ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasdg14
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|BT009431.1| Triticum aestivum clone wlmk1.pk0035.e4:fis, full... 228 6e-57
2gb|AC157491.12| Mus musculus chromosome 8, clone RP24-289G15, co... 40 2.8
3gb|AC099849.4| Homo sapiens chromosome 18, clone RP11-863N1, com... 40 2.8
4gb|AC023932.11| Homo sapiens chromosome 18, clone RP11-510D21, c... 40 2.8
5gb|AC006546.9| Homo sapiens chromosome 18 clone p1-1029 map 18q1... 40 2.8
6gb|AC006545.3| Homo sapiens chromosome 18 clone p1-1028 map 18q1... 40 2.8

>gb|BT009431.1| Triticum aestivum clone wlmk1.pk0035.e4:fis, full insert mRNA
            sequence
          Length = 1652

 Score =  228 bits (115), Expect = 6e-57
 Identities = 146/155 (94%), Gaps = 1/155 (0%)
 Strand = Plus / Minus

                                                                        
Query: 51   acaaatccagctccgactttatccttccgccttacaaattacatttgatcattccattgc 110
            |||||||||||||||||||||| ||| ||| ||||| |||||||||||||||||  ||||
Sbjct: 1576 acaaatccagctccgactttattctttcgctttacagattacatttgatcattcggttgc 1517

                                                                        
Query: 111  acttattccgatcttactcgtacccaccagaatacaaggtggggggtcatactttgctgt 170
            ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 1516 acttattccgatcttactcgtacccaccagaatacaagg-ggggggtcatactttgctgt 1458

                                               
Query: 171  tcatcgtagctggaggcagaagaagaattacagcc 205
            |||||  ||||||||||||||||||||||||||||
Sbjct: 1457 tcatcaaagctggaggcagaagaagaattacagcc 1423



to top

>gb|AC157491.12| Mus musculus chromosome 8, clone RP24-289G15, complete sequence
          Length = 168377

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 24    ctcctatgctgcaccattacatag 47
             ||||||||||||| ||||||||||
Sbjct: 95336 ctcctatgctgcatcattacatag 95313



to top

>gb|AC099849.4| Homo sapiens chromosome 18, clone RP11-863N1, complete sequence
          Length = 200606

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 93     atttgatcattccattgcac 112
              ||||||||||||||||||||
Sbjct: 137918 atttgatcattccattgcac 137899



to top

>gb|AC023932.11| Homo sapiens chromosome 18, clone RP11-510D21, complete sequence
          Length = 166125

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 85    caaattacatttgatcattccatt 108
             |||||||||||| |||||||||||
Sbjct: 78514 caaattacattttatcattccatt 78491



to top

>gb|AC006546.9| Homo sapiens chromosome 18 clone p1-1029 map 18q11, complete sequence
          Length = 79128

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 93    atttgatcattccattgcac 112
             ||||||||||||||||||||
Sbjct: 66460 atttgatcattccattgcac 66441



to top

>gb|AC006545.3| Homo sapiens chromosome 18 clone p1-1028 map 18q11, complete sequence
          Length = 78735

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 93    atttgatcattccattgcac 112
             ||||||||||||||||||||
Sbjct: 52210 atttgatcattccattgcac 52191


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,712,981
Number of Sequences: 3902068
Number of extensions: 1712981
Number of successful extensions: 107271
Number of sequences better than 10.0: 6
Number of HSP's better than 10.0 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 107258
Number of HSP's gapped (non-prelim): 12
length of query: 217
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 195
effective length of database: 17,147,199,772
effective search space: 3343703955540
effective search space used: 3343703955540
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top