ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasdn01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AE017346.1| Cryptococcus neoformans var. neoformans JEC21 chr... 40 9.4
2ref|XM_425809.1| PREDICTED: Gallus gallus similar to MAIL (LOC42... 40 9.4
3gb|AC151969.3| Mus musculus BAC clone RP24-255B1 from chromosome... 40 9.4
4gb|AC122399.4| Mus musculus BAC clone RP24-92B2 from chromosome ... 40 9.4
5emb|CR769787.7| Zebrafish DNA sequence from clone DKEY-148G19 in... 40 9.4
6emb|BX957326.8| Zebrafish DNA sequence from clone DKEY-31B16 in ... 40 9.4
7emb|AL590105.19| Human DNA sequence from clone RP11-273H7 on chr... 40 9.4
8emb|AL451069.34| Human DNA sequence from clone RP11-432J24 on ch... 40 9.4
9gb|AC152170.4| Ornithorhynchus anatinus BAC clone OABb-47A1 from... 40 9.4
10emb|BX511080.4| Zebrafish DNA sequence from clone DKEY-237N7 in ... 40 9.4
11gb|AC158524.2| Mus musculus BAC clone RP23-377I1 from chromosome... 40 9.4
12gb|AC010364.6| Homo sapiens chromosome 5 clone CTD-2042D5, compl... 40 9.4
13gb|AC113618.5| Homo sapiens BAC clone RP11-1367O10 from 2, compl... 40 9.4
14gb|AC010450.6|AC010450 Homo sapiens chromosome 5 clone CTD-2242D... 40 9.4
15dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co... 40 9.4
16gb|AC092619.3| Homo sapiens BAC clone RP11-225M4 from 2, complet... 40 9.4
17gb|AC156252.2| Xenopus tropicalis clone ISB1-275I4, complete seq... 40 9.4
18gb|AC175058.1| Mus musculus BAC clone RP23-210C4 from chromosome... 40 9.4
19emb|BX649383.4| Zebrafish DNA sequence from clone DKEY-247I12 in... 40 9.4

>gb|AE017346.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 6, complete
               sequence
          Length = 1438950

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 332     gtggcagtgtatttggtgacagag 355
               ||||||| ||||||||||||||||
Sbjct: 1185902 gtggcagagtatttggtgacagag 1185925



to top

>ref|XM_425809.1| PREDICTED: Gallus gallus similar to MAIL (LOC428250), mRNA
          Length = 7239

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 308  gcggtgtgctggaagctcca 327
            ||||||||||||||||||||
Sbjct: 1613 gcggtgtgctggaagctcca 1632



to top

>gb|AC151969.3| Mus musculus BAC clone RP24-255B1 from chromosome 9, complete sequence
          Length = 192458

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 631    ggatccggtgggatccggtaggat 654
              ||||| ||||||||||||||||||
Sbjct: 108280 ggatctggtgggatccggtaggat 108257



to top

>gb|AC122399.4| Mus musculus BAC clone RP24-92B2 from chromosome 17, complete sequence
          Length = 184002

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 56     cctgaacttctgattgttgg 75
              ||||||||||||||||||||
Sbjct: 132940 cctgaacttctgattgttgg 132921



to top

>emb|CR769787.7| Zebrafish DNA sequence from clone DKEY-148G19 in linkage group 1,
             complete sequence
          Length = 142653

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 337   agtgtatttggtgacagagg 356
             ||||||||||||||||||||
Sbjct: 21809 agtgtatttggtgacagagg 21828



to top

>emb|BX957326.8| Zebrafish DNA sequence from clone DKEY-31B16 in linkage group 23,
              complete sequence
          Length = 259092

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 156    atctgaacttttccaaatac 175
              ||||||||||||||||||||
Sbjct: 186072 atctgaacttttccaaatac 186091



to top

>emb|AL590105.19| Human DNA sequence from clone RP11-273H7 on chromosome 10 Contains the 5'
              end of the gene for protein kinase (PKE), gene KIAA1674,
              gene LOC170394, the 5' end of a novel gene and six CpG
              islands, complete sequence
          Length = 132772

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 562    ggagggtcctctccagggca 581
              ||||||||||||||||||||
Sbjct: 131865 ggagggtcctctccagggca 131884



to top

>emb|AL451069.34| Human DNA sequence from clone RP11-432J24 on chromosome 10 Contains
            the 3' end of gene LOC170394, four novel genes, gene
            LOC170393, the 5' end of the INPP5A gene for inositol
            polyphosphate-5-phosphatase 40kDa and five CpG islands,
            complete sequence
          Length = 149579

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 562  ggagggtcctctccagggca 581
            ||||||||||||||||||||
Sbjct: 1093 ggagggtcctctccagggca 1112



to top

>gb|AC152170.4| Ornithorhynchus anatinus BAC clone OABb-47A1 from chromosome unknown,
              complete sequence
          Length = 151943

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 145    tcagttagtttatctgaact 164
              ||||||||||||||||||||
Sbjct: 114925 tcagttagtttatctgaact 114906



to top

>emb|BX511080.4| Zebrafish DNA sequence from clone DKEY-237N7 in linkage group 3,
             complete sequence
          Length = 115272

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 156   atctgaacttttccaaatac 175
             ||||||||||||||||||||
Sbjct: 39463 atctgaacttttccaaatac 39482



to top

>gb|AC158524.2| Mus musculus BAC clone RP23-377I1 from chromosome 13, complete sequence
          Length = 191904

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 393   ctccatggatgaaccttcct 412
             ||||||||||||||||||||
Sbjct: 34604 ctccatggatgaaccttcct 34585



to top

>gb|AC010364.6| Homo sapiens chromosome 5 clone CTD-2042D5, complete sequence
          Length = 163400

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 140  tgagttcagttagtttatct 159
            ||||||||||||||||||||
Sbjct: 1431 tgagttcagttagtttatct 1412



to top

>gb|AC113618.5| Homo sapiens BAC clone RP11-1367O10 from 2, complete sequence
          Length = 199917

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 654   tgtggaggtgcctggtgtttctgg 677
             |||||| |||||||||||||||||
Sbjct: 54699 tgtggaagtgcctggtgtttctgg 54722



to top

>gb|AC010450.6|AC010450 Homo sapiens chromosome 5 clone CTD-2242D16, complete sequence
          Length = 108916

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 140   tgagttcagttagtttatct 159
             ||||||||||||||||||||
Sbjct: 64651 tgagttcagttagtttatct 64632



to top

>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 444     gtcgatgtggccggccagga 463
               ||||||||||||||||||||
Sbjct: 3898179 gtcgatgtggccggccagga 3898198



to top

>gb|AC092619.3| Homo sapiens BAC clone RP11-225M4 from 2, complete sequence
          Length = 163475

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 654    tgtggaggtgcctggtgtttctgg 677
              |||||| |||||||||||||||||
Sbjct: 125945 tgtggaagtgcctggtgtttctgg 125968



to top

>gb|AC156252.2| Xenopus tropicalis clone ISB1-275I4, complete sequence
          Length = 63849

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 275   aatggaagcttggcactggaaagg 298
             ||||||||||| ||||||||||||
Sbjct: 60768 aatggaagcttagcactggaaagg 60791



to top

>gb|AC175058.1| Mus musculus BAC clone RP23-210C4 from chromosome 17, complete sequence
          Length = 218488

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 56     cctgaacttctgattgttgg 75
              ||||||||||||||||||||
Sbjct: 144728 cctgaacttctgattgttgg 144747



to top

>emb|BX649383.4| Zebrafish DNA sequence from clone DKEY-247I12 in linkage group 1,
              complete sequence
          Length = 189528

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 337    agtgtatttggtgacagagg 356
              ||||||||||||||||||||
Sbjct: 160645 agtgtatttggtgacagagg 160626


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,843,923
Number of Sequences: 3902068
Number of extensions: 4843923
Number of successful extensions: 88972
Number of sequences better than 10.0: 19
Number of HSP's better than 10.0 without gapping: 19
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 88879
Number of HSP's gapped (non-prelim): 93
length of query: 688
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 665
effective length of database: 17,143,297,704
effective search space: 11400292973160
effective search space used: 11400292973160
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top