggagagagggaggga 460
             ||||||||||||||||||||||
Sbjct: 15060 ggtggagggagagagggaggga 15039

to top

>ref|XM_591758.2| PREDICTED: Bos taurus similar to pleckstrin homology-like domain,
           family A, member 1 (LOC540135), mRNA
          Length = 1188

 Score = 44.1 bits (22), Expect = 0.63
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 178 ccgggctgctgttgctgctgct 199
           ||||||||||||||||||||||
Sbjct: 617 ccgggctgctgttgctgctgct 596

to top

>gb|AC124806.11| Mus musculus chromosome 1, clone RP24-282F20, complete sequence
          Length = 153901

 Score = 44.1 bits (22), Expect = 0.63
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 443   gagggagagagggagggacctg 464
             ||||||||||||||||||||||
Sbjct: 54979 gagggagagagggagggacctg 54958

to top

>gb|AC124549.5| Mus musculus BAC clone RP23-284E24 from 13, complete sequence
          Length = 199240

 Score = 44.1 bits (22), Expect = 0.63
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 439    ggtggagggagagagggaggga 460
              ||||||||||||||||||||||
Sbjct: 195721 ggtggagggagagagggaggga 195700

to top

>gb|CP000091.1| Ralstonia eutropha JMP134 chromosome 2, complete sequence
          Length = 2726152

 Score = 44.1 bits (22), Expect = 0.63
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 177     accgggctgctgttgctgctgc 198
               ||||||||||||||||||||||
Sbjct: 1564372 accgggctgctgttgctgctgc 1564393

to top

>emb|AL137161.24| Human DNA sequence from clone RP1-130L23 on chromosome 11p12-14.1,
             complete sequence
          Length = 55859

 Score = 44.1 bits (22), Expect = 0.63
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 439   ggtggagggagagagggaggga 460
             ||||||||||||||||||||||
Sbjct: 12088 ggtggagggagagagggaggga 12109

to top

>gb|AC160970.7| Mus musculus BAC clone RP24-492D11 from chromosome 10, complete sequence
          Length = 205283

 Score = 44.1 bits (22), Expect = 0.63
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 439    ggtggagggagagagggaggga 460
              ||||||||||||||||||||||
Sbjct: 119094 ggtggagggagagagggaggga 119073



 Score = 44.1 bits (22), Expect = 0.63
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 439    ggtggagggagagagggaggga 460
              ||||||||||||||||||||||
Sbjct: 119026 ggtggagggagagagggaggga 119005



 Score = 44.1 bits (22), Expect = 0.63
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 439    ggtggagggagagagggaggga 460
              ||||||||||||||||||||||
Sbjct: 118890 ggtggagggagagagggaggga 118869

to top

>gb|AC154747.2| Mus musculus BAC clone RP23-116N15 from chromosome 13, complete sequence
          Length = 209567

 Score = 44.1 bits (22), Expect = 0.63
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 439    ggtggagggagagagggaggga 460
              ||||||||||||||||||||||
Sbjct: 203079 ggtggagggagagagggaggga 203100

to top

>gb|AC068907.53| Mus musculus strain C57BL/6J clone rp23-347f7 map 13, complete sequence
          Length = 232472

 Score = 44.1 bits (22), Expect = 0.63
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 439    ggtggagggagagagggaggga 460
              ||||||||||||||||||||||
Sbjct: 117980 ggtggagggagagagggaggga 117959

to top

>gb|AC012417.13| Homo sapiens chromosome 18, clone RP11-408H20, complete sequence
          Length = 181552

 Score = 44.1 bits (22), Expect = 0.63
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 442   ggagggagagagggagggacctgctg 467
             |||||||| |||||||||||||||||
Sbjct: 77296 ggagggagggagggagggacctgctg 77271

to top

>gb|AC159314.3| Mus musculus BAC clone RP23-110E20 from chromosome 9, complete sequence
          Length = 201900

 Score = 44.1 bits (22), Expect = 0.63
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 439    ggtggagggagagagggaggga 460
              ||||||||||||||||||||||
Sbjct: 155871 ggtggagggagagagggaggga 155892

to top

>gb|AC154535.2| Mus musculus BAC clone RP23-447M9 from chromosome 13, complete sequence
          Length = 179176

 Score = 44.1 bits (22), Expect = 0.63
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 180    gggctgctgttgctgctgcttc 201
              ||||||||||||||||||||||
Sbjct: 134645 gggctgctgttgctgctgcttc 134666

to top

>gb|AC154430.3| Mus musculus BAC clone RP24-208K8 from chromosome 16, complete sequence
          Length = 178222

 Score = 44.1 bits (22), Expect = 0.63
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 180    gggctgctgttgctgctgcttc 201
              ||||||||||||||||||||||
Sbjct: 121633 gggctgctgttgctgctgcttc 121612

to top

>gb|AY157846.2| Chlamydomonas reinhardtii putative nucleic acid binding protein
            (Nab1) gene, complete cds
          Length = 4339

 Score = 44.1 bits (22), Expect = 0.63
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 178  ccgggctgctgttgctgctgct 199
            ||||||||||||||||||||||
Sbjct: 1587 ccgggctgctgttgctgctgct 1566

to top

>emb|AL772264.8| Mouse DNA sequence from clone RP23-15I21 on chromosome 2, complete
             sequence
          Length = 189540

 Score = 44.1 bits (22), Expect = 0.63
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 439   ggtggagggagagagggaggga 460
             ||||||||||||||||||||||
Sbjct: 82508 ggtggagggagagagggaggga 82529

to top

>emb|AL772190.6| Mouse DNA sequence from clone RP23-124P7 on chromosome 2, complete
              sequence
          Length = 206240

 Score = 44.1 bits (22), Expect = 0.63
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 439    ggtggagggagagagggaggga 460
              ||||||||||||||||||||||
Sbjct: 175282 ggtggagggagagagggaggga 175261

to top

>gb|AC101706.9| Mus musculus chromosome 15, clone RP23-256L18, complete sequence
          Length = 170006

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 112    tgataatacataacttattta 132
              |||||||||||||||||||||
Sbjct: 149680 tgataatacataacttattta 149660

to top

>gb|AC100927.11| Mus musculus chromosome 3, clone RP23-72A21, complete sequence
          Length = 196709

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 436    ggtggtggagggagagagggaggga 460
              ||||| |||||||||||||||||||
Sbjct: 130676 ggtgggggagggagagagggaggga 130652

to top

>ref|NM_032427.1| Homo sapiens mastermind-like 2 (Drosophila) (MAML2), mRNA
          Length = 5428

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 180  gggctgctgttgctgctgctt 200
            |||||||||||||||||||||
Sbjct: 1655 gggctgctgttgctgctgctt 1635

to top

>gb|AC161581.3| Mus musculus chromosome 15, clone RP24-75A19, complete sequence
          Length = 210059

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 451   gagggagggacctgctgcatg 471
             |||||||||||||||||||||
Sbjct: 24220 gagggagggacctgctgcatg 24240

to top

>gb|AC005737.1| Homo sapiens chromosome 16, BAC clone 97H22 (LANL), complete sequence
          Length = 174098

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 114    ataatacataacttatttaca 134
              |||||||||||||||||||||
Sbjct: 113150 ataatacataacttatttaca 113130

to top

>gb|BC042213.1| Mus musculus a disintegrin-like and metallopeptidase (reprolysin
            type) with thrombospondin type 1 motif, 10, mRNA (cDNA
            clone IMAGE:4502748), with apparent retained intron
          Length = 3981

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 435  tggtggtggagggagagagggaggg 459
            ||||||||||||||| |||||||||
Sbjct: 2733 tggtggtggagggagggagggaggg 2709

to top

>gb|AC118640.8| Mus musculus chromosome 15, clone RP24-112A20, complete sequence
          Length = 179510

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 451   gagggagggacctgctgcatg 471
             |||||||||||||||||||||
Sbjct: 77279 gagggagggacctgctgcatg 77259

to top

>gb|AC147098.2| Mus musculus BAC clone RP23-452E7 from chromosome 9, complete sequence
          Length = 199612

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 182    gctgctgttgctgctgcttcgacaa 206
              ||||||| |||||||||||||||||
Sbjct: 146632 gctgctgctgctgctgcttcgacaa 146656

to top

>ref|NM_131359.1| Danio rerio bone morphogenetic protein 2a (bmp2a), mRNA
          Length = 1161

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 428  caggacatggtggtggaggga 448
            |||||||||||||||||||||
Sbjct: 1126 caggacatggtggtggaggga 1146

to top

>gb|AC121296.7| Mus musculus chromosome 14, clone RP23-286K8, complete sequence
          Length = 232049

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 436   ggtggtggagggagagagggaggga 460
             ||||| |||||||||||||||||||
Sbjct: 18170 ggtgggggagggagagagggaggga 18194

to top

>gb|AC118249.11| Mus musculus chromosome 19, clone RP23-397G23, complete sequence
          Length = 224129

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 442   ggagggagagagggagggacc 462
             |||||||||||||||||||||
Sbjct: 77792 ggagggagagagggagggacc 77772

to top

>gb|AC131039.7| Mus musculus chromosome 1, clone RP23-274I23, complete sequence
          Length = 187304

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 444   agggagagagggagggacctg 464
             |||||||||||||||||||||
Sbjct: 37144 agggagagagggagggacctg 37124

to top

>gb|AC124987.9| Mus musculus chromosome 3, clone RP24-364E17, complete sequence
          Length = 165330

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 440   gtggagggagagagggaggga 460
             |||||||||||||||||||||
Sbjct: 32374 gtggagggagagagggaggga 32394

to top

>gb|AC126935.3| Mus musculus BAC clone RP24-186K24 from chromosome 1, complete sequence
          Length = 197488

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 439    ggtggagggagagagggaggg 459
              |||||||||||||||||||||
Sbjct: 174265 ggtggagggagagagggaggg 174285

to top

>gb|AC122909.2| Mus musculus BAC clone RP23-53K17 from 10, complete sequence
          Length = 198537

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 444   agggagagagggagggacctg 464
             |||||||||||||||||||||
Sbjct: 78669 agggagagagggagggacctg 78649

to top

>gb|AC118006.9| Mus musculus chromosome 14, clone RP23-344J14, complete sequence
          Length = 232234

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 436    ggtggtggagggagagagggaggga 460
              ||||| |||||||||||||||||||
Sbjct: 199177 ggtgggggagggagagagggaggga 199201

to top

>gb|AC115751.6| Mus musculus chromosome 1, clone RP23-16I21, complete sequence
          Length = 256998

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 444   agggagagagggagggacctg 464
             |||||||||||||||||||||
Sbjct: 51108 agggagagagggagggacctg 51128

to top

>gb|AC109214.6| Mus musculus chromosome 10, clone RP23-352E22, complete sequence
          Length = 175569

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 444   agggagagagggagggacctg 464
             |||||||||||||||||||||
Sbjct: 62961 agggagagagggagggacctg 62981

to top

>gb|AC158914.4| Mus musculus chromosome 5, clone RP24-249F11, complete sequence
          Length = 155216

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 443    gagggagagagggagggacct 463
              |||||||||||||||||||||
Sbjct: 125364 gagggagagagggagggacct 125344

to top

>emb|AL161944.22| Human DNA sequence from clone RP5-1079N22 on chromosome 20 Contains
            GSSs, complete sequence
          Length = 11368

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 436  ggtggtggagggagagaggga 456
            |||||||||||||||||||||
Sbjct: 3981 ggtggtggagggagagaggga 4001

to top

>emb|AL138894.11| Human DNA sequence from clone RP11-28O4 on chromosome 9 Contains the 5'
             end of the DBCCR1 gene for deleted in bladder cancer
             chromosome region candidate 1 (IB3089A) and a CpG island,
             complete sequence
          Length = 152366

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 442   ggagggagagagggagggacc 462
             |||||||||||||||||||||
Sbjct: 20275 ggagggagagagggagggacc 20295

to top

>gb|AC158907.2| Mus musculus chromosome 15, clone RP24-266D22, complete sequence
          Length = 146781

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 112   tgataatacataacttattta 132
             |||||||||||||||||||||
Sbjct: 80013 tgataatacataacttattta 80033

to top

>gb|AC105586.5| Rattus norvegicus 3 BAC CH230-239D4 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 235468

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 439    ggtggagggagagagggaggg 459
              |||||||||||||||||||||
Sbjct: 145217 ggtggagggagagagggaggg 145237

to top

>emb|AL596122.14| Mouse DNA sequence from clone RP23-320E6 on chromosome 11 Contains the
              Taf15 gene for TAF15 RNA polymerase II TATA box binding
              protein (TBP)-associated factor, two novel genes, the Ccl5,
              Ccl9, Ccl6, Ccl3 and Ccl4 genes for chemokine (C-C motif)
              ligand 5, 9, 6, 3 and 4, a ribosomal protein L9 (Rpl9)
              pseudogene, three extracellular proteinase inhibitor (Expi)
              pseudogene and an H+ transporting mitochondrial F1F0
              complex ATP synthase subunit e (Atp5k) pseudogene,,
              complete sequence
          Length = 211873

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 436    ggtggtggagggagagagggaggga 460
              |||||||||||||| ||||||||||
Sbjct: 190792 ggtggtggagggagggagggaggga 190768

to top

>gb|AC159616.2| Mus musculus BAC clone RP24-497G20 from chromosome 12, complete
             sequence
          Length = 160836

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 440   gtggagggagagagggaggga 460
             |||||||||||||||||||||
Sbjct: 69956 gtggagggagagagggaggga 69936

to top

>gb|AC096888.2| Homo sapiens chromosome 3 clone RP11-14D22, complete sequence
          Length = 176421

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 445   gggagagagggagggacctgc 465
             |||||||||||||||||||||
Sbjct: 53863 gggagagagggagggacctgc 53843

to top

>dbj|AK142854.1| Mus musculus 15 days embryo head cDNA, RIKEN full-length enriched
            library, clone:D930029O22 product:hypothetical protein,
            full insert sequence
          Length = 3969

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 451  gagggagggacctgctgcatg 471
            |||||||||||||||||||||
Sbjct: 1711 gagggagggacctgctgcatg 1691

to top

>gb|AC104301.2| Homo sapiens chromosome 3 clone RP11-150N22, complete sequence
          Length = 189610

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 443    gagggagagagggagggacct 463
              |||||||||||||||||||||
Sbjct: 100336 gagggagagagggagggacct 100316

to top

>gb|AC122754.13| Mus musculus chromosome 1, clone RP24-510K10, complete sequence
          Length = 227950

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 440  gtggagggagagagggaggga 460
            |||||||||||||||||||||
Sbjct: 1887 gtggagggagagagggaggga 1907

to top

>gb|AY040322.1| Homo sapiens nuclear transcription factor/notch receptor regulator
            (MAML2) mRNA, complete cds
          Length = 5419

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 180  gggctgctgttgctgctgctt 200
            |||||||||||||||||||||
Sbjct: 1655 gggctgctgttgctgctgctt 1635

to top

>gb|AY135688.1| Mus musculus argonaute 2 protein (Ago2) gene, partial cds
          Length = 45299

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 451   gagggagggacctgctgcatg 471
             |||||||||||||||||||||
Sbjct: 44919 gagggagggacctgctgcatg 44899

to top

>emb|AL928932.14| Mouse DNA sequence from clone RP24-235B14 on chromosome 4, complete
             sequence
          Length = 201761

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 58    gcagaaacaatgaagcagtga 78
             |||||||||||||||||||||
Sbjct: 93906 gcagaaacaatgaagcagtga 93886

to top

>dbj|AP000929.6| Homo sapiens genomic DNA, chromosome 11 clone:RP11-778B17, complete
            sequence
          Length = 197195

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 180  gggctgctgttgctgctgctt 200
            |||||||||||||||||||||
Sbjct: 7561 gggctgctgttgctgctgctt 7581

to top

>dbj|AP000848.5| Homo sapiens genomic DNA, chromosome 11 clone:RP11-775D16, complete
              sequence
          Length = 186965

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 180    gggctgctgttgctgctgctt 200
              |||||||||||||||||||||
Sbjct: 163685 gggctgctgttgctgctgctt 163705

to top

>gb|AC121944.4| Mus musculus BAC clone RP24-211H19 from chromosome 1, complete sequence
          Length = 154484

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 439   ggtggagggagagagggaggg 459
             |||||||||||||||||||||
Sbjct: 80590 ggtggagggagagagggaggg 80610

to top

>gb|U82233.1|DRU82233 Danio rerio BMP2 mRNA, complete cds
          Length = 1161

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 428  caggacatggtggtggaggga 448
            |||||||||||||||||||||
Sbjct: 1126 caggacatggtggtggaggga 1146

to top

>gb|AC174648.2| Mus musculus BAC clone CH36-236I19 from chromosome 1, complete sequence
          Length = 202877

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 439    ggtggagggagagagggaggg 459
              |||||||||||||||||||||
Sbjct: 117259 ggtggagggagagagggaggg 117279

to top

>gb|AC111202.5| Mus musculus BAC clone RP23-338I3 from 9, complete sequence
          Length = 200266

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 182   gctgctgttgctgctgcttcgacaa 206
             ||||||| |||||||||||||||||
Sbjct: 76535 gctgctgctgctgctgcttcgacaa 76559

to top

>emb|CT033847.5| Mouse DNA sequence from clone RP24-225N8 on chromosome 17, complete
             sequence
          Length = 171164

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 435   tggtggtggagggagagagggaggg 459
             ||||||||||||||| |||||||||
Sbjct: 22213 tggtggtggagggagggagggaggg 22189

to top

>gb|AC154142.24| Mus musculus chromosome 1, clone RP23-187M7, complete sequence
          Length = 237824

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 440   gtggagggagagagggaggga 460
             |||||||||||||||||||||
Sbjct: 84790 gtggagggagagagggaggga 84810

to top

>emb|AL671275.11| Mouse DNA sequence from clone RP23-344J21 on chromosome X, complete
              sequence
          Length = 160338

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 436    ggtggtggagggagagagggaggga 460
              ||||| |||||||||||||||||||
Sbjct: 134927 ggtgggggagggagagagggaggga 134951

to top

>emb|AL844495.6| Mouse DNA sequence from clone RP23-252L9 on chromosome 2, complete
             sequence
          Length = 174818

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 50    ctctgaatgcagaaacaatga 70
             |||||||||||||||||||||
Sbjct: 87359 ctctgaatgcagaaacaatga 87339

to top

>emb|AL805951.6| Mouse DNA sequence from clone RP23-326P3 on chromosome 4, complete
             sequence
          Length = 197080

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 445   gggagagagggagggacctgc 465
             |||||||||||||||||||||
Sbjct: 72329 gggagagagggagggacctgc 72309

to top

>gb|AC016586.9| Homo sapiens chromosome 19 clone CTD-2622I13, complete sequence
          Length = 205642

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 439    ggtggagggagagagggaggg 459
              |||||||||||||||||||||
Sbjct: 105907 ggtggagggagagagggaggg 105927

to top

>dbj|AB058722.1| Homo sapiens mRNA for KIAA1819 protein, partial cds
          Length = 5419

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 180  gggctgctgttgctgctgctt 200
            |||||||||||||||||||||
Sbjct: 1655 gggctgctgttgctgctgctt 1635

to top

>gb|AC133860.5| Oryza sativa chromosome 3 BAC OSJNBa0091E13 genomic sequence,
            complete sequence
          Length = 157397

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 181  ggctgctgttgctgctgctt 200
            ||||||||||||||||||||
Sbjct: 8087 ggctgctgttgctgctgctt 8068

to top

>gb|AC009749.9| Drosophila melanogaster clone BACR40I04, complete sequence
          Length = 161276

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 182    gctgctgttgctgctgcttc 201
              ||||||||||||||||||||
Sbjct: 149043 gctgctgttgctgctgcttc 149024

to top

>ref|NM_125992.3| Arabidopsis thaliana unknown protein AT5G65950 transcript variant
            AT5G65950.1 mRNA, complete cds
          Length = 2931

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 545  ccatacctgaaggaaggaga 564
            ||||||||||||||||||||
Sbjct: 1714 ccatacctgaaggaaggaga 1733

to top

>ref|NM_001037079.1| Arabidopsis thaliana unknown protein AT5G65950 transcript variant
            AT5G65950.2 mRNA, complete cds
          Length = 2935

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 545  ccatacctgaaggaaggaga 564
            ||||||||||||||||||||
Sbjct: 1718 ccatacctgaaggaaggaga 1737

to top

>gb|AC138671.16| Mus musculus chromosome 5, clone RP23-443N7, complete sequence
          Length = 196443

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 441    tggagggagagagggaggga 460
              ||||||||||||||||||||
Sbjct: 130399 tggagggagagagggaggga 130380

to top

>gb|AC101807.12| Mus musculus chromosome 18, clone RP24-251J22, complete sequence
          Length = 171409

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 442   ggagggagagagggagggac 461
             ||||||||||||||||||||
Sbjct: 73514 ggagggagagagggagggac 73533

to top

>gb|AY602221.1| Petromyzon marinus bone morphogenetic protein 24B (BMP24B) mRNA,
            complete cds
          Length = 2037

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 428  caggacatggtggtggaggg 447
            ||||||||||||||||||||
Sbjct: 1384 caggacatggtggtggaggg 1403

to top

>gb|AY602220.1| Petromyzon marinus bone morphogenetic protein 24A (BMP24A) mRNA,
            complete cds
          Length = 2747

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 428  caggacatggtggtggaggg 447
            ||||||||||||||||||||
Sbjct: 2063 caggacatggtggtggaggg 2082

to top

>gb|AC150430.3| Branchiostoma floridae clone CH302-99K22, complete sequence
          Length = 131908

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 429    aggacatggtggtggaggga 448
              ||||||||||||||||||||
Sbjct: 130097 aggacatggtggtggaggga 130078

to top

>gb|AC144767.4| Mus musculus BAC clone RP23-82F8 from chromosome 6, complete sequence
          Length = 229027

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 121   ataacttatttacatgggtt 140
             ||||||||||||||||||||
Sbjct: 51238 ataacttatttacatgggtt 51257

to top

>gb|AC154520.3| Mus musculus BAC clone RP23-471P16 from chromosome 14, complete
             sequence
          Length = 199186

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 442   ggagggagagagggagggac 461
             ||||||||||||||||||||
Sbjct: 98391 ggagggagagagggagggac 98410

to top

>gb|AC166158.3| Mus musculus BAC clone RP24-244P14 from chromosome 1, complete sequence
          Length = 170234

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 442    ggagggagagagggagggac 461
              ||||||||||||||||||||
Sbjct: 150194 ggagggagagagggagggac 150175

to top

>ref|XM_470485.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 903

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 182 gctgctgttgctgctgcttc 201
           ||||||||||||||||||||
Sbjct: 15  gctgctgttgctgctgcttc 34

to top

>ref|NM_057101.1| Rattus norvegicus cytochrome P450, subfamily 21A, polypeptide 1
           (Cyp21a1), mRNA
          Length = 1964

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 180 gggctgctgttgctgctgct 199
           ||||||||||||||||||||
Sbjct: 22  gggctgctgttgctgctgct 41

to top

>gb|AC153147.7| Mus musculus BAC clone RP23-205D14 from chromosome 12, complete
             sequence
          Length = 206281

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 441   tggagggagagagggaggga 460
             ||||||||||||||||||||
Sbjct: 49245 tggagggagagagggaggga 49226

to top

>gb|AC160028.9| Mus musculus 10 BAC RP24-570M12 (Roswell Park Cancer Institute
             (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 223055

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 441   tggagggagagagggaggga 460
             ||||||||||||||||||||
Sbjct: 45583 tggagggagagagggaggga 45564

to top

>gb|AY542940.1| Cyrtodiopsis dalmanni clone ms-361A microsatellite sequence
          Length = 196

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 182 gctgctgttgctgctgcttc 201
           ||||||||||||||||||||
Sbjct: 169 gctgctgttgctgctgcttc 188

to top

>gb|AC145508.3| Dasypus novemcinctus clone VMRC5-464O17, complete sequence
          Length = 169201

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 441   tggagggagagagggaggga 460
             ||||||||||||||||||||
Sbjct: 38811 tggagggagagagggaggga 38792

to top

>gb|AC137110.11| Mus musculus chromosome 7, clone RP23-399P8, complete sequence
          Length = 199827

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 442   ggagggagagagggagggac 461
             ||||||||||||||||||||
Sbjct: 21657 ggagggagagagggagggac 21638

to top

>ref|NM_181819.1| Mus musculus WAP, follistatin/kazal, immunoglobulin, kunitz and
           netrin domain containing 2 (Wfikkn2), mRNA
          Length = 1716

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 180 gggctgctgttgctgctgct 199
           ||||||||||||||||||||
Sbjct: 40  gggctgctgttgctgctgct 59

to top

>gb|AC158308.4| Mus musculus chromosome 3, clone RP23-182M12, complete sequence
          Length = 176856

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 437    gtggtggagggagagagggaggga 460
              ||||||||||||| ||||||||||
Sbjct: 127829 gtggtggagggagggagggaggga 127806

to top

>gb|CP000081.1| Leishmania major chromosome 35, complete sequence
          Length = 2090491

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 180    gggctgctgttgctgctgct 199
              ||||||||||||||||||||
Sbjct: 105534 gggctgctgttgctgctgct 105553

to top

>gb|AF050737.1| Homo sapiens dopamine D2 receptor (DRD2) gene, complete cds
          Length = 33654

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 442   ggagggagagagggagggac 461
             ||||||||||||||||||||
Sbjct: 24385 ggagggagagagggagggac 24404

to top

>gb|AC119857.10| Mus musculus chromosome 3, clone RP23-257A18, complete sequence
          Length = 152106

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 441   tggagggagagagggaggga 460
             ||||||||||||||||||||
Sbjct: 88114 tggagggagagagggaggga 88095

to top

>gb|AC165357.4| Mus musculus BAC clone RP23-114G24 from chromosome 10, complete sequence
          Length = 216816

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 182    gctgctgttgctgctgcttc 201
              ||||||||||||||||||||
Sbjct: 213248 gctgctgttgctgctgcttc 213229

to top

>gb|AC153878.11| Mus musculus 6 BAC RP23-229B22 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 185647

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 441   tggagggagagagggaggga 460
             ||||||||||||||||||||
Sbjct: 22618 tggagggagagagggaggga 22637

to top

>gb|AF040661.4| Caenorhabditis elegans cosmid W10G11, complete sequence
          Length = 37527

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 304   aggtaggttatgtggtcttgaatg 327
             ||||| ||||||||||||||||||
Sbjct: 10997 aggtaagttatgtggtcttgaatg 10974

to top

>gb|AC103632.8| Mus musculus chromosome 1, clone RP24-555D5, complete sequence
          Length = 177269

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 441    tggagggagagagggaggga 460
              ||||||||||||||||||||
Sbjct: 148187 tggagggagagagggaggga 148168

to top

>gb|AC099628.7| Mus musculus chromosome 1, clone RP24-82L18, complete sequence
          Length = 171875

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 445   gggagagagggagggacctg 464
             ||||||||||||||||||||
Sbjct: 76614 gggagagagggagggacctg 76595

to top

>gb|AC150281.1| Xenopus tropicalis BAC clone ISB1-110D7 containing BMP-2 gene, complete
             cds, complete sequence
          Length = 52180

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 428   caggacatggtggtggaggg 447
             ||||||||||||||||||||
Sbjct: 17921 caggacatggtggtggaggg 17940

to top

>gb|AC007890.6| Drosophila melanogaster clone BACR02G21, complete sequence
          Length = 171563

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 181   ggctgctgttgctgctgctt 200
             ||||||||||||||||||||
Sbjct: 88670 ggctgctgttgctgctgctt 88689

to top

>gb|AC118934.9| Mus musculus chromosome 19, clone RP24-172J14, complete sequence
          Length = 152728

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 441   tggagggagagagggaggga 460
             ||||||||||||||||||||
Sbjct: 26320 tggagggagagagggaggga 26301

to top

>ref|XM_589529.2| PREDICTED: Bos taurus similar to small nuclear RNA activating
            complex, polypeptide 4, 190kDa (LOC512086), mRNA
          Length = 4889

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 182  gctgctgttgctgctgcttc 201
            ||||||||||||||||||||
Sbjct: 1956 gctgctgttgctgctgcttc 1937

to top

>ref|NM_001001392.1| Homo sapiens CD44 molecule (Indian blood group) (CD44), transcript
            variant 5, mRNA
          Length = 3985

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 440  gtggagggagagagggaggg 459
            ||||||||||||||||||||
Sbjct: 2658 gtggagggagagagggaggg 2639

to top

>ref|NM_001001390.1| Homo sapiens CD44 molecule (Indian blood group) (CD44), transcript
            variant 3, mRNA
          Length = 5001

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 440  gtggagggagagagggaggg 459
            ||||||||||||||||||||
Sbjct: 3674 gtggagggagagagggaggg 3655

to top

>ref|NM_000610.3| Homo sapiens CD44 molecule (Indian blood group) (CD44), transcript
            variant 1, mRNA
          Length = 5748

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 440  gtggagggagagagggaggg 459
            ||||||||||||||||||||
Sbjct: 4421 gtggagggagagagggaggg 4402

to top

>ref|NM_001001389.1| Homo sapiens CD44 molecule (Indian blood group) (CD44), transcript
            variant 2, mRNA
          Length = 5619

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 440  gtggagggagagagggaggg 459
            ||||||||||||||||||||
Sbjct: 4292 gtggagggagagagggaggg 4273

to top

>ref|NM_001001391.1| Homo sapiens CD44 molecule (Indian blood group) (CD44), transcript
            variant 4, mRNA
          Length = 4605

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 440  gtggagggagagagggaggg 459
            ||||||||||||||||||||
Sbjct: 3278 gtggagggagagagggaggg 3259

to top

>ref|XM_960532.1| Neurospora crassa OR74A hypothetical protein (NCU02943.1) partial
           mRNA
          Length = 1713

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 182 gctgctgttgctgctgcttc 201
           ||||||||||||||||||||
Sbjct: 328 gctgctgttgctgctgcttc 309

to top

>ref|XM_590721.2| PREDICTED: Bos taurus similar to Nuclear mitotic apparatus protein 1
            (NuMA protein) (SP-H antigen) (LOC513091), mRNA
          Length = 7202

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 265  ctgcagctgctccaggcctc 284
            ||||||||||||||||||||
Sbjct: 5106 ctgcagctgctccaggcctc 5087

to top

>ref|XM_960050.1| Neurospora crassa OR74A hypothetical protein (NCU00950.1) partial
            mRNA
          Length = 1428

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 182  gctgctgttgctgctgcttc 201
            ||||||||||||||||||||
Sbjct: 1167 gctgctgttgctgctgcttc 1148

to top

>ref|XM_325129.1| Neurospora crassa OR74A hypothetical protein (NCU00950.1) partial
            mRNA
          Length = 1428

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 182  gctgctgttgctgctgcttc 201
            ||||||||||||||||||||
Sbjct: 1167 gctgctgttgctgctgcttc 1148

to top

>ref|XM_330130.1| Neurospora crassa OR74A hypothetical protein (NCU02943.1) partial
           mRNA
          Length = 1713

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 182 gctgctgttgctgctgcttc 201
           ||||||||||||||||||||
Sbjct: 328 gctgctgttgctgctgcttc 309

to top

>gb|DQ504427.1| Homo sapiens DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae)
             (DCLRE1C) gene, complete cds
          Length = 50007

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 442   ggagggagagagggagggacctgctgca 469
             |||||||| |||||||||||||| ||||
Sbjct: 28477 ggagggagggagggagggacctgttgca 28450

to top

>ref|XM_868267.1| PREDICTED: Bos taurus similar to trinucleotide repeat containing 15,
            transcript variant 2 (LOC506913), mRNA
          Length = 5680

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 182  gctgctgttgctgctgcttc 201
            ||||||||||||||||||||
Sbjct: 3095 gctgctgttgctgctgcttc 3076

to top

>ref|XM_881454.1| PREDICTED: Bos taurus similar to trinucleotide repeat containing 15,
            transcript variant 3 (LOC506913), mRNA
          Length = 5670

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 182  gctgctgttgctgctgcttc 201
            ||||||||||||||||||||
Sbjct: 3085 gctgctgttgctgctgcttc 3066

to top

>ref|XM_583430.2| PREDICTED: Bos taurus similar to trinucleotide repeat containing 15,
            transcript variant 1 (LOC506913), mRNA
          Length = 5460

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 182  gctgctgttgctgctgcttc 201
            ||||||||||||||||||||
Sbjct: 2875 gctgctgttgctgctgcttc 2856

to top

>gb|AC147132.3| Mus musculus BAC clone RP24-189K3 from chromosome 7, complete sequence
          Length = 189225

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 441    tggagggagagagggaggga 460
              ||||||||||||||||||||
Sbjct: 166770 tggagggagagagggaggga 166789

to top

>ref|XM_676394.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN8217.2), mRNA
          Length = 6159

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 179  cgggctgctgttgctgctgc 198
            ||||||||||||||||||||
Sbjct: 5641 cgggctgctgttgctgctgc 5622

to top

>gb|BT014632.1| Drosophila melanogaster SD12316 full insert cDNA
          Length = 6989

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 182  gctgctgttgctgctgcttc 201
            ||||||||||||||||||||
Sbjct: 6488 gctgctgttgctgctgcttc 6469

to top

>gb|AC147638.2| Mus musculus BAC clone RP23-181L5 from chromosome 7, complete sequence
          Length = 196114

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 441   tggagggagagagggaggga 460
             ||||||||||||||||||||
Sbjct: 79588 tggagggagagagggaggga 79607

to top

>gb|AY494871.1| Ceratocystis fimbriata microsatellite CAG-15 sequence
          Length = 269

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 182 gctgctgttgctgctgcttc 201
           ||||||||||||||||||||
Sbjct: 136 gctgctgttgctgctgcttc 117

to top

>gb|AC158215.3| Mus musculus chromosome 7, clone RP24-180E12, complete sequence
          Length = 156342

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 442   ggagggagagagggagggac 461
             ||||||||||||||||||||
Sbjct: 69968 ggagggagagagggagggac 69949

to top

>gb|AC087252.3| Papio anubis clone RP41-265N24, complete sequence
          Length = 179525

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 182   gctgctgttgctgctgcttc 201
             ||||||||||||||||||||
Sbjct: 17409 gctgctgttgctgctgcttc 17428

to top

>gb|AC151982.4| Mus musculus BAC clone RP23-445J16 from chromosome 12, complete
             sequence
          Length = 183898

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 442   ggagggagagagggagggac 461
             ||||||||||||||||||||
Sbjct: 36717 ggagggagagagggagggac 36698

to top

>gb|AF220262.1| Drosophila virilis TATA box-binding protein (TBP) gene, complete
           cds
          Length = 2007

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 179 cgggctgctgttgctgctgc 198
           ||||||||||||||||||||
Sbjct: 839 cgggctgctgttgctgctgc 820

to top

>gb|AC153378.4| Mus musculus 6 BAC RP23-106C18 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 199980

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 445   gggagagagggagggacctg 464
             ||||||||||||||||||||
Sbjct: 23381 gggagagagggagggacctg 23362

to top

>gb|AC113475.12| Mus musculus chromosome 12, clone RP23-304B1, complete sequence
          Length = 177032

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 441   tggagggagagagggaggga 460
             ||||||||||||||||||||
Sbjct: 11390 tggagggagagagggaggga 11371

to top

>gb|AC164002.4| Mus musculus chromosome 3, clone RP24-114A9, complete sequence
          Length = 198340

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 441    tggagggagagagggaggga 460
              ||||||||||||||||||||
Sbjct: 176948 tggagggagagagggaggga 176967

to top

>gb|AC115860.9| Mus musculus chromosome 1, clone RP24-290C11, complete sequence
          Length = 240785

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 445    gggagagagggagggacctg 464
              ||||||||||||||||||||
Sbjct: 122481 gggagagagggagggacctg 122500

to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 182      gctgctgttgctgctgcttc 201
                ||||||||||||||||||||
Sbjct: 35882453 gctgctgttgctgctgcttc 35882434



 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 181      ggctgctgttgctgctgctt 200
                ||||||||||||||||||||
Sbjct: 22660059 ggctgctgttgctgctgctt 22660078

to top

>gb|AC154726.2| Mus musculus BAC clone RP24-373I6 from chromosome 13, complete sequence
          Length = 173853

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 445    gggagagagggagggacctg 464
              ||||||||||||||||||||
Sbjct: 149583 gggagagagggagggacctg 149602

to top

>gb|AY190956.1| Drosophila virilis clone DVIF01_06_H02 (D1438) genomic sequence
          Length = 46427

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 182   gctgctgttgctgctgcttc 201
             ||||||||||||||||||||
Sbjct: 23997 gctgctgttgctgctgcttc 24016

to top

>gb|AC115073.9| Mus musculus chromosome 8, clone RP24-417J18, complete sequence
          Length = 161625

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 441    tggagggagagagggaggga 460
              ||||||||||||||||||||
Sbjct: 130643 tggagggagagagggaggga 130662

to top

>gb|AC099735.47| Mus musculus chromosome 1, clone RP23-218I9, complete sequence
          Length = 207768

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 442    ggagggagagagggagggac 461
              ||||||||||||||||||||
Sbjct: 204905 ggagggagagagggagggac 204924

to top

>gb|AC131756.3| Mus musculus BAC clone RP24-199J23 from chromosome 19, complete sequence
          Length = 175604

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 442    ggagggagagagggagggac 461
              ||||||||||||||||||||
Sbjct: 121188 ggagggagagagggagggac 121207

to top

>gb|AC102734.11| Mus musculus chromosome 6, clone RP24-222N4, complete sequence
          Length = 238453

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 182    gctgctgttgctgctgcttc 201
              ||||||||||||||||||||
Sbjct: 202412 gctgctgttgctgctgcttc 202431

to top

>gb|AC107865.7| Mus musculus chromosome 1, clone RP23-389C9, complete sequence
          Length = 204959

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 442    ggagggagagagggagggac 461
              ||||||||||||||||||||
Sbjct: 141733 ggagggagagagggagggac 141714

to top

>gb|AC101542.19| Mus musculus chromosome 19, clone RP23-456B17, complete sequence
          Length = 165781

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 441   tggagggagagagggaggga 460
             ||||||||||||||||||||
Sbjct: 82934 tggagggagagagggaggga 82915

to top

>gb|AC141478.3| Mus musculus BAC clone RP24-82N16 from chromosome 18, complete sequence
          Length = 184122

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 441    tggagggagagagggaggga 460
              ||||||||||||||||||||
Sbjct: 117354 tggagggagagagggaggga 117335

to top

>emb|AJ131894.1|HSA131894 Homo sapiens genomic CAG repeat element, clone 60o2(1)
          Length = 271

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 180 gggctgctgttgctgctgct 199
           ||||||||||||||||||||
Sbjct: 140 gggctgctgttgctgctgct 121

to top

>gb|AC055873.8| Homo sapiens chromosome 15, clone RP11-339F1, complete sequence
          Length = 194765

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 441   tggagggagagagggaggga 460
             ||||||||||||||||||||
Sbjct: 25612 tggagggagagagggaggga 25631

to top

>gb|AC118000.14| Mus musculus chromosome 3, clone RP23-33M9, complete sequence
          Length = 167218

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 445   gggagagagggagggacctg 464
             ||||||||||||||||||||
Sbjct: 93015 gggagagagggagggacctg 93034

to top

>gb|AC131765.3| Mus musculus BAC clone RP24-240I9 from chromosome 1, complete sequence
          Length = 152666

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 441   tggagggagagagggaggga 460
             ||||||||||||||||||||
Sbjct: 21920 tggagggagagagggaggga 21901

to top

>gb|AC131700.3| Mus musculus BAC clone RP24-67N3 from chromosome 6, complete sequence
          Length = 197050

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 182    gctgctgttgctgctgcttc 201
              ||||||||||||||||||||
Sbjct: 155562 gctgctgttgctgctgcttc 155543

to top

>gb|AC124728.5| Mus musculus BAC clone RP23-470C22 from chromosome 6, complete sequence
          Length = 183845

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 445   gggagagagggagggacctg 464
             ||||||||||||||||||||
Sbjct: 67789 gggagagagggagggacctg 67770

to top

>ref|XM_853603.1| PREDICTED: Canis familiaris similar to HLA-B associated transcript 2,
            transcript variant 4 (LOC481713), mRNA
          Length = 6930

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 182  gctgctgttgctgctgcttc 201
            ||||||||||||||||||||
Sbjct: 2245 gctgctgttgctgctgcttc 2226

to top

>ref|XM_844311.1| PREDICTED: Canis familiaris similar to HLA-B associated transcript 2,
            transcript variant 2 (LOC481713), mRNA
          Length = 6919

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 182  gctgctgttgctgctgcttc 201
            ||||||||||||||||||||
Sbjct: 2213 gctgctgttgctgctgcttc 2194

to top

>ref|XM_538834.2| PREDICTED: Canis familiaris similar to HLA-B associated transcript 2,
            transcript variant 1 (LOC481713), mRNA
          Length = 6898

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 182  gctgctgttgctgctgcttc 201
            ||||||||||||||||||||
Sbjct: 2213 gctgctgttgctgctgcttc 2194

to top

>gb|AC127552.3| Mus musculus BAC clone RP24-550N13 from chromosome 3, complete sequence
          Length = 156534

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 445   gggagagagggagggacctg 464
             ||||||||||||||||||||
Sbjct: 48101 gggagagagggagggacctg 48082

to top

>gb|AC124694.3| Mus musculus BAC clone RP24-171H8 from chromosome 14, complete sequence
          Length = 154741

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 441    tggagggagagagggaggga 460
              ||||||||||||||||||||
Sbjct: 102101 tggagggagagagggaggga 102120

to top

>gb|AC125486.4| Mus musculus BAC clone RP23-21G7 from chromosome 10, complete sequence
          Length = 222316

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 182    gctgctgttgctgctgcttc 201
              ||||||||||||||||||||
Sbjct: 160255 gctgctgttgctgctgcttc 160236

to top

>gb|AC140436.3| Mus musculus BAC clone RP23-85O2 from chromosome 9, complete sequence
          Length = 142560

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 441    tggagggagagagggaggga 460
              ||||||||||||||||||||
Sbjct: 138170 tggagggagagagggaggga 138189

to top

>gb|AC124571.5| Mus musculus BAC clone RP23-155I21 from chromosome 2, complete sequence
          Length = 181526

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 445    gggagagagggagggacctg 464
              ||||||||||||||||||||
Sbjct: 131334 gggagagagggagggacctg 131315

to top

>gb|AC122342.4| Mus musculus BAC clone RP23-357O17 from chromosome 8, complete
            sequence
          Length = 199412

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 441  tggagggagagagggaggga 460
            ||||||||||||||||||||
Sbjct: 3103 tggagggagagagggaggga 3122

to top

>gb|AC122367.4| Mus musculus BAC clone RP23-449L24 from chromosome 12, complete sequence
          Length = 200004

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 442    ggagggagagagggagggac 461
              ||||||||||||||||||||
Sbjct: 107452 ggagggagagagggagggac 107433

to top

>ref|XM_805955.1| Trypanosoma cruzi strain CL Brener kinesin (Tc00.1047053506857.80)
            partial mRNA
          Length = 2436

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 182  gctgctgttgctgctgcttc 201
            ||||||||||||||||||||
Sbjct: 1132 gctgctgttgctgctgcttc 1151

to top

>gb|AC124352.2| Mus musculus BAC clone RP24-477C23 from chromosome 9, complete sequence
          Length = 177886

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 441    tggagggagagagggaggga 460
              ||||||||||||||||||||
Sbjct: 173789 tggagggagagagggaggga 173808

to top

>gb|AC124682.4| Mus musculus BAC clone RP24-336O24 from chromosome 6, complete sequence
          Length = 127717

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 442    ggagggagagagggagggac 461
              ||||||||||||||||||||
Sbjct: 122540 ggagggagagagggagggac 122521

to top

>gb|AC123053.4| Mus musculus BAC clone RP24-374O20 from chromosome 7, complete sequence
          Length = 184618

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 428    caggacatggtggtggaggg 447
              ||||||||||||||||||||
Sbjct: 101859 caggacatggtggtggaggg 101840

to top

>gb|AC122026.3| Mus musculus BAC clone RP24-390D21 from chromosome 1, complete sequence
          Length = 205642

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 441   tggagggagagagggaggga 460
             ||||||||||||||||||||
Sbjct: 31441 tggagggagagagggaggga 31460

to top

>gb|AC122522.4| Mus musculus BAC clone RP24-486D23 from chromosome 5, complete sequence
          Length = 186083

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 441   tggagggagagagggaggga 460
             ||||||||||||||||||||
Sbjct: 42398 tggagggagagagggaggga 42379

to top

>gb|AC117259.3| Mus musculus BAC clone RP24-492O19 from chromosome 12, complete
             sequence
          Length = 145944

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 441   tggagggagagagggaggga 460
             ||||||||||||||||||||
Sbjct: 33368 tggagggagagagggaggga 33387

to top

>gb|AC129192.4| Mus musculus BAC clone RP24-113B19 from chromosome 5, complete sequence
          Length = 170410

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 442    ggagggagagagggagggac 461
              ||||||||||||||||||||
Sbjct: 130542 ggagggagagagggagggac 130561

to top

>gb|AC121862.3| Mus musculus BAC clone RP24-110E10 from chromosome 14, complete sequence
          Length = 178501

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 182    gctgctgttgctgctgcttc 201
              ||||||||||||||||||||
Sbjct: 144995 gctgctgttgctgctgcttc 144976

to top

>gb|AC124200.4| Mus musculus BAC clone RP23-328F5 from chromosome 8, complete sequence
          Length = 215638

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 439   ggtggagggagagagggagg 458
             ||||||||||||||||||||
Sbjct: 75329 ggtggagggagagagggagg 75348

to top

>gb|AE014304.1| Homo sapiens chromosome 13q34 schizophrenia region contig 1 section 1
            of 11 of the complete sequence
          Length = 250029

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 442  ggagggagagagggagggac 461
            ||||||||||||||||||||
Sbjct: 9025 ggagggagagagggagggac 9006

to top

>gb|AC018688.9| Homo sapiens BAC clone RP11-462H3 from UL, complete sequence
          Length = 170204

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 444    agggagagagggagggacct 463
              ||||||||||||||||||||
Sbjct: 125749 agggagagagggagggacct 125730

to top

>gb|AC098738.2| Mus musculus BAC clone RP23-122F7 from 8, complete sequence
          Length = 216974

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 441   tggagggagagagggaggga 460
             ||||||||||||||||||||
Sbjct: 40336 tggagggagagagggaggga 40317

to top

>gb|AC117213.3| Mus musculus BAC clone RP23-305J6 from 6, complete sequence
          Length = 186160

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 442    ggagggagagagggagggac 461
              ||||||||||||||||||||
Sbjct: 101410 ggagggagagagggagggac 101391

to top

>gb|AC104920.10| Mus musculus chromosome 10, clone RP23-360H23, complete sequence
          Length = 212273

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 441    tggagggagagagggaggga 460
              ||||||||||||||||||||
Sbjct: 208119 tggagggagagagggaggga 208138

to top

>gb|AC098887.4| Mus musculus BAC clone RP23-122N6 from 10, complete sequence
          Length = 211397

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 441    tggagggagagagggaggga 460
              ||||||||||||||||||||
Sbjct: 160706 tggagggagagagggaggga 160687

to top

>gb|AC121600.2| Mus musculus BAC clone RP23-302K1 from 17, complete sequence
          Length = 199296

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 445   gggagagagggagggacctg 464
             ||||||||||||||||||||
Sbjct: 33878 gggagagagggagggacctg 33897

to top

>gb|AC146200.2| Pan troglodytes BAC clone RP43-34F23 from 7, complete sequence
          Length = 160638

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 635   gaatggcactatgtgtaagt 654
             ||||||||||||||||||||
Sbjct: 80269 gaatggcactatgtgtaagt 80288

to top

>gb|AC072063.5| Homo sapiens BAC clone RP11-697B15 from 7, complete sequence
          Length = 136286

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 441   tggagggagagagggaggga 460
             ||||||||||||||||||||
Sbjct: 64171 tggagggagagagggaggga 64152

to top

>gb|AC107830.10| Mus musculus chromosome 16, clone RP23-230L20, complete sequence
          Length = 175615

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 445   gggagagagggagggacctg 464
             ||||||||||||||||||||
Sbjct: 26102 gggagagagggagggacctg 26121

to top

>gb|AC164516.2| Dasypus novemcinctus clone VMRC5-470I13, complete sequence
          Length = 127034

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 441    tggagggagagagggaggga 460
              ||||||||||||||||||||
Sbjct: 117366 tggagggagagagggaggga 117347

to top

>gb|AC165347.4| Mus musculus BAC clone RP23-348B21 from chromosome 13, complete sequence
          Length = 205783

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 441    tggagggagagagggaggga 460
              ||||||||||||||||||||
Sbjct: 136617 tggagggagagagggaggga 136598

to top

>gb|AC160462.6| Mus musculus chromosome 1, clone RP23-225K21, complete sequence
          Length = 197253

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 182   gctgctgttgctgctgcttc 201
             ||||||||||||||||||||
Sbjct: 47390 gctgctgttgctgctgcttc 47409

to top

>gb|AC163638.2| Mus musculus BAC clone RP23-188H10 from chromosome 14, complete sequence
          Length = 203950

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 441    tggagggagagagggaggga 460
              ||||||||||||||||||||
Sbjct: 170980 tggagggagagagggaggga 170961

to top

>gb|AC154352.2| Mus musculus BAC clone RP24-545J11 from chromosome 13, complete sequence
          Length = 199388

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 442    ggagggagagagggagggac 461
              ||||||||||||||||||||
Sbjct: 134102 ggagggagagagggagggac 134083

to top

>gb|AY167905.1| Drosophila melanogaster clone F scribbled (scrib) mRNA,
           scrib-smi97B allele, partial cds
          Length = 3656

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 180 gggctgctgttgctgctgct 199
           ||||||||||||||||||||
Sbjct: 723 gggctgctgttgctgctgct 704

to top

>emb|AL133330.14| Human DNA sequence from clone RP1-68D18 on chromosome 11p12-13 Contains
              part of the SLC1A2 gene for three variants of solute
              carrier family 1 (glial high affinity glutamate
              transporter) member 2 and part of the CD44 gene for CD44
              antigen (homing function and Indian blood group system)
              with five variants, complete sequence
          Length = 183682

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 440    gtggagggagagagggaggg 459
              ||||||||||||||||||||
Sbjct: 120785 gtggagggagagagggaggg 120804

to top

>emb|Z95114.19|HS212A2 Human DNA sequence from clone CTA-212A2 on chromosome 22q12, complete
              sequence
          Length = 212753

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 441    tggagggagagagggaggga 460
              ||||||||||||||||||||
Sbjct: 111312 tggagggagagagggaggga 111293

to top

>emb|AL691482.16| Human DNA sequence from clone RP11-510N19 on chromosome 1 Contains the
             ELF3 gene for E74-like factor 3 (ets domain transcription
             factor, epithelial-specific), a novel gene, an LSM3
             homolog U6 small nuclear RNA associated (S. cerevisiae)
             (LSM3) pseudogene, an ATPase H+ transporting lysosomal
             9kDa V0 subunit e (ATP6V0E) pseudogene and a cysteine-rich
             protein 1 (intestinal) (CRIP1) pseudogene, complete
             sequence
          Length = 112539

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 180   gggctgctgttgctgctgct 199
             ||||||||||||||||||||
Sbjct: 90451 gggctgctgttgctgctgct 90432

to top

>emb|AL603783.14| Human DNA sequence from clone RP11-216B13 on chromosome 6 Contains two
             CpG islands, complete sequence
          Length = 94482

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 441   tggagggagagagggaggga 460
             ||||||||||||||||||||
Sbjct: 37837 tggagggagagagggaggga 37818

to top

>emb|AL589725.6| Human DNA sequence from clone RP11-280I21 on chromosome 6, complete
             sequence
          Length = 30634

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 441   tggagggagagagggaggga 460
             ||||||||||||||||||||
Sbjct: 21242 tggagggagagagggaggga 21261

to top

>gb|DQ471716.1| Isoplexis canariensis CYCLOIDEA-like protein (cyc2) gene, partial
           cds
          Length = 576

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 182 gctgctgttgctgctgcttc 201
           ||||||||||||||||||||
Sbjct: 435 gctgctgttgctgctgcttc 416

to top

>emb|AL392043.21| Human DNA sequence from clone RP11-288G11 on chromosome 10 Contains the
             3' end of the INPP5A gene for inositol
             polyphosphate-5-phosphatase 40kDa, a novel gene, the
             NKX6-2 gene for NK6 transcription factor related locus 2,
             a novel gene (DKFZp434A1721), the 3' end of a novel gene
             and ten CpG islands, complete sequence
          Length = 208064

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 437   gtggtggagggagagagggaggga 460
             ||||||||||||| ||||||||||
Sbjct: 39712 gtggtggagggagggagggaggga 39735

to top

>emb|AL392163.8| Human DNA sequence from clone RP11-43M11 on chromosome 9 Contains part
             of a novel gene (FLJ20375, KIAA1797), complete sequence
          Length = 161103

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 441   tggagggagagagggaggga 460
             ||||||||||||||||||||
Sbjct: 78109 tggagggagagagggaggga 78090

to top

>emb|AL359918.43| Human DNA sequence from clone RP11-567G24 on chromosome 1 Contains part
             of the FMN2 gene for formin 2, a proteasome 26S non-ATPase
             subunit 2 (PSMD2) pseudogene, an alcohol dehydrogenase 5
             (class III), chi polypeptide (ADH5) pseudogene, a novel
             gene and three CpG islands, complete sequence
          Length = 208383

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 437   gtggtggagggagagaggga 456
             ||||||||||||||||||||
Sbjct: 99662 gtggtggagggagagaggga 99681

to top

>emb|AL360083.27| Human DNA sequence from clone RP11-2K17 on chromosome 10 Contains the
             3' end of the gene for suppressor of variegation 3-9
             (Drosophila) homolog 2; hypothetical protein FLJ23414
             (SUV39H2)(FLJ23414), the DCLRE1C gene for DNA cross-link
             repair 1C (PSO2 homolog, S.cerevisiae) (SCIDA, SNM1C,
             ARTEMIS, RS-SCID,DCLREC1C, FLJ11360), the gene for a novel
             protein similar to mouse Meig1 (Meg1)(meiosis expressed
             gene 1), a novel gene, a seven transmembrane receptor
             (Rhodopsin family) pseudogene and two CpG islands,
             complete sequence
          Length = 94963

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 442   ggagggagagagggagggacctgctgca 469
             |||||||| |||||||||||||| ||||
Sbjct: 27990 ggagggagggagggagggacctgttgca 28017

to top

>ref|XM_504405.1| Yarrowia lipolytica CLIB122, YALI0E25960g predicted mRNA
          Length = 3189

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 180 gggctgctgttgctgctgct 199
           ||||||||||||||||||||
Sbjct: 582 gggctgctgttgctgctgct 563

to top

>ref|NM_131360.1| Danio rerio bone morphogenetic protein 2b (bmp2b), mRNA
          Length = 1732

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 428  caggacatggtggtggaggg 447
            ||||||||||||||||||||
Sbjct: 1576 caggacatggtggtggaggg 1595

to top

>gb|AY100450.1| Mus musculus novel secreted protein precursor, mRNA, partial cds
          Length = 349

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 180 gggctgctgttgctgctgct 199
           ||||||||||||||||||||
Sbjct: 212 gggctgctgttgctgctgct 231

to top

>emb|AL357508.10| Human DNA sequence from clone RP11-457K6 on chromosome 20 Contains ESTs
             and GSSs, complete sequence
          Length = 72952

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 441   tggagggagagagggaggga 460
             ||||||||||||||||||||
Sbjct: 62089 tggagggagagagggaggga 62108

to top

>emb|AL356098.10| Human DNA sequence from clone RP11-457L23 on chromosome 13 Contains an
             Alport syndrome mental retardation midface hypoplasia and
             elliptocytosis chromosomal region gene 1 (AMMECR1)
             pseudogene, complete sequence
          Length = 186305

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 442   ggagggagagagggagggac 461
             ||||||||||||||||||||
Sbjct: 99373 ggagggagagagggagggac 99392

to top

>gb|AC137971.4| Mus musculus, clone RP23-135B1, complete sequence
          Length = 224801

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 442    ggagggagagagggagggac 461
              ||||||||||||||||||||
Sbjct: 160803 ggagggagagagggagggac 160822

to top

>emb|AL139821.9| Human DNA sequence from clone RP11-80K21 on chromosome 10 Contains two
             novel genes including FLJ37439, the 5' end of a novel gene
             (KIAA1136) (FLJ37801) and a CpG island, complete sequence
          Length = 163680

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 441   tggagggagagagggaggga 460
             ||||||||||||||||||||
Sbjct: 37159 tggagggagagagggaggga 37140



 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 441   tggagggagagagggaggga 460
             ||||||||||||||||||||
Sbjct: 37078 tggagggagagagggaggga 37059



 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 441   tggagggagagagggaggga 460
             ||||||||||||||||||||
Sbjct: 36997 tggagggagagagggaggga 36978

to top

>emb|AL136991.26| Human DNA sequence from clone RP11-189J1 on chromosome 20 Contains the 3'
              end of the gene for a novel protein (LOC284776), complete
              sequence
          Length = 169342

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 441    tggagggagagagggaggga 460
              ||||||||||||||||||||
Sbjct: 165220 tggagggagagagggaggga 165239

to top

>emb|AL137246.16| Human DNA sequence from clone RP11-255P5 on chromosome 13 Contains a
             hepatocellular carcinoma-associated antigen HCA557b
             (LOC151194) pseudogene, complete sequence
          Length = 39893

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 442   ggagggagagagggagggac 461
             ||||||||||||||||||||
Sbjct: 30030 ggagggagagagggagggac 30011

to top

>emb|AL031577.1|HS391O22 Human DNA sequence from clone RP3-391O22 on chromosome 6p21.2-21.31
             Contains a ribosomal protein L44 (RPL44) pseudogene, the
             3' end of gene FLJ32402, a ribosomal protein L7 (RPL7)
             pseudogene and an interferon induced transmembrane protein
             2 (1-8D) or 3 (1-8U) (IFITM2, IFITM3) pseudogene, complete
             sequence
          Length = 126807

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 441   tggagggagagagggaggga 460
             ||||||||||||||||||||
Sbjct: 58205 tggagggagagagggaggga 58186

to top

>gb|AY308804.1| Mus musculus growth and differentiation factor-associated serum
           protein 1 (Gasp1) mRNA, complete cds
          Length = 1716

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 180 gggctgctgttgctgctgct 199
           ||||||||||||||||||||
Sbjct: 40  gggctgctgttgctgctgct 59

to top

>gb|AC093176.6| Mus musculus Strain C57BL6/J chromosome 6 BAC, RP23-109H11, Complete
             Sequence, complete sequence
          Length = 192227

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 121   ataacttatttacatgggtt 140
             ||||||||||||||||||||
Sbjct: 94788 ataacttatttacatgggtt 94769

to top

>gb|BT000263.1| Arabidopsis thaliana unknown protein (At5g65950) mRNA, complete cds
          Length = 2713

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 545  ccatacctgaaggaaggaga 564
            ||||||||||||||||||||
Sbjct: 1642 ccatacctgaaggaaggaga 1661

to top

>gb|AC163627.4| Mus musculus BAC clone RP23-341E13 from chromosome 6, complete sequence
          Length = 191467

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 121   ataacttatttacatgggtt 140
             ||||||||||||||||||||
Sbjct: 12767 ataacttatttacatgggtt 12748

to top

>emb|X07134.1|DMSHAKE4 D. melanogaster larval Shaker ShE mRNA for put. K(+)-channel
          Length = 1790

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 182 gctgctgttgctgctgcttc 201
           ||||||||||||||||||||
Sbjct: 621 gctgctgttgctgctgcttc 602

to top

>emb|X07131.1|DMSHAKE1 D. melanogaster adult Shaker ShA mRNA for put. K(+)-channel
          Length = 2855

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 182 gctgctgttgctgctgcttc 201
           ||||||||||||||||||||
Sbjct: 613 gctgctgttgctgctgcttc 594

to top

>emb|X06742.1|DMSHB1MR D.melanogaster ShB1 mRNA for Shaker gene
          Length = 2732

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 182 gctgctgttgctgctgcttc 201
           ||||||||||||||||||||
Sbjct: 619 gctgctgttgctgctgcttc 600

to top

>gb|AC166324.1| Mus musculus BAC clone RP24-500J7 from chromosome 9, complete
            sequence
          Length = 168018

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 445  gggagagagggagggacctg 464
            ||||||||||||||||||||
Sbjct: 3490 gggagagagggagggacctg 3471

to top

>gb|AC118283.5| Homo sapiens BAC clone RP11-1398P2 from 4, complete sequence
          Length = 130805

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 440   gtggagggagagagggaggg 459
             ||||||||||||||||||||
Sbjct: 72511 gtggagggagagagggaggg 72530

to top

>emb|BX883044.1| Rattus norvegicus chromosome 20, major histocompatibility complex,
              assembled from 40 BACs, strain Brown Norway (BN/ssNHsd),
              RT1n haplotype; segment 3/11
          Length = 340493

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 180    gggctgctgttgctgctgct 199
              ||||||||||||||||||||
Sbjct: 337358 gggctgctgttgctgctgct 337339

to top

>emb|BX842629.1| Neurospora crassa DNA linkage group I BAC contig B20J13
          Length = 126048

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 182  gctgctgttgctgctgcttc 201
            ||||||||||||||||||||
Sbjct: 9750 gctgctgttgctgctgcttc 9769

to top

>gb|AC162948.4| Mus musculus BAC clone RP23-14N2 from chromosome 9, complete sequence
          Length = 221791

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 441   tggagggagagagggaggga 460
             ||||||||||||||||||||
Sbjct: 30463 tggagggagagagggaggga 30444

to top

>gb|AC164558.2| Mus musculus BAC clone RP23-238F5 from chromosome 16, complete sequence
          Length = 186421

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 441   tggagggagagagggaggga 460
             ||||||||||||||||||||
Sbjct: 89318 tggagggagagagggaggga 89337

to top

>gb|AC151830.3| Mus musculus BAC clone RP24-76I23 from chromosome 7, complete sequence
          Length = 212931

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 441   tggagggagagagggaggga 460
             ||||||||||||||||||||
Sbjct: 32966 tggagggagagagggaggga 32985

to top

>ref|NM_001015963.2| Xenopus tropicalis bone morphogenetic protein 2 (bmp2), mRNA
          Length = 2662

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 428  caggacatggtggtggaggg 447
            ||||||||||||||||||||
Sbjct: 1566 caggacatggtggtggaggg 1585

to top

>gb|AC153495.10| Mus musculus 10 BAC RP23-468D5 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 179258

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 441    tggagggagagagggaggga 460
              ||||||||||||||||||||
Sbjct: 166886 tggagggagagagggaggga 166867

to top

>gb|AC162382.8| Mus musculus 6 BAC RP24-398M13 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 200253

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 182   gctgctgttgctgctgcttc 201
             ||||||||||||||||||||
Sbjct: 38190 gctgctgttgctgctgcttc 38209

to top

>emb|AL939113.1|SCO939113 Streptomyces coelicolor A3(2) complete genome; segment 10/29
          Length = 310550

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 180    gggctgctgttgctgctgct 199
              ||||||||||||||||||||
Sbjct: 225859 gggctgctgttgctgctgct 225878

to top

>emb|AL672141.12| Mouse DNA sequence from clone RP23-219C18 on chromosome 11 Contains the
              3' end of the Hs3st3a gene for heparan sulfate
              (glucosamine) 3-O-sulfotransferase 3A and a CpG island,
              complete sequence
          Length = 153658

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 441    tggagggagagagggaggga 460
              ||||||||||||||||||||
Sbjct: 130259 tggagggagagagggaggga 130240

to top

>emb|AL832642.2|HSM803952 Homo sapiens mRNA; cDNA DKFZp451K1918 (from clone DKFZp451K1918);
            complete cds
          Length = 4606

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 440  gtggagggagagagggaggg 459
            ||||||||||||||||||||
Sbjct: 3279 gtggagggagagagggaggg 3260

to top

>gb|AC129555.29| Mus musculus chromosome 5, clone RP24-90F19, complete sequence
          Length = 242141

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 442    ggagggagagagggagggac 461
              ||||||||||||||||||||
Sbjct: 147306 ggagggagagagggagggac 147287

to top

>emb|AJ315160.1|XTR315160 Xenopus tropicalis BMP-2 gene for bone morphogenetic protein 2
          Length = 13500

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 428   caggacatggtggtggaggg 447
             ||||||||||||||||||||
Sbjct: 12250 caggacatggtggtggaggg 12269

to top

>emb|AL645842.15| Mouse DNA sequence from clone RP23-20A9 on chromosome 11 Contains two
             novel genes and the 3' end of the Accn1 gene for neuronal
             amiloride-sensitive cation channel 1 (degenerin), complete
             sequence
          Length = 114190

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 441   tggagggagagagggaggga 460
             ||||||||||||||||||||
Sbjct: 49774 tggagggagagagggaggga 49755

to top

>emb|AL645844.18| Mouse DNA sequence from clone RP23-82B4 on chromosome 11 Contains a
             heat shock protein Hsp90 family pseudogene, complete
             sequence
          Length = 146832

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 442   ggagggagagagggagggac 461
             ||||||||||||||||||||
Sbjct: 21718 ggagggagagagggagggac 21737

to top

>emb|AL663055.13| Mouse DNA sequence from clone RP23-102H8 on chromosome 11 Contains the 5'
              end of the Gria1 gene for glutamate receptor, ionotropic,
              AMPA1 (alpha 1), complete sequence
          Length = 202981

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 436    ggtggtggagggagagagggaggg 459
              ||||| ||||||||||||||||||
Sbjct: 106748 ggtggaggagggagagagggaggg 106771

to top

>emb|AL645846.12| Mouse DNA sequence from clone RP23-244C22 on chromosome 11 Contains a
              novel gene, the Tob1 gene for transducer of ErbB-2.1, the
              gene for a novel protein (AY100450) (WFIKKN-like growth and
              differentiation factor-associated serum protein 1) (Gasp1),
              a novel gene, the gene for a novel protein (3300001P08Rik)
              (Luc7a) and one CpG island, complete sequence
          Length = 188962

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 180    gggctgctgttgctgctgct 199
              ||||||||||||||||||||
Sbjct: 111830 gggctgctgttgctgctgct 111811

to top

>gb|AC156982.8| Mus musculus chromosome 19, clone RP23-183N3, complete sequence
          Length = 216311

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 182   gctgctgttgctgctgcttc 201
             ||||||||||||||||||||
Sbjct: 97600 gctgctgttgctgctgcttc 97619

to top

>gb|AC161570.6| Mus musculus chromosome 5, clone RP23-36O9, complete sequence
          Length = 228402

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 441    tggagggagagagggaggga 460
              ||||||||||||||||||||
Sbjct: 157907 tggagggagagagggaggga 157888

to top

>gb|AC154795.2| Mus musculus BAC clone RP24-486D21 from chromosome 14, complete sequence
          Length = 153985

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 441    tggagggagagagggaggga 460
              ||||||||||||||||||||
Sbjct: 126032 tggagggagagagggaggga 126051

to top

>gb|AC154642.2| Mus musculus BAC clone RP23-277C14 from chromosome 14, complete sequence
          Length = 211315

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 441    tggagggagagagggaggga 460
              ||||||||||||||||||||
Sbjct: 192315 tggagggagagagggaggga 192296

to top

>emb|BX601648.7| Zebrafish DNA sequence from clone DKEY-14F19 in linkage group 11,
            complete sequence
          Length = 230487

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 441  tggagggagagagggaggga 460
            ||||||||||||||||||||
Sbjct: 6554 tggagggagagagggaggga 6573

to top

>gb|AC098642.5| Genomic sequence for Mus musculus, clone RP23-270O7, complete sequence
          Length = 188834

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 182    gctgctgttgctgctgcttc 201
              ||||||||||||||||||||
Sbjct: 150954 gctgctgttgctgctgcttc 150935

to top

>gb|AC008761.8| Homo sapiens chromosome 19 clone CTD-3149D2, complete sequence
          Length = 226170

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 437    gtggtggagggagagagggaggga 460
              ||||||||||||| ||||||||||
Sbjct: 110455 gtggtggagggagtgagggaggga 110478

to top

>gb|AC013564.7| Homo sapiens chromosome 15, clone RP11-321F6, complete sequence
          Length = 210133

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 180   gggctgctgttgctgctgct 199
             ||||||||||||||||||||
Sbjct: 86193 gggctgctgttgctgctgct 86174

to top

>gb|AC099676.2| Homo sapiens chromosome 1 clone RP11-465N4, complete sequence
          Length = 204679

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 180    gggctgctgttgctgctgct 199
              ||||||||||||||||||||
Sbjct: 197419 gggctgctgttgctgctgct 197400

to top

>gb|AC084823.11| Mus Musculus Strain C57BL6/J chromosome 8 BAC, RP23-290L7, Complete
              Sequence, complete sequence
          Length = 212133

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 442    ggagggagagagggagggac 461
              ||||||||||||||||||||
Sbjct: 194339 ggagggagagagggagggac 194320

to top

>emb|CR749525.1| Homo sapiens mRNA; cDNA DKFZp686F1792 (from clone DKFZp686F1792)
          Length = 5375

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 436  ggtggtggagggagagaggg 455
            ||||||||||||||||||||
Sbjct: 4957 ggtggtggagggagagaggg 4976

to top

>dbj|AK127622.1| Homo sapiens cDNA FLJ45720 fis, clone HCASM2000363
          Length = 2403

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 440  gtggagggagagagggaggg 459
            ||||||||||||||||||||
Sbjct: 1099 gtggagggagagagggaggg 1080

to top

>gb|AC010057.7| Drosophila melanogaster 3L BAC RP98-26C18 (Roswell Park Cancer
           Institute Drosophila BAC Library) complete sequence
          Length = 192588

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 180 gggctgctgttgctgctgct 199
           ||||||||||||||||||||
Sbjct: 68  gggctgctgttgctgctgct 87

to top

>gb|AC023686.4| Drosophila melanogaster X BAC RP98-30C1 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 170626

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 183    ctgctgttgctgctgcttcg 202
              ||||||||||||||||||||
Sbjct: 123177 ctgctgttgctgctgcttcg 123158


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 7,050,195
Number of Sequences: 3902068
Number of extensions: 7050195
Number of successful extensions: 256948
Number of sequences better than 10.0: 465
Number of HSP's better than 10.0 without gapping: 467
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 254129
Number of HSP's gapped (non-prelim): 2818
length of query: 716
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 693
effective length of database: 17,143,297,704
effective search space: 11880305308872
effective search space used: 11880305308872
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

to top

full-length cDNA and EST

Clone Information

BLAST Search Result