ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbasdm10 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY107575.1| Zea mays PCO083849 mRNA sequence Length = 727 Score = 250 bits (126), Expect = 4e-63 Identities = 189/210 (90%) Strand = Plus / Minus Query: 207 ctagccggcgtagatgtggatgtggagggcgagggtgaggatggtgaaggcggcgaagaa 266 |||||||| |||||||||||||||||| ||||| |||||||||||||||||||||||||| Sbjct: 400 ctagccggtgtagatgtggatgtggagcgcgagcgtgaggatggtgaaggcggcgaagaa 341 Query: 267 gaggatggtgtggacgaagatggccttgccgttggtgtggaggccgccgaagtcgacgcg 326 || || ||||||||||||||||||||||||||||||||||| |||||||||||||||| | Sbjct: 340 gacgagggtgtggacgaagatggccttgccgttggtgtggaagccgccgaagtcgacgtg 281 Query: 327 gtggtgcgaccccggcatctcgaacagcagccccggcgtgagcaggatgaagagcaccac 386 | |||| | ||||||| |||| | ||||| ||||||| |||||| | ||| |||||||| Sbjct: 280 gcggtgggtgcccggcagctcgcagagcaggcccggcgagagcagcacgaacagcaccac 221 Query: 387 ccccaccaccaccgggccccagtccgccat 416 ||||||||||| ||||||||||||||||| Sbjct: 220 gcccaccaccacggggccccagtccgccat 191
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 236 bits (119), Expect = 5e-59 Identities = 188/211 (89%) Strand = Plus / Minus Query: 207 ctagccggcgtagatgtggatgtggagggcgagggtgaggatggtgaaggcggcgaagaa 266 |||||||| ||||||||||| ||||||||||||||||||||||| ||||||||||||||| Sbjct: 18311525 ctagccggtgtagatgtggaggtggagggcgagggtgaggatggcgaaggcggcgaagaa 18311466 Query: 267 gaggatggtgtggacgaagatggccttgccgttggtgtggaggccgccgaagtcgacgcg 326 || || ||||||||||||||||||||||||||||||| ||| || ||||||||||||| | Sbjct: 18311465 gatgagggtgtggacgaagatggccttgccgttggtgcggaagctgccgaagtcgacgtg 18311406 Query: 327 gtggtgcgaccccggcatctcgaacagcagccccggcgtgagcaggatgaagagcaccac 386 | |||||| || || | ||| | |||||||||||||| |||||| | ||| |||||||| Sbjct: 18311405 gcggtgcgtgccggggagctccaccagcagccccggcgagagcagcacgaacagcaccac 18311346 Query: 387 ccccaccaccaccgggccccagtccgccatc 417 ||||||||||||||| |||||||||||||| Sbjct: 18311345 ccccaccaccaccggcgcccagtccgccatc 18311315 Score = 67.9 bits (34), Expect = 3e-08 Identities = 64/74 (86%) Strand = Plus / Minus Query: 338 ccggcatctcgaacagcagccccggcgtgagcaggatgaagagcaccacccccaccacca 397 |||||| || |||||| |||||||||| ||||||||||| || | |||| ||||||||| Sbjct: 18281725 ccggcacctggaacagaagccccggcgacagcaggatgaacagtatcaccgccaccacca 18281666 Query: 398 ccgggccccagtcc 411 |||| ||||||||| Sbjct: 18281665 ccggaccccagtcc 18281652 Score = 63.9 bits (32), Expect = 4e-07 Identities = 68/80 (85%) Strand = Plus / Plus Query: 338 ccggcatctcgaacagcagccccggcgtgagcaggatgaagagcaccacccccaccacca 397 |||||| || |||||||||||||||||||||||| | ||| |||||| | | | ||||| Sbjct: 18245669 ccggcagctggaacagcagccccggcgtgagcagcacgaacagcaccgtcgcgatcacca 18245728 Query: 398 ccgggccccagtccgccatc 417 |||| ||||| ||||||||| Sbjct: 18245729 ccggcccccaatccgccatc 18245748 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 438 ctccttcttcttcttccttcg 458 ||||||||||||||||||||| Sbjct: 7745683 ctccttcttcttcttccttcg 7745663 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttc 453 |||||||||||||||||||| Sbjct: 35152336 ccttctccttcttcttcttc 35152317 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 438 ctccttcttcttcttccttc 457 |||||||||||||||||||| Sbjct: 27952870 ctccttcttcttcttccttc 27952889 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 222 gtggatgtggagggcgaggg 241 |||||||||||||||||||| Sbjct: 22682459 gtggatgtggagggcgaggg 22682440 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 381 caccacccccaccaccaccg 400 |||||||||||||||||||| Sbjct: 22592115 caccacccccaccaccaccg 22592134 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 207 ctagccggcgtagatgtgga 226 |||||||||||||||||||| Sbjct: 18245538 ctagccggcgtagatgtgga 18245557 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 430 cttgccttctccttcttcttcttc 453 ||||||| |||||||||||||||| Sbjct: 9881833 cttgcctcctccttcttcttcttc 9881856 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttc 453 |||||||||||||||||||| Sbjct: 8935186 ccttctccttcttcttcttc 8935205 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 380 gcaccacccccaccaccaccgggc 403 |||||||| ||||||||||||||| Sbjct: 4950552 gcaccaccaccaccaccaccgggc 4950529
>dbj|AP005841.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBa0052M16 Length = 145423 Score = 236 bits (119), Expect = 5e-59 Identities = 188/211 (89%) Strand = Plus / Minus Query: 207 ctagccggcgtagatgtggatgtggagggcgagggtgaggatggtgaaggcggcgaagaa 266 |||||||| ||||||||||| ||||||||||||||||||||||| ||||||||||||||| Sbjct: 112738 ctagccggtgtagatgtggaggtggagggcgagggtgaggatggcgaaggcggcgaagaa 112679 Query: 267 gaggatggtgtggacgaagatggccttgccgttggtgtggaggccgccgaagtcgacgcg 326 || || ||||||||||||||||||||||||||||||| ||| || ||||||||||||| | Sbjct: 112678 gatgagggtgtggacgaagatggccttgccgttggtgcggaagctgccgaagtcgacgtg 112619 Query: 327 gtggtgcgaccccggcatctcgaacagcagccccggcgtgagcaggatgaagagcaccac 386 | |||||| || || | ||| | |||||||||||||| |||||| | ||| |||||||| Sbjct: 112618 gcggtgcgtgccggggagctccaccagcagccccggcgagagcagcacgaacagcaccac 112559 Query: 387 ccccaccaccaccgggccccagtccgccatc 417 ||||||||||||||| |||||||||||||| Sbjct: 112558 ccccaccaccaccggcgcccagtccgccatc 112528 Score = 67.9 bits (34), Expect = 3e-08 Identities = 64/74 (86%) Strand = Plus / Minus Query: 338 ccggcatctcgaacagcagccccggcgtgagcaggatgaagagcaccacccccaccacca 397 |||||| || |||||| |||||||||| ||||||||||| || | |||| ||||||||| Sbjct: 82938 ccggcacctggaacagaagccccggcgacagcaggatgaacagtatcaccgccaccacca 82879 Query: 398 ccgggccccagtcc 411 |||| ||||||||| Sbjct: 82878 ccggaccccagtcc 82865 Score = 63.9 bits (32), Expect = 4e-07 Identities = 68/80 (85%) Strand = Plus / Plus Query: 338 ccggcatctcgaacagcagccccggcgtgagcaggatgaagagcaccacccccaccacca 397 |||||| || |||||||||||||||||||||||| | ||| |||||| | | | ||||| Sbjct: 46882 ccggcagctggaacagcagccccggcgtgagcagcacgaacagcaccgtcgcgatcacca 46941 Query: 398 ccgggccccagtccgccatc 417 |||| ||||| ||||||||| Sbjct: 46942 ccggcccccaatccgccatc 46961 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 207 ctagccggcgtagatgtgga 226 |||||||||||||||||||| Sbjct: 46751 ctagccggcgtagatgtgga 46770
>dbj|AK105187.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-F09, full insert sequence Length = 492 Score = 236 bits (119), Expect = 5e-59 Identities = 188/211 (89%) Strand = Plus / Minus Query: 207 ctagccggcgtagatgtggatgtggagggcgagggtgaggatggtgaaggcggcgaagaa 266 |||||||| ||||||||||| ||||||||||||||||||||||| ||||||||||||||| Sbjct: 243 ctagccggtgtagatgtggaggtggagggcgagggtgaggatggcgaaggcggcgaagaa 184 Query: 267 gaggatggtgtggacgaagatggccttgccgttggtgtggaggccgccgaagtcgacgcg 326 || || ||||||||||||||||||||||||||||||| ||| || ||||||||||||| | Sbjct: 183 gatgagggtgtggacgaagatggccttgccgttggtgcggaagctgccgaagtcgacgtg 124 Query: 327 gtggtgcgaccccggcatctcgaacagcagccccggcgtgagcaggatgaagagcaccac 386 | |||||| || || | ||| | |||||||||||||| |||||| | ||| |||||||| Sbjct: 123 gcggtgcgtgccggggagctccaccagcagccccggcgagagcagcacgaacagcaccac 64 Query: 387 ccccaccaccaccgggccccagtccgccatc 417 ||||||||||||||| |||||||||||||| Sbjct: 63 ccccaccaccaccggcgcccagtccgccatc 33
>ref|XM_472284.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 213 Score = 95.6 bits (48), Expect = 1e-16 Identities = 126/152 (82%) Strand = Plus / Minus Query: 260 cgaagaagaggatggtgtggacgaagatggccttgccgttggtgtggaggccgccgaagt 319 ||||||||| |||||||||||||| | || ||||||| || | |||||| |||||||| Sbjct: 157 cgaagaagacgatggtgtggacgacggcggacttgccggtgacgcggaggctgccgaagt 98 Query: 320 cgacgcggtggtgcgaccccggcatctcgaacagcagccccggcgtgagcaggatgaaga 379 |||| | |||||| |||||||| ||||| |||||||||||||| |||| | ||| | Sbjct: 97 cgacccaccggtgcgtccccggcagctcgatcagcagccccggcgacagcaccacgaaca 38 Query: 380 gcaccacccccaccaccaccgggccccagtcc 411 ||||||| |||||||||||||| |||||||| Sbjct: 37 gcaccactcccaccaccaccggcgcccagtcc 6
>emb|AL731601.3|OSJN00245 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0044M19, complete sequence Length = 188317 Score = 95.6 bits (48), Expect = 1e-16 Identities = 126/152 (82%) Strand = Plus / Minus Query: 260 cgaagaagaggatggtgtggacgaagatggccttgccgttggtgtggaggccgccgaagt 319 ||||||||| |||||||||||||| | || ||||||| || | |||||| |||||||| Sbjct: 183452 cgaagaagacgatggtgtggacgacggcggacttgccggtgacgcggaggctgccgaagt 183393 Query: 320 cgacgcggtggtgcgaccccggcatctcgaacagcagccccggcgtgagcaggatgaaga 379 |||| | |||||| |||||||| ||||| |||||||||||||| |||| | ||| | Sbjct: 183392 cgacccaccggtgcgtccccggcagctcgatcagcagccccggcgacagcaccacgaaca 183333 Query: 380 gcaccacccccaccaccaccgggccccagtcc 411 ||||||| |||||||||||||| |||||||| Sbjct: 183332 gcaccactcccaccaccaccggcgcccagtcc 183301 Score = 69.9 bits (35), Expect = 7e-09 Identities = 59/67 (88%) Strand = Plus / Plus Query: 350 acagcagccccggcgtgagcaggatgaagagcaccacccccaccaccaccgggccccagt 409 |||||||||||||||| ||||| | ||| |||||| | ||||||||||||| ||||||| Sbjct: 164772 acagcagccccggcgtcagcagcacgaacagcaccgtcgccaccaccaccggcccccagt 164831 Query: 410 ccgccat 416 ||||||| Sbjct: 164832 ccgccat 164838 Score = 42.1 bits (21), Expect = 1.6 Identities = 81/101 (80%) Strand = Plus / Plus Query: 207 ctagccggcgtagatgtggatgtggagggcgagggtgaggatggtgaaggcggcgaagaa 266 |||||||||||||||||||| | || ||||| | || |||||||| | |||||| | Sbjct: 164629 ctagccggcgtagatgtggacgccgatggcgatgaggaagatggtgaggagtgcgaagta 164688 Query: 267 gaggatggtgtggacgaagatggccttgccgttggtgtgga 307 ||||| || |||||||| |||||| |||| ||||||||| Sbjct: 164689 gaggacggcgtggacgatgatggcgaggccgctggtgtgga 164729
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 95.6 bits (48), Expect = 1e-16 Identities = 126/152 (82%) Strand = Plus / Minus Query: 260 cgaagaagaggatggtgtggacgaagatggccttgccgttggtgtggaggccgccgaagt 319 ||||||||| |||||||||||||| | || ||||||| || | |||||| |||||||| Sbjct: 19091527 cgaagaagacgatggtgtggacgacggcggacttgccggtgacgcggaggctgccgaagt 19091468 Query: 320 cgacgcggtggtgcgaccccggcatctcgaacagcagccccggcgtgagcaggatgaaga 379 |||| | |||||| |||||||| ||||| |||||||||||||| |||| | ||| | Sbjct: 19091467 cgacccaccggtgcgtccccggcagctcgatcagcagccccggcgacagcaccacgaaca 19091408 Query: 380 gcaccacccccaccaccaccgggccccagtcc 411 ||||||| |||||||||||||| |||||||| Sbjct: 19091407 gcaccactcccaccaccaccggcgcccagtcc 19091376 Score = 69.9 bits (35), Expect = 7e-09 Identities = 59/67 (88%) Strand = Plus / Plus Query: 350 acagcagccccggcgtgagcaggatgaagagcaccacccccaccaccaccgggccccagt 409 |||||||||||||||| ||||| | ||| |||||| | ||||||||||||| ||||||| Sbjct: 19072847 acagcagccccggcgtcagcagcacgaacagcaccgtcgccaccaccaccggcccccagt 19072906 Query: 410 ccgccat 416 ||||||| Sbjct: 19072907 ccgccat 19072913 Score = 42.1 bits (21), Expect = 1.6 Identities = 81/101 (80%) Strand = Plus / Plus Query: 207 ctagccggcgtagatgtggatgtggagggcgagggtgaggatggtgaaggcggcgaagaa 266 |||||||||||||||||||| | || ||||| | || |||||||| | |||||| | Sbjct: 19072704 ctagccggcgtagatgtggacgccgatggcgatgaggaagatggtgaggagtgcgaagta 19072763 Query: 267 gaggatggtgtggacgaagatggccttgccgttggtgtgga 307 ||||| || |||||||| |||||| |||| ||||||||| Sbjct: 19072764 gaggacggcgtggacgatgatggcgaggccgctggtgtgga 19072804 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttc 453 |||||||||||||||||||| Sbjct: 20670174 ccttctccttcttcttcttc 20670193
>dbj|AK063212.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-112-D08, full insert sequence Length = 762 Score = 95.6 bits (48), Expect = 1e-16 Identities = 126/152 (82%) Strand = Plus / Minus Query: 260 cgaagaagaggatggtgtggacgaagatggccttgccgttggtgtggaggccgccgaagt 319 ||||||||| |||||||||||||| | || ||||||| || | |||||| |||||||| Sbjct: 370 cgaagaagacgatggtgtggacgacggcggacttgccggtgacgcggaggctgccgaagt 311 Query: 320 cgacgcggtggtgcgaccccggcatctcgaacagcagccccggcgtgagcaggatgaaga 379 |||| | |||||| |||||||| ||||| |||||||||||||| |||| | ||| | Sbjct: 310 cgacccaccggtgcgtccccggcagctcgatcagcagccccggcgacagcaccacgaaca 251 Query: 380 gcaccacccccaccaccaccgggccccagtcc 411 ||||||| |||||||||||||| |||||||| Sbjct: 250 gcaccactcccaccaccaccggcgcccagtcc 219
>emb|AL731599.2|OSJN00244 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0053B21, complete sequence Length = 151936 Score = 95.6 bits (48), Expect = 1e-16 Identities = 126/152 (82%) Strand = Plus / Minus Query: 260 cgaagaagaggatggtgtggacgaagatggccttgccgttggtgtggaggccgccgaagt 319 ||||||||| |||||||||||||| | || ||||||| || | |||||| |||||||| Sbjct: 25048 cgaagaagacgatggtgtggacgacggcggacttgccggtgacgcggaggctgccgaagt 24989 Query: 320 cgacgcggtggtgcgaccccggcatctcgaacagcagccccggcgtgagcaggatgaaga 379 |||| | |||||| |||||||| ||||| |||||||||||||| |||| | ||| | Sbjct: 24988 cgacccaccggtgcgtccccggcagctcgatcagcagccccggcgacagcaccacgaaca 24929 Query: 380 gcaccacccccaccaccaccgggccccagtcc 411 ||||||| |||||||||||||| |||||||| Sbjct: 24928 gcaccactcccaccaccaccggcgcccagtcc 24897 Score = 69.9 bits (35), Expect = 7e-09 Identities = 59/67 (88%) Strand = Plus / Plus Query: 350 acagcagccccggcgtgagcaggatgaagagcaccacccccaccaccaccgggccccagt 409 |||||||||||||||| ||||| | ||| |||||| | ||||||||||||| ||||||| Sbjct: 6368 acagcagccccggcgtcagcagcacgaacagcaccgtcgccaccaccaccggcccccagt 6427 Query: 410 ccgccat 416 ||||||| Sbjct: 6428 ccgccat 6434 Score = 42.1 bits (21), Expect = 1.6 Identities = 81/101 (80%) Strand = Plus / Plus Query: 207 ctagccggcgtagatgtggatgtggagggcgagggtgaggatggtgaaggcggcgaagaa 266 |||||||||||||||||||| | || ||||| | || |||||||| | |||||| | Sbjct: 6225 ctagccggcgtagatgtggacgccgatggcgatgaggaagatggtgaggagtgcgaagta 6284 Query: 267 gaggatggtgtggacgaagatggccttgccgttggtgtgga 307 ||||| || |||||||| |||||| |||| ||||||||| Sbjct: 6285 gaggacggcgtggacgatgatggcgaggccgctggtgtgga 6325
>ref|XM_472281.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 210 Score = 69.9 bits (35), Expect = 7e-09 Identities = 59/67 (88%) Strand = Plus / Minus Query: 350 acagcagccccggcgtgagcaggatgaagagcaccacccccaccaccaccgggccccagt 409 |||||||||||||||| ||||| | ||| |||||| | ||||||||||||| ||||||| Sbjct: 67 acagcagccccggcgtcagcagcacgaacagcaccgtcgccaccaccaccggcccccagt 8 Query: 410 ccgccat 416 ||||||| Sbjct: 7 ccgccat 1 Score = 42.1 bits (21), Expect = 1.6 Identities = 81/101 (80%) Strand = Plus / Minus Query: 207 ctagccggcgtagatgtggatgtggagggcgagggtgaggatggtgaaggcggcgaagaa 266 |||||||||||||||||||| | || ||||| | || |||||||| | |||||| | Sbjct: 210 ctagccggcgtagatgtggacgccgatggcgatgaggaagatggtgaggagtgcgaagta 151 Query: 267 gaggatggtgtggacgaagatggccttgccgttggtgtgga 307 ||||| || |||||||| |||||| |||| ||||||||| Sbjct: 150 gaggacggcgtggacgatgatggcgaggccgctggtgtgga 110
>dbj|AK063862.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-122-D12, full insert sequence Length = 504 Score = 69.9 bits (35), Expect = 7e-09 Identities = 59/67 (88%) Strand = Plus / Minus Query: 350 acagcagccccggcgtgagcaggatgaagagcaccacccccaccaccaccgggccccagt 409 |||||||||||||||| ||||| | ||| |||||| | ||||||||||||| ||||||| Sbjct: 114 acagcagccccggcgtcagcagcacgaacagcaccgtcgccaccaccaccggcccccagt 55 Query: 410 ccgccat 416 ||||||| Sbjct: 54 ccgccat 48 Score = 42.1 bits (21), Expect = 1.6 Identities = 81/101 (80%) Strand = Plus / Minus Query: 207 ctagccggcgtagatgtggatgtggagggcgagggtgaggatggtgaaggcggcgaagaa 266 |||||||||||||||||||| | || ||||| | || |||||||| | |||||| | Sbjct: 257 ctagccggcgtagatgtggacgccgatggcgatgaggaagatggtgaggagtgcgaagta 198 Query: 267 gaggatggtgtggacgaagatggccttgccgttggtgtgga 307 ||||| || |||||||| |||||| |||| ||||||||| Sbjct: 197 gaggacggcgtggacgatgatggcgaggccgctggtgtgga 157
>ref|XM_465910.1| Oryza sativa (japonica cultivar-group), mRNA Length = 213 Score = 67.9 bits (34), Expect = 3e-08 Identities = 64/74 (86%) Strand = Plus / Minus Query: 338 ccggcatctcgaacagcagccccggcgtgagcaggatgaagagcaccacccccaccacca 397 |||||| || |||||| |||||||||| ||||||||||| || | |||| ||||||||| Sbjct: 82 ccggcacctggaacagaagccccggcgacagcaggatgaacagtatcaccgccaccacca 23 Query: 398 ccgggccccagtcc 411 |||| ||||||||| Sbjct: 22 ccggaccccagtcc 9
>gb|AC133608.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0085G12, complete sequence Length = 121470 Score = 67.9 bits (34), Expect = 3e-08 Identities = 70/82 (85%) Strand = Plus / Minus Query: 336 ccccggcatctcgaacagcagccccggcgtgagcaggatgaagagcaccacccccaccac 395 |||||| |||| ||||||||||||||||| ||||||||||| ||||||| ||| | | Sbjct: 99167 ccccgggatctggaacagcagccccggcgacagcaggatgaacagcaccagccctatgaa 99108 Query: 396 caccgggccccagtccgccatc 417 |||||| ||||| ||||||||| Sbjct: 99107 caccggcccccaatccgccatc 99086
>gb|AC135569.6| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0018F17, complete sequence Length = 104291 Score = 67.9 bits (34), Expect = 3e-08 Identities = 70/82 (85%) Strand = Plus / Minus Query: 336 ccccggcatctcgaacagcagccccggcgtgagcaggatgaagagcaccacccccaccac 395 |||||| |||| ||||||||||||||||| ||||||||||| ||||||| ||| | | Sbjct: 5467 ccccgggatctggaacagcagccccggcgacagcaggatgaacagcaccagccctatgaa 5408 Query: 396 caccgggccccagtccgccatc 417 |||||| ||||| ||||||||| Sbjct: 5407 caccggcccccaatccgccatc 5386
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 67.9 bits (34), Expect = 3e-08 Identities = 70/82 (85%) Strand = Plus / Minus Query: 336 ccccggcatctcgaacagcagccccggcgtgagcaggatgaagagcaccacccccaccac 395 |||||| |||| ||||||||||||||||| ||||||||||| ||||||| ||| | | Sbjct: 17031511 ccccgggatctggaacagcagccccggcgacagcaggatgaacagcaccagccctatgaa 17031452 Query: 396 caccgggccccagtccgccatc 417 |||||| ||||| ||||||||| Sbjct: 17031451 caccggcccccaatccgccatc 17031430
>dbj|AK062973.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-109-E07, full insert sequence Length = 562 Score = 67.9 bits (34), Expect = 3e-08 Identities = 70/82 (85%) Strand = Plus / Minus Query: 336 ccccggcatctcgaacagcagccccggcgtgagcaggatgaagagcaccacccccaccac 395 |||||| |||| ||||||||||||||||| ||||||||||| ||||||| ||| | | Sbjct: 183 ccccgggatctggaacagcagccccggcgacagcaggatgaacagcaccagccctatgaa 124 Query: 396 caccgggccccagtccgccatc 417 |||||| ||||| ||||||||| Sbjct: 123 caccggcccccaatccgccatc 102
>gb|AY108687.1| Zea mays PCO149432 mRNA sequence Length = 666 Score = 67.9 bits (34), Expect = 3e-08 Identities = 64/74 (86%) Strand = Plus / Minus Query: 343 atctcgaacagcagccccggcgtgagcaggatgaagagcaccacccccaccaccaccggg 402 |||| ||| ||||| ||||| | |||||||||||||||||||| ||| | || |||||| Sbjct: 228 atctggaagagcaggcccggggagagcaggatgaagagcaccagcccgatcagcaccggc 169 Query: 403 ccccagtccgccat 416 |||||||||||||| Sbjct: 168 ccccagtccgccat 155
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 67.9 bits (34), Expect = 3e-08 Identities = 70/82 (85%) Strand = Plus / Minus Query: 336 ccccggcatctcgaacagcagccccggcgtgagcaggatgaagagcaccacccccaccac 395 |||||| |||| ||||||||||||||||| ||||||||||| ||||||| ||| | | Sbjct: 17126212 ccccgggatctggaacagcagccccggcgacagcaggatgaacagcaccagccctatgaa 17126153 Query: 396 caccgggccccagtccgccatc 417 |||||| ||||| ||||||||| Sbjct: 17126152 caccggcccccaatccgccatc 17126131
>ref|XM_475057.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 210 Score = 65.9 bits (33), Expect = 1e-07 Identities = 123/153 (80%) Strand = Plus / Minus Query: 258 ggcgaagaagaggatggtgtggacgaagatggccttgccgttggtgtggaggccgccgaa 317 ||||||| ||| ||||| |||||||| ||||| | || || ||||||| ||| |||||| Sbjct: 159 ggcgaagtagatgatggagtggacgacgatggacatggcgctggtgtgcaggttgccgaa 100 Query: 318 gtcgacgcggtggtgcgaccccggcatctcgaacagcagccccggcgtgagcaggatgaa 377 |||||| ||||||| ||| || | || || ||||||||||||| |||||| | ||| Sbjct: 99 ctcgacgaagtggtgcctcccggggagctggatgagcagccccggcgagagcagcacgaa 40 Query: 378 gagcaccacccccaccaccaccgggccccagtc 410 ||||||||| | | ||||||||| |||||||| Sbjct: 39 cagcaccaccgcgatcaccaccggcccccagtc 7
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 65.9 bits (33), Expect = 1e-07 Identities = 123/153 (80%) Strand = Plus / Minus Query: 258 ggcgaagaagaggatggtgtggacgaagatggccttgccgttggtgtggaggccgccgaa 317 ||||||| ||| ||||| |||||||| ||||| | || || ||||||| ||| |||||| Sbjct: 162282 ggcgaagtagatgatggagtggacgacgatggacatggcgctggtgtgcaggttgccgaa 162223 Query: 318 gtcgacgcggtggtgcgaccccggcatctcgaacagcagccccggcgtgagcaggatgaa 377 |||||| ||||||| ||| || | || || ||||||||||||| |||||| | ||| Sbjct: 162222 ctcgacgaagtggtgcctcccggggagctggatgagcagccccggcgagagcagcacgaa 162163 Query: 378 gagcaccacccccaccaccaccgggccccagtc 410 ||||||||| | | ||||||||| |||||||| Sbjct: 162162 cagcaccaccgcgatcaccaccggcccccagtc 162130 Score = 56.0 bits (28), Expect = 1e-04 Identities = 31/32 (96%) Strand = Plus / Minus Query: 258 ggcgaagaagaggatggtgtggacgaagatgg 289 |||||||||||||||||||||||||| ||||| Sbjct: 158701 ggcgaagaagaggatggtgtggacgaggatgg 158670 Score = 44.1 bits (22), Expect = 0.41 Identities = 37/42 (88%) Strand = Plus / Minus Query: 343 atctcgaacagcagccccggcgtgagcaggatgaagagcacc 384 |||| |||||| |||||||||| ||||||||||| |||||| Sbjct: 158616 atctggaacagaagccccggcgacagcaggatgaacagcacc 158575 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 433 gccttctccttcttcttcttc 453 ||||||||||||||||||||| Sbjct: 27036923 gccttctccttcttcttcttc 27036903 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttc 453 |||||||||||||||||||| Sbjct: 25305771 ccttctccttcttcttcttc 25305790 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttc 453 |||||||||||||||||||| Sbjct: 568429 ccttctccttcttcttcttc 568410
>dbj|AK066339.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013062F19, full insert sequence Length = 641 Score = 65.9 bits (33), Expect = 1e-07 Identities = 123/153 (80%) Strand = Plus / Minus Query: 258 ggcgaagaagaggatggtgtggacgaagatggccttgccgttggtgtggaggccgccgaa 317 ||||||| ||| ||||| |||||||| ||||| | || || ||||||| ||| |||||| Sbjct: 341 ggcgaagtagatgatggagtggacgacgatggacatggcgctggtgtgcaggttgccgaa 282 Query: 318 gtcgacgcggtggtgcgaccccggcatctcgaacagcagccccggcgtgagcaggatgaa 377 |||||| ||||||| ||| || | || || ||||||||||||| |||||| | ||| Sbjct: 281 ctcgacgaagtggtgcctcccggggagctggatgagcagccccggcgagagcagcacgaa 222 Query: 378 gagcaccacccccaccaccaccgggccccagtc 410 ||||||||| | | ||||||||| |||||||| Sbjct: 221 cagcaccaccgcgatcaccaccggcccccagtc 189
>gb|AC084818.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0668H12, complete sequence Length = 160603 Score = 65.9 bits (33), Expect = 1e-07 Identities = 123/153 (80%) Strand = Plus / Minus Query: 258 ggcgaagaagaggatggtgtggacgaagatggccttgccgttggtgtggaggccgccgaa 317 ||||||| ||| ||||| |||||||| ||||| | || || ||||||| ||| |||||| Sbjct: 44466 ggcgaagtagatgatggagtggacgacgatggacatggcgctggtgtgcaggttgccgaa 44407 Query: 318 gtcgacgcggtggtgcgaccccggcatctcgaacagcagccccggcgtgagcaggatgaa 377 |||||| ||||||| ||| || | || || ||||||||||||| |||||| | ||| Sbjct: 44406 ctcgacgaagtggtgcctcccggggagctggatgagcagccccggcgagagcagcacgaa 44347 Query: 378 gagcaccacccccaccaccaccgggccccagtc 410 ||||||||| | | ||||||||| |||||||| Sbjct: 44346 cagcaccaccgcgatcaccaccggcccccagtc 44314 Score = 56.0 bits (28), Expect = 1e-04 Identities = 31/32 (96%) Strand = Plus / Minus Query: 258 ggcgaagaagaggatggtgtggacgaagatgg 289 |||||||||||||||||||||||||| ||||| Sbjct: 40885 ggcgaagaagaggatggtgtggacgaggatgg 40854 Score = 44.1 bits (22), Expect = 0.41 Identities = 37/42 (88%) Strand = Plus / Minus Query: 343 atctcgaacagcagccccggcgtgagcaggatgaagagcacc 384 |||| |||||| |||||||||| ||||||||||| |||||| Sbjct: 40800 atctggaacagaagccccggcgacagcaggatgaacagcacc 40759
>ref|XM_506811.1| PREDICTED Oryza sativa (japonica cultivar-group), P0047E05.40 mRNA Length = 537 Score = 63.9 bits (32), Expect = 4e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 338 ccggcatctcgaacagcagccccggcgtgagcaggatgaagagcaccacccccaccacca 397 |||||| || |||||||||||||||||||||||| | ||| |||||| | | | ||||| Sbjct: 189 ccggcagctggaacagcagccccggcgtgagcagcacgaacagcaccgtcgcgatcacca 130 Query: 398 ccgggccccagtccgccatc 417 |||| ||||| ||||||||| Sbjct: 129 ccggcccccaatccgccatc 110 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 207 ctagccggcgtagatgtgga 226 |||||||||||||||||||| Sbjct: 320 ctagccggcgtagatgtgga 301
>ref|XM_465906.1| Oryza sativa (japonica cultivar-group), mRNA Length = 521 Score = 63.9 bits (32), Expect = 4e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 338 ccggcatctcgaacagcagccccggcgtgagcaggatgaagagcaccacccccaccacca 397 |||||| || |||||||||||||||||||||||| | ||| |||||| | | | ||||| Sbjct: 168 ccggcagctggaacagcagccccggcgtgagcagcacgaacagcaccgtcgcgatcacca 109 Query: 398 ccgggccccagtccgccatc 417 |||| ||||| ||||||||| Sbjct: 108 ccggcccccaatccgccatc 89 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 207 ctagccggcgtagatgtgga 226 |||||||||||||||||||| Sbjct: 299 ctagccggcgtagatgtgga 280
>dbj|AP005066.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0047E05 Length = 184323 Score = 63.9 bits (32), Expect = 4e-07 Identities = 68/80 (85%) Strand = Plus / Plus Query: 338 ccggcatctcgaacagcagccccggcgtgagcaggatgaagagcaccacccccaccacca 397 |||||| || |||||||||||||||||||||||| | ||| |||||| | | | ||||| Sbjct: 169070 ccggcagctggaacagcagccccggcgtgagcagcacgaacagcaccgtcgcgatcacca 169129 Query: 398 ccgggccccagtccgccatc 417 |||| ||||| ||||||||| Sbjct: 169130 ccggcccccaatccgccatc 169149 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 207 ctagccggcgtagatgtgga 226 |||||||||||||||||||| Sbjct: 168939 ctagccggcgtagatgtgga 168958
>dbj|AK121771.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033092F10, full insert sequence Length = 538 Score = 63.9 bits (32), Expect = 4e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 338 ccggcatctcgaacagcagccccggcgtgagcaggatgaagagcaccacccccaccacca 397 |||||| || |||||||||||||||||||||||| | ||| |||||| | | | ||||| Sbjct: 190 ccggcagctggaacagcagccccggcgtgagcagcacgaacagcaccgtcgcgatcacca 131 Query: 398 ccgggccccagtccgccatc 417 |||| ||||| ||||||||| Sbjct: 130 ccggcccccaatccgccatc 111 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 207 ctagccggcgtagatgtgga 226 |||||||||||||||||||| Sbjct: 321 ctagccggcgtagatgtgga 302
>dbj|AK063931.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-123-D03, full insert sequence Length = 530 Score = 63.9 bits (32), Expect = 4e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 338 ccggcatctcgaacagcagccccggcgtgagcaggatgaagagcaccacccccaccacca 397 |||||| || |||||||||||||||||||||||| | ||| |||||| | | | ||||| Sbjct: 166 ccggcagctggaacagcagccccggcgtgagcagcacgaacagcaccgtcgcgatcacca 107 Query: 398 ccgggccccagtccgccatc 417 |||| ||||| ||||||||| Sbjct: 106 ccggcccccaatccgccatc 87 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 207 ctagccggcgtagatgtgga 226 |||||||||||||||||||| Sbjct: 297 ctagccggcgtagatgtgga 278
>ref|XM_475056.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 219 Score = 56.0 bits (28), Expect = 1e-04 Identities = 31/32 (96%) Strand = Plus / Minus Query: 258 ggcgaagaagaggatggtgtggacgaagatgg 289 |||||||||||||||||||||||||| ||||| Sbjct: 159 ggcgaagaagaggatggtgtggacgaggatgg 128 Score = 44.1 bits (22), Expect = 0.41 Identities = 37/42 (88%) Strand = Plus / Minus Query: 343 atctcgaacagcagccccggcgtgagcaggatgaagagcacc 384 |||| |||||| |||||||||| ||||||||||| |||||| Sbjct: 74 atctggaacagaagccccggcgacagcaggatgaacagcacc 33
>dbj|AK071540.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023101E05, full insert sequence Length = 683 Score = 56.0 bits (28), Expect = 1e-04 Identities = 31/32 (96%) Strand = Plus / Minus Query: 258 ggcgaagaagaggatggtgtggacgaagatgg 289 |||||||||||||||||||||||||| ||||| Sbjct: 278 ggcgaagaagaggatggtgtggacgaggatgg 247 Score = 44.1 bits (22), Expect = 0.41 Identities = 37/42 (88%) Strand = Plus / Minus Query: 343 atctcgaacagcagccccggcgtgagcaggatgaagagcacc 384 |||| |||||| |||||||||| ||||||||||| |||||| Sbjct: 193 atctggaacagaagccccggcgacagcaggatgaacagcacc 152
>dbj|AK062996.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-109-G10, full insert sequence Length = 517 Score = 56.0 bits (28), Expect = 1e-04 Identities = 31/32 (96%) Strand = Plus / Minus Query: 258 ggcgaagaagaggatggtgtggacgaagatgg 289 |||||||||||||||||||||||||| ||||| Sbjct: 275 ggcgaagaagaggatggtgtggacgaggatgg 244 Score = 44.1 bits (22), Expect = 0.41 Identities = 37/42 (88%) Strand = Plus / Minus Query: 343 atctcgaacagcagccccggcgtgagcaggatgaagagcacc 384 |||| |||||| |||||||||| ||||||||||| |||||| Sbjct: 190 atctggaacagaagccccggcgacagcaggatgaacagcacc 149
>ref|NM_111061.3| Arabidopsis thaliana unknown protein AT3G01950 mRNA, complete cds Length = 389 Score = 50.1 bits (25), Expect = 0.007 Identities = 58/69 (84%) Strand = Plus / Minus Query: 212 cggcgtagatgtggatgtggagggcgagggtgaggatggtgaaggcggcgaagaagagga 271 ||||||||||||||||||| ||||||| | | |||||||| | |||||||||||||| Sbjct: 257 cggcgtagatgtggatgtgaagggcgatgagggagatggtgatgaaggcgaagaagagga 198 Query: 272 tggtgtgga 280 ||||||| Sbjct: 197 gagtgtgga 189
>gb|AC011664.10|ATAC011664 Arabidopsis thaliana chromosome III BAC F1C9 genomic sequence, complete sequence Length = 103960 Score = 50.1 bits (25), Expect = 0.007 Identities = 58/69 (84%) Strand = Plus / Plus Query: 212 cggcgtagatgtggatgtggagggcgagggtgaggatggtgaaggcggcgaagaagagga 271 ||||||||||||||||||| ||||||| | | |||||||| | |||||||||||||| Sbjct: 85104 cggcgtagatgtggatgtgaagggcgatgagggagatggtgatgaaggcgaagaagagga 85163 Query: 272 tggtgtgga 280 ||||||| Sbjct: 85164 gagtgtgga 85172 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttc 453 |||||||||||||||||||| Sbjct: 72480 ccttctccttcttcttcttc 72499
>gb|AC010797.4|ATAC010797 Arabidopsis thaliana chromosome III BAC F28J7 genomic sequence, complete sequence Length = 89154 Score = 50.1 bits (25), Expect = 0.007 Identities = 58/69 (84%) Strand = Plus / Minus Query: 212 cggcgtagatgtggatgtggagggcgagggtgaggatggtgaaggcggcgaagaagagga 271 ||||||||||||||||||| ||||||| | | |||||||| | |||||||||||||| Sbjct: 68930 cggcgtagatgtggatgtgaagggcgatgagggagatggtgatgaaggcgaagaagagga 68871 Query: 272 tggtgtgga 280 ||||||| Sbjct: 68870 gagtgtgga 68862 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttc 453 |||||||||||||||||||| Sbjct: 81556 ccttctccttcttcttcttc 81537
>gb|BT004658.1| Arabidopsis thaliana At3g01950 gene, complete cds Length = 213 Score = 50.1 bits (25), Expect = 0.007 Identities = 58/69 (84%) Strand = Plus / Minus Query: 212 cggcgtagatgtggatgtggagggcgagggtgaggatggtgaaggcggcgaagaagagga 271 ||||||||||||||||||| ||||||| | | |||||||| | |||||||||||||| Sbjct: 208 cggcgtagatgtggatgtgaagggcgatgagggagatggtgatgaaggcgaagaagagga 149 Query: 272 tggtgtgga 280 ||||||| Sbjct: 148 gagtgtgga 140
>dbj|AK119150.1| Arabidopsis thaliana At3g01950 mRNA for predicted GPI-anchored protein (by homology), complete cds, clone: RAFL21-49-N11 Length = 389 Score = 50.1 bits (25), Expect = 0.007 Identities = 58/69 (84%) Strand = Plus / Minus Query: 212 cggcgtagatgtggatgtggagggcgagggtgaggatggtgaaggcggcgaagaagagga 271 ||||||||||||||||||| ||||||| | | |||||||| | |||||||||||||| Sbjct: 257 cggcgtagatgtggatgtgaagggcgatgagggagatggtgatgaaggcgaagaagagga 198 Query: 272 tggtgtgga 280 ||||||| Sbjct: 197 gagtgtgga 189
>gb|U63815.1|ATU63815 Arabidopsis thaliana AT.I.24-1, AT.I.24-2, AT.I.24-3, AT.I.24-4, AT.I.24-5, AT.I.24-6, AT.I.24-9 and AT.I.24-14 genes, partial cds, AT.I.24-7, ascorbate peroxidase (ATHAPX1), EF-1alpha-A1, -A2 and -A3 (EF-1alpha) and AT.I.24-13 genes, complete cds Length = 63093 Score = 50.1 bits (25), Expect = 0.007 Identities = 58/69 (84%) Strand = Plus / Plus Query: 212 cggcgtagatgtggatgtggagggcgagggtgaggatggtgaaggcggcgaagaagagga 271 ||||||||||||||||||| ||||||| | | |||||||| | |||||||||||||| Sbjct: 14906 cggcgtagatgtggatgtgaagggcgatgagggagatggtgatgaaggcgaagaagagga 14965 Query: 272 tggtgtgga 280 ||||||| Sbjct: 14966 gagtgtgga 14974 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttc 453 |||||||||||||||||||| Sbjct: 2280 ccttctccttcttcttcttc 2299
>gb|AC160552.13| Mus musculus chromosome 3, clone RP23-326D6, complete sequence Length = 210051 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttccttc 457 |||||||||||||||||||||||| Sbjct: 15056 ccttctccttcttcttcttccttc 15079
>ref|XM_549812.1| Oryza sativa (japonica cultivar-group), mRNA Length = 219 Score = 48.1 bits (24), Expect = 0.027 Identities = 30/32 (93%) Strand = Plus / Minus Query: 258 ggcgaagaagaggatggtgtggacgaagatgg 289 |||||||||||||| || |||||||||||||| Sbjct: 168 ggcgaagaagaggagggcgtggacgaagatgg 137
>gb|AC163612.3| Mus musculus BAC clone RP23-89N5 from chromosome 16, complete sequence Length = 207953 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttccttc 457 |||||||||||||||||||||||| Sbjct: 116448 ccttctccttcttcttcttccttc 116471
>gb|BT019054.1| Zea mays clone Contig578.F mRNA sequence Length = 617 Score = 48.1 bits (24), Expect = 0.027 Identities = 36/40 (90%) Strand = Plus / Plus Query: 211 ccggcgtagatgtggatgtggagggcgagggtgaggatgg 250 |||| ||| |||||||||||||| ||||| |||||||||| Sbjct: 371 ccggggtaaatgtggatgtggagcgcgagcgtgaggatgg 410
>gb|AC091092.3| Papio anubis clone RP41-191D8, complete sequence Length = 167732 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttccttc 457 |||||||||||||||||||||||| Sbjct: 27822 ccttctccttcttcttcttccttc 27845
>emb|AL731550.11| Human DNA sequence from clone RP11-94H3 on chromosome 10 Contains the 5' end of a novel gene, the 3' end of the MBL2 gene for mannose-binding lectin (protein C) 2 soluble (opsonic defect) and a CpG island, complete sequence Length = 102532 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttccttc 457 |||||||||||||||||||||||| Sbjct: 39731 ccttctccttcttcttcttccttc 39754
>emb|X90855.1|ATRPL1GEN A.thaliana rpl1 gene Length = 2413 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttccttc 457 |||||||||||||||||||||||| Sbjct: 186 ccttctccttcttcttcttccttc 163
>emb|AL163818.1|ATMAA21 Arabidopsis thaliana DNA chromosome 3, P1 clone MAA21 (ESSA project) Length = 79153 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttccttc 457 |||||||||||||||||||||||| Sbjct: 66346 ccttctccttcttcttcttccttc 66323
>emb|AJ307712.1|MMU307712 Mus musculus Npr-a gene for guanylate cyclase (atrial natriuretic peptide receptor A), exons 1-22 Length = 17784 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttccttc 457 |||||||||||||||||||||||| Sbjct: 12546 ccttctccttcttcttcttccttc 12523
>gb|AC175614.3| Nomascus leucogenys leucogenys clone CH271-104M23, complete sequence Length = 173997 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttccttc 457 |||||||||||||||||||||||| Sbjct: 85744 ccttctccttcttcttcttccttc 85767
>gb|AC100828.2| Homo sapiens chromosome 15, clone RP11-184D12, complete sequence Length = 175123 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttccttc 457 |||||||||||||||||||||||| Sbjct: 30997 ccttctccttcttcttcttccttc 31020 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttc 453 |||||||||||||||||||| Sbjct: 31025 ccttctccttcttcttcttc 31044
>gb|AC068867.9| Homo sapiens chromosome 15, clone RP11-702M1, complete sequence Length = 179455 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttccttc 457 |||||||||||||||||||||||| Sbjct: 94144 ccttctccttcttcttcttccttc 94167 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttc 453 |||||||||||||||||||| Sbjct: 94172 ccttctccttcttcttcttc 94191 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttccttc 457 |||||| ||||||||||||||||| Sbjct: 94116 ccttcttcttcttcttcttccttc 94139
>gb|AC011037.8| Homo sapiens chromosome 8, clone RP11-7F18, complete sequence Length = 175023 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttccttc 457 |||||||||||||||||||||||| Sbjct: 93658 ccttctccttcttcttcttccttc 93635
>gb|AC090815.3| Homo sapiens chromosome 15, clone RP11-1078O1, complete sequence Length = 180352 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttccttc 457 |||||||||||||||||||||||| Sbjct: 71459 ccttctccttcttcttcttccttc 71436 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttc 453 |||||||||||||||||||| Sbjct: 71431 ccttctccttcttcttcttc 71412
>gb|AC156609.8| Mus musculus chromosome 15, clone RP23-56E21, complete sequence Length = 118659 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttccttc 457 |||||||||||||||||||||||| Sbjct: 26993 ccttctccttcttcttcttccttc 27016
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 48.1 bits (24), Expect = 0.027 Identities = 30/32 (93%) Strand = Plus / Plus Query: 258 ggcgaagaagaggatggtgtggacgaagatgg 289 |||||||||||||| || |||||||||||||| Sbjct: 88037 ggcgaagaagaggagggcgtggacgaagatgg 88068 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 8728014 ccttctccttcttcttcttcct 8728035 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttc 453 |||||||||||||||||||| Sbjct: 43159279 ccttctccttcttcttcttc 43159260 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttc 453 |||||||||||||||||||| Sbjct: 27923640 ccttctccttcttcttcttc 27923659 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 432 tgccttctccttcttcttcttcct 455 |||||||| ||||||||||||||| Sbjct: 526857 tgccttcttcttcttcttcttcct 526834
>gb|AC154312.2| Mus musculus BAC clone RP23-354D20 from chromosome 16, complete sequence Length = 197884 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttccttc 457 |||||||||||||||||||||||| Sbjct: 183500 ccttctccttcttcttcttccttc 183523
>gb|AC135105.11| Mus musculus strain C57BL/6J clone rp23-354f7, complete sequence Length = 209282 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttccttc 457 |||||||||||||||||||||||| Sbjct: 106576 ccttctccttcttcttcttccttc 106553 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 436 ttctccttcttcttcttccttc 457 |||||||||||||||||||||| Sbjct: 77491 ttctccttcttcttcttccttc 77470
>gb|AC026336.20| Homo sapiens 12 BAC RP11-143E21 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 169758 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttccttc 457 |||||||||||||||||||||||| Sbjct: 13314 ccttctccttcttcttcttccttc 13291
>dbj|AP003727.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0672D08 Length = 173729 Score = 48.1 bits (24), Expect = 0.027 Identities = 30/32 (93%) Strand = Plus / Plus Query: 258 ggcgaagaagaggatggtgtggacgaagatgg 289 |||||||||||||| || |||||||||||||| Sbjct: 85839 ggcgaagaagaggagggcgtggacgaagatgg 85870
>emb|AL837520.26| Mouse DNA sequence from clone RP23-412O4 on chromosome 2, complete sequence Length = 128625 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttccttc 457 |||||||||||||||||||||||| Sbjct: 56901 ccttctccttcttcttcttccttc 56878
>dbj|AP000082.1| Homo sapiens genomic DNA, chromosome 8p11.2, senescence gene region, section 18/19 Length = 100000 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttccttc 457 |||||||||||||||||||||||| Sbjct: 51719 ccttctccttcttcttcttccttc 51742
>dbj|AP002969.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0455C04 Length = 147940 Score = 48.1 bits (24), Expect = 0.027 Identities = 30/32 (93%) Strand = Plus / Plus Query: 258 ggcgaagaagaggatggtgtggacgaagatgg 289 |||||||||||||| || |||||||||||||| Sbjct: 36583 ggcgaagaagaggagggcgtggacgaagatgg 36614
>dbj|AP003610.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0402A09 Length = 141966 Score = 48.1 bits (24), Expect = 0.027 Identities = 30/32 (93%) Strand = Plus / Plus Query: 258 ggcgaagaagaggatggtgtggacgaagatgg 289 |||||||||||||| || |||||||||||||| Sbjct: 72967 ggcgaagaagaggagggcgtggacgaagatgg 72998
>ref|XM_391131.1| Gibberella zeae PH-1 chromosome 3 predicted protein (FG10955.1) partial mRNA Length = 444 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 431 ttgccttctccttcttcttcttc 453 ||||||||||||||||||||||| Sbjct: 421 ttgccttctccttcttcttcttc 399
>gb|AC117196.3| Mus musculus BAC clone RP23-108H19 from 8, complete sequence Length = 185947 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttcctt 456 ||||||||||||||||||||||| Sbjct: 58025 ccttctccttcttcttcttcctt 58003
>gb|AC164704.4| Mus musculus BAC clone RP23-238D20 from chromosome 6, complete sequence Length = 189119 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttcctt 456 ||||||||||||||||||||||| Sbjct: 60134 ccttctccttcttcttcttcctt 60112
>emb|AL359833.12| Human DNA sequence from clone RP11-186C9 on chromosome 1, complete sequence Length = 122014 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttcctt 456 ||||||||||||||||||||||| Sbjct: 70888 ccttctccttcttcttcttcctt 70866
>gb|AC102542.8| Mus musculus, clone RP23-110O23, complete sequence Length = 270695 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Plus Query: 435 cttctccttcttcttcttccttc 457 ||||||||||||||||||||||| Sbjct: 28296 cttctccttcttcttcttccttc 28318
>emb|AL355604.11| Human DNA sequence from clone RP11-404E6 on chromosome 9 Contains a pseudogene similar to part of dipeptidylpeptidase 3 (DPP3), complete sequence Length = 183010 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcctt 456 ||||||||||||||||||||||| Sbjct: 136324 ccttctccttcttcttcttcctt 136346
>gb|AC093267.2| Homo sapiens chromosome 5 clone RP11-280F11, complete sequence Length = 170999 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttcctt 456 ||||||||||||||||||||||| Sbjct: 114814 ccttctccttcttcttcttcctt 114792
>gb|AC104471.6| Homo sapiens 3 BAC RP11-80B17 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 160698 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttcctt 456 ||||||||||||||||||||||| Sbjct: 127305 ccttctccttcttcttcttcctt 127283
>gb|AC079015.8| Homo sapiens chromosome 8, clone RP11-489O18, complete sequence Length = 157122 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttcctt 456 ||||||||||||||||||||||| Sbjct: 143122 ccttctccttcttcttcttcctt 143100
>gb|AC046195.9| Homo sapiens chromosome 8, clone RP11-238K6, complete sequence Length = 161507 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcctt 456 ||||||||||||||||||||||| Sbjct: 160531 ccttctccttcttcttcttcctt 160553
>gb|AC022724.8| Homo sapiens chromosome 18, clone RP11-275K5, complete sequence Length = 163978 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcctt 456 ||||||||||||||||||||||| Sbjct: 111195 ccttctccttcttcttcttcctt 111217
>gb|AC158679.8| Mus musculus 6 BAC RP23-345O17 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 192748 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 435 cttctccttcttcttcttccttc 457 ||||||||||||||||||||||| Sbjct: 99290 cttctccttcttcttcttccttc 99268 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttc 453 |||||||||||||||||||| Sbjct: 99318 ccttctccttcttcttcttc 99299
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 46.1 bits (23), Expect = 0.10 Identities = 26/27 (96%) Strand = Plus / Plus Query: 430 cttgccttctccttcttcttcttcctt 456 |||||||||| |||||||||||||||| Sbjct: 21149279 cttgccttcttcttcttcttcttcctt 21149305
>gb|AC007556.3| Homo sapiens BAC clone RP11-18C9 from 2, complete sequence Length = 167358 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 435 cttctccttcttcttcttccttc 457 ||||||||||||||||||||||| Sbjct: 68508 cttctccttcttcttcttccttc 68486
>gb|AC009803.17| Homo sapiens 12 BAC RP11-1028N23 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 186044 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 435 cttctccttcttcttcttccttc 457 ||||||||||||||||||||||| Sbjct: 83226 cttctccttcttcttcttccttc 83204
>dbj|AK109723.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-146-B05, full insert sequence Length = 2057 Score = 46.1 bits (23), Expect = 0.10 Identities = 26/27 (96%) Strand = Plus / Plus Query: 430 cttgccttctccttcttcttcttcctt 456 |||||||||| |||||||||||||||| Sbjct: 89 cttgccttcttcttcttcttcttcctt 115
>dbj|AP006548.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone: P0705E11 Length = 140729 Score = 46.1 bits (23), Expect = 0.10 Identities = 26/27 (96%) Strand = Plus / Plus Query: 430 cttgccttctccttcttcttcttcctt 456 |||||||||| |||||||||||||||| Sbjct: 20036 cttgccttcttcttcttcttcttcctt 20062
>gb|AC132348.3| Mus musculus BAC clone RP24-187H4 from 6, complete sequence Length = 158440 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttcctt 456 ||||||||||||||||||||||| Sbjct: 111092 ccttctccttcttcttcttcctt 111070
>gb|AC133584.12| Mus musculus chromosome 5, clone RP24-448L9, complete sequence Length = 165291 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttcctt 456 ||||||||||||||||||||||| Sbjct: 58878 ccttctccttcttcttcttcctt 58856
>gb|AY437839.1| Halomonas elongata TrkI (trkI) gene, complete cds Length = 1479 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Plus Query: 433 gccttctccttcttcttcttcct 455 ||||||||||||||||||||||| Sbjct: 1213 gccttctccttcttcttcttcct 1235
>emb|AL645827.9| Mouse DNA sequence from clone RP23-443O6 on chromosome 2, complete sequence Length = 76691 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttcctt 456 ||||||||||||||||||||||| Sbjct: 5105 ccttctccttcttcttcttcctt 5083
>ref|NM_122970.3| Arabidopsis thaliana G6PD1; glucose-6-phosphate 1-dehydrogenase AT5G35790 (G6PD1) mRNA, complete cds Length = 1970 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 84 ccttctccttcttcttcttcct 105
>gb|AC167537.7| Mus musculus chromosome 8, clone RP23-99B10, complete sequence Length = 201791 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 22288 ccttctccttcttcttcttcct 22309
>gb|AC139637.17| Mus musculus chromosome 15, clone RP24-253M12, complete sequence Length = 136076 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 90068 ccttctccttcttcttcttcct 90047
>gb|AC099629.6| Mus musculus chromosome 15, clone RP24-86K17, complete sequence Length = 175809 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 56097 ccttctccttcttcttcttcct 56076
>gb|AC119266.14| Mus musculus chromosome 13, clone RP24-321G8, complete sequence Length = 174035 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 108245 ccttctccttcttcttcttcct 108266
>gb|U38378.1| Caenorhabditis elegans cosmid R11F4, complete sequence Length = 27371 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 435 cttctccttcttcttcttcctt 456 |||||||||||||||||||||| Sbjct: 7446 cttctccttcttcttcttcctt 7467
>gb|AC128859.4| Rattus norvegicus 10 BAC CH230-436I22 (Children's Hospital Oakland Research Institute) complete sequence Length = 156078 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 101288 ccttctccttcttcttcttcct 101309
>gb|AC125361.4| Mus musculus BAC clone RP23-93M7 from chromosome 12, complete sequence Length = 202234 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 61180 ccttctccttcttcttcttcct 61201 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttc 453 |||||||||||||||||||| Sbjct: 82277 ccttctccttcttcttcttc 82296
>gb|AC161444.4| Mus musculus chromosome 1, clone RP23-446D9, complete sequence Length = 182353 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 435 cttctccttcttcttcttccttcgat 460 ||||| |||||||||||||||||||| Sbjct: 176637 cttcttcttcttcttcttccttcgat 176612
>gb|AC102698.8| Mus musculus chromosome 3, clone RP24-149G20, complete sequence Length = 167457 Score = 44.1 bits (22), Expect = 0.41 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 tcctcccttgccttctccttcttcttcttc 453 |||||||| |||||||||||||||||||| Sbjct: 72970 tcctccctctccttctccttcttcttcttc 72941
>gb|U58748.1| Caenorhabditis elegans cosmid ZK180, complete sequence Length = 37895 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 378 gagcaccacccccaccaccacc 399 |||||||||||||||||||||| Sbjct: 27515 gagcaccacccccaccaccacc 27494
>ref|XM_889482.2| PREDICTED: Mus musculus RIKEN cDNA 4933402E13 gene, transcript variant 2 (4933402E13Rik), mRNA Length = 1706 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 352 ccttctccttcttcttcttcct 373
>ref|XM_988856.1| PREDICTED: Mus musculus RIKEN cDNA 4933402E13 gene (4933402E13Rik), mRNA Length = 1706 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 352 ccttctccttcttcttcttcct 373
>ref|XM_905084.2| PREDICTED: Mus musculus RIKEN cDNA 4933402E13 gene, transcript variant 3 (4933402E13Rik), mRNA Length = 1706 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 352 ccttctccttcttcttcttcct 373
>gb|AC137108.12| Mus musculus chromosome 9, clone RP23-277J20, complete sequence Length = 204108 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 56848 ccttctccttcttcttcttcct 56869
>gb|AC142474.4| Mus musculus BAC clone RP24-362N7 from chromosome 15, complete sequence Length = 172879 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 160059 ccttctccttcttcttcttcct 160080
>gb|AY298759.1| Crotalus tigris clone Crti09 microsatellite sequence Length = 522 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 95 ccttctccttcttcttcttcct 74
>gb|AC124399.4| Mus musculus BAC clone RP24-351I17 from chromosome 10, complete sequence Length = 179668 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 107536 ccttctccttcttcttcttcct 107557
>gb|AC117253.3| Mus musculus BAC clone RP24-405A12 from chromosome 19, complete sequence Length = 142903 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 89571 ccttctccttcttcttcttcct 89592
>gb|AC129206.3| Mus musculus BAC clone RP24-269P22 from chromosome 8, complete sequence Length = 181214 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 135219 ccttctccttcttcttcttcct 135198
>gb|AF450245.1| Mus musculus clone BAC199M11, complete sequence Length = 124254 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 12644 ccttctccttcttcttcttcct 12665
>gb|AC112701.6| Mus musculus BAC clone RP23-171A11 from 13, complete sequence Length = 184506 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 46141 ccttctccttcttcttcttcct 46120
>gb|AC098724.3| Mus musculus BAC clone RP23-3D14 from 4, complete sequence Length = 190437 Score = 44.1 bits (22), Expect = 0.41 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 tcctcccttgccttctccttcttcttcttc 453 |||||| || |||||||||||||||||||| Sbjct: 73781 tcctccttttccttctccttcttcttcttc 73752
>gb|AC102567.8| Mus musculus chromosome 9, clone RP23-224F1, complete sequence Length = 198097 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 147258 ccttctccttcttcttcttcct 147279
>gb|AC084438.5| Homo sapiens BAC clone RP11-89D15 from 7, complete sequence Length = 133439 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 51500 ccttctccttcttcttcttcct 51521
>gb|AY425004.1| Homo sapiens estrogen receptor 1 (ESR1) gene, complete cds Length = 299637 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 205310 ccttctccttcttcttcttcct 205331
>gb|AC159304.2| Mus musculus BAC clone RP23-211E20 from chromosome 13, complete sequence Length = 195948 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 435 cttctccttcttcttcttcctt 456 |||||||||||||||||||||| Sbjct: 85461 cttctccttcttcttcttcctt 85440
>gb|AC078896.23| Mus musculus strain C57BL/6J clone rp23-329d14 map 6, complete sequence Length = 170323 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 436 ttctccttcttcttcttccttc 457 |||||||||||||||||||||| Sbjct: 164948 ttctccttcttcttcttccttc 164927
>gb|AC084821.26| Mus musculus strain C57BL/6J clone rp23-395h6 map 1, complete sequence Length = 211776 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 188353 ccttctccttcttcttcttcct 188332
>gb|AC166575.1| Mus musculus BAC clone RP23-99E16 from chromosome 17, complete sequence Length = 200353 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 150108 ccttctccttcttcttcttcct 150129
>emb|AL591625.8| Human DNA sequence from clone RP13-202B6 on chromosome Xp21.1-21.3 Contains the gene for a novel protein and a ferritin heavy polypeptide-like 17 (FTHL17) pseudogene, complete sequence Length = 142672 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 13628 ccttctccttcttcttcttcct 13649
>emb|AL513174.19| Human DNA sequence from clone RP11-40F6 on chromosome 10 Contains the 5' end of the ANXA11 gene for annexin A11, a novel gene, a ribosomal protein S12 (RPS12) pseudogene, a pseudogene similar to nuclear pore complex interacting proteins (NPIP) and two CpG islands, complete sequence Length = 80484 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 59335 ccttctccttcttcttcttcct 59356 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttc 453 |||||||||||||||||||| Sbjct: 59265 ccttctccttcttcttcttc 59284
>emb|AL451143.15| Human DNA sequence from clone RP11-369A11 on chromosome 6, complete sequence Length = 22224 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 11873 ccttctccttcttcttcttcct 11894
>emb|AL445438.27| Human DNA sequence from clone RP11-427B20 on chromosome 1 Contains two CpG islands, complete sequence Length = 108271 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 52175 ccttctccttcttcttcttcct 52154
>emb|AL390777.13| Human DNA sequence from clone RP11-301F14 on chromosome 9 Contains the 5' end of the NTRK2 gene for Neurotrophic tyrosine kinase, receptor, type 2 (TRKB) and a CpG island, complete sequence Length = 182914 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 78815 ccttctccttcttcttcttcct 78836
>emb|AL359916.8| Human DNA sequence from clone RP11-550O8 on chromosome 20 Contains the RPL7P2 gene for ribosomal protein L7 pseudogene 2, the STK35 gene for serine/threonine kinase 35 and a CpG island, complete sequence Length = 126053 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 50126 ccttctccttcttcttcttcct 50105
>emb|AL355989.11| Human DNA sequence from clone RP11-272J7 on chromosome 10 Contains a transcription elongation factor B (SIII) pseudogene, a novel gene, a heterogeneous nuclear ribonucleoprotein A3 (HNRPA3) pseudogene gene and a CpG island, complete sequence Length = 161451 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 53483 ccttctccttcttcttcttcct 53462 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttc 453 |||||||||||||||||||| Sbjct: 53615 ccttctccttcttcttcttc 53596 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttc 453 |||||||||||||||||||| Sbjct: 53525 ccttctccttcttcttcttc 53506 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttccttc 457 |||||| ||||||||||||||||| Sbjct: 53519 ccttcttcttcttcttcttccttc 53496
>emb|AL158200.17| Human DNA sequence from clone RP11-278E11 on chromosome Xp11.21-11.22 Contains a novel gene and the gene for a novel protein similar to ubiquinol-cytochrome c reductase binding protein (UQCRB), complete sequence Length = 87538 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 77999 ccttctccttcttcttcttcct 78020
>emb|AL049821.6|HSDJ63I5 Human DNA sequence from clone RP1-63I5 on chromosome 6q25.1-26 Contains part of the ESR1 gene for estrogen receptor 1, complete sequence Length = 87705 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 49544 ccttctccttcttcttcttcct 49565
>gb|AC166172.1| Mus musculus BAC clone RP23-106N22 from chromosome 17, complete sequence Length = 213656 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 89955 ccttctccttcttcttcttcct 89976
>emb|AJ001359.1|ATJ00135 Arabidopsis thaliana cDNA encoding plastidic glucose-6-phosphate dehydrogenase Length = 1975 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 95 ccttctccttcttcttcttcct 116
>emb|AL772164.8| Mouse DNA sequence from clone RP23-400H4 on chromosome 11 no genes, complete sequence Length = 122032 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 17763 ccttctccttcttcttcttcct 17784
>emb|AL691512.11| Mouse DNA sequence from clone RP23-440L5 on chromosome 4 Contains a CpG island, complete sequence Length = 206422 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 159047 ccttctccttcttcttcttcct 159068
>gb|AC138120.3| Mus musculus BAC clone RP23-397F13 from chromosome 13, complete sequence Length = 191799 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 12524 ccttctccttcttcttcttcct 12545
>dbj|AK097626.1| Homo sapiens cDNA FLJ40307 fis, clone TESTI2029259, weakly similar to LYSOSOMAL ACID PHOSPHATASE PRECURSOR (EC 3.1.3.2) Length = 2462 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 1964 ccttctccttcttcttcttcct 1943
>gb|AC078880.27| Homo sapiens 12 BAC RP11-116D17 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 130824 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 95088 ccttctccttcttcttcttcct 95109
>gb|AC116559.30| Papio anubis clone rp41-339c10, complete sequence Length = 162030 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 94520 ccttctccttcttcttcttcct 94499
>gb|AC116558.21| Papio anubis clone rp41-273g19, complete sequence Length = 188182 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 64645 ccttctccttcttcttcttcct 64666
>gb|AC022399.15| Homo sapiens chromosome 10 clone RP11-4G18, complete sequence Length = 173064 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 35545 ccttctccttcttcttcttcct 35524
>gb|AY099561.1| Arabidopsis thaliana glucose-6-phosphate dehydrogenase (At5g35790) mRNA, complete cds Length = 1956 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 71 ccttctccttcttcttcttcct 92
>gb|AC007493.7| Homo sapiens chromosome 16 clone RP11-21B23, complete sequence Length = 155461 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 435 cttctccttcttcttcttcctt 456 |||||||||||||||||||||| Sbjct: 142907 cttctccttcttcttcttcctt 142928 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttc 453 |||||||||||||||||||| Sbjct: 142779 ccttctccttcttcttcttc 142798
>gb|AC080106.6| Homo sapiens chromosome 11, clone RP11-62J13, complete sequence Length = 157637 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 8948 ccttctccttcttcttcttcct 8927
>gb|AC007844.32| Mus musculus strain 129/Sv ES cell line CJ7 chromosome 6 clone ct7-541l22, complete sequence Length = 152316 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 436 ttctccttcttcttcttccttc 457 |||||||||||||||||||||| Sbjct: 82442 ttctccttcttcttcttccttc 82421 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttccttc 457 |||||||||||| ||||||||||| Sbjct: 111527 ccttctccttctccttcttccttc 111504
>gb|AC139035.12| Mus musculus chromosome 5, clone RP23-348E9, complete sequence Length = 237627 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 64320 ccttctccttcttcttcttcct 64299
>gb|AC159623.3| Mus musculus BAC clone RP24-308O7 from chromosome 12, complete sequence Length = 165043 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 89098 ccttctccttcttcttcttcct 89077
>dbj|AK016614.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:4933402E13 product:hypothetical MAGE family containing protein, full insert sequence Length = 1973 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 622 ccttctccttcttcttcttcct 643
>gb|AC138177.12| Mus musculus chromosome 15, clone RP23-32P19, complete sequence Length = 180896 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 89050 ccttctccttcttcttcttcct 89029
>ref|NM_171321.3| Caenorhabditis elegans ZK180.5a (ZK180.5) mRNA, complete cds Length = 1872 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 378 gagcaccacccccaccaccacc 399 |||||||||||||||||||||| Sbjct: 188 gagcaccacccccaccaccacc 209
>ref|NM_171906.3| Caenorhabditis elegans ZK180.5c (ZK180.5) mRNA, complete cds Length = 1491 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 378 gagcaccacccccaccaccacc 399 |||||||||||||||||||||| Sbjct: 233 gagcaccacccccaccaccacc 254
>ref|NM_171905.2| Caenorhabditis elegans ZK180.5b (ZK180.5) mRNA, complete cds Length = 1735 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 378 gagcaccacccccaccaccacc 399 |||||||||||||||||||||| Sbjct: 188 gagcaccacccccaccaccacc 209
>gb|AC007991.7|AC007991 Homo sapiens, clone RP11-44K6, complete sequence Length = 149008 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 135322 ccttctccttcttcttcttcct 135343
>ref|NG_002806.1| Homo sapiens adlican pseudogene (ADLICANP) on chromosome Y Length = 31571 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 435 cttctccttcttcttcttcctt 456 |||||||||||||||||||||| Sbjct: 23410 cttctccttcttcttcttcctt 23431 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 435 cttctccttcttcttcttcct 455 ||||||||||||||||||||| Sbjct: 23335 cttctccttcttcttcttcct 23355
>gb|AC102488.11| Mus musculus chromosome 1, clone RP24-496O18, complete sequence Length = 127076 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Plus Query: 435 cttctccttcttcttcttccttcgat 460 ||||| |||||||||||||||||||| Sbjct: 109848 cttcttcttcttcttcttccttcgat 109873
>emb|BX830237.1|CNS0A1FA Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB68ZC09 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1894 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 36 ccttctccttcttcttcttcct 57
>gb|AC105922.5| Homo sapiens BAC clone RP11-548K13 from 2, complete sequence Length = 115915 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 34970 ccttctccttcttcttcttcct 34991
>gb|AC013463.7| Homo sapiens BAC clone RP11-303H9 from 2, complete sequence Length = 168493 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 20490 ccttctccttcttcttcttcct 20469
>gb|AC138080.4| Homo sapiens chromosome 8, clone RP11-1147M13, complete sequence Length = 164872 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 25004 ccttctccttcttcttcttcct 25025 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttccttc 457 ||||||||||||||||| |||||| Sbjct: 24985 ccttctccttcttcttcctccttc 25008
>gb|AC011302.3|AC011302 Homo sapiens BAC clone RP11-333E9 from Y, complete sequence Length = 178137 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 435 cttctccttcttcttcttcctt 456 |||||||||||||||||||||| Sbjct: 29524 cttctccttcttcttcttcctt 29545 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 435 cttctccttcttcttcttcct 455 ||||||||||||||||||||| Sbjct: 29449 cttctccttcttcttcttcct 29469
>gb|AY086213.1| Arabidopsis thaliana clone 22483 mRNA, complete sequence Length = 1905 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 68 ccttctccttcttcttcttcct 89
>gb|AC055817.12| Mus musculus, clone RP23-154I7, complete sequence Length = 203805 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 24629 ccttctccttcttcttcttcct 24650
>gb|AC010913.9| Homo sapiens BAC clone RP11-44N22 from 2, complete sequence Length = 209161 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 45313 ccttctccttcttcttcttcct 45292
>gb|AC067960.5| Homo sapiens BAC clone RP11-60M20 from 2, complete sequence Length = 63740 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 58027 ccttctccttcttcttcttcct 58006 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 435 cttctccttcttcttcttcct 455 ||||||||||||||||||||| Sbjct: 58195 cttctccttcttcttcttcct 58175
>dbj|AP002817.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0699D11 Length = 140825 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 45471 ccttctccttcttcttcttcct 45492
>dbj|AB005236.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MIK22 Length = 82035 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 7329 ccttctccttcttcttcttcct 7308
>gb|AC002478.1|AC002478 Human BAC clone GS1-2F1, complete sequence Length = 70113 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 17010 ccttctccttcttcttcttcct 16989
>gb|AC006371.2|AC006371 Homo sapiens BAC clone RP11-304C24 from Y, complete sequence Length = 202354 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 175555 ccttctccttcttcttcttcct 175576
>gb|BT002133.1| Arabidopsis thaliana glucose-6-phosphate dehydrogenase (At5g35790) mRNA, complete cds Length = 1890 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 25 ccttctccttcttcttcttcct 46
>gb|AC155813.2| Mus musculus BAC clone RP24-167L2 from 9, complete sequence Length = 166097 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 47658 ccttctccttcttcttcttcct 47679
>gb|AC155272.3| Mus musculus BAC clone RP23-79N13 from chromosome 13, complete sequence Length = 213306 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 9301 ccttctccttcttcttcttcct 9280 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttc 453 |||||||||||||||||||| Sbjct: 9441 ccttctccttcttcttcttc 9422
>gb|AC115976.13| Mus musculus chromosome 1, clone RP24-82A12, complete sequence Length = 222238 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 79457 ccttctccttcttcttcttcct 79436 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttc 453 |||||||||||||||||||| Sbjct: 79850 ccttctccttcttcttcttc 79831 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttc 453 |||||||||||||||||||| Sbjct: 79239 ccttctccttcttcttcttc 79220
>emb|CT030195.12| Mouse DNA sequence from clone RP23-191J8 on chromosome 13, complete sequence Length = 219800 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 174384 ccttctccttcttcttcttcct 174363 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttc 453 |||||||||||||||||||| Sbjct: 174524 ccttctccttcttcttcttc 174505
>gb|AC116688.14| Mus musculus chromosome 17, clone RP24-169A20, complete sequence Length = 150860 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 140596 ccttctccttcttcttcttcct 140617
>dbj|AP000893.5| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-659G9, complete sequence Length = 198024 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 35544 ccttctccttcttcttcttcct 35523
>dbj|AP006245.1| Homo sapiens genomic DNA, chromosome 8, clone:RP11-139F9, complete sequence Length = 155586 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 95754 ccttctccttcttcttcttcct 95775 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttccttc 457 ||||||||||||||||| |||||| Sbjct: 95735 ccttctccttcttcttcctccttc 95758
>dbj|AP001646.5| Homo sapiens genomic DNA, chromosome 11 clone:RP11-718B12, complete sequence Length = 182329 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 128302 ccttctccttcttcttcttcct 128281
>gb|AC101950.11| Mus musculus chromosome 1, clone RP24-149K4, complete sequence Length = 161262 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 46505 ccttctccttcttcttcttcct 46526
>emb|CT573270.1| RP43-049F09, complete sequence Length = 165723 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 88094 ccttctccttcttcttcttcct 88115
>gb|AC131766.4| Mus musculus BAC clone RP24-240O7 from 6, complete sequence Length = 152512 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 109484 ccttctccttcttcttcttcct 109505
>gb|AC104098.5| Mus musculus BAC clone RP24-372H3 from 5, complete sequence Length = 180886 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 133323 ccttctccttcttcttcttcct 133302
>gb|AC003664.1|AC003664 Homo sapiens chromosome 17, clone hCIT54K19, complete sequence Length = 202233 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 75656 ccttctccttcttcttcttcct 75677
>gb|AC140457.3| Mus musculus BAC clone RP23-15F7 from 12, complete sequence Length = 215722 Score = 44.1 bits (22), Expect = 0.41 Identities = 25/26 (96%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttccttcga 459 |||||||||||||||||||| ||||| Sbjct: 115623 ccttctccttcttcttcttctttcga 115598 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttc 453 |||||||||||||||||||| Sbjct: 115773 ccttctccttcttcttcttc 115754
>emb|AL844585.11| Mouse DNA sequence from clone RP23-339I5 on chromosome 4, complete sequence Length = 141401 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 123274 ccttctccttcttcttcttcct 123253 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttc 453 |||||||||||||||||||| Sbjct: 33813 ccttctccttcttcttcttc 33794
>emb|CT009718.13| Mouse DNA sequence from clone RP23-95L9 on chromosome 13, complete sequence Length = 206707 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 125762 ccttctccttcttcttcttcct 125783
>gb|AC161599.3| Mus musculus BAC clone RP23-346B16 from chromosome 9, complete sequence Length = 198471 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 45718 ccttctccttcttcttcttcct 45697 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttccttc 457 ||||||||||||||| |||||||| Sbjct: 45904 ccttctccttcttctccttccttc 45881
>dbj|AP006139.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT02A16, TM0243, complete sequence Length = 86350 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 76229 ccttctccttcttcttcttcct 76208
>emb|AL954388.5| Mouse DNA sequence from clone RP23-395P6 on chromosome 2, complete sequence Length = 131825 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 85880 ccttctccttcttcttcttcct 85901
>gb|AC163497.14| Mus musculus chromosome 1, clone RP24-185N14, complete sequence Length = 116121 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 63119 ccttctccttcttcttcttcct 63098
>gb|AC171318.3| Mus musculus chromosome 8, clone wi1-1251L9, complete sequence Length = 36339 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 2379 ccttctccttcttcttcttcct 2358
>emb|AL611982.26| Mouse DNA sequence from clone RP23-348F1 on chromosome 4, complete sequence Length = 171559 Score = 44.1 bits (22), Expect = 0.41 Identities = 28/30 (93%) Strand = Plus / Minus Query: 424 tcctcccttgccttctccttcttcttcttc 453 |||||| || |||||||||||||||||||| Sbjct: 8879 tcctccttttccttctccttcttcttcttc 8850
>emb|X62778.1|MMIGH3 Mouse IgH 3'enhancer Length = 1565 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 154 ccttctccttcttcttcttcct 133
>emb|AL596456.15| Mouse DNA sequence from clone RP23-353K20 on chromosome 11, complete sequence Length = 228428 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 125049 ccttctccttcttcttcttcct 125070
>emb|X96607.1|MMIGHALP M.musculus IgH 3' alpha enhancer DNA Length = 17956 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 5954 ccttctccttcttcttcttcct 5975
>emb|AL672274.7| Mouse DNA sequence from clone RP23-351G20 on chromosome X, complete sequence Length = 189982 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 78961 ccttctccttcttcttcttcct 78940
>dbj|AB026623.1| Gallus gallus gene for SOX21, complete cds Length = 2217 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 350 ccttctccttcttcttcttcct 329
>dbj|AP000079.1| Homo sapiens genomic DNA, chromosome 8p11.2, senescence gene region, section 15/19, complete sequence Length = 100000 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 59536 ccttctccttcttcttcttcct 59515 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttccttc 457 ||||||||||||||||| |||||| Sbjct: 59555 ccttctccttcttcttcctccttc 59532
>emb|AL831775.6| Mouse DNA sequence from clone RP23-146M22 on chromosome X, complete sequence Length = 108563 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 5953 ccttctccttcttcttcttcct 5974
>emb|AL732623.7| Mouse DNA sequence from clone RP23-276F7 on chromosome 4, complete sequence Length = 82990 Score = 44.1 bits (22), Expect = 0.41 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcct 455 |||||||||||||||||||||| Sbjct: 2206 ccttctccttcttcttcttcct 2227
>ref|NM_106267.3| Arabidopsis thaliana ERD14 (EARLY RESPONSE TO DEHYDRATION 14) AT1G76180 (ERD14) mRNA, complete cds Length = 1018 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 435 cttctccttcttcttcttcct 455 ||||||||||||||||||||| Sbjct: 523 cttctccttcttcttcttcct 503
>ref|XM_476952.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2870 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 431 ttgccttctccttcttcttcttcct 455 |||||||||||||| |||||||||| Sbjct: 2530 ttgccttctccttcatcttcttcct 2506
>gb|AC166646.4| Mus musculus chromosome 3, clone RP24-400P18, complete sequence Length = 176864 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Plus Query: 429 ccttgccttctccttcttcttcttccttc 457 ||||||||||||||||| |||||| |||| Sbjct: 143571 ccttgccttctccttctccttctttcttc 143599
>gb|AC109149.15| Mus musculus chromosome 19, clone RP24-178F17, complete sequence Length = 176668 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 435 cttctccttcttcttcttcct 455 ||||||||||||||||||||| Sbjct: 90652 cttctccttcttcttcttcct 90632
>gb|AC170163.1| Homo sapiens chromosome 1 clone WI2-3014I21, complete sequence Length = 40554 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 435 cttctccttcttcttcttcct 455 ||||||||||||||||||||| Sbjct: 7145 cttctccttcttcttcttcct 7165
>gb|AC135502.4| Oryza sativa chromosome 3 BAC OSJNBb0085A04 genomic sequence, complete sequence Length = 132292 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 435 cttctccttcttcttcttcct 455 ||||||||||||||||||||| Sbjct: 70563 cttctccttcttcttcttcct 70543
>gb|AY019797.1| Oryza sativa microsatellite MRG2122 containing (CA)X12, closest to marker RG745, genomic sequence Length = 224 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcc 454 ||||||||||||||||||||| Sbjct: 63 ccttctccttcttcttcttcc 83
>gb|AC121517.7| Mus musculus chromosome 15, clone RP23-120A12, complete sequence Length = 222681 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 435 cttctccttcttcttcttcct 455 ||||||||||||||||||||| Sbjct: 22777 cttctccttcttcttcttcct 22797
>gb|AC133103.5| Mus musculus BAC clone RP23-226J10 from chromosome 1, complete sequence Length = 241735 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 435 cttctccttcttcttcttcct 455 ||||||||||||||||||||| Sbjct: 155621 cttctccttcttcttcttcct 155641
>gb|AC161050.2| Mus musculus BAC clone RP23-477C12 from chromosome 12, complete sequence Length = 197084 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 435 cttctccttcttcttcttcct 455 ||||||||||||||||||||| Sbjct: 189465 cttctccttcttcttcttcct 189445
>gb|AC163622.4| Mus musculus BAC clone RP24-566G6 from chromosome y, complete sequence Length = 166756 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 435 cttctccttcttcttcttcct 455 ||||||||||||||||||||| Sbjct: 126733 cttctccttcttcttcttcct 126753
>gb|AC107772.19| Mus musculus chromosome 15, clone RP23-102L5, complete sequence Length = 194704 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 425 cctcccttgccttctccttcttcttcttc 453 ||||||| |||||||||||||||||||| Sbjct: 59836 cctccctctccttctccttcttcttcttc 59808
>gb|AC118628.11| Mus musculus chromosome 19, clone RP24-92P15, complete sequence Length = 202071 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 435 cttctccttcttcttcttcct 455 ||||||||||||||||||||| Sbjct: 11446 cttctccttcttcttcttcct 11466
>gb|AC138004.3| Oryza sativa chromosome 3 BAC OSJNBb0023J24 genomic sequence, complete sequence Length = 130193 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 386 cccccaccaccaccgggcccc 406 ||||||||||||||||||||| Sbjct: 18503 cccccaccaccaccgggcccc 18523
>gb|AC121785.3| Mus musculus BAC clone RP23-382K4 from chromosome 3, complete sequence Length = 197272 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 435 cttctccttcttcttcttcct 455 ||||||||||||||||||||| Sbjct: 5942 cttctccttcttcttcttcct 5962
>gb|AC140218.2| Mus musculus BAC clone RP23-474A22 from chromosome 5, complete sequence Length = 184636 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 435 cttctccttcttcttcttcct 455 ||||||||||||||||||||| Sbjct: 18835 cttctccttcttcttcttcct 18855
>gb|AC140187.3| Mus musculus BAC clone RP24-364N20 from chromosome Y, complete sequence Length = 151358 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 435 cttctccttcttcttcttcct 455 ||||||||||||||||||||| Sbjct: 129938 cttctccttcttcttcttcct 129918
>gb|AC148003.2| Mus musculus BAC clone RP23-413H13 from chromosome 18, complete sequence Length = 205418 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 435 cttctccttcttcttcttcct 455 ||||||||||||||||||||| Sbjct: 75455 cttctccttcttcttcttcct 75475
>ref|XM_452387.1| Kluyveromyces lactis NRRL Y-1140, KLLA0C04257g predicted mRNA Length = 2064 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 435 cttctccttcttcttcttcct 455 ||||||||||||||||||||| Sbjct: 313 cttctccttcttcttcttcct 293
>gb|AC162872.9| Mus musculus chromosome 3, clone RP24-346J6, complete sequence Length = 147221 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 429 ccttgccttctccttcttcttcttccttc 457 ||||||||||||||||| |||||| |||| Sbjct: 54566 ccttgccttctccttctccttctttcttc 54538
>gb|AC154396.11| Mus musculus chromosome 3, clone RP24-254D5, complete sequence Length = 153799 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 429 ccttgccttctccttcttcttcttccttc 457 ||||||||||||||||| |||||| |||| Sbjct: 118625 ccttgccttctccttctccttctttcttc 118597
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 386 cccccaccaccaccgggcccc 406 ||||||||||||||||||||| Sbjct: 25284205 cccccaccaccaccgggcccc 25284185 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 435 cttctccttcttcttcttcct 455 ||||||||||||||||||||| Sbjct: 21565669 cttctccttcttcttcttcct 21565649 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttcc 454 ||||||||||||||||||||| Sbjct: 12020269 ccttctccttcttcttcttcc 12020249 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttc 453 |||||||||||||||||||| Sbjct: 27216292 ccttctccttcttcttcttc 27216273 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 280 acgaagatggccttgccgtt 299 |||||||||||||||||||| Sbjct: 7455497 acgaagatggccttgccgtt 7455516
>gb|AC163903.4| Mus musculus BAC clone RP24-314J18 from chromosome 17, complete sequence Length = 197522 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 435 cttctccttcttcttcttcct 455 ||||||||||||||||||||| Sbjct: 189258 cttctccttcttcttcttcct 189238 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttc 453 |||||||||||||||||||| Sbjct: 196325 ccttctccttcttcttcttc 196306
>gb|AC164091.3| Mus musculus BAC clone RP23-97M20 from chromosome 3, complete sequence Length = 218807 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcc 454 ||||||||||||||||||||| Sbjct: 78026 ccttctccttcttcttcttcc 78046
>ref|XM_549382.2| PREDICTED: Canis familiaris similar to H/ACA ribonucleoprotein complex subunit 4 (Dyskerin) (Nucleolar protein family A member 4) (snoRNP protein DKC1) (Nopp140-associated protein of 57 kDa) (Nucleolar protein NAP57) (CBF5 homolog) (LOC492263), mRNA Length = 1635 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 433 gccttctccttcttcttcttc 453 ||||||||||||||||||||| Sbjct: 1529 gccttctccttcttcttcttc 1509
>gb|AC122397.2| Mus musculus BAC clone RP24-90D21 from chromosome 15, complete sequence Length = 181742 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 435 cttctccttcttcttcttcct 455 ||||||||||||||||||||| Sbjct: 25312 cttctccttcttcttcttcct 25292
>gb|AC006338.6| Homo sapiens BAC clone RP11-539D10 from Y, complete sequence Length = 175990 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 435 cttctccttcttcttcttcct 455 ||||||||||||||||||||| Sbjct: 94637 cttctccttcttcttcttcct 94617
>gb|AC121079.20| Mus musculus chromosome 3, clone RP24-178P12, complete sequence Length = 177802 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 435 cttctccttcttcttcttcct 455 ||||||||||||||||||||| Sbjct: 128826 cttctccttcttcttcttcct 128806
>gb|AY380824.1| Lycopersicon esculentum sucrose transporter 1 gene, 3' UTR Length = 1234 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 435 cttctccttcttcttcttcct 455 ||||||||||||||||||||| Sbjct: 42 cttctccttcttcttcttcct 22
>emb|CT010522.7| Mouse DNA sequence from clone RP23-310H3 on chromosome 16, complete sequence Length = 169798 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 437 tctccttcttcttcttccttc 457 ||||||||||||||||||||| Sbjct: 32882 tctccttcttcttcttccttc 32862
>ref|XM_569003.1| Cryptococcus neoformans var. neoformans JEC21 hypothetical protein (CNB01270) partial mRNA Length = 2730 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 435 cttctccttcttcttcttcct 455 ||||||||||||||||||||| Sbjct: 1348 cttctccttcttcttcttcct 1328
>gb|AC140219.3| Mus musculus BAC clone RP24-270J6 from chromosome 18, complete sequence Length = 119095 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 435 cttctccttcttcttcttcct 455 ||||||||||||||||||||| Sbjct: 95433 cttctccttcttcttcttcct 95453
>gb|AC129014.4| Mus musculus BAC clone RP24-317F20 from chromosome 19, complete sequence Length = 175855 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 435 cttctccttcttcttcttcct 455 ||||||||||||||||||||| Sbjct: 104742 cttctccttcttcttcttcct 104762
>gb|AC109364.6| Mus musculus BAC clone RP23-127N24 from chromosome 17, complete sequence Length = 198838 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 435 cttctccttcttcttcttcct 455 ||||||||||||||||||||| Sbjct: 131375 cttctccttcttcttcttcct 131395 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttc 453 |||||||||||||||||||| Sbjct: 124308 ccttctccttcttcttcttc 124327
>gb|AC127355.4| Mus musculus BAC clone RP23-96F6 from chromosome 7, complete sequence Length = 150343 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttcc 454 ||||||||||||||||||||| Sbjct: 4623 ccttctccttcttcttcttcc 4603
>gb|AC073594.31| Homo sapiens 12 BAC RP11-972K6 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 81410 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 435 cttctccttcttcttcttcct 455 ||||||||||||||||||||| Sbjct: 77508 cttctccttcttcttcttcct 77528 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 435 cttctccttcttcttcttcct 455 ||||||||||||||||||||| Sbjct: 77463 cttctccttcttcttcttcct 77483
>gb|AC124408.4| Mus musculus BAC clone RP24-262E22 from chromosome 14, complete sequence Length = 159082 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcc 454 ||||||||||||||||||||| Sbjct: 55585 ccttctccttcttcttcttcc 55605
>gb|AC131735.3| Mus musculus BAC clone RP23-103D3 from 2, complete sequence Length = 218830 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Plus Query: 425 cctcccttgccttctccttcttcttcttc 453 |||||||| ||||||||||||| |||||| Sbjct: 79779 cctccctttccttctccttctttttcttc 79807
>gb|AC122806.4| Mus musculus BAC clone RP23-297C11 from 8, complete sequence Length = 184206 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttcc 454 ||||||||||||||||||||| Sbjct: 11581 ccttctccttcttcttcttcc 11561
>gb|AC146218.2| Pan troglodytes BAC clone CH251-267E2 from Y, complete sequence Length = 203014 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 435 cttctccttcttcttcttcct 455 ||||||||||||||||||||| Sbjct: 177728 cttctccttcttcttcttcct 177748 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 435 cttctccttcttcttcttcct 455 ||||||||||||||||||||| Sbjct: 177409 cttctccttcttcttcttcct 177429
>gb|AC102627.8| Mus musculus chromosome 14, clone RP23-466M3, complete sequence Length = 193228 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 435 cttctccttcttcttcttcct 455 ||||||||||||||||||||| Sbjct: 34647 cttctccttcttcttcttcct 34627
>ref|XM_724171.1| Plasmodium yoelii yoelii str. 17XNL ATP-dependent RNA helicase (PY01492) partial mRNA Length = 2604 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 435 cttctccttcttcttcttcct 455 ||||||||||||||||||||| Sbjct: 163 cttctccttcttcttcttcct 143
>gb|AC116489.6| Mus musculus chromosome 18, clone RP24-137L16, complete sequence Length = 198242 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 435 cttctccttcttcttcttcct 455 ||||||||||||||||||||| Sbjct: 26876 cttctccttcttcttcttcct 26896
>gb|AC115768.9| Mus musculus chromosome 19, clone RP23-107E10, complete sequence Length = 212161 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 435 cttctccttcttcttcttcct 455 ||||||||||||||||||||| Sbjct: 174066 cttctccttcttcttcttcct 174086
>gb|AC113019.13| Mus musculus chromosome 7, clone RP23-185A21, complete sequence Length = 215975 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttcc 454 ||||||||||||||||||||| Sbjct: 9622 ccttctccttcttcttcttcc 9642
>gb|AC118026.7| Mus musculus chromosome 10, clone RP23-463I7, complete sequence Length = 191392 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 435 cttctccttcttcttcttcct 455 ||||||||||||||||||||| Sbjct: 103064 cttctccttcttcttcttcct 103044 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttc 453 |||||||||||||||||||| Sbjct: 103116 ccttctccttcttcttcttc 103097
>gb|AC111103.7| Mus musculus chromosome 16, clone RP23-187G7, complete sequence Length = 222348 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 437 tctccttcttcttcttccttc 457 ||||||||||||||||||||| Sbjct: 83927 tctccttcttcttcttccttc 83947
>gb|AC104329.22| Mus musculus strain C57BL/6J clone rp23-418c12 map 3, complete sequence Length = 197096 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 435 cttctccttcttcttcttcct 455 ||||||||||||||||||||| Sbjct: 96968 cttctccttcttcttcttcct 96988
>gb|AC115885.29| Mus musculus chromosome 3, clone RP24-396D16, complete sequence Length = 186636 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 434 ccttctccttcttcttcttcc 454 ||||||||||||||||||||| Sbjct: 107000 ccttctccttcttcttcttcc 106980
>gb|BC099832.1| Rattus norvegicus dyskeratosis congenita 1, dyskerin, mRNA (cDNA clone MGC:124569 IMAGE:7934021), complete cds Length = 1857 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 428 cccttgccttctccttcttcttcttcctt 456 |||||||||||| |||||| ||||||||| Sbjct: 1555 cccttgccttcttcttctttttcttcctt 1527
>emb|AL845311.9| Human DNA sequence from clone RP11-402N8 on chromosome 9 Contains a novel gene and a CpG island, complete sequence Length = 148407 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 435 cttctccttcttcttcttcct 455 ||||||||||||||||||||| Sbjct: 70217 cttctccttcttcttcttcct 70237
>emb|AL772284.5| Human DNA sequence from clone RP13-347D8 on chromosome X Contains a pseudogene similar to part of KIAA0633 protein (COBL), the RNF127 gene for ring finger protein 127 (FLJ40322, FLJ34458, FLJ22612), gene KIAA1210 and three CpG islands, complete sequence Length = 186148 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 435 cttctccttcttcttcttcct 455 ||||||||||||||||||||| Sbjct: 7171 cttctccttcttcttcttcct 7151 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 435 cttctccttcttcttcttcct 455 ||||||||||||||||||||| Sbjct: 7138 cttctccttcttcttcttcct 7118 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 435 cttctccttcttcttcttcct 455 ||||||||||||||||||||| Sbjct: 7114 cttctccttcttcttcttcct 7094
>emb|AL671862.6| Human DNA sequence from clone RP11-810H18 on chromosome 1, complete sequence Length = 62080 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 435 cttctccttcttcttcttcct 455 ||||||||||||||||||||| Sbjct: 39801 cttctccttcttcttcttcct 39821 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 434 ccttctccttcttcttcttc 453 |||||||||||||||||||| Sbjct: 40095 ccttctccttcttcttcttc 40114
>emb|AL358780.22| Human DNA sequence from clone RP11-418C1 on chromosome 10 Contains two novel genes (FLJ31094), the gene for a novel protein, the 5' end of the MLLT10 gene for myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to 10 (AF10), a noel gene (DKFZP761J229) and six CpG islands, complete sequence Length = 112311 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 381 caccacccccaccaccaccgggccc 405 ||||||| ||||||||||||||||| Sbjct: 48289 caccaccaccaccaccaccgggccc 48265
>emb|AL355361.39| Human DNA sequence from clone RP11-58N22 on chromosome 10 Contains a CpG island, complete sequence Length = 153070 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Minus Query: 424 tcctcccttgccttctccttcttcttcttcctt 456 |||| |||| |||||| |||||||||||||||| Sbjct: 15211 tccttccttcccttcttcttcttcttcttcctt 15179
>emb|AL158087.12| Human DNA sequence from clone RP5-952N6 on chromosome 1p31.3-32.3 Contains the 3' end of a novel gene and the 3' end of the PTGER3 gene for prostaglandin E receptor 3 (subtype EP3), complete sequence Length = 152689 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 435 cttctccttcttcttcttcct 455 ||||||||||||||||||||| Sbjct: 40937 cttctccttcttcttcttcct 40917
>ref|XM_785874.1| PREDICTED: Strongylocentrotus purpuratus similar to CG2503-PA (LOC586079), mRNA Length = 1524 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 435 cttctccttcttcttcttcct 455 ||||||||||||||||||||| Sbjct: 1273 cttctccttcttcttcttcct 1253
>emb|AL138958.18| Human DNA sequence from clone RP11-206I15 on chromosome 13 Contains the 3' end of a novel gene (KIAA0410), a transcription elongation factor B (SIII) polypeptide 2 (18kD, elongin B) (TCEB2) pseudogene, the 5' end of the ATP8A2 gene for aminophospholipid transporter-like ATPase Class I type 8A member 2 and three CpG islands, complete sequence Length = 162973 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 435 cttctccttcttcttcttcct 455 ||||||||||||||||||||| Sbjct: 124538 cttctccttcttcttcttcct 124518
>emb|AL050322.13|HSJ727I10 Human DNA sequence from clone RP4-727I10 on chromosome 20 Contains a novel gene, ESTs, STSs and GSSs, complete sequence Length = 114152 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 435 cttctccttcttcttcttcct 455 ||||||||||||||||||||| Sbjct: 62826 cttctccttcttcttcttcct 62806
>emb|AL008636.1|HS722E9 Human DNA sequence from clone CTA-722E9 on chromosome 22q13.2-13.33, complete sequence Length = 81674 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 435 cttctccttcttcttcttcct 455 ||||||||||||||||||||| Sbjct: 27277 cttctccttcttcttcttcct 27297
>gb|AC130725.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0494H05, complete sequence Length = 141715 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 433 gccttctccttcttcttcttc 453 ||||||||||||||||||||| Sbjct: 43505 gccttctccttcttcttcttc 43485
>gb|AC074336.14| Mus musculus Strain C57BL6/J chromosome 1 BAC, RP23-366C17, Complete Sequence, complete sequence Length = 217768 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 379 agcaccacccccaccaccacc 399 ||||||||||||||||||||| Sbjct: 17931 agcaccacccccaccaccacc 17951 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,769,184 Number of Sequences: 3902068 Number of extensions: 5769184 Number of successful extensions: 769924 Number of sequences better than 10.0: 1988 Number of HSP's better than 10.0 without gapping: 2011 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 684753 Number of HSP's gapped (non-prelim): 84965 length of query: 479 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 457 effective length of database: 17,147,199,772 effective search space: 7836270295804 effective search space used: 7836270295804 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
