ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbasdg18 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY589580.1| Triticum aestivum beta-expansin TaEXPB3 mRNA, complete cds Length = 1013 Score = 686 bits (346), Expect = 0.0 Identities = 406/426 (95%), Gaps = 5/426 (1%) Strand = Plus / Minus Query: 284 gcatgcgtgcatgatgcaggcgcacgtggccgctcatgggccggtcggggc-----caat 338 |||||| |||||||||||||||||||||||||| ||||||||||||||||| | || Sbjct: 918 gcatgcatgcatgatgcaggcgcacgtggccgcccatgggccggtcggggcgtcgccgat 859 Query: 339 caactgaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgaca 398 || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 858 cagctgaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgaca 799 Query: 399 ttgttggccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccctgg 458 |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| Sbjct: 798 ttgttggccaccagcttcttgccggagtcgctggtgatgcgcatggagaagggcccctgg 739 Query: 459 aggcggtggttggagtccatccgccagatggatccccacgactcgcgcatcgccatccac 518 |||||||||||||||||||||||||||||||| ||||| ||||||||||||| | ||||| Sbjct: 738 aggcggtggttggagtccatccgccagatggagccccaggactcgcgcatcggcgtccac 679 Query: 519 gaccccgagttggcctccttcatgtccacctggatcacgtcgccgtccatgtcctcgtac 578 ||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 678 gacccggagttgacctccttcatgtccacctggatcacgtcgccgtccatgtcctcgtac 619 Query: 579 tcgatcagcaccgccaggtacaccgcgttggagccctccaccacgtggaagttgatcttg 638 ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| Sbjct: 618 tcgatcagcaccgccaggtacaccgcgttggagccgtccaccacgtggaagttgatcttg 559 Query: 639 aggccggggaagttgcacggcaccctcctgaactggatgtcgatgatgcccgagtggcgg 698 ||||| ||||||||||| |||||||||| ||||||||||||||||||||||||||||||| Sbjct: 558 aggcccgggaagttgcagggcaccctccggaactggatgtcgatgatgcccgagtggcgg 499 Query: 699 agcttc 704 |||||| Sbjct: 498 agcttc 493 Score = 127 bits (64), Expect = 5e-26 Identities = 97/108 (89%) Strand = Plus / Minus Query: 177 agctccgtgatcccacgcaaaatacaaaaaataaaataaggcaaatgatttcgatcaacc 236 |||||| |||||||||||||||||||||| |||||||||||||||||||||||||| || Sbjct: 1013 agctccttgatcccacgcaaaatacaaaagataaaataaggcaaatgatttcgatcggcc 954 Query: 237 gagtgatgaactgcaaccagcagaggggccagagcgcatgcatgcatg 284 ||| || || | | |||||||||||||||||||||||||||||||| Sbjct: 953 gagcaattaatcgtagccagcagaggggccagagcgcatgcatgcatg 906
>gb|AY543541.1| Triticum aestivum expansin EXPB7 mRNA, complete cds Length = 1056 Score = 678 bits (342), Expect = 0.0 Identities = 405/426 (95%), Gaps = 5/426 (1%) Strand = Plus / Minus Query: 284 gcatgcgtgcatgatgcaggcgcacgtggccgctcatgggccggtcggggc-----caat 338 |||||| |||||||||||||||||||||||||| ||||||||||||||||| | || Sbjct: 950 gcatgcatgcatgatgcaggcgcacgtggccgcccatgggccggtcggggcgtcgccgat 891 Query: 339 caactgaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgaca 398 || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 890 cagctgaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgaca 831 Query: 399 ttgttggccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccctgg 458 |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| Sbjct: 830 ttgttggccaccagcttcttgccggagtcgctggtgatgcgcatggagaagggcccctgg 771 Query: 459 aggcggtggttggagtccatccgccagatggatccccacgactcgcgcatcgccatccac 518 |||||||||||||||||||||||||||||||| ||||| ||||||||||||| | ||||| Sbjct: 770 aggcggtggttggagtccatccgccagatggagccccaggactcgcgcatcggcgtccac 711 Query: 519 gaccccgagttggcctccttcatgtccacctggatcacgtcgccgtccatgtcctcgtac 578 ||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||| Sbjct: 710 gacccggagttggcctccttcatgtccacctggatcacgtcgccgtccatatcctcgtac 651 Query: 579 tcgatcagcaccgccaggtacaccgcgttggagccctccaccacgtggaagttgatcttg 638 |||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||| Sbjct: 650 tcgaccagcaccgccaggtacaccgcgttggagccgtccaccacgtggaagttgatcttg 591 Query: 639 aggccggggaagttgcacggcaccctcctgaactggatgtcgatgatgcccgagtggcgg 698 ||||| ||||||||||| |||||||||| ||||||||||||||||||||||||||||||| Sbjct: 590 aggcccgggaagttgcagggcaccctccggaactggatgtcgatgatgcccgagtggcgg 531 Query: 699 agcttc 704 |||||| Sbjct: 530 agcttc 525 Score = 141 bits (71), Expect = 4e-30 Identities = 107/119 (89%) Strand = Plus / Minus Query: 166 acggcatctcaagctccgtgatcccacgcaaaatacaaaaaataaaataaggcaaatgat 225 |||||||||| |||||| |||||||||||||||||||||| ||||||||||||||||||| Sbjct: 1056 acggcatctcgagctccttgatcccacgcaaaatacaaaagataaaataaggcaaatgat 997 Query: 226 ttcgatcaaccgagtgatgaactgcaaccagcagaggggccagagcgcatgcatgcatg 284 ||||||| ||||| || || | | |||||||||||||||||||||||||||||||| Sbjct: 996 ttcgatcggccgagcaattaatcgtagccagcagaggggccagagcgcatgcatgcatg 938
>emb|AJ295941.1|FPR295941 Festuca pratensis mRNA for beta expansin B2 (expB2 gene) Length = 1194 Score = 525 bits (265), Expect = e-146 Identities = 343/369 (92%) Strand = Plus / Minus Query: 336 aatcaactgaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatg 395 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 894 aatcaactgaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatg 835 Query: 396 acattgttggccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccc 455 | |||||||| || |||| ||||||||||||||||||||||||||||||||| ||| || Sbjct: 834 atgttgttggcgacgagctgcttgccggagtcgctggtgatgcgcatggagaatggcgcc 775 Query: 456 tggaggcggtggttggagtccatccgccagatggatccccacgactcgcgcatcgccatc 515 ||||| ||||||||||||||||||| |||||||||||||||||||||| |||||| | | Sbjct: 774 tggagacggtggttggagtccatcctccagatggatccccacgactcgtgcatcggcgcc 715 Query: 516 cacgaccccgagttggcctccttcatgtccacctggatcacgtcgccgtccatgtcctcg 575 || |||| |||||||||||||||||||||||||| | | ||||||||||||||||||| Sbjct: 714 caagaccgggagttggcctccttcatgtccacctgcgtgaggtcgccgtccatgtcctcg 655 Query: 576 tactcgatcagcaccgccaggtacaccgcgttggagccctccaccacgtggaagttgatc 635 |||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||| Sbjct: 654 tactcgatcagcaccgccaggtacaccgcgttggagccgtccacgacgtggaagttgatc 595 Query: 636 ttgaggccggggaagttgcacggcaccctcctgaactggatgtcgatgatgcccgagtgg 695 || ||||||||||||||||| ||||||| || |||||||||||||||||||||||||||| Sbjct: 594 ttcaggccggggaagttgcagggcacccgccggaactggatgtcgatgatgcccgagtgg 535 Query: 696 cggagcttc 704 ||||||||| Sbjct: 534 cggagcttc 526 Score = 56.0 bits (28), Expect = 2e-04 Identities = 28/28 (100%) Strand = Plus / Minus Query: 70 gtcagtgggcgggagagcacatgcaaac 97 |||||||||||||||||||||||||||| Sbjct: 1105 gtcagtgggcgggagagcacatgcaaac 1078 Score = 56.0 bits (28), Expect = 2e-04 Identities = 28/28 (100%) Strand = Plus / Minus Query: 149 catatgacaccagacagacggcatctca 176 |||||||||||||||||||||||||||| Sbjct: 1030 catatgacaccagacagacggcatctca 1003
>gb|AY543536.1| Triticum aestivum expansin EXPB1 mRNA, complete cds Length = 810 Score = 363 bits (183), Expect = 5e-97 Identities = 315/359 (87%) Strand = Plus / Minus Query: 346 actggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgttgg 405 ||||||||| |||||||||| |||| ||||| |||||||||||||||||| |||| || Sbjct: 797 actggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtcgg 738 Query: 406 ccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccctggaggcggt 465 |||||||| |||||||||| ||| ||||||||||||||||||| ||| |||||||||||| Sbjct: 737 ccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggaggcggt 678 Query: 466 ggttggagtccatccgccagatggatccccacgactcgcgcatcgccatccacgaccccg 525 || |||||||| |||||||||||||||||||||||||||||||| | |||||| ||| | Sbjct: 677 ggccggagtccagccgccagatggatccccacgactcgcgcatcggcgtccacgtcccgg 618 Query: 526 agttggcctccttcatgtccacctggatcacgtcgccgtccatgtcctcgtactcgatca 585 ||||||||||| | | ||||||||| | |||||||||||| |||||||||||| | || Sbjct: 617 agttggcctccatgaggtccacctgcaccacgtcgccgtcgccgtcctcgtactccacca 558 Query: 586 gcaccgccaggtacaccgcgttggagccctccaccacgtggaagttgatcttgaggccgg 645 ||||||| | |||||||| ||| || |||| | ||||||||||| | | |||||| |||| Sbjct: 557 gcaccgcgaagtacaccgggttcgacccctgctccacgtggaaggtcaccttgagaccgg 498 Query: 646 ggaagttgcacggcaccctcctgaactggatgtcgatgatgcccgagtggcggagcttc 704 |||| | ||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 497 ggaactcgcacggcaccctcttgaactggatgtcgatgatgcccgagtggcggagcttc 439
>gb|AY589579.1| Triticum aestivum beta-expansin TaEXPB2 mRNA, complete cds Length = 897 Score = 339 bits (171), Expect = 7e-90 Identities = 312/359 (86%) Strand = Plus / Minus Query: 346 actggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgttgg 405 ||||||||| |||||||||| |||| ||||| |||||||||||||||||| |||| || Sbjct: 824 actggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtcgg 765 Query: 406 ccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccctggaggcggt 465 |||||||| |||||||||| ||| ||||||||||||||||||| ||| |||||||||||| Sbjct: 764 ccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggaggcggt 705 Query: 466 ggttggagtccatccgccagatggatccccacgactcgcgcatcgccatccacgaccccg 525 || |||||| | |||||||||||| ||||| ||||||||||||| | |||||| ||| | Sbjct: 704 ggccggagtcgagccgccagatggagccccatgactcgcgcatcggcgtccacgtcccgg 645 Query: 526 agttggcctccttcatgtccacctggatcacgtcgccgtccatgtcctcgtactcgatca 585 ||||||||||| | | ||||||||| | |||||||||||| |||||||||||| | || Sbjct: 644 agttggcctccatgaggtccacctgcaccacgtcgccgtcgccgtcctcgtactccacca 585 Query: 586 gcaccgccaggtacaccgcgttggagccctccaccacgtggaagttgatcttgaggccgg 645 ||||||| | |||||||| ||| || |||| | ||||||||||| | | |||||| |||| Sbjct: 584 gcaccgcgaagtacaccgggttcgacccctgctccacgtggaaggtcaccttgagaccgg 525 Query: 646 ggaagttgcacggcaccctcctgaactggatgtcgatgatgcccgagtggcggagcttc 704 |||| | ||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 524 ggaactcgcacggcaccctcttgaactggatgtcgatgatgcccgagtggcggagcttc 466
>gb|AY543538.1| Triticum aestivum expansin EXPB3 mRNA, complete cds Length = 834 Score = 307 bits (155), Expect = 3e-80 Identities = 308/359 (85%) Strand = Plus / Minus Query: 346 actggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgttgg 405 ||||||||| ||| |||||| |||| ||||| |||||||||||||||||| |||| || Sbjct: 803 actggacgatggaacggtagaaggtgctgggcgcccagttggccgggatgaccttgtcgg 744 Query: 406 ccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccctggaggcggt 465 |||||||| ||||||||| ||| ||||||||||||||||||| ||| |||||||||||| Sbjct: 743 ccaccagcgacttgccggactcgttggtgatgcgcatggagaagggcgcctggaggcggt 684 Query: 466 ggttggagtccatccgccagatggatccccacgactcgcgcatcgccatccacgaccccg 525 || ||||| | |||||||||||| ||||| ||||||||||||| | |||||| ||| | Sbjct: 683 ggccagagtcgagccgccagatggagccccatgactcgcgcatcggcgtccacgtcccgg 624 Query: 526 agttggcctccttcatgtccacctggatcacgtcgccgtccatgtcctcgtactcgatca 585 ||||||||||| | | ||||||||| | |||||||||||| |||||||||||| | || Sbjct: 623 agttggcctccatgaggtccacctgcaccacgtcgccgtcgccgtcctcgtactccacca 564 Query: 586 gcaccgccaggtacaccgcgttggagccctccaccacgtggaagttgatcttgaggccgg 645 ||||||| | |||||||| ||| || |||| | ||||||||||| | | |||||| |||| Sbjct: 563 gcaccgcgaagtacaccgggttcgacccctgctccacgtggaaggtcaccttgagaccgg 504 Query: 646 ggaagttgcacggcaccctcctgaactggatgtcgatgatgcccgagtggcggagcttc 704 |||| | ||||||||||||| |||||||||||||||| ||||||||||||||||||||| Sbjct: 503 ggaactcgcacggcaccctcttgaactggatgtcgattatgcccgagtggcggagcttc 445
>emb|AJ295942.1|FPR295942 Festuca pratensis mRNA for beta expansin B3 (expB3 gene) Length = 1219 Score = 242 bits (122), Expect = 1e-60 Identities = 302/362 (83%) Strand = Plus / Minus Query: 342 ctgaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattg 401 ||||||||||||| |||||||||| || | |||| ||| ||||||||||||| ||| Sbjct: 902 ctgaactggacgatggagcggtaggaggcgctgggggcccaattggccgggatgatcttg 843 Query: 402 ttggccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccctggagg 461 | ||| || |||| ||||||||| ||| ||||||||||||||||||| ||| |||||||| Sbjct: 842 tcggcgacgagctgcttgccggactcgttggtgatgcgcatggagaagggcgcctggagg 783 Query: 462 cggtggttggagtccatccgccagatggatccccacgactcgcgcatcgccatccacgac 521 ||||||||||||||||| ||||||||||||||||||||||| | ||||| | |||| | Sbjct: 782 cggtggttggagtccatgcgccagatggatccccacgactccctcatcggcgtccagttc 723 Query: 522 cccgagttggcctccttcatgtccacctggatcacgtcgccgtccatgtcctcgtactcg 581 | | |||||||||| | | ||||||||| | ||||||||||| |||||||||||| Sbjct: 722 ctggcgttggcctccatgaggtccacctgcacaacgtcgccgtcgccgtcctcgtactcc 663 Query: 582 atcagcaccgccaggtacaccgcgttggagccctccaccacgtggaagttgatcttgagg 641 | ||||||||| | | |||||||||| || || | | | ||||||||| | | ||| ||| Sbjct: 662 accagcaccgcgaagcacaccgcgttcgaaccatgctcgacgtggaaggtcaccttcagg 603 Query: 642 ccggggaagttgcacggcaccctcctgaactggatgtcgatgatgcccgagtggcggagc 701 |||||||| | ||||||||| ||| ||||||||||||||||||| || |||||||||||| Sbjct: 602 ccggggaactcgcacggcactctcttgaactggatgtcgatgataccggagtggcggagc 543 Query: 702 tt 703 || Sbjct: 542 tt 541
>ref|NM_197700.1| Oryza sativa (japonica cultivar-group) beta-expansin EXPB3 (OSJNBb0014I11.1), mRNA Length = 904 Score = 236 bits (119), Expect = 8e-59 Identities = 272/323 (84%) Strand = Plus / Minus Query: 380 ccagttggccgggatgacattgttggccaccagcttcttgccggagtcgctggtgatgcg 439 |||||||||||||||||| | | |||| || |||| ||||||||| ||| |||||||||| Sbjct: 859 ccagttggccgggatgacctggctggcgacgagctgcttgccggactcgttggtgatgcg 800 Query: 440 catggagaaaggcccctggaggcggtggttggagtccatccgccagatggatccccacga 499 | ||||| ||| || |||||||||||||||||| | || ||||||||| |||||||| Sbjct: 799 gagcgagaagggcgccgtgaggcggtggttggagtcgagcctccagatggagccccacga 740 Query: 500 ctcgcgcatcgccatccacgaccccgagttggcctccttcatgtccacctggatcacgtc 559 ||||||||||| | |||||||| |||||||||||| | | |||||||| | |||||| Sbjct: 739 ctcgcgcatcggcgtccacgactgggagttggcctccatgagatccacctgcaccacgtc 680 Query: 560 gccgtccatgtcctcgtactcgatcagcaccgccaggtacaccgcgttggagccctccac 619 |||||| |||||||||||| | ||||||||| | |||||||| ||| || |||||| | Sbjct: 679 gccgtcgccgtcctcgtactcaaccagcaccgcgaagtacaccgggttcgacccctcctc 620 Query: 620 cacgtggaagttgatcttgaggccggggaagttgcacggcaccctcctgaactggatgtc 679 ||||||||| | | ||| || || ||||||||||||||||||||| ||||||||||||| Sbjct: 619 cacgtggaacgtcaccttcagcccagggaagttgcacggcaccctcttgaactggatgtc 560 Query: 680 gatgatgcccgagtggcggagct 702 ||||||||| | ||||||||||| Sbjct: 559 gatgatgccggcgtggcggagct 537
>gb|AF261271.1| Oryza sativa beta-expansin (EXPB3) mRNA, complete cds Length = 1319 Score = 236 bits (119), Expect = 8e-59 Identities = 272/323 (84%) Strand = Plus / Minus Query: 380 ccagttggccgggatgacattgttggccaccagcttcttgccggagtcgctggtgatgcg 439 |||||||||||||||||| | | |||| || |||| ||||||||| ||| |||||||||| Sbjct: 858 ccagttggccgggatgacctggctggcgacgagctgcttgccggactcgttggtgatgcg 799 Query: 440 catggagaaaggcccctggaggcggtggttggagtccatccgccagatggatccccacga 499 | ||||| ||| || |||||||||||||||||| | || ||||||||| |||||||| Sbjct: 798 gagcgagaagggcgccgtgaggcggtggttggagtcgagcctccagatggagccccacga 739 Query: 500 ctcgcgcatcgccatccacgaccccgagttggcctccttcatgtccacctggatcacgtc 559 ||||||||||| | |||||||| |||||||||||| | | |||||||| | |||||| Sbjct: 738 ctcgcgcatcggcgtccacgactgggagttggcctccatgagatccacctgcaccacgtc 679 Query: 560 gccgtccatgtcctcgtactcgatcagcaccgccaggtacaccgcgttggagccctccac 619 |||||| |||||||||||| | ||||||||| | |||||||| ||| || |||||| | Sbjct: 678 gccgtcgccgtcctcgtactcaaccagcaccgcgaagtacaccgggttcgacccctcctc 619 Query: 620 cacgtggaagttgatcttgaggccggggaagttgcacggcaccctcctgaactggatgtc 679 ||||||||| | | ||| || || ||||||||||||||||||||| ||||||||||||| Sbjct: 618 cacgtggaacgtcaccttcagcccagggaagttgcacggcaccctcttgaactggatgtc 559 Query: 680 gatgatgcccgagtggcggagct 702 ||||||||| | ||||||||||| Sbjct: 558 gatgatgccggcgtggcggagct 536 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 73 agtgggcgggagagcacatgcaaac 97 ||||||||||| ||||||||||||| Sbjct: 1213 agtgggcgggacagcacatgcaaac 1189
>dbj|AK105318.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-117-F11, full insert sequence Length = 1031 Score = 236 bits (119), Expect = 8e-59 Identities = 272/323 (84%) Strand = Plus / Minus Query: 380 ccagttggccgggatgacattgttggccaccagcttcttgccggagtcgctggtgatgcg 439 |||||||||||||||||| | | |||| || |||| ||||||||| ||| |||||||||| Sbjct: 614 ccagttggccgggatgacctggctggcgacgagctgcttgccggactcgttggtgatgcg 555 Query: 440 catggagaaaggcccctggaggcggtggttggagtccatccgccagatggatccccacga 499 | ||||| ||| || |||||||||||||||||| | || ||||||||| |||||||| Sbjct: 554 gagcgagaagggcgccgtgaggcggtggttggagtcgagcctccagatggagccccacga 495 Query: 500 ctcgcgcatcgccatccacgaccccgagttggcctccttcatgtccacctggatcacgtc 559 ||||||||||| | |||||||| |||||||||||| | | |||||||| | |||||| Sbjct: 494 ctcgcgcatcggcgtccacgactgggagttggcctccatgagatccacctgcaccacgtc 435 Query: 560 gccgtccatgtcctcgtactcgatcagcaccgccaggtacaccgcgttggagccctccac 619 |||||| |||||||||||| | ||||||||| | |||||||| ||| || |||||| | Sbjct: 434 gccgtcgccgtcctcgtactcaaccagcaccgcgaagtacaccgggttcgacccctcctc 375 Query: 620 cacgtggaagttgatcttgaggccggggaagttgcacggcaccctcctgaactggatgtc 679 ||||||||| | | ||| || || ||||||||||||||||||||| ||||||||||||| Sbjct: 374 cacgtggaacgtcaccttcagcccagggaagttgcacggcaccctcttgaactggatgtc 315 Query: 680 gatgatgcccgagtggcggagct 702 ||||||||| | ||||||||||| Sbjct: 314 gatgatgccggcgtggcggagct 292 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 73 agtgggcgggagagcacatgcaaac 97 ||||||||||| ||||||||||||| Sbjct: 969 agtgggcgggacagcacatgcaaac 945
>dbj|AK100959.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023140O05, full insert sequence Length = 1313 Score = 236 bits (119), Expect = 8e-59 Identities = 272/323 (84%) Strand = Plus / Minus Query: 380 ccagttggccgggatgacattgttggccaccagcttcttgccggagtcgctggtgatgcg 439 |||||||||||||||||| | | |||| || |||| ||||||||| ||| |||||||||| Sbjct: 870 ccagttggccgggatgacctggctggcgacgagctgcttgccggactcgttggtgatgcg 811 Query: 440 catggagaaaggcccctggaggcggtggttggagtccatccgccagatggatccccacga 499 | ||||| ||| || |||||||||||||||||| | || ||||||||| |||||||| Sbjct: 810 gagcgagaagggcgccgtgaggcggtggttggagtcgagcctccagatggagccccacga 751 Query: 500 ctcgcgcatcgccatccacgaccccgagttggcctccttcatgtccacctggatcacgtc 559 ||||||||||| | |||||||| |||||||||||| | | |||||||| | |||||| Sbjct: 750 ctcgcgcatcggcgtccacgactgggagttggcctccatgagatccacctgcaccacgtc 691 Query: 560 gccgtccatgtcctcgtactcgatcagcaccgccaggtacaccgcgttggagccctccac 619 |||||| |||||||||||| | ||||||||| | |||||||| ||| || |||||| | Sbjct: 690 gccgtcgccgtcctcgtactcaaccagcaccgcgaagtacaccgggttcgacccctcctc 631 Query: 620 cacgtggaagttgatcttgaggccggggaagttgcacggcaccctcctgaactggatgtc 679 ||||||||| | | ||| || || ||||||||||||||||||||| ||||||||||||| Sbjct: 630 cacgtggaacgtcaccttcagcccagggaagttgcacggcaccctcttgaactggatgtc 571 Query: 680 gatgatgcccgagtggcggagct 702 ||||||||| | ||||||||||| Sbjct: 570 gatgatgccggcgtggcggagct 548 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 73 agtgggcgggagagcacatgcaaac 97 ||||||||||| ||||||||||||| Sbjct: 1225 agtgggcgggacagcacatgcaaac 1201
>gb|AF332178.1|AF332178 Zea mays beta-expansin 5 (expB5) mRNA, partial cds Length = 650 Score = 228 bits (115), Expect = 2e-56 Identities = 289/347 (83%) Strand = Plus / Minus Query: 356 ggagcggtagtcggtgttgggcctccagttggccgggatgacattgttggccaccagctt 415 ||||||||||| |||||||||| ||||||||| |||||||| ||||||||||||| Sbjct: 517 ggagcggtagtaggtgttgggcgcccagttggcagggatgacccgagtggccaccagctt 458 Query: 416 cttgccggagtcgctggtgatgcgcatggagaaaggcccctggaggcggtggttggagtc 475 | ||||||| ||| |||||| ||||| ||||| ||| |||| || | |||||||| ||| Sbjct: 457 cctgccggactcgttggtgacgcgcagcgagaagggcgcctgtagcctgtggttggcgtc 398 Query: 476 catccgccagatggatccccacgactcgcgcatcgccatccacgaccccgagttggcctc 535 || || ||||||||| ||||| ||||||||||||| | |||| | || ||||||||||| Sbjct: 397 cagcctccagatggacccccaggactcgcgcatcggcgtccagtagccggagttggcctc 338 Query: 536 cttcatgtccacctggatcacgtcgccgtccatgtcctcgtactcgatcagcaccgccag 595 | | | ||||||||| | |||||||||||| ||||||| |||||| ||||||||||| Sbjct: 337 catgaggtccacctgcaccacgtcgccgtcgccgtcctcgaactcgacgagcaccgccag 278 Query: 596 gtacaccgcgttggagccctccaccacgtggaagttgatcttgaggccggggaagttgca 655 ||| || ||||| ||||||||| |||||||||| | | ||| | |||||| ||||||| Sbjct: 277 gtagacggcgttcgagccctcctccacgtggaacgtcaccttccgcccggggtagttgca 218 Query: 656 cggcaccctcctgaactggatgtcgatgatgcccgagtggcggagct 702 ||||||||| |||||||||||||||||||||| | ||||||||||| Sbjct: 217 gggcaccctcttgaactggatgtcgatgatgccggcgtggcggagct 171
>gb|AF332180.1|AF332180 Zea mays beta-expansin 7 (expB7) mRNA, complete cds Length = 1173 Score = 216 bits (109), Expect = 7e-53 Identities = 295/357 (82%) Strand = Plus / Minus Query: 346 actggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgttgg 405 ||||||||| || ||||||| |||||||||| ||||||||| |||||||||| || | Sbjct: 866 actggacgatagaacggtagtaggtgttgggcacccagttggcggggatgacatggtcag 807 Query: 406 ccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccctggaggcggt 465 |||||||| |||||||||| ||| | || ||||||| |||||| ||| | |||||||| Sbjct: 806 ccaccagcgtcttgccggactcgttcgtaatgcgcagggagaatggcgcggtgaggcggt 747 Query: 466 ggttggagtccatccgccagatggatccccacgactcgcgcatcgccatccacgaccccg 525 || |||||| | || ||||||||||||||| ||||||||||||| | |||||||| | | Sbjct: 746 ggccggagtcgagcctccagatggatccccaggactcgcgcatcggcgtccacgacgcag 687 Query: 526 agttggcctccttcatgtccacctggatcacgtcgccgtccatgtcctcgtactcgatca 585 ||||||||||| | | ||||||||| | | |||||||||| ||| ||| |||||| || Sbjct: 686 agttggcctccatgaggtccacctgcaccgcgtcgccgtcgccgtcttcgaactcgacca 627 Query: 586 gcaccgccaggtacaccgcgttggagccctccaccacgtggaagttgatcttgaggccgg 645 ||||||| | ||| || | ||||||||||||| | |||||||| | | ||| | |||| Sbjct: 626 gcaccgcgaagtagacggggttggagccctcctcgacgtggaacgtcaccttctgcccgg 567 Query: 646 ggaagttgcacggcaccctcctgaactggatgtcgatgatgcccgagtggcggagct 702 || ||||||| ||||||||| |||||||||||||||||||||| | ||||||||||| Sbjct: 566 ggtagttgcagggcaccctcttgaactggatgtcgatgatgccggcgtggcggagct 510
>gb|AC069300.7| Oryza sativa chromosome 10 BAC OSJNBa0010C11 genomic sequence, complete sequence Length = 147117 Score = 184 bits (93), Expect = 3e-43 Identities = 237/285 (83%) Strand = Plus / Plus Query: 380 ccagttggccgggatgacattgttggccaccagcttcttgccggagtcgctggtgatgcg 439 |||||||||||||||||| | | |||| || |||| ||||||||| ||| |||||||||| Sbjct: 4107 ccagttggccgggatgacctggctggcgacgagctgcttgccggactcgttggtgatgcg 4166 Query: 440 catggagaaaggcccctggaggcggtggttggagtccatccgccagatggatccccacga 499 | ||||| ||| || |||||||||||||||||| | || ||||||||| |||||||| Sbjct: 4167 gagcgagaagggcgccgtgaggcggtggttggagtcgagcctccagatggagccccacga 4226 Query: 500 ctcgcgcatcgccatccacgaccccgagttggcctccttcatgtccacctggatcacgtc 559 ||||||||||| | |||||||| |||||||||||| | | |||||||| | |||||| Sbjct: 4227 ctcgcgcatcggcgtccacgactgggagttggcctccatgagatccacctgcaccacgtc 4286 Query: 560 gccgtccatgtcctcgtactcgatcagcaccgccaggtacaccgcgttggagccctccac 619 |||||| |||||||||||| | ||||||||| | |||||||| ||| || |||||| | Sbjct: 4287 gccgtcgccgtcctcgtactcaaccagcaccgcgaagtacaccgggttcgacccctcctc 4346 Query: 620 cacgtggaagttgatcttgaggccggggaagttgcacggcaccct 664 ||||||||| | | ||| || || |||||||||||||||||||| Sbjct: 4347 cacgtggaacgtcaccttcagcccagggaagttgcacggcaccct 4391 Score = 145 bits (73), Expect = 2e-31 Identities = 136/157 (86%) Strand = Plus / Minus Query: 346 actggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgttgg 405 |||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| Sbjct: 16762 actggacgaaggagcggtagaatgtgttgggcctccagttggccgggatgacgttgttgg 16703 Query: 406 ccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccctggaggcggt 465 | || ||| |||||||||| ||| || |||||| |||||||| || ||||||| | || Sbjct: 16702 cgacgagcgtcttgccggactcgttgcggatgcggatggagaagggggcctggagcctgt 16643 Query: 466 ggttggagtccatccgccagatggatccccacgactc 502 |||||| ||||| || ||||||||| ||||||||||| Sbjct: 16642 ggttggtgtccagcctccagatggagccccacgactc 16606 Score = 63.9 bits (32), Expect = 7e-07 Identities = 107/132 (81%) Strand = Plus / Minus Query: 533 ctccttcatgtccacctggatcacgtcgccgtccatgtcctcgtactcgatcagcaccgc 592 |||| ||| ||||||||| | |||||||||||| |||||||||||| | ||||||||| Sbjct: 16557 ctccatcaggtccacctgcaccacgtcgccgtcgccgtcctcgtactccaccagcaccgc 16498 Query: 593 caggtacaccgcgttggagccctccaccacgtggaagttgatcttgaggccggggaagtt 652 | |||||| | ||| ||| |||| |||||||||| ||||||||| || ||||| | Sbjct: 16497 gaagtacacagggttcgagtactcctccacgtggaacccgatcttgagccccgggaactc 16438 Query: 653 gcacggcaccct 664 ||| |||||||| Sbjct: 16437 gcatggcaccct 16426 Score = 58.0 bits (29), Expect = 4e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 662 cctcctgaactggatgtcgatgatgcccgagtggcggagct 702 |||| |||||||||||||||||||||| | ||||||||||| Sbjct: 4734 cctcttgaactggatgtcgatgatgccggcgtggcggagct 4774 Score = 50.1 bits (25), Expect = 0.010 Identities = 34/37 (91%) Strand = Plus / Minus Query: 667 tgaactggatgtcgatgatgcccgagtggcggagctt 703 |||||| ||||||||||||||| |||||||| ||||| Sbjct: 15845 tgaactcgatgtcgatgatgccggagtggcgcagctt 15809 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 73 agtgggcgggagagcacatgcaaac 97 ||||||||||| ||||||||||||| Sbjct: 3752 agtgggcgggacagcacatgcaaac 3776
>gb|AC037426.12| Oryza sativa chromosome 10 BAC OSJNBb0014I11 genomic sequence, complete sequence Length = 135510 Score = 184 bits (93), Expect = 3e-43 Identities = 237/285 (83%) Strand = Plus / Minus Query: 380 ccagttggccgggatgacattgttggccaccagcttcttgccggagtcgctggtgatgcg 439 |||||||||||||||||| | | |||| || |||| ||||||||| ||| |||||||||| Sbjct: 5266 ccagttggccgggatgacctggctggcgacgagctgcttgccggactcgttggtgatgcg 5207 Query: 440 catggagaaaggcccctggaggcggtggttggagtccatccgccagatggatccccacga 499 | ||||| ||| || |||||||||||||||||| | || ||||||||| |||||||| Sbjct: 5206 gagcgagaagggcgccgtgaggcggtggttggagtcgagcctccagatggagccccacga 5147 Query: 500 ctcgcgcatcgccatccacgaccccgagttggcctccttcatgtccacctggatcacgtc 559 ||||||||||| | |||||||| |||||||||||| | | |||||||| | |||||| Sbjct: 5146 ctcgcgcatcggcgtccacgactgggagttggcctccatgagatccacctgcaccacgtc 5087 Query: 560 gccgtccatgtcctcgtactcgatcagcaccgccaggtacaccgcgttggagccctccac 619 |||||| |||||||||||| | ||||||||| | |||||||| ||| || |||||| | Sbjct: 5086 gccgtcgccgtcctcgtactcaaccagcaccgcgaagtacaccgggttcgacccctcctc 5027 Query: 620 cacgtggaagttgatcttgaggccggggaagttgcacggcaccct 664 ||||||||| | | ||| || || |||||||||||||||||||| Sbjct: 5026 cacgtggaacgtcaccttcagcccagggaagttgcacggcaccct 4982 Score = 168 bits (85), Expect = 2e-38 Identities = 133/149 (89%) Strand = Plus / Minus Query: 555 acgtcgccgtccatgtcctcgtactcgatcagcaccgccaggtacaccgcgttggagccc 614 ||||||||||| | |||||||||||||| ||||| || | |||||||| |||||||||| Sbjct: 22823 acgtcgccgtcgaggtcctcgtactcgacgagcacggcgaagtacaccgggttggagccc 22764 Query: 615 tccaccacgtggaagttgatcttgaggccggggaagttgcacggcaccctcctgaactgg 674 ||| | ||||||||||||||||||||||| ||| ||||||| || || | |||||||||| Sbjct: 22763 tcctcgacgtggaagttgatcttgaggcccgggtagttgcaggggacgcgcctgaactgg 22704 Query: 675 atgtcgatgatgcccgagtggcggagctt 703 ||||||||||||||||||||||||||||| Sbjct: 22703 atgtcgatgatgcccgagtggcggagctt 22675 Score = 153 bits (77), Expect = 9e-34 Identities = 140/161 (86%) Strand = Plus / Minus Query: 342 ctgaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattg 401 ||||||||||||| ||||||||||| || |||||| |||||| ||||||||||| ||| Sbjct: 23054 ctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgttg 22995 Query: 402 ttggccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccctggagg 461 ||||| || ||| ||||||||||||||||| |||||| | |||||| ||| |||||||| Sbjct: 22994 ttggcgacgagcgtcttgccggagtcgctgcggatgcggagggagaagggcgcctggagg 22935 Query: 462 cggtggttggagtccatccgccagatggatccccacgactc 502 |||||||||||||| | ||||||||||| ||||||||||| Sbjct: 22934 cggtggttggagtcgaggcgccagatggagccccacgactc 22894 Score = 87.7 bits (44), Expect = 5e-14 Identities = 131/160 (81%) Strand = Plus / Minus Query: 337 atcaactgaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatga 396 |||||| ||||||||| ||||| ||||| |||||||| |||||||||||||||||||| Sbjct: 17197 atcaacggaactggactttggagccgtagttggtgttggccctccagttggccgggatga 17138 Query: 397 cattgttggccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccct 456 | | || ||| | | ||| |||||| |||||| ||||| | |||||| || |||| Sbjct: 17137 cctggtgggcgatgacggtctggccggactcgctgaccatgcggagggagaaggggccct 17078 Query: 457 ggaggcggtggttggagtccatccgccagatggatcccca 496 ||||||||||||||| ||| | ||||||||||||||||| Sbjct: 17077 ggaggcggtggttggcgtcgaggcgccagatggatcccca 17038 Score = 69.9 bits (35), Expect = 1e-08 Identities = 98/119 (82%) Strand = Plus / Minus Query: 584 cagcaccgccaggtacaccgcgttggagccctccaccacgtggaagttgatcttgaggcc 643 |||||| || |||||||||| |||||| || || | ||||||||||| | | |||||| Sbjct: 16935 cagcacggcgaggtacaccgggttggacccggcctcgacgtggaagttcacgtagaggcc 16876 Query: 644 ggggaagttgcacggcaccctcctgaactggatgtcgatgatgcccgagtggcggagct 702 | || || |||||| || | |||||||||||||||||||||||| | ||||||||||| Sbjct: 16875 gcggtggtagcacgggacgcgcctgaactggatgtcgatgatgccggcgtggcggagct 16817 Score = 58.0 bits (29), Expect = 4e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 662 cctcctgaactggatgtcgatgatgcccgagtggcggagct 702 |||| |||||||||||||||||||||| | ||||||||||| Sbjct: 4639 cctcttgaactggatgtcgatgatgccggcgtggcggagct 4599 Score = 46.1 bits (23), Expect = 0.16 Identities = 23/23 (100%) Strand = Plus / Minus Query: 72 cagtgggcgggagagcacatgca 94 ||||||||||||||||||||||| Sbjct: 23301 cagtgggcgggagagcacatgca 23279 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 73 agtgggcgggagagcacatgcaaac 97 ||||||||||| ||||||||||||| Sbjct: 5621 agtgggcgggacagcacatgcaaac 5597
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 184 bits (93), Expect = 3e-43 Identities = 237/285 (83%) Strand = Plus / Plus Query: 380 ccagttggccgggatgacattgttggccaccagcttcttgccggagtcgctggtgatgcg 439 |||||||||||||||||| | | |||| || |||| ||||||||| ||| |||||||||| Sbjct: 21329093 ccagttggccgggatgacctggctggcgacgagctgcttgccggactcgttggtgatgcg 21329152 Query: 440 catggagaaaggcccctggaggcggtggttggagtccatccgccagatggatccccacga 499 | ||||| ||| || |||||||||||||||||| | || ||||||||| |||||||| Sbjct: 21329153 gagcgagaagggcgccgtgaggcggtggttggagtcgagcctccagatggagccccacga 21329212 Query: 500 ctcgcgcatcgccatccacgaccccgagttggcctccttcatgtccacctggatcacgtc 559 ||||||||||| | |||||||| |||||||||||| | | |||||||| | |||||| Sbjct: 21329213 ctcgcgcatcggcgtccacgactgggagttggcctccatgagatccacctgcaccacgtc 21329272 Query: 560 gccgtccatgtcctcgtactcgatcagcaccgccaggtacaccgcgttggagccctccac 619 |||||| |||||||||||| | ||||||||| | |||||||| ||| || |||||| | Sbjct: 21329273 gccgtcgccgtcctcgtactcaaccagcaccgcgaagtacaccgggttcgacccctcctc 21329332 Query: 620 cacgtggaagttgatcttgaggccggggaagttgcacggcaccct 664 ||||||||| | | ||| || || |||||||||||||||||||| Sbjct: 21329333 cacgtggaacgtcaccttcagcccagggaagttgcacggcaccct 21329377 Score = 168 bits (85), Expect = 2e-38 Identities = 133/149 (89%) Strand = Plus / Plus Query: 555 acgtcgccgtccatgtcctcgtactcgatcagcaccgccaggtacaccgcgttggagccc 614 ||||||||||| | |||||||||||||| ||||| || | |||||||| |||||||||| Sbjct: 21311536 acgtcgccgtcgaggtcctcgtactcgacgagcacggcgaagtacaccgggttggagccc 21311595 Query: 615 tccaccacgtggaagttgatcttgaggccggggaagttgcacggcaccctcctgaactgg 674 ||| | ||||||||||||||||||||||| ||| ||||||| || || | |||||||||| Sbjct: 21311596 tcctcgacgtggaagttgatcttgaggcccgggtagttgcaggggacgcgcctgaactgg 21311655 Query: 675 atgtcgatgatgcccgagtggcggagctt 703 ||||||||||||||||||||||||||||| Sbjct: 21311656 atgtcgatgatgcccgagtggcggagctt 21311684 Score = 153 bits (77), Expect = 9e-34 Identities = 140/161 (86%) Strand = Plus / Plus Query: 342 ctgaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattg 401 ||||||||||||| ||||||||||| || |||||| |||||| ||||||||||| ||| Sbjct: 21311305 ctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgttg 21311364 Query: 402 ttggccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccctggagg 461 ||||| || ||| ||||||||||||||||| |||||| | |||||| ||| |||||||| Sbjct: 21311365 ttggcgacgagcgtcttgccggagtcgctgcggatgcggagggagaagggcgcctggagg 21311424 Query: 462 cggtggttggagtccatccgccagatggatccccacgactc 502 |||||||||||||| | ||||||||||| ||||||||||| Sbjct: 21311425 cggtggttggagtcgaggcgccagatggagccccacgactc 21311465 Score = 145 bits (73), Expect = 2e-31 Identities = 136/157 (86%) Strand = Plus / Minus Query: 346 actggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgttgg 405 |||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| Sbjct: 21341749 actggacgaaggagcggtagaatgtgttgggcctccagttggccgggatgacgttgttgg 21341690 Query: 406 ccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccctggaggcggt 465 | || ||| |||||||||| ||| || |||||| |||||||| || ||||||| | || Sbjct: 21341689 cgacgagcgtcttgccggactcgttgcggatgcggatggagaagggggcctggagcctgt 21341630 Query: 466 ggttggagtccatccgccagatggatccccacgactc 502 |||||| ||||| || ||||||||| ||||||||||| Sbjct: 21341629 ggttggtgtccagcctccagatggagccccacgactc 21341593 Score = 87.7 bits (44), Expect = 5e-14 Identities = 131/160 (81%) Strand = Plus / Plus Query: 337 atcaactgaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatga 396 |||||| ||||||||| ||||| ||||| |||||||| |||||||||||||||||||| Sbjct: 21317162 atcaacggaactggactttggagccgtagttggtgttggccctccagttggccgggatga 21317221 Query: 397 cattgttggccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccct 456 | | || ||| | | ||| |||||| |||||| ||||| | |||||| || |||| Sbjct: 21317222 cctggtgggcgatgacggtctggccggactcgctgaccatgcggagggagaaggggccct 21317281 Query: 457 ggaggcggtggttggagtccatccgccagatggatcccca 496 ||||||||||||||| ||| | ||||||||||||||||| Sbjct: 21317282 ggaggcggtggttggcgtcgaggcgccagatggatcccca 21317321 Score = 69.9 bits (35), Expect = 1e-08 Identities = 98/119 (82%) Strand = Plus / Plus Query: 584 cagcaccgccaggtacaccgcgttggagccctccaccacgtggaagttgatcttgaggcc 643 |||||| || |||||||||| |||||| || || | ||||||||||| | | |||||| Sbjct: 21317424 cagcacggcgaggtacaccgggttggacccggcctcgacgtggaagttcacgtagaggcc 21317483 Query: 644 ggggaagttgcacggcaccctcctgaactggatgtcgatgatgcccgagtggcggagct 702 | || || |||||| || | |||||||||||||||||||||||| | ||||||||||| Sbjct: 21317484 gcggtggtagcacgggacgcgcctgaactggatgtcgatgatgccggcgtggcggagct 21317542 Score = 63.9 bits (32), Expect = 7e-07 Identities = 107/132 (81%) Strand = Plus / Minus Query: 533 ctccttcatgtccacctggatcacgtcgccgtccatgtcctcgtactcgatcagcaccgc 592 |||| ||| ||||||||| | |||||||||||| |||||||||||| | ||||||||| Sbjct: 21341544 ctccatcaggtccacctgcaccacgtcgccgtcgccgtcctcgtactccaccagcaccgc 21341485 Query: 593 caggtacaccgcgttggagccctccaccacgtggaagttgatcttgaggccggggaagtt 652 | |||||| | ||| ||| |||| |||||||||| ||||||||| || ||||| | Sbjct: 21341484 gaagtacacagggttcgagtactcctccacgtggaacccgatcttgagccccgggaactc 21341425 Query: 653 gcacggcaccct 664 ||| |||||||| Sbjct: 21341424 gcatggcaccct 21341413 Score = 58.0 bits (29), Expect = 4e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 662 cctcctgaactggatgtcgatgatgcccgagtggcggagct 702 |||| |||||||||||||||||||||| | ||||||||||| Sbjct: 21329720 cctcttgaactggatgtcgatgatgccggcgtggcggagct 21329760 Score = 56.0 bits (28), Expect = 2e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 641 gccggggaagttgcacggcaccctcctgaactggatgtcgatgatgcc 688 ||||||| | ||||| |||||||||||||||| |||||||||||||| Sbjct: 20947063 gccggggtacttgcagcgcaccctcctgaactgcatgtcgatgatgcc 20947016 Score = 50.1 bits (25), Expect = 0.010 Identities = 34/37 (91%) Strand = Plus / Minus Query: 667 tgaactggatgtcgatgatgcccgagtggcggagctt 703 |||||| ||||||||||||||| |||||||| ||||| Sbjct: 21340832 tgaactcgatgtcgatgatgccggagtggcgcagctt 21340796 Score = 46.1 bits (23), Expect = 0.16 Identities = 23/23 (100%) Strand = Plus / Plus Query: 72 cagtgggcgggagagcacatgca 94 ||||||||||||||||||||||| Sbjct: 21311058 cagtgggcgggagagcacatgca 21311080 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 273 catgcatgcatgcatgcgtgc 293 ||||||||||||||||||||| Sbjct: 21594394 catgcatgcatgcatgcgtgc 21594374 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 73 agtgggcgggagagcacatgcaaac 97 ||||||||||| ||||||||||||| Sbjct: 21328738 agtgggcgggacagcacatgcaaac 21328762 Score = 40.1 bits (20), Expect = 9.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 270 gcgcatgcatgcatgcatgc 289 |||||||||||||||||||| Sbjct: 8872971 gcgcatgcatgcatgcatgc 8872990
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 184 bits (93), Expect = 3e-43 Identities = 237/285 (83%) Strand = Plus / Plus Query: 380 ccagttggccgggatgacattgttggccaccagcttcttgccggagtcgctggtgatgcg 439 |||||||||||||||||| | | |||| || |||| ||||||||| ||| |||||||||| Sbjct: 21340357 ccagttggccgggatgacctggctggcgacgagctgcttgccggactcgttggtgatgcg 21340416 Query: 440 catggagaaaggcccctggaggcggtggttggagtccatccgccagatggatccccacga 499 | ||||| ||| || |||||||||||||||||| | || ||||||||| |||||||| Sbjct: 21340417 gagcgagaagggcgccgtgaggcggtggttggagtcgagcctccagatggagccccacga 21340476 Query: 500 ctcgcgcatcgccatccacgaccccgagttggcctccttcatgtccacctggatcacgtc 559 ||||||||||| | |||||||| |||||||||||| | | |||||||| | |||||| Sbjct: 21340477 ctcgcgcatcggcgtccacgactgggagttggcctccatgagatccacctgcaccacgtc 21340536 Query: 560 gccgtccatgtcctcgtactcgatcagcaccgccaggtacaccgcgttggagccctccac 619 |||||| |||||||||||| | ||||||||| | |||||||| ||| || |||||| | Sbjct: 21340537 gccgtcgccgtcctcgtactcaaccagcaccgcgaagtacaccgggttcgacccctcctc 21340596 Query: 620 cacgtggaagttgatcttgaggccggggaagttgcacggcaccct 664 ||||||||| | | ||| || || |||||||||||||||||||| Sbjct: 21340597 cacgtggaacgtcaccttcagcccagggaagttgcacggcaccct 21340641 Score = 168 bits (85), Expect = 2e-38 Identities = 133/149 (89%) Strand = Plus / Plus Query: 555 acgtcgccgtccatgtcctcgtactcgatcagcaccgccaggtacaccgcgttggagccc 614 ||||||||||| | |||||||||||||| ||||| || | |||||||| |||||||||| Sbjct: 21322800 acgtcgccgtcgaggtcctcgtactcgacgagcacggcgaagtacaccgggttggagccc 21322859 Query: 615 tccaccacgtggaagttgatcttgaggccggggaagttgcacggcaccctcctgaactgg 674 ||| | ||||||||||||||||||||||| ||| ||||||| || || | |||||||||| Sbjct: 21322860 tcctcgacgtggaagttgatcttgaggcccgggtagttgcaggggacgcgcctgaactgg 21322919 Query: 675 atgtcgatgatgcccgagtggcggagctt 703 ||||||||||||||||||||||||||||| Sbjct: 21322920 atgtcgatgatgcccgagtggcggagctt 21322948 Score = 153 bits (77), Expect = 9e-34 Identities = 140/161 (86%) Strand = Plus / Plus Query: 342 ctgaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattg 401 ||||||||||||| ||||||||||| || |||||| |||||| ||||||||||| ||| Sbjct: 21322569 ctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgttg 21322628 Query: 402 ttggccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccctggagg 461 ||||| || ||| ||||||||||||||||| |||||| | |||||| ||| |||||||| Sbjct: 21322629 ttggcgacgagcgtcttgccggagtcgctgcggatgcggagggagaagggcgcctggagg 21322688 Query: 462 cggtggttggagtccatccgccagatggatccccacgactc 502 |||||||||||||| | ||||||||||| ||||||||||| Sbjct: 21322689 cggtggttggagtcgaggcgccagatggagccccacgactc 21322729 Score = 145 bits (73), Expect = 2e-31 Identities = 136/157 (86%) Strand = Plus / Minus Query: 346 actggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgttgg 405 |||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| Sbjct: 21353012 actggacgaaggagcggtagaatgtgttgggcctccagttggccgggatgacgttgttgg 21352953 Query: 406 ccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccctggaggcggt 465 | || ||| |||||||||| ||| || |||||| |||||||| || ||||||| | || Sbjct: 21352952 cgacgagcgtcttgccggactcgttgcggatgcggatggagaagggggcctggagcctgt 21352893 Query: 466 ggttggagtccatccgccagatggatccccacgactc 502 |||||| ||||| || ||||||||| ||||||||||| Sbjct: 21352892 ggttggtgtccagcctccagatggagccccacgactc 21352856 Score = 87.7 bits (44), Expect = 5e-14 Identities = 131/160 (81%) Strand = Plus / Plus Query: 337 atcaactgaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatga 396 |||||| ||||||||| ||||| ||||| |||||||| |||||||||||||||||||| Sbjct: 21328426 atcaacggaactggactttggagccgtagttggtgttggccctccagttggccgggatga 21328485 Query: 397 cattgttggccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccct 456 | | || ||| | | ||| |||||| |||||| ||||| | |||||| || |||| Sbjct: 21328486 cctggtgggcgatgacggtctggccggactcgctgaccatgcggagggagaaggggccct 21328545 Query: 457 ggaggcggtggttggagtccatccgccagatggatcccca 496 ||||||||||||||| ||| | ||||||||||||||||| Sbjct: 21328546 ggaggcggtggttggcgtcgaggcgccagatggatcccca 21328585 Score = 69.9 bits (35), Expect = 1e-08 Identities = 98/119 (82%) Strand = Plus / Plus Query: 584 cagcaccgccaggtacaccgcgttggagccctccaccacgtggaagttgatcttgaggcc 643 |||||| || |||||||||| |||||| || || | ||||||||||| | | |||||| Sbjct: 21328688 cagcacggcgaggtacaccgggttggacccggcctcgacgtggaagttcacgtagaggcc 21328747 Query: 644 ggggaagttgcacggcaccctcctgaactggatgtcgatgatgcccgagtggcggagct 702 | || || |||||| || | |||||||||||||||||||||||| | ||||||||||| Sbjct: 21328748 gcggtggtagcacgggacgcgcctgaactggatgtcgatgatgccggcgtggcggagct 21328806 Score = 63.9 bits (32), Expect = 7e-07 Identities = 107/132 (81%) Strand = Plus / Minus Query: 533 ctccttcatgtccacctggatcacgtcgccgtccatgtcctcgtactcgatcagcaccgc 592 |||| ||| ||||||||| | |||||||||||| |||||||||||| | ||||||||| Sbjct: 21352807 ctccatcaggtccacctgcaccacgtcgccgtcgccgtcctcgtactccaccagcaccgc 21352748 Query: 593 caggtacaccgcgttggagccctccaccacgtggaagttgatcttgaggccggggaagtt 652 | |||||| | ||| ||| |||| |||||||||| ||||||||| || ||||| | Sbjct: 21352747 gaagtacacagggttcgagtactcctccacgtggaacccgatcttgagccccgggaactc 21352688 Query: 653 gcacggcaccct 664 ||| |||||||| Sbjct: 21352687 gcatggcaccct 21352676 Score = 58.0 bits (29), Expect = 4e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 662 cctcctgaactggatgtcgatgatgcccgagtggcggagct 702 |||| |||||||||||||||||||||| | ||||||||||| Sbjct: 21340984 cctcttgaactggatgtcgatgatgccggcgtggcggagct 21341024 Score = 56.0 bits (28), Expect = 2e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 641 gccggggaagttgcacggcaccctcctgaactggatgtcgatgatgcc 688 ||||||| | ||||| |||||||||||||||| |||||||||||||| Sbjct: 20958327 gccggggtacttgcagcgcaccctcctgaactgcatgtcgatgatgcc 20958280 Score = 50.1 bits (25), Expect = 0.010 Identities = 34/37 (91%) Strand = Plus / Minus Query: 667 tgaactggatgtcgatgatgcccgagtggcggagctt 703 |||||| ||||||||||||||| |||||||| ||||| Sbjct: 21352095 tgaactcgatgtcgatgatgccggagtggcgcagctt 21352059 Score = 46.1 bits (23), Expect = 0.16 Identities = 23/23 (100%) Strand = Plus / Plus Query: 72 cagtgggcgggagagcacatgca 94 ||||||||||||||||||||||| Sbjct: 21322322 cagtgggcgggagagcacatgca 21322344 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 273 catgcatgcatgcatgcgtgc 293 ||||||||||||||||||||| Sbjct: 21606057 catgcatgcatgcatgcgtgc 21606037 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 73 agtgggcgggagagcacatgcaaac 97 ||||||||||| ||||||||||||| Sbjct: 21340002 agtgggcgggacagcacatgcaaac 21340026 Score = 40.1 bits (20), Expect = 9.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 270 gcgcatgcatgcatgcatgc 289 |||||||||||||||||||| Sbjct: 8878110 gcgcatgcatgcatgcatgc 8878129
>gb|AF332179.1|AF332179 Zea mays beta-expansin 6 (expB6) mRNA, complete cds Length = 1142 Score = 170 bits (86), Expect = 4e-39 Identities = 290/358 (81%) Strand = Plus / Minus Query: 346 actggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgttgg 405 ||||||||||||||||||||||| || ||| | |||||||||||||||| || |||| Sbjct: 909 actggacgaaggagcggtagtcgacgtcggggatgtagttggccgggatgacgttcttgg 850 Query: 406 ccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccctggaggcggt 465 ||||||||| | ||||||| ||| ||||||||||||||||||| || || |||| || Sbjct: 849 ccaccagctgcctgccggactcgttggtgatgcgcatggagaaggggccacggagcgggc 790 Query: 466 ggttggagtccatccgccagatggatccccacgactcgcgcatcgccatccacgaccccg 525 |||||| ||| |||| ||||||||| ||||| |||||| |||| | | ||| || | Sbjct: 789 ggttggggtcgatcctccagatggagccccaggactcgtgcatgggctcccagtggccgg 730 Query: 526 agttggcctccttcatgtccacctggatcacgtcgccgtccatgtcctcgtactcgatca 585 ||||| || | | |||||| |||| | ||||||||||||| ||| ||||| |||||| | Sbjct: 729 agttgctctgcatgatgtccgcctgcaccacgtcgccgtccttgttctcgtgctcgatga 670 Query: 586 gcaccgccaggtacaccgcgttggagccctccaccacgtggaagttgatcttgaggccgg 645 |||| |||||||||| | ||||||||| | | ||| ||||| |||| | ||||| | Sbjct: 669 gcacggccaggtacatggggttggagccgtgctggacgcggaaggtgatggtcaggcccg 610 Query: 646 ggaagttgcacggcaccctcctgaactggatgtcgatgatgcccgagtggcggagctt 703 |||||||||||||||||| ||||||||| ||||||||||| || | ||| |||||||| Sbjct: 609 ggaagttgcacggcacccgcctgaactgcatgtcgatgatcccggcgtgccggagctt 552
>gb|AY104151.1| Zea mays PCO112411 mRNA sequence Length = 1171 Score = 170 bits (86), Expect = 4e-39 Identities = 290/358 (81%) Strand = Plus / Minus Query: 346 actggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgttgg 405 ||||||||||||||||||||||| || ||| | |||||||||||||||| || |||| Sbjct: 918 actggacgaaggagcggtagtcgacgtcggggatgtagttggccgggatgacgttcttgg 859 Query: 406 ccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccctggaggcggt 465 ||||||||| | ||||||| ||| ||||||||||||||||||| || || |||| || Sbjct: 858 ccaccagctgcctgccggactcgttggtgatgcgcatggagaaggggccacggagcgggc 799 Query: 466 ggttggagtccatccgccagatggatccccacgactcgcgcatcgccatccacgaccccg 525 |||||| ||| |||| ||||||||| ||||| |||||| |||| | | ||| || | Sbjct: 798 ggttggggtcgatcctccagatggagccccaggactcgtgcatgggctcccagtggccgg 739 Query: 526 agttggcctccttcatgtccacctggatcacgtcgccgtccatgtcctcgtactcgatca 585 ||||| || | | |||||| |||| | ||||||||||||| ||| ||||| |||||| | Sbjct: 738 agttgctctgcatgatgtccgcctgcaccacgtcgccgtccttgttctcgtgctcgatga 679 Query: 586 gcaccgccaggtacaccgcgttggagccctccaccacgtggaagttgatcttgaggccgg 645 |||| |||||||||| | ||||||||| | | ||| ||||| |||| | ||||| | Sbjct: 678 gcacggccaggtacatggggttggagccgtgctggacgcggaaggtgatggtcaggcccg 619 Query: 646 ggaagttgcacggcaccctcctgaactggatgtcgatgatgcccgagtggcggagctt 703 |||||||||||||||||| ||||||||| ||||||||||| || | ||| |||||||| Sbjct: 618 ggaagttgcacggcacccgcctgaactgcatgtcgatgatcccggcgtgccggagctt 561
>ref|NM_197698.1| Oryza sativa (japonica cultivar-group) beta-expansin EXPB6 (OSJNBb0014I11.3), mRNA Length = 1240 Score = 168 bits (85), Expect = 2e-38 Identities = 133/149 (89%) Strand = Plus / Minus Query: 555 acgtcgccgtccatgtcctcgtactcgatcagcaccgccaggtacaccgcgttggagccc 614 ||||||||||| | |||||||||||||| ||||| || | |||||||| |||||||||| Sbjct: 689 acgtcgccgtcgaggtcctcgtactcgacgagcacggcgaagtacaccgggttggagccc 630 Query: 615 tccaccacgtggaagttgatcttgaggccggggaagttgcacggcaccctcctgaactgg 674 ||| | ||||||||||||||||||||||| ||| ||||||| || || | |||||||||| Sbjct: 629 tcctcgacgtggaagttgatcttgaggcccgggtagttgcaggggacgcgcctgaactgg 570 Query: 675 atgtcgatgatgcccgagtggcggagctt 703 ||||||||||||||||||||||||||||| Sbjct: 569 atgtcgatgatgcccgagtggcggagctt 541 Score = 153 bits (77), Expect = 9e-34 Identities = 140/161 (86%) Strand = Plus / Minus Query: 342 ctgaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattg 401 ||||||||||||| ||||||||||| || |||||| |||||| ||||||||||| ||| Sbjct: 920 ctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgttg 861 Query: 402 ttggccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccctggagg 461 ||||| || ||| ||||||||||||||||| |||||| | |||||| ||| |||||||| Sbjct: 860 ttggcgacgagcgtcttgccggagtcgctgcggatgcggagggagaagggcgcctggagg 801 Query: 462 cggtggttggagtccatccgccagatggatccccacgactc 502 |||||||||||||| | ||||||||||| ||||||||||| Sbjct: 800 cggtggttggagtcgaggcgccagatggagccccacgactc 760 Score = 46.1 bits (23), Expect = 0.16 Identities = 23/23 (100%) Strand = Plus / Minus Query: 72 cagtgggcgggagagcacatgca 94 ||||||||||||||||||||||| Sbjct: 1167 cagtgggcgggagagcacatgca 1145
>gb|AF261274.1| Oryza sativa beta-expansin (EXPB6) mRNA, complete cds Length = 1250 Score = 168 bits (85), Expect = 2e-38 Identities = 133/149 (89%) Strand = Plus / Minus Query: 555 acgtcgccgtccatgtcctcgtactcgatcagcaccgccaggtacaccgcgttggagccc 614 ||||||||||| | |||||||||||||| ||||| || | |||||||| |||||||||| Sbjct: 682 acgtcgccgtcgaggtcctcgtactcgacgagcacggcgaagtacaccgggttggagccc 623 Query: 615 tccaccacgtggaagttgatcttgaggccggggaagttgcacggcaccctcctgaactgg 674 ||| | ||||||||||||||||||||||| ||| ||||||| || || | |||||||||| Sbjct: 622 tcctcgacgtggaagttgatcttgaggcccgggtagttgcaggggacgcgcctgaactgg 563 Query: 675 atgtcgatgatgcccgagtggcggagctt 703 ||||||||||||||||||||||||||||| Sbjct: 562 atgtcgatgatgcccgagtggcggagctt 534 Score = 153 bits (77), Expect = 9e-34 Identities = 140/161 (86%) Strand = Plus / Minus Query: 342 ctgaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattg 401 ||||||||||||| ||||||||||| || |||||| |||||| ||||||||||| ||| Sbjct: 913 ctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgttg 854 Query: 402 ttggccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccctggagg 461 ||||| || ||| ||||||||||||||||| |||||| | |||||| ||| |||||||| Sbjct: 853 ttggcgacgagcgtcttgccggagtcgctgcggatgcggagggagaagggcgcctggagg 794 Query: 462 cggtggttggagtccatccgccagatggatccccacgactc 502 |||||||||||||| | ||||||||||| ||||||||||| Sbjct: 793 cggtggttggagtcgaggcgccagatggagccccacgactc 753 Score = 46.1 bits (23), Expect = 0.16 Identities = 23/23 (100%) Strand = Plus / Minus Query: 72 cagtgggcgggagagcacatgca 94 ||||||||||||||||||||||| Sbjct: 1160 cagtgggcgggagagcacatgca 1138
>dbj|AK105799.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-A09, full insert sequence Length = 1257 Score = 168 bits (85), Expect = 2e-38 Identities = 133/149 (89%) Strand = Plus / Minus Query: 555 acgtcgccgtccatgtcctcgtactcgatcagcaccgccaggtacaccgcgttggagccc 614 ||||||||||| | |||||||||||||| ||||| || | |||||||| |||||||||| Sbjct: 702 acgtcgccgtcgaggtcctcgtactcgacgagcacggcgaagtacaccgggttggagccc 643 Query: 615 tccaccacgtggaagttgatcttgaggccggggaagttgcacggcaccctcctgaactgg 674 ||| | ||||||||||||||||||||||| ||| ||||||| || || | |||||||||| Sbjct: 642 tcctcgacgtggaagttgatcttgaggcccgggtagttgcaggggacgcgcctgaactgg 583 Query: 675 atgtcgatgatgcccgagtggcggagctt 703 ||||||||||||||||||||||||||||| Sbjct: 582 atgtcgatgatgcccgagtggcggagctt 554 Score = 153 bits (77), Expect = 9e-34 Identities = 140/161 (86%) Strand = Plus / Minus Query: 342 ctgaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattg 401 ||||||||||||| ||||||||||| || |||||| |||||| ||||||||||| ||| Sbjct: 933 ctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgttg 874 Query: 402 ttggccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccctggagg 461 ||||| || ||| ||||||||||||||||| |||||| | |||||| ||| |||||||| Sbjct: 873 ttggcgacgagcgtcttgccggagtcgctgcggatgcggagggagaagggcgcctggagg 814 Query: 462 cggtggttggagtccatccgccagatggatccccacgactc 502 |||||||||||||| | ||||||||||| ||||||||||| Sbjct: 813 cggtggttggagtcgaggcgccagatggagccccacgactc 773 Score = 46.1 bits (23), Expect = 0.16 Identities = 23/23 (100%) Strand = Plus / Minus Query: 72 cagtgggcgggagagcacatgca 94 ||||||||||||||||||||||| Sbjct: 1180 cagtgggcgggagagcacatgca 1158
>dbj|AK104197.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-304-A02, full insert sequence Length = 1257 Score = 168 bits (85), Expect = 2e-38 Identities = 133/149 (89%) Strand = Plus / Minus Query: 555 acgtcgccgtccatgtcctcgtactcgatcagcaccgccaggtacaccgcgttggagccc 614 ||||||||||| | |||||||||||||| ||||| || | |||||||| |||||||||| Sbjct: 702 acgtcgccgtcgaggtcctcgtactcgacgagcacggcgaagtacaccgggttggagccc 643 Query: 615 tccaccacgtggaagttgatcttgaggccggggaagttgcacggcaccctcctgaactgg 674 ||| | ||||||||||||||||||||||| ||| ||||||| || || | |||||||||| Sbjct: 642 tcctcgacgtggaagttgatcttgaggcccgggtagttgcaggggacgcgcctgaactgg 583 Query: 675 atgtcgatgatgcccgagtggcggagctt 703 ||||||||||||||||||||||||||||| Sbjct: 582 atgtcgatgatgcccgagtggcggagctt 554 Score = 153 bits (77), Expect = 9e-34 Identities = 140/161 (86%) Strand = Plus / Minus Query: 342 ctgaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattg 401 ||||||||||||| ||||||||||| || |||||| |||||| ||||||||||| ||| Sbjct: 933 ctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgttg 874 Query: 402 ttggccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccctggagg 461 ||||| || ||| ||||||||||||||||| |||||| | |||||| ||| |||||||| Sbjct: 873 ttggcgacgagcgtcttgccggagtcgctgcggatgcggagggagaagggcgcctggagg 814 Query: 462 cggtggttggagtccatccgccagatggatccccacgactc 502 |||||||||||||| | ||||||||||| ||||||||||| Sbjct: 813 cggtggttggagtcgaggcgccagatggagccccacgactc 773 Score = 46.1 bits (23), Expect = 0.16 Identities = 23/23 (100%) Strand = Plus / Minus Query: 72 cagtgggcgggagagcacatgca 94 ||||||||||||||||||||||| Sbjct: 1180 cagtgggcgggagagcacatgca 1158
>dbj|AK101728.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033061F13, full insert sequence Length = 1263 Score = 168 bits (85), Expect = 2e-38 Identities = 133/149 (89%) Strand = Plus / Minus Query: 555 acgtcgccgtccatgtcctcgtactcgatcagcaccgccaggtacaccgcgttggagccc 614 ||||||||||| | |||||||||||||| ||||| || | |||||||| |||||||||| Sbjct: 708 acgtcgccgtcgaggtcctcgtactcgacgagcacggcgaagtacaccgggttggagccc 649 Query: 615 tccaccacgtggaagttgatcttgaggccggggaagttgcacggcaccctcctgaactgg 674 ||| | ||||||||||||||||||||||| ||| ||||||| || || | |||||||||| Sbjct: 648 tcctcgacgtggaagttgatcttgaggcccgggtagttgcaggggacgcgcctgaactgg 589 Query: 675 atgtcgatgatgcccgagtggcggagctt 703 ||||||||||||||||||||||||||||| Sbjct: 588 atgtcgatgatgcccgagtggcggagctt 560 Score = 153 bits (77), Expect = 9e-34 Identities = 140/161 (86%) Strand = Plus / Minus Query: 342 ctgaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattg 401 ||||||||||||| ||||||||||| || |||||| |||||| ||||||||||| ||| Sbjct: 939 ctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgttg 880 Query: 402 ttggccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccctggagg 461 ||||| || ||| ||||||||||||||||| |||||| | |||||| ||| |||||||| Sbjct: 879 ttggcgacgagcgtcttgccggagtcgctgcggatgcggagggagaagggcgcctggagg 820 Query: 462 cggtggttggagtccatccgccagatggatccccacgactc 502 |||||||||||||| | ||||||||||| ||||||||||| Sbjct: 819 cggtggttggagtcgaggcgccagatggagccccacgactc 779 Score = 46.1 bits (23), Expect = 0.16 Identities = 23/23 (100%) Strand = Plus / Minus Query: 72 cagtgggcgggagagcacatgca 94 ||||||||||||||||||||||| Sbjct: 1186 cagtgggcgggagagcacatgca 1164
>dbj|AK061498.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-D06, full insert sequence Length = 1259 Score = 168 bits (85), Expect = 2e-38 Identities = 133/149 (89%) Strand = Plus / Minus Query: 555 acgtcgccgtccatgtcctcgtactcgatcagcaccgccaggtacaccgcgttggagccc 614 ||||||||||| | |||||||||||||| ||||| || | |||||||| |||||||||| Sbjct: 702 acgtcgccgtcgaggtcctcgtactcgacgagcacggcgaagtacaccgggttggagccc 643 Query: 615 tccaccacgtggaagttgatcttgaggccggggaagttgcacggcaccctcctgaactgg 674 ||| | ||||||||||||||||||||||| ||| ||||||| || || | |||||||||| Sbjct: 642 tcctcgacgtggaagttgatcttgaggcccgggtagttgcaggggacgcgcctgaactgg 583 Query: 675 atgtcgatgatgcccgagtggcggagctt 703 ||||||||||||||||||||||||||||| Sbjct: 582 atgtcgatgatgcccgagtggcggagctt 554 Score = 153 bits (77), Expect = 9e-34 Identities = 140/161 (86%) Strand = Plus / Minus Query: 342 ctgaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattg 401 ||||||||||||| ||||||||||| || |||||| |||||| ||||||||||| ||| Sbjct: 933 ctgaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgttg 874 Query: 402 ttggccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccctggagg 461 ||||| || ||| ||||||||||||||||| |||||| | |||||| ||| |||||||| Sbjct: 873 ttggcgacgagcgtcttgccggagtcgctgcggatgcggagggagaagggcgcctggagg 814 Query: 462 cggtggttggagtccatccgccagatggatccccacgactc 502 |||||||||||||| | ||||||||||| ||||||||||| Sbjct: 813 cggtggttggagtcgaggcgccagatggagccccacgactc 773 Score = 46.1 bits (23), Expect = 0.16 Identities = 23/23 (100%) Strand = Plus / Minus Query: 72 cagtgggcgggagagcacatgca 94 ||||||||||||||||||||||| Sbjct: 1182 cagtgggcgggagagcacatgca 1160
>gb|AY543537.1| Triticum aestivum expansin EXPB2 mRNA, complete cds Length = 948 Score = 168 bits (85), Expect = 2e-38 Identities = 139/157 (88%) Strand = Plus / Minus Query: 346 actggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgttgg 405 |||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| Sbjct: 873 actggacgaaggagcggtagaaggtgttgggcctccagttggccgggatgaccttgttgg 814 Query: 406 ccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccctggaggcggt 465 | || ||| |||||||||| ||| || |||||| |||||||| ||| |||||||||||| Sbjct: 813 cgacgagcgtcttgccggactcgttgcggatgcggatggagaagggcgcctggaggcggt 754 Query: 466 ggttggagtccatccgccagatggatccccacgactc 502 |||||||||| | ||||||| ||| ||||||||||| Sbjct: 753 ggttggagtcgaggcgccagacggagccccacgactc 717 Score = 95.6 bits (48), Expect = 2e-16 Identities = 132/160 (82%) Strand = Plus / Minus Query: 542 gtccacctggatcacgtcgccgtccatgtcctcgtactcgatcagcaccgccaggtacac 601 ||||||||| | |||||||||||| |||||||||||| | ||||||||| | ||| || Sbjct: 668 gtccacctgcaccacgtcgccgtcgccgtcctcgtactccaccagcaccgcgaagtagac 609 Query: 602 cgcgttggagccctccaccacgtggaagttgatcttgaggccggggaagttgcacggcac 661 | ||| ||| |||| |||||||||| ||||||||| || ||||| | ||||||||| Sbjct: 608 ggggttcgagtactcctccacgtggaacccgatcttgagccccgggaactcgcacggcac 549 Query: 662 cctcctgaactggatgtcgatgatgcccgagtggcggagc 701 || |||||| ||||||||||||||| |||||||||||| Sbjct: 548 ccgtgtgaactcgatgtcgatgatgccggagtggcggagc 509
>ref|NM_197701.1| Oryza sativa (japonica cultivar-group) beta-expansin EXPB4 (OSJNBa0010C11.2), mRNA Length = 1340 Score = 145 bits (73), Expect = 2e-31 Identities = 136/157 (86%) Strand = Plus / Minus Query: 346 actggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgttgg 405 |||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| Sbjct: 960 actggacgaaggagcggtagaatgtgttgggcctccagttggccgggatgacgttgttgg 901 Query: 406 ccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccctggaggcggt 465 | || ||| |||||||||| ||| || |||||| |||||||| || ||||||| | || Sbjct: 900 cgacgagcgtcttgccggactcgttgcggatgcggatggagaagggggcctggagcctgt 841 Query: 466 ggttggagtccatccgccagatggatccccacgactc 502 |||||| ||||| || ||||||||| ||||||||||| Sbjct: 840 ggttggtgtccagcctccagatggagccccacgactc 804 Score = 101 bits (51), Expect = 3e-18 Identities = 141/171 (82%) Strand = Plus / Minus Query: 533 ctccttcatgtccacctggatcacgtcgccgtccatgtcctcgtactcgatcagcaccgc 592 |||| ||| ||||||||| | |||||||||||| |||||||||||| | ||||||||| Sbjct: 755 ctccatcaggtccacctgcaccacgtcgccgtcgccgtcctcgtactccaccagcaccgc 696 Query: 593 caggtacaccgcgttggagccctccaccacgtggaagttgatcttgaggccggggaagtt 652 | |||||| | ||| ||| |||| |||||||||| ||||||||| || ||||| | Sbjct: 695 gaagtacacagggttcgagtactcctccacgtggaacccgatcttgagccccgggaactc 636 Query: 653 gcacggcaccctcctgaactggatgtcgatgatgcccgagtggcggagctt 703 ||| |||||||| |||||| ||||||||||||||| |||||||| ||||| Sbjct: 635 gcatggcaccctggtgaactcgatgtcgatgatgccggagtggcgcagctt 585
>gb|BT017478.1| Zea mays clone EL01N0408G02.c mRNA sequence Length = 832 Score = 145 bits (73), Expect = 2e-31 Identities = 142/165 (86%) Strand = Plus / Minus Query: 346 actggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgttgg 405 |||||||||||||||||||| ||||||||| | |||||||||||||||||| ||||||| Sbjct: 297 actggacgaaggagcggtagaaggtgttggggcgccagttggccgggatgacgttgttgg 238 Query: 406 ccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccctggaggcggt 465 | || ||| |||||||||| ||| || |||||| |||||||| ||| ||| | ||||| Sbjct: 237 cgacgagcgtcttgccggactcgttgcggatgcggatggagaagggcggctgcatgcggt 178 Query: 466 ggttggagtccatccgccagatggatccccacgactcgcgcatcg 510 |||||| |||||| ||||||| ||| ||||| ||||||||||||| Sbjct: 177 ggttggtgtccatgcgccagacggagccccaggactcgcgcatcg 133 Score = 50.1 bits (25), Expect = 0.010 Identities = 55/65 (84%) Strand = Plus / Minus Query: 528 ttggcctccttcatgtccacctggatcacgtcgccgtccatgtcctcgtactcgatcagc 587 |||| |||| ||| ||||||||| | |||||||||||| |||||||||||| | |||| Sbjct: 97 ttggactccatcaggtccacctgcaccacgtcgccgtcgccgtcctcgtactccaccagc 38 Query: 588 accgc 592 ||||| Sbjct: 37 accgc 33
>gb|AF261272.1| Oryza sativa beta-expansin (EXPB4) mRNA, complete cds Length = 1249 Score = 145 bits (73), Expect = 2e-31 Identities = 136/157 (86%) Strand = Plus / Minus Query: 346 actggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgttgg 405 |||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| Sbjct: 916 actggacgaaggagcggtagaatgtgttgggcctccagttggccgggatgacgttgttgg 857 Query: 406 ccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccctggaggcggt 465 | || ||| |||||||||| ||| || |||||| |||||||| || ||||||| | || Sbjct: 856 cgacgagcgtcttgccggactcgttgcggatgcggatggagaagggggcctggagcctgt 797 Query: 466 ggttggagtccatccgccagatggatccccacgactc 502 |||||| ||||| || ||||||||| ||||||||||| Sbjct: 796 ggttggtgtccagcctccagatggagccccacgactc 760 Score = 101 bits (51), Expect = 3e-18 Identities = 141/171 (82%) Strand = Plus / Minus Query: 533 ctccttcatgtccacctggatcacgtcgccgtccatgtcctcgtactcgatcagcaccgc 592 |||| ||| ||||||||| | |||||||||||| |||||||||||| | ||||||||| Sbjct: 711 ctccatcaggtccacctgcaccacgtcgccgtcgccgtcctcgtactccaccagcaccgc 652 Query: 593 caggtacaccgcgttggagccctccaccacgtggaagttgatcttgaggccggggaagtt 652 | |||||| | ||| ||| |||| |||||||||| ||||||||| || ||||| | Sbjct: 651 gaagtacacagggttcgagtactcctccacgtggaacccgatcttgagccccgggaactc 592 Query: 653 gcacggcaccctcctgaactggatgtcgatgatgcccgagtggcggagctt 703 ||| |||||||| |||||| ||||||||||||||| |||||||| ||||| Sbjct: 591 gcatggcaccctggtgaactcgatgtcgatgatgccggagtggcgcagctt 541
>gb|AF332181.1|AF332181 Zea mays beta-expansin 8 (expB8) mRNA, complete cds Length = 1479 Score = 145 bits (73), Expect = 2e-31 Identities = 142/165 (86%) Strand = Plus / Minus Query: 346 actggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgttgg 405 |||||||||||||||||||| ||||||||| | |||||||||||||||||| ||||||| Sbjct: 933 actggacgaaggagcggtagaaggtgttggggcgccagttggccgggatgacgttgttgg 874 Query: 406 ccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccctggaggcggt 465 | || ||| |||||||||| ||| || |||||| |||||||| ||| ||| | ||||| Sbjct: 873 cgacgagcgtcttgccggactcgttgcggatgcggatggagaagggcggctgcatgcggt 814 Query: 466 ggttggagtccatccgccagatggatccccacgactcgcgcatcg 510 |||||| |||||| ||||||| ||| ||||| ||||||||||||| Sbjct: 813 ggttggtgtccatgcgccagacggagccccaggactcgcgcatcg 769 Score = 111 bits (56), Expect = 3e-21 Identities = 146/176 (82%) Strand = Plus / Minus Query: 528 ttggcctccttcatgtccacctggatcacgtcgccgtccatgtcctcgtactcgatcagc 587 |||| |||| ||| ||||||||| | |||||||||||| |||||||||||| | |||| Sbjct: 733 ttggactccatcaggtccacctgcaccacgtcgccgtcgccgtcctcgtactccaccagc 674 Query: 588 accgccaggtacaccgcgttggagccctccaccacgtggaagttgatcttgaggccgggg 647 ||||| | ||| || | ||| ||| |||| |||||||||| |||||| ||||| ||| Sbjct: 673 accgcgaagtagacggggttcgagtactcctccacgtggaacccgatcttcaggcccggg 614 Query: 648 aagttgcacggcaccctcctgaactggatgtcgatgatgcccgagtggcggagctt 703 || | |||||||||||| |||||| ||||||||||||||| |||||||||||||| Sbjct: 613 aactcgcacggcaccctggtgaactcgatgtcgatgatgccggagtggcggagctt 558
>gb|AF332175.1|AF332175 Zea mays beta-expansin 2 (expB2) mRNA, partial cds Length = 907 Score = 145 bits (73), Expect = 2e-31 Identities = 142/165 (86%) Strand = Plus / Minus Query: 346 actggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgttgg 405 |||||||||||||||||||| |||||||||||||||||||||||||||||| || ||| Sbjct: 520 actggacgaaggagcggtagaaggtgttgggcctccagttggccgggatgacgttcctgg 461 Query: 406 ccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccctggaggcggt 465 | || ||| |||||||||| ||| || |||||| |||||||| ||| ||| | ||||| Sbjct: 460 cgacgagcgtcttgccggactcgttgcggatgcggatggagaagggcggctgcatgcggt 401 Query: 466 ggttggagtccatccgccagatggatccccacgactcgcgcatcg 510 |||||| |||||| ||||||| ||| ||||| ||||||||||||| Sbjct: 400 ggttggtgtccatgcgccagacggagccccaggactcgcgcatcg 356 Score = 119 bits (60), Expect = 1e-23 Identities = 147/176 (83%) Strand = Plus / Minus Query: 528 ttggcctccttcatgtccacctggatcacgtcgccgtccatgtcctcgtactcgatcagc 587 |||| |||| ||| ||||||||| | |||||||||||| |||||||||||| | |||| Sbjct: 320 ttggactccatcaggtccacctgcaccacgtcgccgtcgccgtcctcgtactccaccagc 261 Query: 588 accgccaggtacaccgcgttggagccctccaccacgtggaagttgatcttgaggccgggg 647 ||||| | ||| || | | | ||| |||| |||||||||| |||||||||||| ||| Sbjct: 260 accgcgaagtagacggggctcgagtactcctccacgtggaacccgatcttgaggccaggg 201 Query: 648 aagttgcacggcaccctcctgaactggatgtcgatgatgcccgagtggcggagctt 703 || | |||||||||||| |||||| |||||||||||||||||||||||||||||| Sbjct: 200 aactcgcacggcaccctggtgaactcgatgtcgatgatgcccgagtggcggagctt 145
>dbj|AK105981.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-205-F12, full insert sequence Length = 1290 Score = 145 bits (73), Expect = 2e-31 Identities = 136/157 (86%) Strand = Plus / Minus Query: 346 actggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgttgg 405 |||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| Sbjct: 973 actggacgaaggagcggtagaatgtgttgggcctccagttggccgggatgacgttgttgg 914 Query: 406 ccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccctggaggcggt 465 | || ||| |||||||||| ||| || |||||| |||||||| || ||||||| | || Sbjct: 913 cgacgagcgtcttgccggactcgttgcggatgcggatggagaagggggcctggagcctgt 854 Query: 466 ggttggagtccatccgccagatggatccccacgactc 502 |||||| ||||| || ||||||||| ||||||||||| Sbjct: 853 ggttggtgtccagcctccagatggagccccacgactc 817 Score = 101 bits (51), Expect = 3e-18 Identities = 141/171 (82%) Strand = Plus / Minus Query: 533 ctccttcatgtccacctggatcacgtcgccgtccatgtcctcgtactcgatcagcaccgc 592 |||| ||| ||||||||| | |||||||||||| |||||||||||| | ||||||||| Sbjct: 768 ctccatcaggtccacctgcaccacgtcgccgtcgccgtcctcgtactccaccagcaccgc 709 Query: 593 caggtacaccgcgttggagccctccaccacgtggaagttgatcttgaggccggggaagtt 652 | |||||| | ||| ||| |||| |||||||||| ||||||||| || ||||| | Sbjct: 708 gaagtacacagggttcgagtactcctccacgtggaacccgatcttgagccccgggaactc 649 Query: 653 gcacggcaccctcctgaactggatgtcgatgatgcccgagtggcggagctt 703 ||| |||||||| |||||| ||||||||||||||| |||||||| ||||| Sbjct: 648 gcatggcaccctggtgaactcgatgtcgatgatgccggagtggcgcagctt 598
>dbj|AK103929.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-D11, full insert sequence Length = 1266 Score = 145 bits (73), Expect = 2e-31 Identities = 136/157 (86%) Strand = Plus / Minus Query: 346 actggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgttgg 405 |||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| Sbjct: 966 actggacgaaggagcggtagaatgtgttgggcctccagttggccgggatgacgttgttgg 907 Query: 406 ccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccctggaggcggt 465 | || ||| |||||||||| ||| || |||||| |||||||| || ||||||| | || Sbjct: 906 cgacgagcgtcttgccggactcgttgcggatgcggatggagaagggggcctggagcctgt 847 Query: 466 ggttggagtccatccgccagatggatccccacgactc 502 |||||| ||||| || ||||||||| ||||||||||| Sbjct: 846 ggttggtgtccagcctccagatggagccccacgactc 810 Score = 101 bits (51), Expect = 3e-18 Identities = 141/171 (82%) Strand = Plus / Minus Query: 533 ctccttcatgtccacctggatcacgtcgccgtccatgtcctcgtactcgatcagcaccgc 592 |||| ||| ||||||||| | |||||||||||| |||||||||||| | ||||||||| Sbjct: 761 ctccatcaggtccacctgcaccacgtcgccgtcgccgtcctcgtactccaccagcaccgc 702 Query: 593 caggtacaccgcgttggagccctccaccacgtggaagttgatcttgaggccggggaagtt 652 | |||||| | ||| ||| |||| |||||||||| ||||||||| || ||||| | Sbjct: 701 gaagtacacagggttcgagtactcctccacgtggaacccgatcttgagccccgggaactc 642 Query: 653 gcacggcaccctcctgaactggatgtcgatgatgcccgagtggcggagctt 703 ||| |||||||| |||||| ||||||||||||||| |||||||| ||||| Sbjct: 641 gcatggcaccctggtgaactcgatgtcgatgatgccggagtggcgcagctt 591
>dbj|AK101806.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033066K12, full insert sequence Length = 1883 Score = 145 bits (73), Expect = 2e-31 Identities = 136/157 (86%) Strand = Plus / Minus Query: 346 actggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgttgg 405 |||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| Sbjct: 1550 actggacgaaggagcggtagaatgtgttgggcctccagttggccgggatgacgttgttgg 1491 Query: 406 ccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccctggaggcggt 465 | || ||| |||||||||| ||| || |||||| |||||||| || ||||||| | || Sbjct: 1490 cgacgagcgtcttgccggactcgttgcggatgcggatggagaagggggcctggagcctgt 1431 Query: 466 ggttggagtccatccgccagatggatccccacgactc 502 |||||| ||||| || ||||||||| ||||||||||| Sbjct: 1430 ggttggtgtccagcctccagatggagccccacgactc 1394 Score = 63.9 bits (32), Expect = 7e-07 Identities = 107/132 (81%) Strand = Plus / Minus Query: 533 ctccttcatgtccacctggatcacgtcgccgtccatgtcctcgtactcgatcagcaccgc 592 |||| ||| ||||||||| | |||||||||||| |||||||||||| | ||||||||| Sbjct: 1345 ctccatcaggtccacctgcaccacgtcgccgtcgccgtcctcgtactccaccagcaccgc 1286 Query: 593 caggtacaccgcgttggagccctccaccacgtggaagttgatcttgaggccggggaagtt 652 | |||||| | ||| ||| |||| |||||||||| ||||||||| || ||||| | Sbjct: 1285 gaagtacacagggttcgagtactcctccacgtggaacccgatcttgagccccgggaactc 1226 Query: 653 gcacggcaccct 664 ||| |||||||| Sbjct: 1225 gcatggcaccct 1214 Score = 50.1 bits (25), Expect = 0.010 Identities = 34/37 (91%) Strand = Plus / Minus Query: 667 tgaactggatgtcgatgatgcccgagtggcggagctt 703 |||||| ||||||||||||||| |||||||| ||||| Sbjct: 633 tgaactcgatgtcgatgatgccggagtggcgcagctt 597
>dbj|AK101357.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033035B15, full insert sequence Length = 1475 Score = 145 bits (73), Expect = 2e-31 Identities = 136/157 (86%) Strand = Plus / Minus Query: 346 actggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgttgg 405 |||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| Sbjct: 1154 actggacgaaggagcggtagaatgtgttgggcctccagttggccgggatgacgttgttgg 1095 Query: 406 ccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccctggaggcggt 465 | || ||| |||||||||| ||| || |||||| |||||||| || ||||||| | || Sbjct: 1094 cgacgagcgtcttgccggactcgttgcggatgcggatggagaagggggcctggagcctgt 1035 Query: 466 ggttggagtccatccgccagatggatccccacgactc 502 |||||| ||||| || ||||||||| ||||||||||| Sbjct: 1034 ggttggtgtccagcctccagatggagccccacgactc 998 Score = 101 bits (51), Expect = 3e-18 Identities = 141/171 (82%) Strand = Plus / Minus Query: 533 ctccttcatgtccacctggatcacgtcgccgtccatgtcctcgtactcgatcagcaccgc 592 |||| ||| ||||||||| | |||||||||||| |||||||||||| | ||||||||| Sbjct: 949 ctccatcaggtccacctgcaccacgtcgccgtcgccgtcctcgtactccaccagcaccgc 890 Query: 593 caggtacaccgcgttggagccctccaccacgtggaagttgatcttgaggccggggaagtt 652 | |||||| | ||| ||| |||| |||||||||| ||||||||| || ||||| | Sbjct: 889 gaagtacacagggttcgagtactcctccacgtggaacccgatcttgagccccgggaactc 830 Query: 653 gcacggcaccctcctgaactggatgtcgatgatgcccgagtggcggagctt 703 ||| |||||||| |||||| ||||||||||||||| |||||||| ||||| Sbjct: 829 gcatggcaccctggtgaactcgatgtcgatgatgccggagtggcgcagctt 779
>dbj|AK060096.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-307-G02, full insert sequence Length = 1293 Score = 145 bits (73), Expect = 2e-31 Identities = 136/157 (86%) Strand = Plus / Minus Query: 346 actggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgttgg 405 |||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| Sbjct: 972 actggacgaaggagcggtagaatgtgttgggcctccagttggccgggatgacgttgttgg 913 Query: 406 ccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccctggaggcggt 465 | || ||| |||||||||| ||| || |||||| |||||||| || ||||||| | || Sbjct: 912 cgacgagcgtcttgccggactcgttgcggatgcggatggagaagggggcctggagcctgt 853 Query: 466 ggttggagtccatccgccagatggatccccacgactc 502 |||||| ||||| || ||||||||| ||||||||||| Sbjct: 852 ggttggtgtccagcctccagatggagccccacgactc 816 Score = 93.7 bits (47), Expect = 7e-16 Identities = 140/171 (81%) Strand = Plus / Minus Query: 533 ctccttcatgtccacctggatcacgtcgccgtccatgtcctcgtactcgatcagcaccgc 592 |||| ||| ||||| ||| | |||||||||||| |||||||||||| | ||||||||| Sbjct: 767 ctccatcaggtccatctgcaccacgtcgccgtcgccgtcctcgtactccaccagcaccgc 708 Query: 593 caggtacaccgcgttggagccctccaccacgtggaagttgatcttgaggccggggaagtt 652 | |||||| | ||| ||| |||| |||||||||| ||||||||| || ||||| | Sbjct: 707 gaagtacacagggttcgagtactcctccacgtggaacccgatcttgagccccgggaactc 648 Query: 653 gcacggcaccctcctgaactggatgtcgatgatgcccgagtggcggagctt 703 ||| |||||||| |||||| ||||||||||||||| |||||||| ||||| Sbjct: 647 gcatggcaccctggtgaactcgatgtcgatgatgccggagtggcgcagctt 597
>gb|BT019137.1| Zea mays clone Contig781.F mRNA sequence Length = 1044 Score = 137 bits (69), Expect = 6e-29 Identities = 141/165 (85%) Strand = Plus / Minus Query: 346 actggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgttgg 405 |||||||||||||||||||| ||||||||| | |||||||||||||||||| ||||||| Sbjct: 558 actggacgaaggagcggtagaaggtgttggggcgccagttggccgggatgacgttgttgg 499 Query: 406 ccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccctggaggcggt 465 | || ||| ||||| |||| ||| || |||||| |||||||| ||| ||| | ||||| Sbjct: 498 cgacgagcgtcttggcggactcgttgcggatgcggatggagaagggcggctgcatgcggt 439 Query: 466 ggttggagtccatccgccagatggatccccacgactcgcgcatcg 510 |||||| |||||| ||||||| ||| ||||| ||||||||||||| Sbjct: 438 ggttggtgtccatgcgccagacggagccccaggactcgcgcatcg 394 Score = 119 bits (60), Expect = 1e-23 Identities = 147/176 (83%) Strand = Plus / Minus Query: 528 ttggcctccttcatgtccacctggatcacgtcgccgtccatgtcctcgtactcgatcagc 587 |||| |||| ||| ||||||||| | |||||||||||| |||||||||||| | |||| Sbjct: 358 ttggactccatcaggtccacctgcaccacgtcgccgtcgccgtcctcgtactccaccagc 299 Query: 588 accgccaggtacaccgcgttggagccctccaccacgtggaagttgatcttgaggccgggg 647 ||||| | ||| || | ||| ||| |||| |||||||||| |||||| ||||| ||| Sbjct: 298 accgcgaagtagacggggttcgagtactcctccacgtggaacccgatcttcaggcccggg 239 Query: 648 aagttgcacggcaccctcctgaactggatgtcgatgatgcccgagtggcggagctt 703 || | |||||||||||| |||||| |||||||||||||||||||||||||||||| Sbjct: 238 aactcgcacggcaccctggtgaactcgatgtcgatgatgcccgagtggcggagctt 183
>gb|AY589581.1| Triticum aestivum beta-expansin TaEXPB4 mRNA, complete cds Length = 898 Score = 133 bits (67), Expect = 9e-28 Identities = 154/183 (84%) Strand = Plus / Minus Query: 335 caatcaactgaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggat 394 |||||||| |||||||||| ||| ||||||| |||| ||||||||||||||||||||| Sbjct: 855 caatcaacggaactggacgttggaacggtagttcgtgtcgggcctccagttggccgggat 796 Query: 395 gacattgttggccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggccc 454 ||| | |||||||||||| |||||||||| |||||| |||||| | ||||| || || Sbjct: 795 gacttgtttggccaccagcgtcttgccggattcgctgcggatgcggagagagaaggggcc 736 Query: 455 ctggaggcggtggttggagtccatccgccagatggatccccacgactcgcgcatcgccat 514 ||| || ||| | ||||||||||||||||||||| |||||||| | |||||||||| | Sbjct: 735 ctgcagccggcgcctggagtccatccgccagatggcgccccacgagtggcgcatcgccgt 676 Query: 515 cca 517 ||| Sbjct: 675 cca 673 Score = 50.1 bits (25), Expect = 0.010 Identities = 46/53 (86%) Strand = Plus / Minus Query: 651 ttgcacggcaccctcctgaactggatgtcgatgatgcccgagtggcggagctt 703 ||||| |||||||| ||||||||||||||| ||||| | |||||||||||| Sbjct: 527 ttgcatggcaccctttggaactggatgtcgataatgccggcgtggcggagctt 475
>gb|AY543542.1| Triticum aestivum expansin EXPB8 mRNA, complete cds Length = 1078 Score = 131 bits (66), Expect = 3e-27 Identities = 99/110 (90%) Strand = Plus / Minus Query: 387 gccgggatgacattgttggccaccagcttcttgccggagtcgctggtgatgcgcatggag 446 ||||||||||||||||||||||| ||| |||| ||||||||||||||||| ||||||||| Sbjct: 794 gccgggatgacattgttggccacaagcgtcttcccggagtcgctggtgatacgcatggag 735 Query: 447 aaaggcccctggaggcggtggttggagtccatccgccagatggatcccca 496 || |||||||| || || || ||| |||||||||||||||||||||||| Sbjct: 734 aagggcccctgcagcgggcggctggtgtccatccgccagatggatcccca 685 Score = 85.7 bits (43), Expect = 2e-13 Identities = 73/83 (87%) Strand = Plus / Minus Query: 621 acgtggaagttgatcttgaggccggggaagttgcacggcaccctcctgaactggatgtcg 680 ||||||||| ||| ||| | ||| ||||||||||| |||||||||||||||| |||||| Sbjct: 548 acgtggaaggtgaccttcatgcccgggaagttgcagcgcaccctcctgaactgcatgtcg 489 Query: 681 atgatgcccgagtggcggagctt 703 |||||||| | |||||||||||| Sbjct: 488 atgatgccggcgtggcggagctt 466
>gb|AY111405.1| Zea mays CL5426_1 mRNA sequence Length = 528 Score = 115 bits (58), Expect = 2e-22 Identities = 116/137 (84%) Strand = Plus / Plus Query: 473 gtccatccgccagatggatccccacgactcgcgcatcgccatccacgaccccgagttggc 532 ||||| |||||||||||| ||||||||||||||| | |||||||||| |||||||| Sbjct: 392 gtccagccgccagatggannnnnacgactcgcgcatcggcgtccacgacccggagttggc 451 Query: 533 ctccttcatgtccacctggatcacgtcgccgtccatgtcctcgtactcgatcagcaccgc 592 |||| | | ||||||||| | |||||||||||| ||||||| |||||| |||||||| Sbjct: 452 ctccatgaggtccacctgcaccacgtcgccgtcgccgtcctcgaactcgacgagcaccgc 511 Query: 593 caggtacaccgcgttgg 609 ||||||||||| ||||| Sbjct: 512 caggtacaccgggttgg 528 Score = 91.7 bits (46), Expect = 3e-15 Identities = 82/94 (87%) Strand = Plus / Plus Query: 346 actggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgttgg 405 |||||| || ||| ||||||| ||||||||| |||||||||||||||||| | ||||| Sbjct: 265 actggatgatggaacggtagtaggtgttgggaacccagttggccgggatgacctggttgg 324 Query: 406 ccaccagcttcttgccggagtcgctggtgatgcg 439 |||||||| |||||||||| ||| |||||||||| Sbjct: 325 ccaccagcgtcttgccggactcgttggtgatgcg 358
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 113 bits (57), Expect = 8e-22 Identities = 126/149 (84%) Strand = Plus / Plus Query: 555 acgtcgccgtccatgtcctcgtactcgatcagcaccgccaggtacaccgcgttggagccc 614 ||||||||||| | ||||||||||| || ||||| || | |||||||| |||||| ||| Sbjct: 6211001 acgtcgccgtcgaggtcctcgtacttgacgagcacggcgaagtacaccgggttggacccc 6211060 Query: 615 tccaccacgtggaagttgatcttgaggccggggaagttgcacggcaccctcctgaactgg 674 ||| | ||||||||| |||||||| || ||| ||||||||||||| | ||| || ||| Sbjct: 6211061 tcctaaatgtggaagtttatcttgagccccgggtagttgcacggcacacgcctaaagtgg 6211120 Query: 675 atgtcgatgatgcccgagtggcggagctt 703 |||||||||||||| |||||||||||||| Sbjct: 6211121 atgtcgatgatgccggagtggcggagctt 6211149 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 2564494 gcatgcatgcatgcatgcatgcatg 2564518 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 2564515 gcatgcatgcatgcatgcatgcatg 2564491 Score = 40.1 bits (20), Expect = 9.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 270 gcgcatgcatgcatgcatgc 289 |||||||||||||||||||| Sbjct: 24076513 gcgcatgcatgcatgcatgc 24076532 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 2564518 catgcatgcatgcatgcatgcatg 2564495 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 2564491 catgcatgcatgcatgcatgcatg 2564514
>gb|AY589582.1| Triticum aestivum beta-expansin TaEXPB5 mRNA, complete cds Length = 939 Score = 113 bits (57), Expect = 8e-22 Identities = 99/113 (87%) Strand = Plus / Minus Query: 387 gccgggatgacattgttggccaccagcttcttgccggagtcgctggtgatgcgcatggag 446 ||||||||| ||||||||||||||||| |||| |||| |||||||||||||| |||| | Sbjct: 811 gccgggatggcattgttggccaccagcgtctttccggtatcgctggtgatgcggatggcg 752 Query: 447 aaaggcccctggaggcggtggttggagtccatccgccagatggatccccacga 499 || |||||||| || || |||||| |||||||||||||||||| |||||||| Sbjct: 751 aatggcccctgcagcgggcggttggtgtccatccgccagatggagccccacga 699 Score = 81.8 bits (41), Expect = 3e-12 Identities = 53/57 (92%) Strand = Plus / Minus Query: 645 gggaagttgcacggcaccctcctgaactggatgtcgatgatgcccgagtggcggagc 701 ||||||||||| ||||||||||||||||| |||||||||||||| | |||||||||| Sbjct: 541 gggaagttgcagggcaccctcctgaactgcatgtcgatgatgccggcgtggcggagc 485
>dbj|AP003875.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ1119_C05 Length = 126112 Score = 113 bits (57), Expect = 8e-22 Identities = 126/149 (84%) Strand = Plus / Plus Query: 555 acgtcgccgtccatgtcctcgtactcgatcagcaccgccaggtacaccgcgttggagccc 614 ||||||||||| | ||||||||||| || ||||| || | |||||||| |||||| ||| Sbjct: 74394 acgtcgccgtcgaggtcctcgtacttgacgagcacggcgaagtacaccgggttggacccc 74453 Query: 615 tccaccacgtggaagttgatcttgaggccggggaagttgcacggcaccctcctgaactgg 674 ||| | ||||||||| |||||||| || ||| ||||||||||||| | ||| || ||| Sbjct: 74454 tcctaaatgtggaagtttatcttgagccccgggtagttgcacggcacacgcctaaagtgg 74513 Query: 675 atgtcgatgatgcccgagtggcggagctt 703 |||||||||||||| |||||||||||||| Sbjct: 74514 atgtcgatgatgccggagtggcggagctt 74542
>gb|AY543544.1| Triticum aestivum expansin EXPB10 mRNA, complete cds Length = 1132 Score = 113 bits (57), Expect = 8e-22 Identities = 99/113 (87%) Strand = Plus / Minus Query: 387 gccgggatgacattgttggccaccagcttcttgccggagtcgctggtgatgcgcatggag 446 ||||||||| ||||||||||||||||| |||| |||| |||||||||||||| |||| | Sbjct: 786 gccgggatggcattgttggccaccagcgtctttccggtatcgctggtgatgcggatggcg 727 Query: 447 aaaggcccctggaggcggtggttggagtccatccgccagatggatccccacga 499 || |||||||| || || |||||| |||||||||||||||||| |||||||| Sbjct: 726 aatggcccctgcagcgggcggttggtgtccatccgccagatggagccccacga 674 Score = 81.8 bits (41), Expect = 3e-12 Identities = 53/57 (92%) Strand = Plus / Minus Query: 645 gggaagttgcacggcaccctcctgaactggatgtcgatgatgcccgagtggcggagc 701 ||||||||||| ||||||||||||||||| |||||||||||||| | |||||||||| Sbjct: 516 gggaagttgcagggcaccctcctgaactgcatgtcgatgatgccggcgtggcggagc 460
>dbj|AK064012.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-124-H01, full insert sequence Length = 1794 Score = 105 bits (53), Expect = 2e-19 Identities = 110/129 (85%) Strand = Plus / Minus Query: 374 gggcctccagttggccgggatgacattgttggccaccagcttcttgccggagtcgctggt 433 ||||||||||| |||||||||||| |||||||| || ||| |||||||||| ||| || Sbjct: 944 gggcctccagtaggccgggatgacgttgttggcgacgagcgtcttgccggactcgttgcg 885 Query: 434 gatgcgcatggagaaaggcccctggaggcggtggttggagtccatccgccagatggatcc 493 |||||| |||||||| || ||||||| | |||||||| ||||| || ||||||||| || Sbjct: 884 gatgcggatggagaagggggcctggagcctgtggttggtgtccagcctccagatggagcc 825 Query: 494 ccacgactc 502 ||||||||| Sbjct: 824 ccacgactc 816 Score = 101 bits (51), Expect = 3e-18 Identities = 141/171 (82%) Strand = Plus / Minus Query: 533 ctccttcatgtccacctggatcacgtcgccgtccatgtcctcgtactcgatcagcaccgc 592 |||| ||| ||||||||| | |||||||||||| |||||||||||| | ||||||||| Sbjct: 767 ctccatcaggtccacctgcaccacgtcgccgtcgccgtcctcgtactccaccagcaccgc 708 Query: 593 caggtacaccgcgttggagccctccaccacgtggaagttgatcttgaggccggggaagtt 652 | |||||| | ||| ||| |||| |||||||||| ||||||||| || ||||| | Sbjct: 707 gaagtacacagggttcgagtactcctccacgtggaacccgatcttgagccccgggaactc 648 Query: 653 gcacggcaccctcctgaactggatgtcgatgatgcccgagtggcggagctt 703 ||| |||||||| |||||| ||||||||||||||| |||||||| ||||| Sbjct: 647 gcatggcaccctggtgaactcgatgtcgatgatgccggagtggcgcagctt 597
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 97.6 bits (49), Expect = 5e-17 Identities = 136/165 (82%) Strand = Plus / Plus Query: 346 actggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgttgg 405 ||||||||||||| |||||| |||||||||| |||||||| |||||||| | | | Sbjct: 157668 actggacgaaggaacggtagaaggtgttgggcgtccagttgagggggatgacgtcgggtg 157727 Query: 406 ccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccctggaggcggt 465 |||||| | |||||||||||||||| |||||| |||||||| ||| || | ||||||| Sbjct: 157728 ccaccaacgtcttgccggagtcgctccggatgcggatggagaatggcgcccgcaggcggt 157787 Query: 466 ggttggagtccatccgccagatggatccccacgactcgcgcatcg 510 |||||||||||| || ||| | || ||||||||||| ||||||| Sbjct: 157788 ggttggagtccagcctccacaccgacccccacgactcccgcatcg 157832 Score = 85.7 bits (43), Expect = 2e-13 Identities = 130/159 (81%) Strand = Plus / Minus Query: 344 gaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgtt 403 ||||||||||| ||||| |||| ||||||||||| ||||| ||| |||||||| | | Sbjct: 169424 gaactggacgatggagctgtagacggtgttgggctgccagtcggcggggatgacctgatc 169365 Query: 404 ggccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccctggaggcg 463 ||| | || |||||||||| ||| |||||||||| | |||||| |||||||| || | Sbjct: 169364 ggcgatgagggtcttgccggactcgttggtgatgcggagggagaagggcccctgcagcgg 169305 Query: 464 gtggttggagtccatccgccagatggatccccacgactc 502 |||||||| ||||| || ||| || |||||||||||||| Sbjct: 169304 gtggttggtgtccagcctccatatcgatccccacgactc 169266 Score = 65.9 bits (33), Expect = 2e-07 Identities = 39/41 (95%) Strand = Plus / Minus Query: 662 cctcctgaactggatgtcgatgatgcccgagtggcggagct 702 ||||||||||||||||||||||||||| | ||||||||||| Sbjct: 168752 cctcctgaactggatgtcgatgatgccggcgtggcggagct 168712 Score = 61.9 bits (31), Expect = 3e-06 Identities = 136/171 (79%) Strand = Plus / Plus Query: 530 ggcctccttcatgtccacctggatcacgtcgccgtccatgtcctcgtactcgatcagcac 589 ||||||||| | ||||||||| |||||| ||||| || ||||||||| | |||||| Sbjct: 157858 ggcctccttgaggtccacctgcgccacgtctccgtcgccgttctcgtactccaccagcac 157917 Query: 590 cgccaggtacaccgcgttggagccctccaccacgtggaagttgatcttgaggccggggaa 649 |||||||||||| | | |||| || ||| |||||||||| | ||||||||| ||||| Sbjct: 157918 cgccaggtacacggggctggacccttcctccacgtggaatcccaccttgaggcccgggaa 157977 Query: 650 gttgcacggcaccctcctgaactggatgtcgatgatgcccgagtggcggag 700 | ||||||||| | | |||||| | ||||||||| |||| | ||||||| Sbjct: 157978 ctcgcacggcacgcgcgcgaactgcacgtcgatgatccccgcgcggcggag 158028 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 1068052 gcatgcatgcatgcatgcatgcatg 1068028 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 1068027 gcatgcatgcatgcatgcatgcatg 1068051 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 1068048 gcatgcatgcatgcatgcatgcatg 1068024 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 1068023 gcatgcatgcatgcatgcatgcatg 1068047 Score = 40.1 bits (20), Expect = 9.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 275 tgcatgcatgcatgcgtgca 294 |||||||||||||||||||| Sbjct: 1663747 tgcatgcatgcatgcgtgca 1663728
>gb|AC125411.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNAb0079B22, from chromosome 3, complete sequence Length = 156933 Score = 97.6 bits (49), Expect = 5e-17 Identities = 136/165 (82%) Strand = Plus / Plus Query: 346 actggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgttgg 405 ||||||||||||| |||||| |||||||||| |||||||| |||||||| | | | Sbjct: 91668 actggacgaaggaacggtagaaggtgttgggcgtccagttgagggggatgacgtcgggtg 91727 Query: 406 ccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccctggaggcggt 465 |||||| | |||||||||||||||| |||||| |||||||| ||| || | ||||||| Sbjct: 91728 ccaccaacgtcttgccggagtcgctccggatgcggatggagaatggcgcccgcaggcggt 91787 Query: 466 ggttggagtccatccgccagatggatccccacgactcgcgcatcg 510 |||||||||||| || ||| | || ||||||||||| ||||||| Sbjct: 91788 ggttggagtccagcctccacaccgacccccacgactcccgcatcg 91832 Score = 85.7 bits (43), Expect = 2e-13 Identities = 130/159 (81%) Strand = Plus / Minus Query: 344 gaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgtt 403 ||||||||||| ||||| |||| ||||||||||| ||||| ||| |||||||| | | Sbjct: 103424 gaactggacgatggagctgtagacggtgttgggctgccagtcggcggggatgacctgatc 103365 Query: 404 ggccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccctggaggcg 463 ||| | || |||||||||| ||| |||||||||| | |||||| |||||||| || | Sbjct: 103364 ggcgatgagggtcttgccggactcgttggtgatgcggagggagaagggcccctgcagcgg 103305 Query: 464 gtggttggagtccatccgccagatggatccccacgactc 502 |||||||| ||||| || ||| || |||||||||||||| Sbjct: 103304 gtggttggtgtccagcctccatatcgatccccacgactc 103266 Score = 65.9 bits (33), Expect = 2e-07 Identities = 39/41 (95%) Strand = Plus / Minus Query: 662 cctcctgaactggatgtcgatgatgcccgagtggcggagct 702 ||||||||||||||||||||||||||| | ||||||||||| Sbjct: 102752 cctcctgaactggatgtcgatgatgccggcgtggcggagct 102712 Score = 61.9 bits (31), Expect = 3e-06 Identities = 136/171 (79%) Strand = Plus / Plus Query: 530 ggcctccttcatgtccacctggatcacgtcgccgtccatgtcctcgtactcgatcagcac 589 ||||||||| | ||||||||| |||||| ||||| || ||||||||| | |||||| Sbjct: 91858 ggcctccttgaggtccacctgcgccacgtctccgtcgccgttctcgtactccaccagcac 91917 Query: 590 cgccaggtacaccgcgttggagccctccaccacgtggaagttgatcttgaggccggggaa 649 |||||||||||| | | |||| || ||| |||||||||| | ||||||||| ||||| Sbjct: 91918 cgccaggtacacggggctggacccttcctccacgtggaatcccaccttgaggcccgggaa 91977 Query: 650 gttgcacggcaccctcctgaactggatgtcgatgatgcccgagtggcggag 700 | ||||||||| | | |||||| | ||||||||| |||| | ||||||| Sbjct: 91978 ctcgcacggcacgcgcgcgaactgcacgtcgatgatccccgcgcggcggag 92028
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 97.6 bits (49), Expect = 5e-17 Identities = 136/165 (82%) Strand = Plus / Plus Query: 346 actggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgttgg 405 ||||||||||||| |||||| |||||||||| |||||||| |||||||| | | | Sbjct: 157668 actggacgaaggaacggtagaaggtgttgggcgtccagttgagggggatgacgtcgggtg 157727 Query: 406 ccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccctggaggcggt 465 |||||| | |||||||||||||||| |||||| |||||||| ||| || | ||||||| Sbjct: 157728 ccaccaacgtcttgccggagtcgctccggatgcggatggagaatggcgcccgcaggcggt 157787 Query: 466 ggttggagtccatccgccagatggatccccacgactcgcgcatcg 510 |||||||||||| || ||| | || ||||||||||| ||||||| Sbjct: 157788 ggttggagtccagcctccacaccgacccccacgactcccgcatcg 157832 Score = 85.7 bits (43), Expect = 2e-13 Identities = 130/159 (81%) Strand = Plus / Minus Query: 344 gaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgtt 403 ||||||||||| ||||| |||| ||||||||||| ||||| ||| |||||||| | | Sbjct: 169424 gaactggacgatggagctgtagacggtgttgggctgccagtcggcggggatgacctgatc 169365 Query: 404 ggccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccctggaggcg 463 ||| | || |||||||||| ||| |||||||||| | |||||| |||||||| || | Sbjct: 169364 ggcgatgagggtcttgccggactcgttggtgatgcggagggagaagggcccctgcagcgg 169305 Query: 464 gtggttggagtccatccgccagatggatccccacgactc 502 |||||||| ||||| || ||| || |||||||||||||| Sbjct: 169304 gtggttggtgtccagcctccatatcgatccccacgactc 169266 Score = 65.9 bits (33), Expect = 2e-07 Identities = 39/41 (95%) Strand = Plus / Minus Query: 662 cctcctgaactggatgtcgatgatgcccgagtggcggagct 702 ||||||||||||||||||||||||||| | ||||||||||| Sbjct: 168752 cctcctgaactggatgtcgatgatgccggcgtggcggagct 168712 Score = 61.9 bits (31), Expect = 3e-06 Identities = 136/171 (79%) Strand = Plus / Plus Query: 530 ggcctccttcatgtccacctggatcacgtcgccgtccatgtcctcgtactcgatcagcac 589 ||||||||| | ||||||||| |||||| ||||| || ||||||||| | |||||| Sbjct: 157858 ggcctccttgaggtccacctgcgccacgtctccgtcgccgttctcgtactccaccagcac 157917 Query: 590 cgccaggtacaccgcgttggagccctccaccacgtggaagttgatcttgaggccggggaa 649 |||||||||||| | | |||| || ||| |||||||||| | ||||||||| ||||| Sbjct: 157918 cgccaggtacacggggctggacccttcctccacgtggaatcccaccttgaggcccgggaa 157977 Query: 650 gttgcacggcaccctcctgaactggatgtcgatgatgcccgagtggcggag 700 | ||||||||| | | |||||| | ||||||||| |||| | ||||||| Sbjct: 157978 ctcgcacggcacgcgcgcgaactgcacgtcgatgatccccgcgcggcggag 158028 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 1068050 gcatgcatgcatgcatgcatgcatg 1068026 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 1068025 gcatgcatgcatgcatgcatgcatg 1068049 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 1068046 gcatgcatgcatgcatgcatgcatg 1068022 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 1068021 gcatgcatgcatgcatgcatgcatg 1068045 Score = 40.1 bits (20), Expect = 9.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 275 tgcatgcatgcatgcgtgca 294 |||||||||||||||||||| Sbjct: 1663745 tgcatgcatgcatgcgtgca 1663726
>gb|AF485811.1| Oryza sativa BAC OSJNa0049F05, complete sequence Length = 162241 Score = 97.6 bits (49), Expect = 5e-17 Identities = 136/165 (82%) Strand = Plus / Minus Query: 346 actggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgttgg 405 ||||||||||||| |||||| |||||||||| |||||||| |||||||| | | | Sbjct: 104998 actggacgaaggaacggtagaaggtgttgggcgtccagttgagggggatgacgtcgggtg 104939 Query: 406 ccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccctggaggcggt 465 |||||| | |||||||||||||||| |||||| |||||||| ||| || | ||||||| Sbjct: 104938 ccaccaacgtcttgccggagtcgctccggatgcggatggagaatggcgcccgcaggcggt 104879 Query: 466 ggttggagtccatccgccagatggatccccacgactcgcgcatcg 510 |||||||||||| || ||| | || ||||||||||| ||||||| Sbjct: 104878 ggttggagtccagcctccacaccgacccccacgactcccgcatcg 104834 Score = 85.7 bits (43), Expect = 2e-13 Identities = 130/159 (81%) Strand = Plus / Plus Query: 344 gaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgtt 403 ||||||||||| ||||| |||| ||||||||||| ||||| ||| |||||||| | | Sbjct: 93242 gaactggacgatggagctgtagacggtgttgggctgccagtcggcggggatgacctgatc 93301 Query: 404 ggccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccctggaggcg 463 ||| | || |||||||||| ||| |||||||||| | |||||| |||||||| || | Sbjct: 93302 ggcgatgagggtcttgccggactcgttggtgatgcggagggagaagggcccctgcagcgg 93361 Query: 464 gtggttggagtccatccgccagatggatccccacgactc 502 |||||||| ||||| || ||| || |||||||||||||| Sbjct: 93362 gtggttggtgtccagcctccatatcgatccccacgactc 93400 Score = 65.9 bits (33), Expect = 2e-07 Identities = 39/41 (95%) Strand = Plus / Plus Query: 662 cctcctgaactggatgtcgatgatgcccgagtggcggagct 702 ||||||||||||||||||||||||||| | ||||||||||| Sbjct: 93914 cctcctgaactggatgtcgatgatgccggcgtggcggagct 93954 Score = 61.9 bits (31), Expect = 3e-06 Identities = 136/171 (79%) Strand = Plus / Minus Query: 530 ggcctccttcatgtccacctggatcacgtcgccgtccatgtcctcgtactcgatcagcac 589 ||||||||| | ||||||||| |||||| ||||| || ||||||||| | |||||| Sbjct: 104808 ggcctccttgaggtccacctgcgccacgtctccgtcgccgttctcgtactccaccagcac 104749 Query: 590 cgccaggtacaccgcgttggagccctccaccacgtggaagttgatcttgaggccggggaa 649 |||||||||||| | | |||| || ||| |||||||||| | ||||||||| ||||| Sbjct: 104748 cgccaggtacacggggctggacccttcctccacgtggaatcccaccttgaggcccgggaa 104689 Query: 650 gttgcacggcaccctcctgaactggatgtcgatgatgcccgagtggcggag 700 | ||||||||| | | |||||| | ||||||||| |||| | ||||||| Sbjct: 104688 ctcgcacggcacgcgcgcgaactgcacgtcgatgatccccgcgcggcggag 104638
>dbj|AK070972.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023069H18, full insert sequence Length = 1019 Score = 97.6 bits (49), Expect = 5e-17 Identities = 136/165 (82%) Strand = Plus / Minus Query: 346 actggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgttgg 405 ||||||||||||| |||||| |||||||||| |||||||| |||||||| | | | Sbjct: 887 actggacgaaggaacggtagaaggtgttgggcgtccagttgagggggatgacgtcgggtg 828 Query: 406 ccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccctggaggcggt 465 |||||| | |||||||||||||||| |||||| |||||||| ||| || | ||||||| Sbjct: 827 ccaccaacgtcttgccggagtcgctccggatgcggatggagaatggcgcccgcaggcggt 768 Query: 466 ggttggagtccatccgccagatggatccccacgactcgcgcatcg 510 |||||||||||| || ||| | || ||||||||||| ||||||| Sbjct: 767 ggttggagtccagcctccacaccgacccccacgactcccgcatcg 723 Score = 61.9 bits (31), Expect = 3e-06 Identities = 136/171 (79%) Strand = Plus / Minus Query: 530 ggcctccttcatgtccacctggatcacgtcgccgtccatgtcctcgtactcgatcagcac 589 ||||||||| | ||||||||| |||||| ||||| || ||||||||| | |||||| Sbjct: 697 ggcctccttgaggtccacctgcgccacgtctccgtcgccgttctcgtactccaccagcac 638 Query: 590 cgccaggtacaccgcgttggagccctccaccacgtggaagttgatcttgaggccggggaa 649 |||||||||||| | | |||| || ||| |||||||||| | ||||||||| ||||| Sbjct: 637 cgccaggtacacggggctggacccttcctccacgtggaatcccaccttgaggcccgggaa 578 Query: 650 gttgcacggcaccctcctgaactggatgtcgatgatgcccgagtggcggag 700 | ||||||||| | | |||||| | ||||||||| |||| | ||||||| Sbjct: 577 ctcgcacggcacgcgcgcgaactgcacgtcgatgatccccgcgcggcggag 527
>gb|U91981.1|TAU91981 Triticum aestivum pollen allergen homolog mRNA, complete cds Length = 1232 Score = 97.6 bits (49), Expect = 5e-17 Identities = 97/113 (85%) Strand = Plus / Minus Query: 387 gccgggatgacattgttggccaccagcttcttgccggagtcgctggtgatgcgcatggag 446 ||||||||| |||||||||| |||||| |||| |||| |||||||||||||| |||||| Sbjct: 816 gccgggatggcattgttggcgaccagcgtctttccggtatcgctggtgatgcggatggag 757 Query: 447 aaaggcccctggaggcggtggttggagtccatccgccagatggatccccacga 499 || |||||||| | || |||||| |||||||||||||| ||| |||||||| Sbjct: 756 aatggcccctgcaccgggcggttggtgtccatccgccagacggagccccacga 704 Score = 73.8 bits (37), Expect = 7e-10 Identities = 52/57 (91%) Strand = Plus / Minus Query: 645 gggaagttgcacggcaccctcctgaactggatgtcgatgatgcccgagtggcggagc 701 ||||||||||| ||||||||||||||||| ||||| |||||||| | |||||||||| Sbjct: 546 gggaagttgcagggcaccctcctgaactgcatgtcaatgatgccggcgtggcggagc 490
>gb|AF261276.2| Oryza sativa beta-expansin (EXPB8) mRNA, partial cds Length = 933 Score = 89.7 bits (45), Expect = 1e-14 Identities = 135/165 (81%) Strand = Plus / Minus Query: 346 actggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgttgg 405 ||||||||||||| ||||| |||||||||| |||||||| |||||||| | | | Sbjct: 805 actggacgaaggaacggtaaaaggtgttgggcgtccagttgagggggatgacgtcgggtg 746 Query: 406 ccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccctggaggcggt 465 |||||| | |||||||||||||||| |||||| |||||||| ||| || | ||||||| Sbjct: 745 ccaccaacgtcttgccggagtcgctccggatgcggatggagaatggcgcccgcaggcggt 686 Query: 466 ggttggagtccatccgccagatggatccccacgactcgcgcatcg 510 |||||||||||| || ||| | || ||||||||||| ||||||| Sbjct: 685 ggttggagtccagcctccacaccgacccccacgactcccgcatcg 641 Score = 61.9 bits (31), Expect = 3e-06 Identities = 136/171 (79%) Strand = Plus / Minus Query: 530 ggcctccttcatgtccacctggatcacgtcgccgtccatgtcctcgtactcgatcagcac 589 ||||||||| | ||||||||| |||||| ||||| || ||||||||| | |||||| Sbjct: 615 ggcctccttgaggtccacctgcgccacgtctccgtcgccgttctcgtactccaccagcac 556 Query: 590 cgccaggtacaccgcgttggagccctccaccacgtggaagttgatcttgaggccggggaa 649 |||||||||||| | | |||| || ||| |||||||||| | ||||||||| ||||| Sbjct: 555 cgccaggtacacggggctggacccttcctccacgtggaatcccaccttgaggcccgggaa 496 Query: 650 gttgcacggcaccctcctgaactggatgtcgatgatgcccgagtggcggag 700 | ||||||||| | | |||||| | ||||||||| |||| | ||||||| Sbjct: 495 ctcgcacggcacgcgcgcgaactgcacgtcgatgatccccgcgcggcggag 445
>ref|NM_197699.1| Oryza sativa (japonica cultivar-group) beta-expansin EXPB2 (OSJNBb0014I11.2), mRNA Length = 1262 Score = 87.7 bits (44), Expect = 5e-14 Identities = 131/160 (81%) Strand = Plus / Minus Query: 337 atcaactgaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatga 396 |||||| ||||||||| ||||| ||||| |||||||| |||||||||||||||||||| Sbjct: 856 atcaacggaactggactttggagccgtagttggtgttggccctccagttggccgggatga 797 Query: 397 cattgttggccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccct 456 | | || ||| | | ||| |||||| |||||| ||||| | |||||| || |||| Sbjct: 796 cctggtgggcgatgacggtctggccggactcgctgaccatgcggagggagaaggggccct 737 Query: 457 ggaggcggtggttggagtccatccgccagatggatcccca 496 ||||||||||||||| ||| | ||||||||||||||||| Sbjct: 736 ggaggcggtggttggcgtcgaggcgccagatggatcccca 697 Score = 69.9 bits (35), Expect = 1e-08 Identities = 98/119 (82%) Strand = Plus / Minus Query: 584 cagcaccgccaggtacaccgcgttggagccctccaccacgtggaagttgatcttgaggcc 643 |||||| || |||||||||| |||||| || || | ||||||||||| | | |||||| Sbjct: 594 cagcacggcgaggtacaccgggttggacccggcctcgacgtggaagttcacgtagaggcc 535 Query: 644 ggggaagttgcacggcaccctcctgaactggatgtcgatgatgcccgagtggcggagct 702 | || || |||||| || | |||||||||||||||||||||||| | ||||||||||| Sbjct: 534 gcggtggtagcacgggacgcgcctgaactggatgtcgatgatgccggcgtggcggagct 476
>dbj|AK104128.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-F04, full insert sequence Length = 1043 Score = 87.7 bits (44), Expect = 5e-14 Identities = 131/160 (81%) Strand = Plus / Minus Query: 337 atcaactgaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatga 396 |||||| ||||||||| ||||| ||||| |||||||| |||||||||||||||||||| Sbjct: 855 atcaacggaactggactttggagccgtagttggtgttggccctccagttggccgggatga 796 Query: 397 cattgttggccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccct 456 | | || ||| | | ||| |||||| |||||| ||||| | |||||| || |||| Sbjct: 795 cctggtgggcgatgacggtctggccggactcgctgaccatgcggagggagaaggggccct 736 Query: 457 ggaggcggtggttggagtccatccgccagatggatcccca 496 ||||||||||||||| ||| | ||||||||||||||||| Sbjct: 735 ggaggcggtggttggcgtcgaggcgccagatggatcccca 696 Score = 69.9 bits (35), Expect = 1e-08 Identities = 98/119 (82%) Strand = Plus / Minus Query: 584 cagcaccgccaggtacaccgcgttggagccctccaccacgtggaagttgatcttgaggcc 643 |||||| || |||||||||| |||||| || || | ||||||||||| | | |||||| Sbjct: 593 cagcacggcgaggtacaccgggttggacccggcctcgacgtggaagttcacgtagaggcc 534 Query: 644 ggggaagttgcacggcaccctcctgaactggatgtcgatgatgcccgagtggcggagct 702 | || || |||||| || | |||||||||||||||||||||||| | ||||||||||| Sbjct: 533 gcggtggtagcacgggacgcgcctgaactggatgtcgatgatgccggcgtggcggagct 475
>dbj|AK061068.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-206-C01, full insert sequence Length = 1259 Score = 87.7 bits (44), Expect = 5e-14 Identities = 131/160 (81%) Strand = Plus / Minus Query: 337 atcaactgaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatga 396 |||||| ||||||||| ||||| ||||| |||||||| |||||||||||||||||||| Sbjct: 853 atcaacggaactggactttggagccgtagttggtgttggccctccagttggccgggatga 794 Query: 397 cattgttggccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccct 456 | | || ||| | | ||| |||||| |||||| ||||| | |||||| || |||| Sbjct: 793 cctggtgggcgatgacggtctggccggactcgctgaccatgcggagggagaaggggccct 734 Query: 457 ggaggcggtggttggagtccatccgccagatggatcccca 496 ||||||||||||||| ||| | ||||||||||||||||| Sbjct: 733 ggaggcggtggttggcgtcgaggcgccagatggatcccca 694 Score = 69.9 bits (35), Expect = 1e-08 Identities = 98/119 (82%) Strand = Plus / Minus Query: 584 cagcaccgccaggtacaccgcgttggagccctccaccacgtggaagttgatcttgaggcc 643 |||||| || |||||||||| |||||| || || | ||||||||||| | | |||||| Sbjct: 591 cagcacggcgaggtacaccgggttggacccggcctcgacgtggaagttcacgtagaggcc 532 Query: 644 ggggaagttgcacggcaccctcctgaactggatgtcgatgatgcccgagtggcggagct 702 | || || |||||| || | |||||||||||||||||||||||| | ||||||||||| Sbjct: 531 gcggtggtagcacgggacgcgcctgaactggatgtcgatgatgccggcgtggcggagct 473
>dbj|AK058895.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-F11, full insert sequence Length = 1026 Score = 87.7 bits (44), Expect = 5e-14 Identities = 131/160 (81%) Strand = Plus / Minus Query: 337 atcaactgaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatga 396 |||||| ||||||||| ||||| ||||| |||||||| |||||||||||||||||||| Sbjct: 846 atcaacggaactggactttggagccgtagttggtgttggccctccagttggccgggatga 787 Query: 397 cattgttggccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccct 456 | | || ||| | | ||| |||||| |||||| ||||| | |||||| || |||| Sbjct: 786 cctggtgggcgatgacggtctggccggactcgctgaccatgcggagggagaaggggccct 727 Query: 457 ggaggcggtggttggagtccatccgccagatggatcccca 496 ||||||||||||||| ||| | ||||||||||||||||| Sbjct: 726 ggaggcggtggttggcgtcgaggcgccagatggatcccca 687 Score = 69.9 bits (35), Expect = 1e-08 Identities = 98/119 (82%) Strand = Plus / Minus Query: 584 cagcaccgccaggtacaccgcgttggagccctccaccacgtggaagttgatcttgaggcc 643 |||||| || |||||||||| |||||| || || | ||||||||||| | | |||||| Sbjct: 584 cagcacggcgaggtacaccgggttggacccggcctcgacgtggaagttcacgtagaggcc 525 Query: 644 ggggaagttgcacggcaccctcctgaactggatgtcgatgatgcccgagtggcggagct 702 | || || |||||| || | |||||||||||||||||||||||| | ||||||||||| Sbjct: 524 gcggtggtagcacgggacgcgcctgaactggatgtcgatgatgccggcgtggcggagct 466
>gb|AC118673.2| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNBb0080O10, from chromosome 3, complete sequence Length = 127917 Score = 85.7 bits (43), Expect = 2e-13 Identities = 130/159 (81%) Strand = Plus / Minus Query: 344 gaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgtt 403 ||||||||||| ||||| |||| ||||||||||| ||||| ||| |||||||| | | Sbjct: 6491 gaactggacgatggagctgtagacggtgttgggctgccagtcggcggggatgacctgatc 6432 Query: 404 ggccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccctggaggcg 463 ||| | || |||||||||| ||| |||||||||| | |||||| |||||||| || | Sbjct: 6431 ggcgatgagggtcttgccggactcgttggtgatgcggagggagaagggcccctgcagcgg 6372 Query: 464 gtggttggagtccatccgccagatggatccccacgactc 502 |||||||| ||||| || ||| || |||||||||||||| Sbjct: 6371 gtggttggtgtccagcctccatatcgatccccacgactc 6333 Score = 65.9 bits (33), Expect = 2e-07 Identities = 39/41 (95%) Strand = Plus / Minus Query: 662 cctcctgaactggatgtcgatgatgcccgagtggcggagct 702 ||||||||||||||||||||||||||| | ||||||||||| Sbjct: 5819 cctcctgaactggatgtcgatgatgccggcgtggcggagct 5779
>dbj|AK061423.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-306-G02, full insert sequence Length = 1027 Score = 85.7 bits (43), Expect = 2e-13 Identities = 130/159 (81%) Strand = Plus / Minus Query: 344 gaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgtt 403 ||||||||||| ||||| |||| ||||||||||| ||||| ||| |||||||| | | Sbjct: 836 gaactggacgatggagctgtagacggtgttgggctgccagtcggcggggatgacctgatc 777 Query: 404 ggccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccctggaggcg 463 ||| | || |||||||||| ||| |||||||||| | |||||| |||||||| || | Sbjct: 776 ggcgatgagggtcttgccggactcgttggtgatgcggagggagaagggcccctgcagcgg 717 Query: 464 gtggttggagtccatccgccagatggatccccacgactc 502 |||||||| ||||| || ||| || |||||||||||||| Sbjct: 716 gtggttggtgtccagcctccatatcgatccccacgactc 678 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 657 ggcaccctcctgaactggatgtcgatgatgcccgagtggcggagct 702 |||||||||||||||||||||||||||||||| | ||||||||||| Sbjct: 493 ggcaccctcctgaactggatgtcgatgatgccggcgtggcggagct 448
>gb|DQ428284.1| Sorghum propinquum locus PRC0324 genomic sequence Length = 477 Score = 83.8 bits (42), Expect = 7e-13 Identities = 72/82 (87%) Strand = Plus / Minus Query: 344 gaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgtt 403 |||||||||| |||| |||||||||| | ||| ||||||||||||||||||| ||| | Sbjct: 310 gaactggacgttggaggggtagtcggtcatcggcttccagttggccgggatgacgttgct 251 Query: 404 ggccaccagcttcttgccggag 425 |||||||||| ||||||||||| Sbjct: 250 ggccaccagcgtcttgccggag 229
>gb|DQ428283.1| Sorghum bicolor voucher PI585454 locus PRC0324 genomic sequence Length = 467 Score = 83.8 bits (42), Expect = 7e-13 Identities = 72/82 (87%) Strand = Plus / Minus Query: 344 gaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgtt 403 |||||||||| |||| |||||||||| | ||| ||||||||||||||||||| ||| | Sbjct: 310 gaactggacgttggaggggtagtcggtcatcggcttccagttggccgggatgacgttgct 251 Query: 404 ggccaccagcttcttgccggag 425 |||||||||| ||||||||||| Sbjct: 250 ggccaccagcgtcttgccggag 229
>gb|DQ428282.1| Sorghum bicolor voucher PI267539 locus PRC0324 genomic sequence Length = 467 Score = 83.8 bits (42), Expect = 7e-13 Identities = 72/82 (87%) Strand = Plus / Minus Query: 344 gaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgtt 403 |||||||||| |||| |||||||||| | ||| ||||||||||||||||||| ||| | Sbjct: 310 gaactggacgttggaggggtagtcggtcatcggcttccagttggccgggatgacgttgct 251 Query: 404 ggccaccagcttcttgccggag 425 |||||||||| ||||||||||| Sbjct: 250 ggccaccagcgtcttgccggag 229
>gb|DQ428281.1| Sorghum bicolor voucher PI267408 locus PRC0324 genomic sequence Length = 467 Score = 83.8 bits (42), Expect = 7e-13 Identities = 72/82 (87%) Strand = Plus / Minus Query: 344 gaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgtt 403 |||||||||| |||| |||||||||| | ||| ||||||||||||||||||| ||| | Sbjct: 310 gaactggacgttggaggggtagtcggtcatcggcttccagttggccgggatgacgttgct 251 Query: 404 ggccaccagcttcttgccggag 425 |||||||||| ||||||||||| Sbjct: 250 ggccaccagcgtcttgccggag 229
>gb|DQ428280.1| Sorghum bicolor voucher PI221607 locus PRC0324 genomic sequence Length = 467 Score = 83.8 bits (42), Expect = 7e-13 Identities = 72/82 (87%) Strand = Plus / Minus Query: 344 gaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgtt 403 |||||||||| |||| |||||||||| | ||| ||||||||||||||||||| ||| | Sbjct: 310 gaactggacgttggaggggtagtcggtcatcggcttccagttggccgggatgacgttgct 251 Query: 404 ggccaccagcttcttgccggag 425 |||||||||| ||||||||||| Sbjct: 250 ggccaccagcgtcttgccggag 229
>gb|DQ428279.1| Sorghum bicolor voucher PI152702 locus PRC0324 genomic sequence Length = 467 Score = 83.8 bits (42), Expect = 7e-13 Identities = 72/82 (87%) Strand = Plus / Minus Query: 344 gaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgtt 403 |||||||||| |||| |||||||||| | ||| ||||||||||||||||||| ||| | Sbjct: 310 gaactggacgttggaggggtagtcggtcatcggcttccagttggccgggatgacgttgct 251 Query: 404 ggccaccagcttcttgccggag 425 |||||||||| ||||||||||| Sbjct: 250 ggccaccagcgtcttgccggag 229
>gb|DQ428278.1| Sorghum bicolor voucher NSL92371 locus PRC0324 genomic sequence Length = 467 Score = 83.8 bits (42), Expect = 7e-13 Identities = 72/82 (87%) Strand = Plus / Minus Query: 344 gaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgtt 403 |||||||||| |||| |||||||||| | ||| ||||||||||||||||||| ||| | Sbjct: 310 gaactggacgttggaggggtagtcggtcatcggcttccagttggccgggatgacgttgct 251 Query: 404 ggccaccagcttcttgccggag 425 |||||||||| ||||||||||| Sbjct: 250 ggccaccagcgtcttgccggag 229
>gb|DQ428277.1| Sorghum bicolor voucher NSL87902 locus PRC0324 genomic sequence Length = 467 Score = 83.8 bits (42), Expect = 7e-13 Identities = 72/82 (87%) Strand = Plus / Minus Query: 344 gaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgtt 403 |||||||||| |||| |||||||||| | ||| ||||||||||||||||||| ||| | Sbjct: 310 gaactggacgttggaggggtagtcggtcatcggcttccagttggccgggatgacgttgct 251 Query: 404 ggccaccagcttcttgccggag 425 |||||||||| ||||||||||| Sbjct: 250 ggccaccagcgtcttgccggag 229
>gb|DQ428276.1| Sorghum bicolor voucher NSL87666 locus PRC0324 genomic sequence Length = 467 Score = 83.8 bits (42), Expect = 7e-13 Identities = 72/82 (87%) Strand = Plus / Minus Query: 344 gaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgtt 403 |||||||||| |||| |||||||||| | ||| ||||||||||||||||||| ||| | Sbjct: 310 gaactggacgttggaggggtagtcggtcatcggcttccagttggccgggatgacgttgct 251 Query: 404 ggccaccagcttcttgccggag 425 |||||||||| ||||||||||| Sbjct: 250 ggccaccagcgtcttgccggag 229
>gb|DQ428275.1| Sorghum bicolor voucher NSL77217 locus PRC0324 genomic sequence Length = 467 Score = 83.8 bits (42), Expect = 7e-13 Identities = 72/82 (87%) Strand = Plus / Minus Query: 344 gaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgtt 403 |||||||||| |||| |||||||||| | ||| ||||||||||||||||||| ||| | Sbjct: 310 gaactggacgttggaggggtagtcggtcatcggcttccagttggccgggatgacgttgct 251 Query: 404 ggccaccagcttcttgccggag 425 |||||||||| ||||||||||| Sbjct: 250 ggccaccagcgtcttgccggag 229
>gb|DQ428274.1| Sorghum bicolor voucher NSL77034 locus PRC0324 genomic sequence Length = 467 Score = 83.8 bits (42), Expect = 7e-13 Identities = 72/82 (87%) Strand = Plus / Minus Query: 344 gaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgtt 403 |||||||||| |||| |||||||||| | ||| ||||||||||||||||||| ||| | Sbjct: 310 gaactggacgttggaggggtagtcggtcatcggcttccagttggccgggatgacgttgct 251 Query: 404 ggccaccagcttcttgccggag 425 |||||||||| ||||||||||| Sbjct: 250 ggccaccagcgtcttgccggag 229
>gb|DQ428273.1| Sorghum bicolor voucher NSL56174 locus PRC0324 genomic sequence Length = 467 Score = 83.8 bits (42), Expect = 7e-13 Identities = 72/82 (87%) Strand = Plus / Minus Query: 344 gaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgtt 403 |||||||||| |||| |||||||||| | ||| ||||||||||||||||||| ||| | Sbjct: 310 gaactggacgttggaggggtagtcggtcatcggcttccagttggccgggatgacgttgct 251 Query: 404 ggccaccagcttcttgccggag 425 |||||||||| ||||||||||| Sbjct: 250 ggccaccagcgtcttgccggag 229
>gb|DQ428272.1| Sorghum bicolor voucher NSL56003 locus PRC0324 genomic sequence Length = 467 Score = 83.8 bits (42), Expect = 7e-13 Identities = 72/82 (87%) Strand = Plus / Minus Query: 344 gaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgtt 403 |||||||||| |||| |||||||||| | ||| ||||||||||||||||||| ||| | Sbjct: 310 gaactggacgttggaggggtagtcggtcatcggcttccagttggccgggatgacgttgct 251 Query: 404 ggccaccagcttcttgccggag 425 |||||||||| ||||||||||| Sbjct: 250 ggccaccagcgtcttgccggag 229
>gb|DQ428271.1| Sorghum bicolor voucher NSL55243 locus PRC0324 genomic sequence Length = 467 Score = 83.8 bits (42), Expect = 7e-13 Identities = 72/82 (87%) Strand = Plus / Minus Query: 344 gaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgtt 403 |||||||||| |||| |||||||||| | ||| ||||||||||||||||||| ||| | Sbjct: 310 gaactggacgttggaggggtagtcggtcatcggcttccagttggccgggatgacgttgct 251 Query: 404 ggccaccagcttcttgccggag 425 |||||||||| ||||||||||| Sbjct: 250 ggccaccagcgtcttgccggag 229
>gb|DQ428270.1| Sorghum bicolor voucher NSL51365 locus PRC0324 genomic sequence Length = 467 Score = 83.8 bits (42), Expect = 7e-13 Identities = 72/82 (87%) Strand = Plus / Minus Query: 344 gaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgtt 403 |||||||||| |||| |||||||||| | ||| ||||||||||||||||||| ||| | Sbjct: 310 gaactggacgttggaggggtagtcggtcatcggcttccagttggccgggatgacgttgct 251 Query: 404 ggccaccagcttcttgccggag 425 |||||||||| ||||||||||| Sbjct: 250 ggccaccagcgtcttgccggag 229
>gb|DQ428269.1| Sorghum bicolor voucher NSL51030 locus PRC0324 genomic sequence Length = 467 Score = 83.8 bits (42), Expect = 7e-13 Identities = 72/82 (87%) Strand = Plus / Minus Query: 344 gaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgtt 403 |||||||||| |||| |||||||||| | ||| ||||||||||||||||||| ||| | Sbjct: 310 gaactggacgttggaggggtagtcggtcatcggcttccagttggccgggatgacgttgct 251 Query: 404 ggccaccagcttcttgccggag 425 |||||||||| ||||||||||| Sbjct: 250 ggccaccagcgtcttgccggag 229
>gb|DQ428268.1| Sorghum bicolor voucher NSL50875 locus PRC0324 genomic sequence Length = 467 Score = 83.8 bits (42), Expect = 7e-13 Identities = 72/82 (87%) Strand = Plus / Minus Query: 344 gaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgtt 403 |||||||||| |||| |||||||||| | ||| ||||||||||||||||||| ||| | Sbjct: 310 gaactggacgttggaggggtagtcggtcatcggcttccagttggccgggatgacgttgct 251 Query: 404 ggccaccagcttcttgccggag 425 |||||||||| ||||||||||| Sbjct: 250 ggccaccagcgtcttgccggag 229
>gb|DQ428267.1| Sorghum bicolor voucher BTx623 locus PRC0324 genomic sequence Length = 467 Score = 83.8 bits (42), Expect = 7e-13 Identities = 72/82 (87%) Strand = Plus / Minus Query: 344 gaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgtt 403 |||||||||| |||| |||||||||| | ||| ||||||||||||||||||| ||| | Sbjct: 310 gaactggacgttggaggggtagtcggtcatcggcttccagttggccgggatgacgttgct 251 Query: 404 ggccaccagcttcttgccggag 425 |||||||||| ||||||||||| Sbjct: 250 ggccaccagcgtcttgccggag 229
>gb|U95968.1|OSU95968 Oryza sativa beta-expansin (EXPB2) mRNA, complete cds Length = 999 Score = 83.8 bits (42), Expect = 7e-13 Identities = 130/160 (81%) Strand = Plus / Minus Query: 337 atcaactgaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatga 396 |||||| ||||||||| ||||| ||||| |||||||| |||||||||||||||||||| Sbjct: 856 atcaacggaactggactttggagccgtagttggtgttggccctccagttggccgggatga 797 Query: 397 cattgttggccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccct 456 | | || ||| | | ||| |||||| |||||| ||||| | ||| || || |||| Sbjct: 796 cctggtgggcgatgacggtctggccggactcgctgaccatgcggagggakaaggggccct 737 Query: 457 ggaggcggtggttggagtccatccgccagatggatcccca 496 ||||||||||||||| ||| | ||||||||||||||||| Sbjct: 736 ggaggcggtggttggcgtcgaggcgccagatggatcccca 697 Score = 69.9 bits (35), Expect = 1e-08 Identities = 98/119 (82%) Strand = Plus / Minus Query: 584 cagcaccgccaggtacaccgcgttggagccctccaccacgtggaagttgatcttgaggcc 643 |||||| || |||||||||| |||||| || || | ||||||||||| | | |||||| Sbjct: 594 cagcacggcgaggtacaccgggttggacccggcctcgacgtggaagttcacgtagaggcc 535 Query: 644 ggggaagttgcacggcaccctcctgaactggatgtcgatgatgcccgagtggcggagct 702 | || || |||||| || | |||||||||||||||||||||||| | ||||||||||| Sbjct: 534 gcggtggtagcacgggacgcgcctgaactggatgtcgatgatgccggcgtggcggagct 476
>gb|AF261275.1| Oryza sativa beta-expansin (EXPB7) mRNA, complete cds Length = 1210 Score = 81.8 bits (41), Expect = 3e-12 Identities = 129/159 (81%) Strand = Plus / Minus Query: 344 gaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgtt 403 ||||||||||| ||||| ||| ||||||||||| ||||| ||| |||||||| | | Sbjct: 1028 gaactggacgatggagctgtaracggtgttgggctgccagtcggcggggatgacctgatc 969 Query: 404 ggccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccctggaggcg 463 ||| | || |||||||||| ||| |||||||||| | |||||| |||||||| || | Sbjct: 968 ggcgatgagggtcttgccggactcgttggtgatgcggagggagaagggcccctgcagcgg 909 Query: 464 gtggttggagtccatccgccagatggatccccacgactc 502 |||||||| ||||| || ||| || |||||||||||||| Sbjct: 908 gtggttggtgtccagcctccatatcgatccccacgactc 870 Score = 75.8 bits (38), Expect = 2e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 657 ggcaccctcctgaactggatgtcgatgatgcccgagtggcggagct 702 |||||||||||||||||||||||||||||||| | ||||||||||| Sbjct: 685 ggcaccctcctgaactggatgtcgatgatgccggcgtggcggagct 640
>emb|AJ295940.1|FPR295940 Festuca pratensis mRNA for beta expansin B1 (expB1 gene) Length = 1224 Score = 75.8 bits (38), Expect = 2e-10 Identities = 62/70 (88%) Strand = Plus / Minus Query: 387 gccgggatgacattgttggccaccagcttcttgccggagtcgctggtgatgcgcatggag 446 |||||||| ||||||||||| | |||||||||||||| |||||||||||||||| ||| Sbjct: 808 gccgggataacattgttggcgatgagcttcttgccggaatcgctggtgatgcgcaaggac 749 Query: 447 aaaggcccct 456 || ||||||| Sbjct: 748 aatggcccct 739 Score = 50.1 bits (25), Expect = 0.010 Identities = 28/29 (96%) Strand = Plus / Minus Query: 649 agttgcacggcaccctcctgaactggatg 677 ||||||| ||||||||||||||||||||| Sbjct: 534 agttgcagggcaccctcctgaactggatg 506
>gb|AY533104.1| Triticum aestivum beta-expansin 2 (EXPB2) gene, complete cds Length = 1216 Score = 63.9 bits (32), Expect = 7e-07 Identities = 74/88 (84%) Strand = Plus / Minus Query: 361 ggtagtcggtgttgggcctccagttggccgggatgacattgttggccaccagcttcttgc 420 ||||| |||||| || | |||||||||| |||||||| | ||||| | |||||||||| Sbjct: 1036 ggtagacggtgtcggccttccagttggcggggatgacgtccttggcgatgagcttcttgc 977 Query: 421 cggagtcgctggtgatgcgcatggagaa 448 |||| |||||||||| ||| |||||||| Sbjct: 976 cggactcgctggtgacgcggatggagaa 949
>gb|AY533102.1| Triticum aestivum beta-expansin 2 (EXPB2) mRNA, complete cds Length = 1068 Score = 63.9 bits (32), Expect = 7e-07 Identities = 74/88 (84%) Strand = Plus / Minus Query: 361 ggtagtcggtgttgggcctccagttggccgggatgacattgttggccaccagcttcttgc 420 ||||| |||||| || | |||||||||| |||||||| | ||||| | |||||||||| Sbjct: 801 ggtagacggtgtcggccttccagttggcggggatgacgtccttggcgatgagcttcttgc 742 Query: 421 cggagtcgctggtgatgcgcatggagaa 448 |||| |||||||||| ||| |||||||| Sbjct: 741 cggactcgctggtgacgcggatggagaa 714
>gb|AY533103.1| Triticum aestivum beta-expansin 1 (EXPB1) gene, complete cds Length = 1149 Score = 61.9 bits (31), Expect = 3e-06 Identities = 73/87 (83%) Strand = Plus / Minus Query: 362 gtagtcggtgttgggcctccagttggccgggatgacattgttggccaccagcttcttgcc 421 |||| |||||| || | |||||||||| |||||||| | ||||| | ||||||||||| Sbjct: 1114 gtagacggtgtcggccttccagttggcggggatgacgtccttggcgatgagcttcttgcc 1055 Query: 422 ggagtcgctggtgatgcgcatggagaa 448 ||| |||||||||| ||| |||||||| Sbjct: 1054 ggactcgctggtgacgcggatggagaa 1028
>gb|AY533101.1| Triticum aestivum beta-expansin 1 (EXPB1) mRNA, complete cds Length = 1111 Score = 61.9 bits (31), Expect = 3e-06 Identities = 73/87 (83%) Strand = Plus / Minus Query: 362 gtagtcggtgttgggcctccagttggccgggatgacattgttggccaccagcttcttgcc 421 |||| |||||| || | |||||||||| |||||||| | ||||| | ||||||||||| Sbjct: 830 gtagacggtgtcggccttccagttggcggggatgacgtccttggcgatgagcttcttgcc 771 Query: 422 ggagtcgctggtgatgcgcatggagaa 448 ||| |||||||||| ||| |||||||| Sbjct: 770 ggactcgctggtgacgcggatggagaa 744
>gb|AY533100.1| Triticum aestivum beta-expansin 1 (EXPB1) mRNA, partial cds Length = 496 Score = 61.9 bits (31), Expect = 3e-06 Identities = 73/87 (83%) Strand = Plus / Minus Query: 362 gtagtcggtgttgggcctccagttggccgggatgacattgttggccaccagcttcttgcc 421 |||| |||||| || | |||||||||| |||||||| | ||||| | ||||||||||| Sbjct: 290 gtagacggtgtcggccttccagttggcggggatgacgtccttggcgatgagcttcttgcc 231 Query: 422 ggagtcgctggtgatgcgcatggagaa 448 ||| |||||||||| ||| |||||||| Sbjct: 230 ggactcgctggtgacgcggatggagaa 204
>gb|AY112069.1| Zea mays CL35761_1 mRNA sequence Length = 631 Score = 61.9 bits (31), Expect = 3e-06 Identities = 115/143 (80%) Strand = Plus / Plus Query: 546 acctggatcacgtcgccgtccatgtcctcgtactcgatcagcaccgccaggtacaccgcg 605 ||||||| ||||||||||| || ||||||||||| |||||| || | ||| ||| | Sbjct: 302 acctggacgacgtcgccgtcgccgttctcgtactcgaccagcacggcgaagtagacctgg 361 Query: 606 ttggagccctccaccacgtggaagttgatcttgaggccggggaagttgcacggcaccctc 665 ||||||| ||| | ||||||||| || ||||||||| ||||| | ||| || ||||| Sbjct: 362 gtggagccttcctcgacgtggaagccgaccttgaggcctgggaactcgcagggtaccctg 421 Query: 666 ctgaactggatgtcgatgatgcc 688 ||||||||||||||||||||| Sbjct: 422 gcgaactggatgtcgatgatgcc 444 Score = 61.9 bits (31), Expect = 3e-06 Identities = 73/87 (83%) Strand = Plus / Plus Query: 415 tcttgccggagtcgctggtgatgcgcatggagaaaggcccctggaggcggtggttggagt 474 |||||||||||||| || | |||| |||||||| || ||| |||||||||||||||| Sbjct: 171 tcttgccggagtcggtgcgggtgcggatggagaagggtggctgcaggcggtggttggagt 230 Query: 475 ccatccgccagatggatccccacgact 501 | | ||||||||||||||||| |||| Sbjct: 231 cgaggcgccagatggatccccatgact 257
>gb|AY589578.1| Triticum aestivum beta-expansin TaEXPB1 mRNA, complete cds Length = 1034 Score = 60.0 bits (30), Expect = 1e-05 Identities = 42/46 (91%) Strand = Plus / Minus Query: 657 ggcaccctcctgaactggatgtcgatgatgcccgagtggcggagct 702 ||||||||| ||||||| |||||||||||||| | ||||||||||| Sbjct: 615 ggcaccctcttgaactgcatgtcgatgatgccggcgtggcggagct 570 Score = 46.1 bits (23), Expect = 0.16 Identities = 23/23 (100%) Strand = Plus / Minus Query: 480 cgccagatggatccccacgactc 502 ||||||||||||||||||||||| Sbjct: 810 cgccagatggatccccacgactc 788
>gb|AF332176.1|AF332176 Zea mays beta-expansin 3 (expB3) mRNA, partial cds Length = 788 Score = 58.0 bits (29), Expect = 4e-05 Identities = 131/165 (79%) Strand = Plus / Minus Query: 344 gaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgtt 403 ||||||||||| ||||| |||| || ||| |||| ||||| ||||| ||||| | || Sbjct: 646 gaactggacgatggagctgtagacgttgtcgggctgccagtctgccggaatgacctggtc 587 Query: 404 ggccaccagcttcttgccggagtcgctggtgatgcgcatggagaaaggcccctggaggcg 463 ||||||||| |||||||||| ||| |||||| ||||| ||||| ||||| || || | Sbjct: 586 cgccaccagcgtcttgccggactcgttggtgacgcgcagcgagaagggcccttgcagcgg 527 Query: 464 gtggttggagtccatccgccagatggatccccacgactcgcgcat 508 || || |||||||| ||| ||||| ||||| ||||||||||| Sbjct: 526 ccggcgggtgtccatcctccatatggagccccaggactcgcgcat 482 Score = 52.0 bits (26), Expect = 0.003 Identities = 56/66 (84%) Strand = Plus / Minus Query: 533 ctccttcatgtccacctggatcacgtcgccgtccatgtcctcgtactcgatcagcaccgc 592 |||| ||| ||||||||| | |||||||||||| || ||||||||| | ||||||||| Sbjct: 439 ctccatcaggtccacctgcaccacgtcgccgtcgccgttctcgtactccaccagcaccgc 380 Query: 593 caggta 598 |||||| Sbjct: 379 caggta 374 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Minus Query: 660 accctcctgaactggatgtcgatgat 685 |||||| ||||||||||||||||||| Sbjct: 312 accctcttgaactggatgtcgatgat 287
>gb|AF220610.1| Oryza sativa pollen allergen mRNA, complete cds Length = 1106 Score = 56.0 bits (28), Expect = 2e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 641 gccggggaagttgcacggcaccctcctgaactggatgtcgatgatgcc 688 ||||||| | ||||| |||||||||||||||| |||||||||||||| Sbjct: 540 gccggggtacttgcagcgcaccctcctgaactgcatgtcgatgatgcc 493
>ref|NM_197637.1| Oryza sativa (japonica cultivar-group) beta-expansin (OSJNBa0082M15.4), mRNA Length = 1148 Score = 56.0 bits (28), Expect = 2e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 641 gccggggaagttgcacggcaccctcctgaactggatgtcgatgatgcc 688 ||||||| | ||||| |||||||||||||||| |||||||||||||| Sbjct: 555 gccggggtacttgcagcgcaccctcctgaactgcatgtcgatgatgcc 508
>gb|AF261277.1| Oryza sativa beta-expansin (EXPB9) mRNA, complete cds Length = 1117 Score = 56.0 bits (28), Expect = 2e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 641 gccggggaagttgcacggcaccctcctgaactggatgtcgatgatgcc 688 ||||||| | ||||| |||||||||||||||| |||||||||||||| Sbjct: 555 gccggggtacttgcagcgcaccctcctgaactgcatgtcgatgatgcc 508
>emb|AJ890019.1| Triticum aestivum mRNA for expansin EXPB11 protein precursor (expb11 gene), cultivar Wyuna, from endosperm tissue Length = 1032 Score = 56.0 bits (28), Expect = 2e-04 Identities = 73/88 (82%) Strand = Plus / Minus Query: 415 tcttgccggagtcgctggtgatgcgcatggagaaaggcccctggaggcggtggttggagt 474 |||||||||| ||| |||||||||||| ||||| ||| ||| | | |||||| || | Sbjct: 748 tcttgccggactcgttggtgatgcgcaacgagaatggcgccttcatggggtggtgggcat 689 Query: 475 ccatccgccagatggatccccacgactc 502 |||||| ||||||||| ||||||||||| Sbjct: 688 ccatcctccagatggaaccccacgactc 661 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Minus Query: 653 gcacggcaccctcctgaactggatgtcgatgatgcccgagtggcggagct 702 ||||||||||||| ||||||| |||| ||| ||||| | ||||||||||| Sbjct: 486 gcacggcaccctcttgaactgcatgttgatcatgccggcgtggcggagct 437
>gb|AC020666.8| Oryza sativa chromosome 10 BAC OSJNBa0082M15 genomic sequence, complete sequence Length = 158550 Score = 56.0 bits (28), Expect = 2e-04 Identities = 43/48 (89%) Strand = Plus / Plus Query: 641 gccggggaagttgcacggcaccctcctgaactggatgtcgatgatgcc 688 ||||||| | ||||| |||||||||||||||| |||||||||||||| Sbjct: 117328 gccggggtacttgcagcgcaccctcctgaactgcatgtcgatgatgcc 117375
>dbj|AK099112.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023033P05, full insert sequence Length = 1071 Score = 56.0 bits (28), Expect = 2e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 641 gccggggaagttgcacggcaccctcctgaactggatgtcgatgatgcc 688 ||||||| | ||||| |||||||||||||||| |||||||||||||| Sbjct: 571 gccggggtacttgcagcgcaccctcctgaactgcatgtcgatgatgcc 524
>dbj|AK070187.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023043G12, full insert sequence Length = 1121 Score = 56.0 bits (28), Expect = 2e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 641 gccggggaagttgcacggcaccctcctgaactggatgtcgatgatgcc 688 ||||||| | ||||| |||||||||||||||| |||||||||||||| Sbjct: 571 gccggggtacttgcagcgcaccctcctgaactgcatgtcgatgatgcc 524
>gb|AY197353.1| Zea mays clone pJR9 beta-expansin 1 protein (EXPB1) mRNA, complete cds Length = 1066 Score = 54.0 bits (27), Expect = 6e-04 Identities = 60/71 (84%) Strand = Plus / Minus Query: 378 ctccagttggccgggatgacattgttggccaccagcttcttgccggagtcgctggtgatg 437 |||||||| ||||||||||| | ||||| | | |||||||||||| |||||||||| | Sbjct: 801 ctccagttcgccgggatgacgtctttggcgatgaccttcttgccggactcgctggtgagg 742 Query: 438 cgcatggagaa 448 || |||||||| Sbjct: 741 cggatggagaa 731
>gb|AF332174.1|AF332174 Zea mays beta-expansin 1 (expB1) mRNA, complete cds Length = 1080 Score = 54.0 bits (27), Expect = 6e-04 Identities = 60/71 (84%) Strand = Plus / Minus Query: 378 ctccagttggccgggatgacattgttggccaccagcttcttgccggagtcgctggtgatg 437 |||||||| ||||||||||| | ||||| | | |||||||||||| |||||||||| | Sbjct: 801 ctccagttcgccgggatgacgtctttggcgatgaccttcttgccggactcgctggtgagg 742 Query: 438 cgcatggagaa 448 || |||||||| Sbjct: 741 cggatggagaa 731
>gb|AY103636.1| Zea mays PCO124530 mRNA sequence Length = 1085 Score = 54.0 bits (27), Expect = 6e-04 Identities = 60/71 (84%) Strand = Plus / Minus Query: 378 ctccagttggccgggatgacattgttggccaccagcttcttgccggagtcgctggtgatg 437 |||||||| ||||||||||| | ||||| | | |||||||||||| |||||||||| | Sbjct: 813 ctccagttcgccgggatgacgtctttggcgatgaccttcttgccggactcgctggtgagg 754 Query: 438 cgcatggagaa 448 || |||||||| Sbjct: 753 cggatggagaa 743
>gb|AY543540.1| Triticum aestivum expansin EXPB5 mRNA, complete cds Length = 960 Score = 54.0 bits (27), Expect = 6e-04 Identities = 72/87 (82%) Strand = Plus / Minus Query: 362 gtagtcggtgttgggcctccagttggccgggatgacattgttggccaccagcttcttgcc 421 |||| |||||| || | |||||||||| |||||||| | ||||| | ||||||||||| Sbjct: 783 gtagacggtgtcggccttccagttggcggggatgacgtccttggcgatgagcttcttgcc 724 Query: 422 ggagtcgctggtgatgcgcatggagaa 448 || |||||||||| ||| |||||||| Sbjct: 723 gggctcgctggtgacgcggatggagaa 697
>dbj|AB158404.1| Triticum aestivum expB mRNA for putative beta-expansin, complete cds Length = 1247 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Minus Query: 379 tccagttggccgggatgacattgttggccaccagcttcttgccggagtcg 428 |||||||||| |||||||| |||||| ||||||||| ||||||||||| Sbjct: 917 tccagttggcggggatgacgttgttgatgaccagcttcctgccggagtcg 868
>emb|AL954325.8| Mouse DNA sequence from clone RP23-416H10 on chromosome 2, complete sequence Length = 195457 Score = 52.0 bits (26), Expect = 0.003 Identities = 29/30 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatgatgca 301 |||||||||||||||||| ||||||||||| Sbjct: 66448 gcatgcatgcatgcatgcatgcatgatgca 66477 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 66472 catgcatgcatgcatgcatgcatg 66449
>emb|CT009546.4| Mouse DNA sequence from clone RP23-111H19 on chromosome 13, complete sequence Length = 207769 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 ||||||||||||||||||||||||| Sbjct: 192243 gcatgcatgcatgcatgcgtgcatg 192267
>gb|AC116656.5| Mus musculus BAC clone RP23-10A7 from chromosome 15, complete sequence Length = 198019 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 ||||||||||||||||||||||||| Sbjct: 13120 gcatgcatgcatgcatgcgtgcatg 13144
>gb|AC101810.5| Mus musculus chromosome 15, clone RP24-278M16, complete sequence Length = 178304 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 ||||||||||||||||||||||||| Sbjct: 134700 gcatgcatgcatgcatgcgtgcatg 134724
>gb|AC107707.10| Mus musculus chromosome 1, clone RP24-268C13, complete sequence Length = 178000 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 ||||||||||||||||||||||||| Sbjct: 50899 gcatgcatgcatgcatgcgtgcatg 50875
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Plus Query: 267 agagcgcatgcatgcatgcatgcgt 291 ||||||||||||||||||||||||| Sbjct: 24884076 agagcgcatgcatgcatgcatgcgt 24884100 Score = 40.1 bits (20), Expect = 9.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 271 cgcatgcatgcatgcatgcg 290 |||||||||||||||||||| Sbjct: 24884099 cgcatgcatgcatgcatgcg 24884080
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 ||||||||||||||||||||||||| Sbjct: 40746824 gcatgcatgcatgcatgcgtgcatg 40746800 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcat 295 |||||||||||||||||| ||||| Sbjct: 40749612 gcatgcatgcatgcatgcatgcat 40749589 Score = 40.1 bits (20), Expect = 9.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 270 gcgcatgcatgcatgcatgc 289 |||||||||||||||||||| Sbjct: 33830463 gcgcatgcatgcatgcatgc 33830444 Score = 40.1 bits (20), Expect = 9.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 93 caaaccatgcttcctacatt 112 |||||||||||||||||||| Sbjct: 18458508 caaaccatgcttcctacatt 18458527
>dbj|AP006458.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJNBa0072I06 Length = 162411 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Plus Query: 267 agagcgcatgcatgcatgcatgcgt 291 ||||||||||||||||||||||||| Sbjct: 67708 agagcgcatgcatgcatgcatgcgt 67732 Score = 40.1 bits (20), Expect = 9.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 271 cgcatgcatgcatgcatgcg 290 |||||||||||||||||||| Sbjct: 67731 cgcatgcatgcatgcatgcg 67712
>dbj|AP004330.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJNBa0052O12 Length = 167881 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 ||||||||||||||||||||||||| Sbjct: 49470 gcatgcatgcatgcatgcgtgcatg 49446 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcat 295 |||||||||||||||||| ||||| Sbjct: 52258 gcatgcatgcatgcatgcatgcat 52235
>dbj|AP005193.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0493C06 Length = 158923 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Plus Query: 267 agagcgcatgcatgcatgcatgcgt 291 ||||||||||||||||||||||||| Sbjct: 118527 agagcgcatgcatgcatgcatgcgt 118551 Score = 40.1 bits (20), Expect = 9.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 271 cgcatgcatgcatgcatgcg 290 |||||||||||||||||||| Sbjct: 118550 cgcatgcatgcatgcatgcg 118531
>emb|AL670959.8| Mouse DNA sequence from clone RP23-94L5 on chromosome 4, complete sequence Length = 262388 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 ||||||||||||||||||||||||| Sbjct: 113475 gcatgcatgcatgcatgcgtgcatg 113451
>gb|AY779427.1| Eimeria maxima clone USDA-EM-5-10 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 48.1 bits (24), Expect = 0.040 Identities = 30/32 (93%) Strand = Plus / Minus Query: 270 gcgcatgcatgcatgcatgcgtgcatgatgca 301 |||||||||||||||||||| ||||| ||||| Sbjct: 381 gcgcatgcatgcatgcatgcatgcatcatgca 350 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 ||||||||||||||||||| ||||| Sbjct: 362 gcatgcatgcatgcatgcgcgcatg 386
>gb|AC161809.3| Mus musculus chromosome 1, clone RP23-114N13, complete sequence Length = 213778 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcat 295 |||||||||||||||||||||||| Sbjct: 181091 gcatgcatgcatgcatgcgtgcat 181068
>gb|AC125466.4| Mus musculus BAC clone RP23-477O24 from chromosome 9, complete sequence Length = 150128 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 270 gcgcatgcatgcatgcatgcgtgc 293 |||||||||||||||||||||||| Sbjct: 134518 gcgcatgcatgcatgcatgcgtgc 134541 Score = 40.1 bits (20), Expect = 9.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 271 cgcatgcatgcatgcatgcg 290 |||||||||||||||||||| Sbjct: 134538 cgcatgcatgcatgcatgcg 134519
>gb|AY692478.1| Triticum aestivum beta-expansin EXPB6 mRNA, partial cds Length = 671 Score = 48.1 bits (24), Expect = 0.040 Identities = 28/30 (93%) Strand = Plus / Minus Query: 473 gtccatccgccagatggatccccacgactc 502 |||||||||||||||||| |||||||| || Sbjct: 233 gtccatccgccagatggamccccacgamtc 204
>emb|AL928693.9| Mouse DNA sequence from clone RP23-407K8 on chromosome 2, complete sequence Length = 206478 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcat 295 |||||||||||||||||||||||| Sbjct: 20558 gcatgcatgcatgcatgcgtgcat 20581
>gb|AC167245.2| Mus musculus BAC clone RP23-421F2 from chromosome 19, complete sequence Length = 198219 Score = 46.1 bits (23), Expect = 0.16 Identities = 26/27 (96%) Strand = Plus / Plus Query: 270 gcgcatgcatgcatgcatgcgtgcatg 296 |||||| |||||||||||||||||||| Sbjct: 84667 gcgcatacatgcatgcatgcgtgcatg 84693
>gb|AC112962.15| Mus musculus chromosome 19, clone RP24-74N6, complete sequence Length = 182999 Score = 46.1 bits (23), Expect = 0.16 Identities = 26/27 (96%) Strand = Plus / Plus Query: 271 cgcatgcatgcatgcatgcgtgcatga 297 ||||||||||||||||||| ||||||| Sbjct: 51456 cgcatgcatgcatgcatgcatgcatga 51482 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 51481 catgcatgcatgcatgcatgcatg 51458 Score = 40.1 bits (20), Expect = 9.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgt 291 |||||||||||||||||||| Sbjct: 51474 gcatgcatgcatgcatgcgt 51455
>gb|AC164422.2| Mus musculus chromosome 19, clone RP23-407G6, complete sequence Length = 212046 Score = 46.1 bits (23), Expect = 0.16 Identities = 26/27 (96%) Strand = Plus / Plus Query: 270 gcgcatgcatgcatgcatgcgtgcatg 296 |||||| |||||||||||||||||||| Sbjct: 78277 gcgcatacatgcatgcatgcgtgcatg 78303
>gb|AC166829.3| Mus musculus BAC clone RP23-299M19 from chromosome 1, complete sequence Length = 211292 Score = 46.1 bits (23), Expect = 0.16 Identities = 23/23 (100%) Strand = Plus / Minus Query: 268 gagcgcatgcatgcatgcatgcg 290 ||||||||||||||||||||||| Sbjct: 161388 gagcgcatgcatgcatgcatgcg 161366 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 270 gcgcatgcatgcatgcatgcg 290 ||||||||||||||||||||| Sbjct: 161365 gcgcatgcatgcatgcatgcg 161385
>gb|AC149058.7| Mus musculus BAC clone RP23-338G5 from chromosome 7, complete sequence Length = 219369 Score = 46.1 bits (23), Expect = 0.16 Identities = 23/23 (100%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgca 294 ||||||||||||||||||||||| Sbjct: 160967 gcatgcatgcatgcatgcgtgca 160989
>gb|AC124574.4| Mus musculus BAC clone RP23-160J13 from 7, complete sequence Length = 176188 Score = 46.1 bits (23), Expect = 0.16 Identities = 23/23 (100%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgca 294 ||||||||||||||||||||||| Sbjct: 161149 gcatgcatgcatgcatgcgtgca 161127
>gb|AC006956.16| Mus musculus Chromosome 19 BAC Clone 7d23, complete sequence Length = 132397 Score = 46.1 bits (23), Expect = 0.16 Identities = 26/27 (96%) Strand = Plus / Minus Query: 270 gcgcatgcatgcatgcatgcgtgcatg 296 |||||| |||||||||||||||||||| Sbjct: 32793 gcgcatacatgcatgcatgcgtgcatg 32767
>emb|AL669968.10| Mouse DNA sequence from clone RP23-475F22 on chromosome 11 Contains a glyceraldehyde-3-phosphate dehydrogenase (Gapd) pseudogene, complete sequence Length = 167170 Score = 46.1 bits (23), Expect = 0.16 Identities = 26/27 (96%) Strand = Plus / Plus Query: 270 gcgcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||||| |||||| Sbjct: 138607 gcgcatgcatgcatgcatgcatgcatg 138633 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 138633 catgcatgcatgcatgcatgcatg 138610
>gb|AC157916.2| Mus musculus chromosome 19, clone RP24-330P23, complete sequence Length = 190666 Score = 46.1 bits (23), Expect = 0.16 Identities = 26/27 (96%) Strand = Plus / Minus Query: 271 cgcatgcatgcatgcatgcgtgcatga 297 ||||||||||||||||||| ||||||| Sbjct: 41544 cgcatgcatgcatgcatgcatgcatga 41518 Score = 40.1 bits (20), Expect = 9.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgt 291 |||||||||||||||||||| Sbjct: 41526 gcatgcatgcatgcatgcgt 41545 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 41519 catgcatgcatgcatgcatgcatg 41542
>gb|AC153820.4| Mus musculus 6 BAC RP23-459L15 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 180996 Score = 46.1 bits (23), Expect = 0.16 Identities = 26/27 (96%) Strand = Plus / Plus Query: 270 gcgcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||||| |||||| Sbjct: 17915 gcgcatgcatgcatgcatgcatgcatg 17941 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 17950 gcatgcatgcatgcatgcatgcatg 17926 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 17925 gcatgcatgcatgcatgcatgcatg 17949 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 17946 gcatgcatgcatgcatgcatgcatg 17922 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 17921 gcatgcatgcatgcatgcatgcatg 17945 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 17942 gcatgcatgcatgcatgcatgcatg 17918
>emb|BX005323.10| Zebrafish DNA sequence from clone DKEY-11F12 in linkage group 7, complete sequence Length = 219799 Score = 46.1 bits (23), Expect = 0.16 Identities = 23/23 (100%) Strand = Plus / Plus Query: 194 caaaatacaaaaaataaaataag 216 ||||||||||||||||||||||| Sbjct: 161876 caaaatacaaaaaataaaataag 161898
>emb|BX005310.6| Zebrafish DNA sequence from clone CH211-214J2 in linkage group 7, complete sequence Length = 221979 Score = 46.1 bits (23), Expect = 0.16 Identities = 23/23 (100%) Strand = Plus / Plus Query: 194 caaaatacaaaaaataaaataag 216 ||||||||||||||||||||||| Sbjct: 97276 caaaatacaaaaaataaaataag 97298
>gb|AC161148.7| Mus musculus BAC clone RP23-358L5 from chromosome 1, complete sequence Length = 181120 Score = 46.1 bits (23), Expect = 0.16 Identities = 23/23 (100%) Strand = Plus / Plus Query: 268 gagcgcatgcatgcatgcatgcg 290 ||||||||||||||||||||||| Sbjct: 153943 gagcgcatgcatgcatgcatgcg 153965 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 270 gcgcatgcatgcatgcatgcg 290 ||||||||||||||||||||| Sbjct: 153966 gcgcatgcatgcatgcatgcg 153946
>gb|AC147612.5| Mus musculus BAC clone RP23-374K9 from 6, complete sequence Length = 190156 Score = 46.1 bits (23), Expect = 0.16 Identities = 23/23 (100%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgca 294 ||||||||||||||||||||||| Sbjct: 122926 gcatgcatgcatgcatgcgtgca 122904 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 271 cgcatgcatgcatgcatgcgtgcat 295 ||||||||||||||||||| ||||| Sbjct: 122908 cgcatgcatgcatgcatgcatgcat 122932
>gb|AC024913.33| Mus musculus BAC Clone 402k12 RPCI-23, complete sequence Length = 197831 Score = 46.1 bits (23), Expect = 0.16 Identities = 26/27 (96%) Strand = Plus / Minus Query: 270 gcgcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||||| |||||| Sbjct: 124615 gcgcatgcatgcatgcatgcatgcatg 124589 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 124588 gcatgcatgcatgcatgcatgcatg 124612 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 124609 gcatgcatgcatgcatgcatgcatg 124585 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 124584 gcatgcatgcatgcatgcatgcatg 124608 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 124605 gcatgcatgcatgcatgcatgcatg 124581 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 124580 gcatgcatgcatgcatgcatgcatg 124604
>gb|AC166773.7| Mus musculus chromosome 7, clone RP24-303J15, complete sequence Length = 193859 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 275 tgcatgcatgcatgcgtgcatg 296 |||||||||||||||||||||| Sbjct: 155849 tgcatgcatgcatgcgtgcatg 155828
>gb|AY779451.1| Eimeria maxima clone USDA-EM-6-40 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 44.1 bits (22), Expect = 0.62 Identities = 28/30 (93%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatgatgca 301 |||||||||||||||||| ||||| ||||| Sbjct: 379 gcatgcatgcatgcatgcatgcatcatgca 350
>gb|AY779450.1| Eimeria maxima clone USDA-EM-6-39 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 44.1 bits (22), Expect = 0.62 Identities = 28/30 (93%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatgatgca 301 |||||||||||||||||| ||||| ||||| Sbjct: 379 gcatgcatgcatgcatgcatgcatcatgca 350
>gb|AY779448.1| Eimeria maxima clone USDA-EM-6-36 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 44.1 bits (22), Expect = 0.62 Identities = 28/30 (93%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatgatgca 301 |||||||||||||||||| ||||| ||||| Sbjct: 379 gcatgcatgcatgcatgcatgcatcatgca 350
>gb|AY779447.1| Eimeria maxima clone USDA-EM-6-35 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 44.1 bits (22), Expect = 0.62 Identities = 28/30 (93%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatgatgca 301 |||||||||||||||||| ||||| ||||| Sbjct: 379 gcatgcatgcatgcatgcatgcatcatgca 350
>gb|AY779442.1| Eimeria maxima clone USDA-EM-6-21 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 950 Score = 44.1 bits (22), Expect = 0.62 Identities = 28/30 (93%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatgatgca 301 |||||||||||||||||| ||||| ||||| Sbjct: 379 gcatgcatgcatgcatgcatgcatcatgca 350
>gb|AY779437.1| Eimeria maxima clone USDA-EM-6-16 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 44.1 bits (22), Expect = 0.62 Identities = 28/30 (93%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatgatgca 301 |||||||||||||||||| ||||| ||||| Sbjct: 379 gcatgcatgcatgcatgcatgcatcatgca 350
>gb|AY779436.1| Eimeria maxima clone USDA-EM-6-13 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 44.1 bits (22), Expect = 0.62 Identities = 28/30 (93%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatgatgca 301 |||||||||||||||||| ||||| ||||| Sbjct: 379 gcatgcatgcatgcatgcatgcatcatgca 350
>gb|AY779429.1| Eimeria maxima clone USDA-EM-5-36 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 44.1 bits (22), Expect = 0.62 Identities = 28/30 (93%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatgatgca 301 |||||||||||||||||| ||||| ||||| Sbjct: 379 gcatgcatgcatgcatgcatgcatcatgca 350
>gb|AY779425.1| Eimeria maxima clone USDA-EM-4-38 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 971 Score = 44.1 bits (22), Expect = 0.62 Identities = 28/30 (93%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatgatgca 301 |||||||||||||||||| ||||| ||||| Sbjct: 379 gcatgcatgcatgcatgcatgcatcatgca 350
>gb|AY779417.1| Eimeria maxima clone USDA-EM-3-56 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 44.1 bits (22), Expect = 0.62 Identities = 28/30 (93%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatgatgca 301 |||||||||||||||||| ||||| ||||| Sbjct: 379 gcatgcatgcatgcatgcatgcatcatgca 350
>gb|AY779416.1| Eimeria maxima clone USDA-EM-3-55 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 44.1 bits (22), Expect = 0.62 Identities = 28/30 (93%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatgatgca 301 |||||||||||||||||| ||||| ||||| Sbjct: 379 gcatgcatgcatgcatgcatgcatcatgca 350
>gb|AY779412.1| Eimeria maxima clone USDA-EM-3-49 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 44.1 bits (22), Expect = 0.62 Identities = 28/30 (93%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatgatgca 301 |||||||||||||||||| ||||| ||||| Sbjct: 379 gcatgcatgcatgcatgcatgcatcatgca 350
>gb|AY779410.1| Eimeria maxima clone USDA-EM-3-2 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 44.1 bits (22), Expect = 0.62 Identities = 28/30 (93%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatgatgca 301 |||||||||||||||||| ||||| ||||| Sbjct: 379 gcatgcatgcatgcatgcatgcatcatgca 350
>gb|AY779408.1| Eimeria maxima clone USDA-EM-3-12 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 44.1 bits (22), Expect = 0.62 Identities = 28/30 (93%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatgatgca 301 |||||||||||||||||| ||||| ||||| Sbjct: 379 gcatgcatgcatgcatgcatgcatcatgca 350
>gb|AY779403.1| Eimeria maxima clone USDA-EM-2-43 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 951 Score = 44.1 bits (22), Expect = 0.62 Identities = 28/30 (93%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatgatgca 301 |||||||||||||||||| ||||| ||||| Sbjct: 379 gcatgcatgcatgcatgcatgcatcatgca 350
>gb|AY779399.1| Eimeria maxima clone USDA-EM-2-115 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 44.1 bits (22), Expect = 0.62 Identities = 28/30 (93%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatgatgca 301 |||||||||||||||||| ||||| ||||| Sbjct: 379 gcatgcatgcatgcatgcatgcatcatgca 350
>gb|AY779396.1| Eimeria maxima clone USDA-EM-2-1 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 950 Score = 44.1 bits (22), Expect = 0.62 Identities = 28/30 (93%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatgatgca 301 |||||||||||||||||| ||||| ||||| Sbjct: 379 gcatgcatgcatgcatgcatgcatcatgca 350
>gb|AY779390.1| Eimeria maxima clone USDA-EM-1-3 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 950 Score = 44.1 bits (22), Expect = 0.62 Identities = 28/30 (93%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatgatgca 301 |||||||||||||||||| ||||| ||||| Sbjct: 379 gcatgcatgcatgcatgcatgcatcatgca 350
>gb|AY779388.1| Eimeria maxima clone USDA-EM-1-18 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 966 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 275 tgcatgcatgcatgcgtgcatg 296 |||||||||||||||||||||| Sbjct: 318 tgcatgcatgcatgcgtgcatg 339
>gb|AY779386.1| Eimeria maxima clone USDA-EM-1-15 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 966 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 275 tgcatgcatgcatgcgtgcatg 296 |||||||||||||||||||||| Sbjct: 318 tgcatgcatgcatgcgtgcatg 339
>gb|AC124333.13| Mus musculus chromosome 1, clone RP24-511E9, complete sequence Length = 185857 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgc 293 |||||||||||||||||||||| Sbjct: 76849 gcatgcatgcatgcatgcgtgc 76870 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Minus Query: 271 cgcatgcatgcatgcatgcgtgcatg 296 ||||||||||||||||||| |||||| Sbjct: 76867 cgcatgcatgcatgcatgcatgcatg 76842 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 76842 catgcatgcatgcatgcatgcatg 76865
>gb|AC167466.6| Mus musculus chromosome 7, clone RP24-220N8, complete sequence Length = 163721 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgc 293 |||||||||||||||||||||| Sbjct: 45457 gcatgcatgcatgcatgcgtgc 45478
>gb|AY024015.1| Oryza sativa microsatellite MRG6340 containing (CATG)X8, closest to marker L131, genomic sequence Length = 232 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatga 297 |||||||||||||||||| ||||||| Sbjct: 125 gcatgcatgcatgcatgcatgcatga 100 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 108 gcatgcatgcatgcatgcatgcatg 132 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 129 gcatgcatgcatgcatgcatgcatg 105 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 104 gcatgcatgcatgcatgcatgcatg 128 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 132 catgcatgcatgcatgcatgcatg 109 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 101 catgcatgcatgcatgcatgcatg 124
>gb|AC145325.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0034E03 map near 50283S, complete sequence Length = 134074 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgc 293 |||||||||||||||||||||| Sbjct: 64248 gcatgcatgcatgcatgcgtgc 64227
>gb|AC154527.2| Mus musculus BAC clone RP23-221K13 from chromosome 14, complete sequence Length = 215802 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatga 297 |||||||||||||||||| ||||||| Sbjct: 120471 gcatgcatgcatgcatgcatgcatga 120446 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcat 295 |||||||||||||||||| ||||| Sbjct: 120450 gcatgcatgcatgcatgcatgcat 120473 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 120447 catgcatgcatgcatgcatgcatg 120470
>gb|AC162902.4| Mus musculus BAC clone RP23-448D23 from chromosome 12, complete sequence Length = 190357 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatga 297 |||||||||||||||||| ||||||| Sbjct: 106002 gcatgcatgcatgcatgcatgcatga 105977 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 105978 catgcatgcatgcatgcatgcatg 106001
>gb|AC163748.6| Mus musculus BAC clone RP23-411N10 from chromosome 9, complete sequence Length = 226254 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgc 293 |||||||||||||||||||||| Sbjct: 38696 gcatgcatgcatgcatgcgtgc 38717
>gb|AC164641.5| Mus musculus BAC clone RP23-393F10 from chromosome 12, complete sequence Length = 198725 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatga 297 |||||||||||||||||| ||||||| Sbjct: 175084 gcatgcatgcatgcatgcatgcatga 175109 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 175108 catgcatgcatgcatgcatgcatg 175085
>gb|AC024696.1| Caenorhabditis elegans cosmid F07B7, complete sequence Length = 40246 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Minus Query: 271 cgcatgcatgcatgcatgcgtgcatg 296 ||||||||||||||||||| |||||| Sbjct: 17268 cgcatgcatgcatgcatgcatgcatg 17243 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 17242 gcatgcatgcatgcatgcatgcatg 17266
>gb|AC150540.2| Bos taurus BAC CH240-385H19 (Children's Hospital Oakland Research Institute Bovine BAC Library (male)) complete sequence Length = 172471 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgc 293 |||||||||||||||||||||| Sbjct: 18991 gcatgcatgcatgcatgcgtgc 18970 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 271 cgcatgcatgcatgcatgcgtgcat 295 ||||||||||||||||||| ||||| Sbjct: 18973 cgcatgcatgcatgcatgcatgcat 18997
>gb|AF130357.2| Mus musculus chromosome X clone CT7-148C10, complete sequence Length = 106724 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatga 297 |||||||||||||||||| ||||||| Sbjct: 23332 gcatgcatgcatgcatgcatgcatga 23307 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 23308 catgcatgcatgcatgcatgcatg 23331
>gb|AC141565.3| Mus musculus BAC clone RP23-160M21 from chromosome 14, complete sequence Length = 210128 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 275 tgcatgcatgcatgcgtgcatg 296 |||||||||||||||||||||| Sbjct: 124734 tgcatgcatgcatgcgtgcatg 124755 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 64921 gcatgcatgcatgcatgcatgcatg 64897 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 64896 gcatgcatgcatgcatgcatgcatg 64920 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 64917 gcatgcatgcatgcatgcatgcatg 64893 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 64892 gcatgcatgcatgcatgcatgcatg 64916 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcat 295 |||||||||||||||||| ||||| Sbjct: 64900 gcatgcatgcatgcatgcatgcat 64923
>gb|AC130828.4| Mus musculus BAC clone RP23-406H14 from chromosome 6, complete sequence Length = 182673 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatga 297 |||||||||||||||||| ||||||| Sbjct: 56666 gcatgcatgcatgcatgcatgcatga 56691 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 56690 catgcatgcatgcatgcatgcatg 56667 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcat 295 |||||||||||||||||| ||||| Sbjct: 56687 gcatgcatgcatgcatgcatgcat 56664
>gb|AC124211.2| Mus musculus chromosome X clone CT7-497M13 map qA7.1, complete sequence Length = 114873 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatga 297 |||||||||||||||||| ||||||| Sbjct: 70832 gcatgcatgcatgcatgcatgcatga 70807 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 70808 catgcatgcatgcatgcatgcatg 70831
>gb|AC124717.3| Mus musculus BAC clone RP24-147K15 from chromosome 18, complete sequence Length = 204165 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatga 297 |||||||||||||||||| ||||||| Sbjct: 18179 gcatgcatgcatgcatgcatgcatga 18204 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 18203 catgcatgcatgcatgcatgcatg 18180 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcat 295 |||||||||||||||||| ||||| Sbjct: 18200 gcatgcatgcatgcatgcatgcat 18177
>gb|AC155074.12| Mus musculus chromosome 15, clone RP24-127H11, complete sequence Length = 184795 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Minus Query: 271 cgcatgcatgcatgcatgcgtgcatg 296 ||||||||||||||||||| |||||| Sbjct: 38850 cgcatgcatgcatgcatgcatgcatg 38825 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||||| |||| Sbjct: 38832 gcatgcatgcatgcatgcgtacatg 38856 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 38825 catgcatgcatgcatgcatgcatg 38848
>gb|AC161453.6| Mus musculus BAC clone RP23-403B2 from chromosome 14, complete sequence Length = 205636 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 275 tgcatgcatgcatgcgtgcatg 296 |||||||||||||||||||||| Sbjct: 106731 tgcatgcatgcatgcgtgcatg 106710
>gb|U64843.2| Caenorhabditis elegans cosmid K06C4, complete sequence Length = 43177 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Minus Query: 271 cgcatgcatgcatgcatgcgtgcatg 296 ||||||||||||||||||| |||||| Sbjct: 14924 cgcatgcatgcatgcatgcatgcatg 14899 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 14898 gcatgcatgcatgcatgcatgcatg 14922
>gb|AC135016.3| Mus musculus BAC clone RP24-244B4 from chromosome 18, complete sequence Length = 177193 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatga 297 |||||||||||||||||| ||||||| Sbjct: 33295 gcatgcatgcatgcatgcatgcatga 33320 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 33316 gcatgcatgcatgcatgcatgcatg 33292 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 33291 gcatgcatgcatgcatgcatgcatg 33315 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 33312 gcatgcatgcatgcatgcatgcatg 33288 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 33319 catgcatgcatgcatgcatgcatg 33296 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 33288 catgcatgcatgcatgcatgcatg 33311
>emb|CR974462.5| Mouse DNA sequence from clone RP23-222K15 on chromosome 17, complete sequence Length = 228057 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatga 297 |||||||||||||||||| ||||||| Sbjct: 111438 gcatgcatgcatgcatgcatgcatga 111463 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 111462 catgcatgcatgcatgcatgcatg 111439 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcat 295 |||||||||||||||||| ||||| Sbjct: 111459 gcatgcatgcatgcatgcatgcat 111436
>emb|CT025643.4| Mouse DNA sequence from clone RP24-386L23 on chromosome 13, complete sequence Length = 148821 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatga 297 |||||||||||||||||| ||||||| Sbjct: 76371 gcatgcatgcatgcatgcatgcatga 76346 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 274 atgcatgcatgcatgcgtgcatga 297 |||||||||||||||| ||||||| Sbjct: 76489 atgcatgcatgcatgcatgcatga 76466 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 274 atgcatgcatgcatgcgtgcatga 297 |||||||||||||||| ||||||| Sbjct: 76453 atgcatgcatgcatgcatgcatga 76430 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcat 295 |||||||||||||||||| ||||| Sbjct: 76350 gcatgcatgcatgcatgcatgcat 76373 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 76347 catgcatgcatgcatgcatgcatg 76370
>emb|CR538723.1| M.truncatula DNA sequence from clone MTH2-27D24 on chromosome 3, complete sequence Length = 106695 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Plus Query: 202 aaaaaataaaataaggcaaatgattt 227 ||||||||||||||||||||| |||| Sbjct: 94563 aaaaaataaaataaggcaaattattt 94588
>emb|CR538722.1| M.truncatula DNA sequence from clone MTH2-11A20 on chromosome 3, complete sequence Length = 118829 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Plus Query: 202 aaaaaataaaataaggcaaatgattt 227 ||||||||||||||||||||| |||| Sbjct: 14507 aaaaaataaaataaggcaaattattt 14532
>gb|AC084162.3| Mus musculus strain C57BL6/J chromosome 5 clone RP23-11P12, complete sequence Length = 159180 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Plus Query: 271 cgcatgcatgcatgcatgcgtgcatg 296 ||||||||||||||||||| |||||| Sbjct: 37588 cgcatgcatgcatgcatgcatgcatg 37613 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 37614 gcatgcatgcatgcatgcatgcatg 37590 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtg 292 ||||||||||||||||||||| Sbjct: 37606 gcatgcatgcatgcatgcgtg 37586 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcat 295 |||||||||||||||||| ||||| Sbjct: 37593 gcatgcatgcatgcatgcatgcat 37616
>gb|AC123074.2| Mus musculus BAC clone RP23-168H19 from 10, complete sequence Length = 210189 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 268 gagcgcatgcatgcatgcatgc 289 |||||||||||||||||||||| Sbjct: 63695 gagcgcatgcatgcatgcatgc 63716
>gb|AC116178.4| Mus musculus BAC clone RP23-28O18 from 14, complete sequence Length = 195306 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 275 tgcatgcatgcatgcgtgcatg 296 |||||||||||||||||||||| Sbjct: 17061 tgcatgcatgcatgcgtgcatg 17040
>gb|AC102432.9| Mus musculus chromosome 19, clone RP24-114A21, complete sequence Length = 199240 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgc 293 |||||||||||||||||||||| Sbjct: 68172 gcatgcatgcatgcatgcgtgc 68151
>gb|AC108812.9| Mus musculus chromosome 18, clone RP23-417M2, complete sequence Length = 202340 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatga 297 |||||||||||||||||| ||||||| Sbjct: 125481 gcatgcatgcatgcatgcatgcatga 125506 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 125502 gcatgcatgcatgcatgcatgcatg 125478 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 125477 gcatgcatgcatgcatgcatgcatg 125501 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 125498 gcatgcatgcatgcatgcatgcatg 125474 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 125505 catgcatgcatgcatgcatgcatg 125482 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 125474 catgcatgcatgcatgcatgcatg 125497
>gb|AC108423.10| Mus musculus chromosome 16, clone RP23-443N12, complete sequence Length = 192819 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatga 297 |||||||||||||||||| ||||||| Sbjct: 184859 gcatgcatgcatgcatgcatgcatga 184884 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 184883 catgcatgcatgcatgcatgcatg 184860
>gb|AC161413.5| Mus musculus chromosome 19, clone RP23-106D17, complete sequence Length = 215356 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgc 293 |||||||||||||||||||||| Sbjct: 62892 gcatgcatgcatgcatgcgtgc 62913
>gb|AC141112.7| Medicago truncatula clone mth2-15m12, complete sequence Length = 135248 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 274 atgcatgcatgcatgcgtgcat 295 |||||||||||||||||||||| Sbjct: 85784 atgcatgcatgcatgcgtgcat 85805
>gb|AC154601.3| Mus musculus BAC clone RP23-342J18 from chromosome 16, complete sequence Length = 189457 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatga 297 |||||||||||||||||| ||||||| Sbjct: 4885 gcatgcatgcatgcatgcatgcatga 4910 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 4909 catgcatgcatgcatgcatgcatg 4886
>emb|CR450696.6| Zebrafish DNA sequence from clone CH211-147K9 in linkage group 25, complete sequence Length = 187055 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 195 aaaatacaaaaaataaaataag 216 |||||||||||||||||||||| Sbjct: 76958 aaaatacaaaaaataaaataag 76979
>emb|BX000436.5| Mouse DNA sequence from clone RP23-182F17 on chromosome 11, complete sequence Length = 64667 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 275 tgcatgcatgcatgcgtgcatg 296 |||||||||||||||||||||| Sbjct: 47535 tgcatgcatgcatgcgtgcatg 47514
>emb|BX682552.9| Zebrafish DNA sequence from clone DKEY-120C6 in linkage group 3, complete sequence Length = 228044 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgc 293 |||||||||||||||||||||| Sbjct: 27230 gcatgcatgcatgcatgcgtgc 27209 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 271 cgcatgcatgcatgcatgcgtgcat 295 ||||||||||||||||||| ||||| Sbjct: 27212 cgcatgcatgcatgcatgcatgcat 27236 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||| |||||||||| Sbjct: 27226 gcatgcatgcatgcgtgcgtgcatg 27202
>dbj|AK140551.1| Mus musculus 10 days neonate cerebellum cDNA, RIKEN full-length enriched library, clone:B930026D16 product:unclassifiable, full insert sequence Length = 1136 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatga 297 |||||||||||||||||| ||||||| Sbjct: 273 gcatgcatgcatgcatgcatgcatga 298 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatga 297 |||||||||||||||||| ||||||| Sbjct: 294 gcatgcatgcatgcatgcatgcatga 269 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 297 catgcatgcatgcatgcatgcatg 274 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 270 catgcatgcatgcatgcatgcatg 293
>gb|AC160561.2| Mus musculus BAC clone RP23-102D22 from chromosome 12, complete sequence Length = 204231 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatga 297 |||||||||||||||||| ||||||| Sbjct: 53717 gcatgcatgcatgcatgcatgcatga 53742 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 53741 catgcatgcatgcatgcatgcatg 53718 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcat 295 |||||||||||||||||| ||||| Sbjct: 53738 gcatgcatgcatgcatgcatgcat 53715
>gb|AC155312.2| Mus musculus BAC clone RP23-411F11 from chromosome 12, complete sequence Length = 197795 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatga 297 |||||||||||||||||| ||||||| Sbjct: 193567 gcatgcatgcatgcatgcatgcatga 193542 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 193543 catgcatgcatgcatgcatgcatg 193566
>gb|AC154713.2| Mus musculus BAC clone RP23-129G17 from chromosome 13, complete sequence Length = 197815 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgc 293 |||||||||||||||||||||| Sbjct: 749 gcatgcatgcatgcatgcgtgc 728
>gb|AC137146.9| Mus musculus chromosome 1, clone RP24-358I14, complete sequence Length = 189466 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Plus Query: 271 cgcatgcatgcatgcatgcgtgcatg 296 ||||||||||||||||||| |||||| Sbjct: 9156 cgcatgcatgcatgcatgcatgcatg 9181 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgc 293 |||||||||||||||||||||| Sbjct: 9174 gcatgcatgcatgcatgcgtgc 9153 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 9181 catgcatgcatgcatgcatgcatg 9158
>dbj|AK078684.1| Mus musculus adult male eyeball cDNA, RIKEN full-length enriched library, clone:7530406I19 product:unclassifiable, full insert sequence Length = 3453 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatga 297 |||||||||||||||||| ||||||| Sbjct: 1851 gcatgcatgcatgcatgcatgcatga 1876 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 1872 gcatgcatgcatgcatgcatgcatg 1848 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 1847 gcatgcatgcatgcatgcatgcatg 1871 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 1868 gcatgcatgcatgcatgcatgcatg 1844 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 1875 catgcatgcatgcatgcatgcatg 1852 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 1844 catgcatgcatgcatgcatgcatg 1867
>dbj|AK036810.1| Mus musculus adult female vagina cDNA, RIKEN full-length enriched library, clone:9930013M16 product:hypothetical ARM repeat structure containing protein, full insert sequence Length = 1773 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Plus Query: 271 cgcatgcatgcatgcatgcgtgcatg 296 ||||||||||||||||||| |||||| Sbjct: 1560 cgcatgcatgcatgcatgcatgcatg 1585 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||||| |||| Sbjct: 1578 gcatgcatgcatgcatgcgtacatg 1554 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 1585 catgcatgcatgcatgcatgcatg 1562
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgc 293 |||||||||||||||||||||| Sbjct: 14762812 gcatgcatgcatgcatgcgtgc 14762833 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 275 tgcatgcatgcatgcgtgcatgatg 299 ||||||||||||||| ||||||||| Sbjct: 21108448 tgcatgcatgcatgcatgcatgatg 21108472 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtg 292 ||||||||||||||||||||| Sbjct: 15917286 gcatgcatgcatgcatgcgtg 15917306 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 26702626 catgcatgcatgcatgcatgcatg 26702603 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 26702603 catgcatgcatgcatgcatgcatg 26702626 Score = 40.1 bits (20), Expect = 9.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 276 gcatgcatgcatgcgtgcat 295 |||||||||||||||||||| Sbjct: 22714171 gcatgcatgcatgcgtgcat 22714190
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatga 297 |||||||||||||||||| ||||||| Sbjct: 22326348 gcatgcatgcatgcatgcatgcatga 22326323 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 22326331 gcatgcatgcatgcatgcatgcatg 22326355 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 22326352 gcatgcatgcatgcatgcatgcatg 22326328 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 22326327 gcatgcatgcatgcatgcatgcatg 22326351 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 22326355 catgcatgcatgcatgcatgcatg 22326332 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 22326324 catgcatgcatgcatgcatgcatg 22326347
>emb|BX649552.3| Zebrafish DNA sequence from clone CH211-91I13 in linkage group 18, complete sequence Length = 163544 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 194 caaaatacaaaaaataaaataa 215 |||||||||||||||||||||| Sbjct: 39692 caaaatacaaaaaataaaataa 39671
>gb|AC160725.1| Ornithorhynchus anatinus chromosome UNK clone OABb-130A1, complete sequence Length = 108108 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 196 aaatacaaaaaataaaataagg 217 |||||||||||||||||||||| Sbjct: 50217 aaatacaaaaaataaaataagg 50238
>gb|AC154470.2| Mus musculus BAC clone RP23-193P13 from chromosome 13, complete sequence Length = 216294 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatga 297 |||||||||||||||||| ||||||| Sbjct: 13479 gcatgcatgcatgcatgcatgcatga 13454 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 274 atgcatgcatgcatgcgtgcatga 297 |||||||||||||||| ||||||| Sbjct: 13597 atgcatgcatgcatgcatgcatga 13574 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 274 atgcatgcatgcatgcgtgcatga 297 |||||||||||||||| ||||||| Sbjct: 13561 atgcatgcatgcatgcatgcatga 13538 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcat 295 |||||||||||||||||| ||||| Sbjct: 13458 gcatgcatgcatgcatgcatgcat 13481 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 13455 catgcatgcatgcatgcatgcatg 13478
>gb|AC154183.2| Mus musculus BAC clone RP23-474E16 from chromosome 17, complete sequence Length = 181773 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatga 297 |||||||||||||||||| ||||||| Sbjct: 10977 gcatgcatgcatgcatgcatgcatga 11002 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatga 297 |||||||||||||||||| ||||||| Sbjct: 10998 gcatgcatgcatgcatgcatgcatga 10973 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 11001 catgcatgcatgcatgcatgcatg 10978 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 10974 catgcatgcatgcatgcatgcatg 10997
>gb|AC148019.5| Mus musculus BAC clone RP23-12B6 from chromosome 18, complete sequence Length = 211149 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatga 297 |||||||||||||||||| ||||||| Sbjct: 61311 gcatgcatgcatgcatgcatgcatga 61286 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcat 295 |||||||||||||||||| ||||| Sbjct: 61290 gcatgcatgcatgcatgcatgcat 61313 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 61287 catgcatgcatgcatgcatgcatg 61310
>gb|AC156938.3| Mus musculus BAC clone RP23-314M12 from chromosome 14, complete sequence Length = 207534 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 275 tgcatgcatgcatgcgtgcatg 296 |||||||||||||||||||||| Sbjct: 144408 tgcatgcatgcatgcgtgcatg 144387
>gb|AC092936.9| Homo sapiens 12 BAC RP11-286J13 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 217112 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Plus Query: 271 cgcatgcatgcatgcatgcgtgcatg 296 ||||||||||||||||||| |||||| Sbjct: 70243 cgcatgcatgcatgcatgcatgcatg 70268 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 70268 catgcatgcatgcatgcatgcatg 70245 Score = 40.1 bits (20), Expect = 9.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgt 291 |||||||||||||||||||| Sbjct: 70261 gcatgcatgcatgcatgcgt 70242
>gb|AF446061.1| Eimeria maxima isolate C internal transcribed spacer 1, complete sequence Length = 544 Score = 44.1 bits (22), Expect = 0.62 Identities = 28/30 (93%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatgatgca 301 |||||||||||||||||| ||||| ||||| Sbjct: 426 gcatgcatgcatgcatgcatgcatcatgca 397
>gb|AC167668.1| Mus musculus BAC clone RP24-241I19 from chromosome 14, complete sequence Length = 173679 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 275 tgcatgcatgcatgcgtgcatg 296 |||||||||||||||||||||| Sbjct: 71334 tgcatgcatgcatgcgtgcatg 71355
>gb|AC103644.15| Mus musculus chromosome 7, clone RP24-361F3, complete sequence Length = 171338 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 275 tgcatgcatgcatgcgtgcatg 296 |||||||||||||||||||||| Sbjct: 45599 tgcatgcatgcatgcgtgcatg 45578
>dbj|AP003630.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0566A10 Length = 174367 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatga 297 |||||||||||||||||| ||||||| Sbjct: 104771 gcatgcatgcatgcatgcatgcatga 104746 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 104754 gcatgcatgcatgcatgcatgcatg 104778 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 104775 gcatgcatgcatgcatgcatgcatg 104751 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 104750 gcatgcatgcatgcatgcatgcatg 104774 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 104778 catgcatgcatgcatgcatgcatg 104755 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 104747 catgcatgcatgcatgcatgcatg 104770
>gb|AY789595.1| Tripsacum andersonii FL1 gene, partial cds Length = 939 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Minus Query: 271 cgcatgcatgcatgcatgcgtgcatg 296 ||||||||||||||||||| |||||| Sbjct: 511 cgcatgcatgcatgcatgcatgcatg 486 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 485 gcatgcatgcatgcatgcatgcatg 509 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcat 295 |||||||||||||||||| ||||| Sbjct: 506 gcatgcatgcatgcatgcatgcat 483
>emb|AL929254.12| Mouse DNA sequence from clone RP23-456I1 on chromosome 2, complete sequence Length = 222104 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgc 293 |||||||||||||||||||||| Sbjct: 221038 gcatgcatgcatgcatgcgtgc 221017 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcat 295 |||||||||||||| ||||||||| Sbjct: 221034 gcatgcatgcatgcgtgcgtgcat 221011
>gb|AC154552.2| Mus musculus BAC clone RP23-414P13 from 13, complete sequence Length = 187806 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgc 293 |||||||||||||||||||||| Sbjct: 47998 gcatgcatgcatgcatgcgtgc 48019
>emb|BX649294.7| Zebrafish DNA sequence from clone CH211-223C9 in linkage group 22, complete sequence Length = 209223 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 194 caaaatacaaaaaataaaataa 215 |||||||||||||||||||||| Sbjct: 99449 caaaatacaaaaaataaaataa 99428
>gb|AC154388.4| Mus musculus BAC clone RP23-14P7 from chromosome 14, complete sequence Length = 246800 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgc 293 |||||||||||||||||||||| Sbjct: 28072 gcatgcatgcatgcatgcgtgc 28051
>gb|AF100956.1|AF100956 Mus musculus major histocompatibility locus class II region; Fas-binding protein Daxx (DAXX) gene, partial cds; Bing1 (BING1), tapasin (tapasin), RalGDS-like factor (RLF), KE2 (KE2), BING4 (BING4), beta1, 3-galactosyl transferase (beta1,3-galactosyl transferase), ribosomal protein subunit S18 (RPS18), Sacm21 (Sacm21), H2K1(b) (H2-K1(b)), RING1 (RING1), KE6a (KE6a), KE4 (KE4), RXRbeta (RXRbeta), collagen alpha-2 (XI) (COLA11A2), H2-O alpha (H2-Oalpha), RING3 (RING3), H2-M alpha (H2-M alpha), H2-M beta 2 (H2-M beta2), and H2-M beta1 (H2-M beta1) genes, complete cds; and LMP 2 gene, partial cds Length = 273800 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatga 297 |||||||||||||||||| ||||||| Sbjct: 104919 gcatgcatgcatgcatgcatgcatga 104944 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 104943 catgcatgcatgcatgcatgcatg 104920 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcat 295 |||||||||||||||||| ||||| Sbjct: 104940 gcatgcatgcatgcatgcatgcat 104917
>emb|AL591542.20| Mouse DNA sequence from clone RP23-321M14 on chromosome 2, complete sequence Length = 197190 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatga 297 |||||||||||||||||| ||||||| Sbjct: 115966 gcatgcatgcatgcatgcatgcatga 115941 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 115942 catgcatgcatgcatgcatgcatg 115965
>emb|AL591411.14| Mouse DNA sequence from clone RP23-428M13 on chromosome 2, complete sequence Length = 155889 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgc 293 |||||||||||||||||||||| Sbjct: 150986 gcatgcatgcatgcatgcgtgc 150965
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgc 293 |||||||||||||||||||||| Sbjct: 14843249 gcatgcatgcatgcatgcgtgc 14843270 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 275 tgcatgcatgcatgcgtgcatgatg 299 ||||||||||||||| ||||||||| Sbjct: 21418689 tgcatgcatgcatgcatgcatgatg 21418713 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtg 292 ||||||||||||||||||||| Sbjct: 16004662 gcatgcatgcatgcatgcgtg 16004682 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 27027689 catgcatgcatgcatgcatgcatg 27027666 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 27027666 catgcatgcatgcatgcatgcatg 27027689 Score = 40.1 bits (20), Expect = 9.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 276 gcatgcatgcatgcgtgcat 295 |||||||||||||||||||| Sbjct: 23024082 gcatgcatgcatgcgtgcat 23024101
>emb|AL845430.12| Mouse DNA sequence from clone RP23-402L5 on chromosome 2, complete sequence Length = 201232 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 275 tgcatgcatgcatgcgtgcatg 296 |||||||||||||||||||||| Sbjct: 1588 tgcatgcatgcatgcgtgcatg 1609
>emb|CT009699.13| Mouse DNA sequence from clone RP23-119C14 on chromosome 9, complete sequence Length = 192913 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 275 tgcatgcatgcatgcgtgcatg 296 |||||||||||||||||||||| Sbjct: 56412 tgcatgcatgcatgcgtgcatg 56433
>emb|CT010520.15| Mouse DNA sequence from clone RP23-349A19 on chromosome 14, complete sequence Length = 175582 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgc 293 |||||||||||||||||||||| Sbjct: 24940 gcatgcatgcatgcatgcgtgc 24961
>emb|AL844846.11| Mouse DNA sequence from clone RP23-358I19 on chromosome 2, complete sequence Length = 209013 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgc 293 |||||||||||||||||||||| Sbjct: 72631 gcatgcatgcatgcatgcgtgc 72610 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcat 295 |||||||||||||| ||||||||| Sbjct: 72627 gcatgcatgcatgcgtgcgtgcat 72604
>dbj|AP002983.1| Lotus japonicus chloroplast DNA, complete genome Length = 150519 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 4 actttgatttggtattttggtt 25 |||||||||||||||||||||| Sbjct: 42534 actttgatttggtattttggtt 42513
>emb|CR956393.14| Pig DNA sequence from clone CH242-163M14 on chromosome 17, complete sequence Length = 195684 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatga 297 |||||||||||||||||| ||||||| Sbjct: 95668 gcatgcatgcatgcatgcatgcatga 95693 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 95692 catgcatgcatgcatgcatgcatg 95669 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcat 295 |||||||||||||||||| ||||| Sbjct: 95689 gcatgcatgcatgcatgcatgcat 95666
>gb|AY543543.1| Triticum aestivum expansin EXPB9 mRNA, complete cds Length = 1060 Score = 44.1 bits (22), Expect = 0.62 Identities = 43/50 (86%) Strand = Plus / Minus Query: 379 tccagttggccgggatgacattgttggccaccagcttcttgccggagtcg 428 |||||||||| |||||||| ||| || | || |||||| ||||||||||| Sbjct: 881 tccagttggcggggatgacgttgctgacgacgagcttcctgccggagtcg 832
>dbj|AP006646.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT04I09, TM0269b, complete sequence Length = 66087 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 4 actttgatttggtattttggtt 25 |||||||||||||||||||||| Sbjct: 52790 actttgatttggtattttggtt 52811
>gb|AC159884.2| Mus musculus BAC clone RP24-416O24 from chromosome 9, complete sequence Length = 219361 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 275 tgcatgcatgcatgcgtgcatg 296 |||||||||||||||||||||| Sbjct: 44088 tgcatgcatgcatgcgtgcatg 44109
>emb|AL845273.7| Mouse DNA sequence from clone RP23-334D15 on chromosome 2, complete sequence Length = 158861 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 275 tgcatgcatgcatgcgtgcatg 296 |||||||||||||||||||||| Sbjct: 158449 tgcatgcatgcatgcgtgcatg 158470
>emb|AL662932.10| Mouse DNA sequence from clone RP23-15B7 on chromosome X, complete sequence Length = 218740 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Minus Query: 271 cgcatgcatgcatgcatgcgtgcatg 296 ||||||||||| |||||||||||||| Sbjct: 172422 cgcatgcatgcgtgcatgcgtgcatg 172397 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 271 cgcatgcatgcatgcatgcgtgca 294 |||||||| ||||||||||||||| Sbjct: 172403 cgcatgcacgcatgcatgcgtgca 172426
>emb|AL672241.6| Mouse DNA sequence from clone RP23-147D3 on chromosome 2, complete sequence Length = 197925 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgc 293 |||||||||||||||||||||| Sbjct: 25039 gcatgcatgcatgcatgcgtgc 25018
>emb|AL671335.12| Mouse DNA sequence from clone RP23-130J1 on chromosome X, complete sequence Length = 175336 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatga 297 |||||||||||||||||| ||||||| Sbjct: 121662 gcatgcatgcatgcatgcatgcatga 121637 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 121638 catgcatgcatgcatgcatgcatg 121661
>emb|AL844530.7| Mouse DNA sequence from clone RP23-248L2 on chromosome 2, complete sequence Length = 169779 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Minus Query: 270 gcgcatgcatgcatgcatgcgtgcat 295 |||||||||||||||||||| ||||| Sbjct: 48186 gcgcatgcatgcatgcatgcatgcat 48161
>emb|AL807394.9| Mouse DNA sequence from clone RP23-304N5 on chromosome X, complete sequence Length = 161674 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatga 297 |||||||||||||||||| ||||||| Sbjct: 84797 gcatgcatgcatgcatgcatgcatga 84772 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 84773 catgcatgcatgcatgcatgcatg 84796
>gb|AC137849.11| Mus musculus chromosome 1, clone RP24-124J24, complete sequence Length = 178764 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtg 292 ||||||||||||||||||||| Sbjct: 145206 gcatgcatgcatgcatgcgtg 145226
>gb|AC108429.11| Mus musculus chromosome 7, clone RP23-161B5, complete sequence Length = 186903 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 26855 gcatgcatgcatgcatgcatgcatg 26831 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 26830 gcatgcatgcatgcatgcatgcatg 26854 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 26851 gcatgcatgcatgcatgcatgcatg 26827 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 26826 gcatgcatgcatgcatgcatgcatg 26850 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 26847 gcatgcatgcatgcatgcatgcatg 26823 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 26822 gcatgcatgcatgcatgcatgcatg 26846 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcat 295 |||||||||||||||||| ||||| Sbjct: 26843 gcatgcatgcatgcatgcatgcat 26820
>gb|AC110035.8| Mus musculus chromosome 1, clone RP23-237M24, complete sequence Length = 172559 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtg 292 ||||||||||||||||||||| Sbjct: 19039 gcatgcatgcatgcatgcgtg 19059
>gb|AC164069.9| Mus musculus chromosome 15, clone RP23-422H17, complete sequence Length = 216364 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 59420 gcatgcatgcatgcatgcatgcatg 59396 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 59395 gcatgcatgcatgcatgcatgcatg 59419 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 59416 gcatgcatgcatgcatgcatgcatg 59392 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcat 295 |||||||||||||||||| ||||| Sbjct: 59399 gcatgcatgcatgcatgcatgcat 59422 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 59392 catgcatgcatgcatgcatgcatg 59415
>gb|AC124664.14| Mus musculus chromosome 1, clone RP23-103B18, complete sequence Length = 220456 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| ||||||| Sbjct: 205061 gcatgcatgcatgcatgtgtgcatg 205085
>gb|AY779455.1| Eimeria maxima clone USDA-EM-6-8 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 344 gcatgcatgcatgcatgcatgcatg 320 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 319 gcatgcatgcatgcatgcatgcatg 343
>gb|AY779452.1| Eimeria maxima clone USDA-EM-6-47 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 344 gcatgcatgcatgcatgcatgcatg 320 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 319 gcatgcatgcatgcatgcatgcatg 343
>gb|AY779445.1| Eimeria maxima clone USDA-EM-6-31 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 951 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 326 gcatgcatgcatgcatgcatgcatg 302 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 301 gcatgcatgcatgcatgcatgcatg 325
>gb|AY779444.1| Eimeria maxima clone USDA-EM-6-3 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 973 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 330 gcatgcatgcatgcatgcatgcatg 306 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 305 gcatgcatgcatgcatgcatgcatg 329
>gb|AY779439.1| Eimeria maxima clone USDA-EM-6-18 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 344 gcatgcatgcatgcatgcatgcatg 320 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 319 gcatgcatgcatgcatgcatgcatg 343
>gb|AY779433.1| Eimeria maxima clone USDA-EM-5-43 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 968 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 344 gcatgcatgcatgcatgcatgcatg 320 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 319 gcatgcatgcatgcatgcatgcatg 343
>gb|AY779421.1| Eimeria maxima clone USDA-EM-4-16 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 344 gcatgcatgcatgcatgcatgcatg 320 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 319 gcatgcatgcatgcatgcatgcatg 343
>gb|AY779415.1| Eimeria maxima clone USDA-EM-3-54 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 973 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 330 gcatgcatgcatgcatgcatgcatg 306 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 305 gcatgcatgcatgcatgcatgcatg 329
>gb|AC132830.12| Mus musculus chromosome 1, clone RP24-566B6, complete sequence Length = 205300 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| ||||||| Sbjct: 60509 gcatgcatgcatgcatgtgtgcatg 60533
>gb|AC164310.2| Mus musculus BAC clone RP23-139E15 from chromosome 8, complete sequence Length = 204269 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 195 aaaatacaaaaaataaaataa 215 ||||||||||||||||||||| Sbjct: 78110 aaaatacaaaaaataaaataa 78130
>gb|AC151980.3| Mus musculus BAC clone RP24-83M3 from chromosome 8, complete sequence Length = 253457 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 9172 gcatgcatgcatgcatgcatgcatg 9196 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 9196 catgcatgcatgcatgcatgcatg 9173 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcat 295 |||||||||||||||||| ||||| Sbjct: 9193 gcatgcatgcatgcatgcatgcat 9170
>gb|AC166158.3| Mus musculus BAC clone RP24-244P14 from chromosome 1, complete sequence Length = 170234 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 271 cgcatgcatgcatgcatgcgtgcat 295 ||||||||||||||||||| ||||| Sbjct: 34629 cgcatgcatgcatgcatgcatgcat 34653 Score = 40.1 bits (20), Expect = 9.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgt 291 |||||||||||||||||||| Sbjct: 34647 gcatgcatgcatgcatgcgt 34628
>gb|AC167971.3| Mus musculus BAC clone RP24-439I22 from chromosome 7, complete sequence Length = 198057 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| ||||||| Sbjct: 71247 gcatgcatgcatgcatgtgtgcatg 71271
>gb|AY796304.1| Homo sapiens transforming growth factor, beta receptor III (betaglycan, 300kDa) (TGFBR3) gene, complete cds Length = 226174 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 195 aaaatacaaaaaataaaataa 215 ||||||||||||||||||||| Sbjct: 204866 aaaatacaaaaaataaaataa 204846
>gb|AF405701.1| Synthetic construct legume box RY repeat motif sequence Length = 82 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 46 gcatgcatgcatgcatgcatgcatg 70 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 67 gcatgcatgcatgcatgcatgcatg 43 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 42 gcatgcatgcatgcatgcatgcatg 66 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 63 gcatgcatgcatgcatgcatgcatg 39 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 38 gcatgcatgcatgcatgcatgcatg 62 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 59 gcatgcatgcatgcatgcatgcatg 35 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 34 gcatgcatgcatgcatgcatgcatg 58 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 55 gcatgcatgcatgcatgcatgcatg 31 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 272 gcatgcatgcatgcatgcgtgcatg 296 |||||||||||||||||| |||||| Sbjct: 30 gcatgcatgcatgcatgcatgcatg 54 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 273 catgcatgcatgcatgcgtgcatg 296 ||||||||||||||||| |||||| Sbjct: 70 catgcatgcatgcatgcatgcatg 47 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 7,563,066 Number of Sequences: 3902068 Number of extensions: 7563066 Number of successful extensions: 460767 Number of sequences better than 10.0: 742 Number of HSP's better than 10.0 without gapping: 757 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 449991 Number of HSP's gapped (non-prelim): 9315 length of query: 704 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 681 effective length of database: 17,143,297,704 effective search space: 11674585736424 effective search space used: 11674585736424 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
