Clone Name | rbasde21 |
---|---|
Clone Library Name | barley_pub |
>gb|AC134053.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0005H02, complete sequence Length = 144882 Score = 281 bits (142), Expect = 1e-72 Identities = 391/474 (82%) Strand = Plus / Plus Query: 202 catcttcgtcgggcctgcttgcgaggcagagctcgtggagctcattcaggatccactcct 261 ||||||||||||||||||| |||||||| ||||| ||||||||||| || |||||||||| Sbjct: 53167 catcttcgtcgggcctgctcgcgaggcacagctcatggagctcattgagaatccactcct 53226 Query: 262 ctccgctgtgtccaccaagaaccaagaccctagtgccaccaaccacgcaggtgctgtgtc 321 | || |||| ||||| || || | ||||| ||||| ||||||||||| ||||| || | Sbjct: 53227 ccccagtgtggccacccaggacaagaaccctggtgccgccaaccacgcatgtgctatgac 53286 Query: 322 cccaagcgaacttgggtggctgccccgggacgttcaggattctccatgtcggtttttcct 381 |||| ||||||||||||||||| || |||||||||| || ||||||||||| || |||| Sbjct: 53287 cccaggcgaacttgggtggctggccagggacgttcaaaatcctccatgtcggcttctcct 53346 Query: 382 cagccggatcaagcaagaagagctcagcgggtgagtgcagcccagcgattgagccgccaa 441 | || || || || | ||| |||| | ||| ||||||||||||||||| ||||| || | Sbjct: 53347 ccgctgggtcgaggaggaacagctgtgagggcgagtgcagcccagcgatggagccaccga 53406 Query: 442 atatgatgatccttccacagggcaggctcacggtgacatgatcaagccttggtggtggac 501 ||||||| |||| ||||||||| ||||| || | ||||||||| ||||| || ||||||| Sbjct: 53407 atatgattatccgtccacaggggaggctgaccgcgacatgatcgagcctcggaggtggac 53466 Query: 502 aaccgcttggaaacacagttgttgccaactgcctccattgtggattctcttcaccaacat 561 ||| || ||| | ||||| |||| |||||||||||||| | ||||||||| | | Sbjct: 53467 cgatgctcgggaacccggttgtcgccagttgcctccattgtgggctgtcttcaccagcgt 53526 Query: 562 ccattatgtaggcatcactggagcgcagtcggagcgagccactctttgccaatccaccaa 621 |||| |||||||||||| |||||| || ||||| ||||| ||||||||||| ||||||| Sbjct: 53527 ccatagtgtaggcatcacaggagcgtagccggagagagccgctctttgccaacccaccaa 53586 Query: 622 acataaatattttagtcttaccataaacagacaaggtatggccaaggcgggatg 675 |||| || | ||| ||||||||| | || |||||||| ||||| |||||||||| Sbjct: 53587 acatgaagagtttggtcttaccaaagacggacaaggtgtggccgaggcgggatg 53640
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 281 bits (142), Expect = 1e-72 Identities = 391/474 (82%) Strand = Plus / Plus Query: 202 catcttcgtcgggcctgcttgcgaggcagagctcgtggagctcattcaggatccactcct 261 ||||||||||||||||||| |||||||| ||||| ||||||||||| || |||||||||| Sbjct: 19478890 catcttcgtcgggcctgctcgcgaggcacagctcatggagctcattgagaatccactcct 19478949 Query: 262 ctccgctgtgtccaccaagaaccaagaccctagtgccaccaaccacgcaggtgctgtgtc 321 | || |||| ||||| || || | ||||| ||||| ||||||||||| ||||| || | Sbjct: 19478950 ccccagtgtggccacccaggacaagaaccctggtgccgccaaccacgcatgtgctatgac 19479009 Query: 322 cccaagcgaacttgggtggctgccccgggacgttcaggattctccatgtcggtttttcct 381 |||| ||||||||||||||||| || |||||||||| || ||||||||||| || |||| Sbjct: 19479010 cccaggcgaacttgggtggctggccagggacgttcaaaatcctccatgtcggcttctcct 19479069 Query: 382 cagccggatcaagcaagaagagctcagcgggtgagtgcagcccagcgattgagccgccaa 441 | || || || || | ||| |||| | ||| ||||||||||||||||| ||||| || | Sbjct: 19479070 ccgctgggtcgaggaggaacagctgtgagggcgagtgcagcccagcgatggagccaccga 19479129 Query: 442 atatgatgatccttccacagggcaggctcacggtgacatgatcaagccttggtggtggac 501 ||||||| |||| ||||||||| ||||| || | ||||||||| ||||| || ||||||| Sbjct: 19479130 atatgattatccgtccacaggggaggctgaccgcgacatgatcgagcctcggaggtggac 19479189 Query: 502 aaccgcttggaaacacagttgttgccaactgcctccattgtggattctcttcaccaacat 561 ||| || ||| | ||||| |||| |||||||||||||| | ||||||||| | | Sbjct: 19479190 cgatgctcgggaacccggttgtcgccagttgcctccattgtgggctgtcttcaccagcgt 19479249 Query: 562 ccattatgtaggcatcactggagcgcagtcggagcgagccactctttgccaatccaccaa 621 |||| |||||||||||| |||||| || ||||| ||||| ||||||||||| ||||||| Sbjct: 19479250 ccatagtgtaggcatcacaggagcgtagccggagagagccgctctttgccaacccaccaa 19479309 Query: 622 acataaatattttagtcttaccataaacagacaaggtatggccaaggcgggatg 675 |||| || | ||| ||||||||| | || |||||||| ||||| |||||||||| Sbjct: 19479310 acatgaagagtttggtcttaccaaagacggacaaggtgtggccgaggcgggatg 19479363
>dbj|AK100677.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023113D18, full insert sequence Length = 2190 Score = 281 bits (142), Expect = 1e-72 Identities = 391/474 (82%) Strand = Plus / Minus Query: 202 catcttcgtcgggcctgcttgcgaggcagagctcgtggagctcattcaggatccactcct 261 ||||||||||||||||||| |||||||| ||||| ||||||||||| || |||||||||| Sbjct: 1982 catcttcgtcgggcctgctcgcgaggcacagctcatggagctcattgagaatccactcct 1923 Query: 262 ctccgctgtgtccaccaagaaccaagaccctagtgccaccaaccacgcaggtgctgtgtc 321 | || |||| ||||| || || | ||||| ||||| ||||||||||| ||||| || | Sbjct: 1922 ccccagtgtggccacccaggacaagaaccctggtgccgccaaccacgcatgtgctatgac 1863 Query: 322 cccaagcgaacttgggtggctgccccgggacgttcaggattctccatgtcggtttttcct 381 |||| ||||||||||||||||| || |||||||||| || ||||||||||| || |||| Sbjct: 1862 cccaggcgaacttgggtggctggccagggacgttcaaaatcctccatgtcggcttctcct 1803 Query: 382 cagccggatcaagcaagaagagctcagcgggtgagtgcagcccagcgattgagccgccaa 441 | || || || || | ||| |||| | ||| ||||||||||||||||| ||||| || | Sbjct: 1802 ccgctgggtcgaggaggaacagctgtgagggcgagtgcagcccagcgatggagccaccga 1743 Query: 442 atatgatgatccttccacagggcaggctcacggtgacatgatcaagccttggtggtggac 501 ||||||| |||| ||||||||| ||||| || | ||||||||| ||||| || ||||||| Sbjct: 1742 atatgattatccgtccacaggggaggctgaccgcgacatgatcgagcctcggaggtggac 1683 Query: 502 aaccgcttggaaacacagttgttgccaactgcctccattgtggattctcttcaccaacat 561 ||| || ||| | ||||| |||| |||||||||||||| | ||||||||| | | Sbjct: 1682 cgatgctcgggaacccggttgtcgccagttgcctccattgtgggctgtcttcaccagcgt 1623 Query: 562 ccattatgtaggcatcactggagcgcagtcggagcgagccactctttgccaatccaccaa 621 |||| |||||||||||| |||||| || ||||| ||||| ||||||||||| ||||||| Sbjct: 1622 ccatagtgtaggcatcacaggagcgtagccggagagagccgctctttgccaacccaccaa 1563 Query: 622 acataaatattttagtcttaccataaacagacaaggtatggccaaggcgggatg 675 |||| || | ||| ||||||||| | || |||||||| ||||| |||||||||| Sbjct: 1562 acatgaagagtttggtcttaccaaagacggacaaggtgtggccgaggcgggatg 1509
>dbj|AK065369.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013023A04, full insert sequence Length = 3839 Score = 281 bits (142), Expect = 1e-72 Identities = 391/474 (82%) Strand = Plus / Minus Query: 202 catcttcgtcgggcctgcttgcgaggcagagctcgtggagctcattcaggatccactcct 261 ||||||||||||||||||| |||||||| ||||| ||||||||||| || |||||||||| Sbjct: 3620 catcttcgtcgggcctgctcgcgaggcacagctcatggagctcattgagaatccactcct 3561 Query: 262 ctccgctgtgtccaccaagaaccaagaccctagtgccaccaaccacgcaggtgctgtgtc 321 | || |||| ||||| || || | ||||| ||||| ||||||||||| ||||| || | Sbjct: 3560 ccccagtgtggccacccaggacaagaaccctggtgccgccaaccacgcatgtgctatgac 3501 Query: 322 cccaagcgaacttgggtggctgccccgggacgttcaggattctccatgtcggtttttcct 381 |||| ||||||||||||||||| || |||||||||| || ||||||||||| || |||| Sbjct: 3500 cccaggcgaacttgggtggctggccagggacgttcaaaatcctccatgtcggcttctcct 3441 Query: 382 cagccggatcaagcaagaagagctcagcgggtgagtgcagcccagcgattgagccgccaa 441 | || || || || | ||| |||| | ||| ||||||||||||||||| ||||| || | Sbjct: 3440 ccgctgggtcgaggaggaacagctgtgagggcgagtgcagcccagcgatggagccaccga 3381 Query: 442 atatgatgatccttccacagggcaggctcacggtgacatgatcaagccttggtggtggac 501 ||||||| |||| ||||||||| ||||| || | ||||||||| ||||| || ||||||| Sbjct: 3380 atatgattatccgtccacaggggaggctgaccgcgacatgatcgagcctcggaggtggac 3321 Query: 502 aaccgcttggaaacacagttgttgccaactgcctccattgtggattctcttcaccaacat 561 ||| || ||| | ||||| |||| |||||||||||||| | ||||||||| | | Sbjct: 3320 cgatgctcgggaacccggttgtcgccagttgcctccattgtgggctgtcttcaccagcgt 3261 Query: 562 ccattatgtaggcatcactggagcgcagtcggagcgagccactctttgccaatccaccaa 621 |||| |||||||||||| |||||| || ||||| ||||| ||||||||||| ||||||| Sbjct: 3260 ccatagtgtaggcatcacaggagcgtagccggagagagccgctctttgccaacccaccaa 3201 Query: 622 acataaatattttagtcttaccataaacagacaaggtatggccaaggcgggatg 675 |||| || | ||| ||||||||| | || |||||||| ||||| |||||||||| Sbjct: 3200 acatgaagagtttggtcttaccaaagacggacaaggtgtggccgaggcgggatg 3147
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 281 bits (142), Expect = 1e-72 Identities = 391/474 (82%) Strand = Plus / Plus Query: 202 catcttcgtcgggcctgcttgcgaggcagagctcgtggagctcattcaggatccactcct 261 ||||||||||||||||||| |||||||| ||||| ||||||||||| || |||||||||| Sbjct: 19638064 catcttcgtcgggcctgctcgcgaggcacagctcatggagctcattgagaatccactcct 19638123 Query: 262 ctccgctgtgtccaccaagaaccaagaccctagtgccaccaaccacgcaggtgctgtgtc 321 | || |||| ||||| || || | ||||| ||||| ||||||||||| ||||| || | Sbjct: 19638124 ccccagtgtggccacccaggacaagaaccctggtgccgccaaccacgcatgtgctatgac 19638183 Query: 322 cccaagcgaacttgggtggctgccccgggacgttcaggattctccatgtcggtttttcct 381 |||| ||||||||||||||||| || |||||||||| || ||||||||||| || |||| Sbjct: 19638184 cccaggcgaacttgggtggctggccagggacgttcaaaatcctccatgtcggcttctcct 19638243 Query: 382 cagccggatcaagcaagaagagctcagcgggtgagtgcagcccagcgattgagccgccaa 441 | || || || || | ||| |||| | ||| ||||||||||||||||| ||||| || | Sbjct: 19638244 ccgctgggtcgaggaggaacagctgtgagggcgagtgcagcccagcgatggagccaccga 19638303 Query: 442 atatgatgatccttccacagggcaggctcacggtgacatgatcaagccttggtggtggac 501 ||||||| |||| ||||||||| ||||| || | ||||||||| ||||| || ||||||| Sbjct: 19638304 atatgattatccgtccacaggggaggctgaccgcgacatgatcgagcctcggaggtggac 19638363 Query: 502 aaccgcttggaaacacagttgttgccaactgcctccattgtggattctcttcaccaacat 561 ||| || ||| | ||||| |||| |||||||||||||| | ||||||||| | | Sbjct: 19638364 cgatgctcgggaacccggttgtcgccagttgcctccattgtgggctgtcttcaccagcgt 19638423 Query: 562 ccattatgtaggcatcactggagcgcagtcggagcgagccactctttgccaatccaccaa 621 |||| |||||||||||| |||||| || ||||| ||||| ||||||||||| ||||||| Sbjct: 19638424 ccatagtgtaggcatcacaggagcgtagccggagagagccgctctttgccaacccaccaa 19638483 Query: 622 acataaatattttagtcttaccataaacagacaaggtatggccaaggcgggatg 675 |||| || | ||| ||||||||| | || |||||||| ||||| |||||||||| Sbjct: 19638484 acatgaagagtttggtcttaccaaagacggacaaggtgtggccgaggcgggatg 19638537
>ref|NM_122248.2| Arabidopsis thaliana unknown protein AT5G23410 mRNA, complete cds Length = 458 Score = 91.7 bits (46), Expect = 3e-15 Identities = 112/134 (83%) Strand = Plus / Minus Query: 243 tcattcaggatccactcctctccgctgtgtccaccaagaaccaagaccctagtgccacca 302 ||||| || ||||| ||||| || |||| |||||||| ||||| || ||||| || ||| Sbjct: 209 tcattgagtatccattcctcaccattgtgaccaccaaggaccaatactctagttcctcca 150 Query: 303 accacgcaggtgctgtgtccccaagcgaacttgggtggctgccccgggacgttcaggatt 362 || ||||| ||||| ||||||||||| ||||||||||| | ||| ||||| |||||||| Sbjct: 149 acaacgcatgtgctatgtccccaagctaacttgggtggtttccctgggacattcaggatc 90 Query: 363 ctccatgtcggttt 376 ||||||| |||||| Sbjct: 89 ctccatgacggttt 76
>dbj|AB018110.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K19M13 Length = 42563 Score = 91.7 bits (46), Expect = 3e-15 Identities = 112/134 (83%) Strand = Plus / Plus Query: 243 tcattcaggatccactcctctccgctgtgtccaccaagaaccaagaccctagtgccacca 302 ||||| || ||||| ||||| || |||| |||||||| ||||| || ||||| || ||| Sbjct: 7454 tcattgagtatccattcctcaccattgtgaccaccaaggaccaatactctagttcctcca 7513 Query: 303 accacgcaggtgctgtgtccccaagcgaacttgggtggctgccccgggacgttcaggatt 362 || ||||| ||||| ||||||||||| ||||||||||| | ||| ||||| |||||||| Sbjct: 7514 acaacgcatgtgctatgtccccaagctaacttgggtggtttccctgggacattcaggatc 7573 Query: 363 ctccatgtcggttt 376 ||||||| |||||| Sbjct: 7574 ctccatgacggttt 7587
>dbj|AB007647.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MJB21 Length = 78369 Score = 83.8 bits (42), Expect = 7e-13 Identities = 111/134 (82%) Strand = Plus / Minus Query: 243 tcattcaggatccactcctctccgctgtgtccaccaagaaccaagaccctagtgccacca 302 ||||| || ||||| ||||| || |||| |||||||| ||||| || ||||| || ||| Sbjct: 41321 tcattgagtatccattcctcaccattgtgaccaccaaggaccaatactctagttcctcca 41262 Query: 303 accacgcaggtgctgtgtccccaagcgaacttgggtggctgccccgggacgttcaggatt 362 || ||||| ||||| ||||||||||| ||||||||||| | ||| ||||| || ||||| Sbjct: 41261 acaacgcatgtgctatgtccccaagctaacttgggtggtttccctgggacatttaggatc 41202 Query: 363 ctccatgtcggttt 376 ||||||| |||||| Sbjct: 41201 ctccatgacggttt 41188
>dbj|AK117315.1| Arabidopsis thaliana mRNA for unknown protein, complete cds, clone: RAFL16-88-C20 Length = 897 Score = 83.8 bits (42), Expect = 7e-13 Identities = 111/134 (82%) Strand = Plus / Minus Query: 243 tcattcaggatccactcctctccgctgtgtccaccaagaaccaagaccctagtgccacca 302 ||||| || ||||| ||||| || |||| |||||||| ||||| || ||||| || ||| Sbjct: 710 tcattgagtatccattcctcaccattgtgaccaccaaggaccaatactctagttcctcca 651 Query: 303 accacgcaggtgctgtgtccccaagcgaacttgggtggctgccccgggacgttcaggatt 362 || ||||| ||||| ||||||||||| ||||||||||| | ||| ||||| || ||||| Sbjct: 650 acaacgcatgtgctatgtccccaagctaacttgggtggtttccctgggacatttaggatc 591 Query: 363 ctccatgtcggttt 376 ||||||| |||||| Sbjct: 590 ctccatgacggttt 577
>ref|NM_105475.3| Arabidopsis thaliana FKF1 (FLAVIN-BINDING KELCH DOMAIN F BOX PROTEIN); signal transducer/ ubiquitin-protein ligase AT1G68050 (FKF1) mRNA, complete cds Length = 2113 Score = 75.8 bits (38), Expect = 2e-10 Identities = 110/134 (82%) Strand = Plus / Minus Query: 243 tcattcaggatccactcctctccgctgtgtccaccaagaaccaagaccctagtgccacca 302 ||||| || ||||| ||||| || |||| |||||||| ||||| || ||||| || ||| Sbjct: 1875 tcattgagtatccattcctcaccagtgtgaccaccaaggaccaatactctagttcctcca 1816 Query: 303 accacgcaggtgctgtgtccccaagcgaacttgggtggctgccccgggacgttcaggatt 362 || ||||| ||||| ||||||||||| ||||| || || | ||| ||||| |||||||| Sbjct: 1815 acaacgcatgtgctatgtccccaagctaacttaggcggtttcccggggacattcaggatc 1756 Query: 363 ctccatgtcggttt 376 ||||||| |||||| Sbjct: 1755 ctccatgacggttt 1742
>gb|AY113029.1| Arabidopsis thaliana At1g68050/T23K23_10 mRNA, complete cds Length = 1860 Score = 75.8 bits (38), Expect = 2e-10 Identities = 110/134 (82%) Strand = Plus / Minus Query: 243 tcattcaggatccactcctctccgctgtgtccaccaagaaccaagaccctagtgccacca 302 ||||| || ||||| ||||| || |||| |||||||| ||||| || ||||| || ||| Sbjct: 1814 tcattgagtatccattcctcaccagtgtgaccaccaaggaccaatactctagttcctcca 1755 Query: 303 accacgcaggtgctgtgtccccaagcgaacttgggtggctgccccgggacgttcaggatt 362 || ||||| ||||| ||||||||||| ||||| || || | ||| ||||| |||||||| Sbjct: 1754 acaacgcatgtgctatgtccccaagctaacttaggcggtttcccggggacattcaggatc 1695 Query: 363 ctccatgtcggttt 376 ||||||| |||||| Sbjct: 1694 ctccatgacggttt 1681
>gb|AY064999.1| Arabidopsis thaliana At1g68050/T23K23_10 mRNA, complete cds Length = 2105 Score = 75.8 bits (38), Expect = 2e-10 Identities = 110/134 (82%) Strand = Plus / Minus Query: 243 tcattcaggatccactcctctccgctgtgtccaccaagaaccaagaccctagtgccacca 302 ||||| || ||||| ||||| || |||| |||||||| ||||| || ||||| || ||| Sbjct: 1876 tcattgagtatccattcctcaccagtgtgaccaccaaggaccaatactctagttcctcca 1817 Query: 303 accacgcaggtgctgtgtccccaagcgaacttgggtggctgccccgggacgttcaggatt 362 || ||||| ||||| ||||||||||| ||||| || || | ||| ||||| |||||||| Sbjct: 1816 acaacgcatgtgctatgtccccaagctaacttaggcggtttcccggggacattcaggatc 1757 Query: 363 ctccatgtcggttt 376 ||||||| |||||| Sbjct: 1756 ctccatgacggttt 1743
>gb|AC012563.7|AC012563 Arabidopsis thaliana chromosome 1 BAC T23K23 genomic sequence, complete sequence Length = 101966 Score = 75.8 bits (38), Expect = 2e-10 Identities = 110/134 (82%) Strand = Plus / Plus Query: 243 tcattcaggatccactcctctccgctgtgtccaccaagaaccaagaccctagtgccacca 302 ||||| || ||||| ||||| || |||| |||||||| ||||| || ||||| || ||| Sbjct: 33739 tcattgagtatccattcctcaccagtgtgaccaccaaggaccaatactctagttcctcca 33798 Query: 303 accacgcaggtgctgtgtccccaagcgaacttgggtggctgccccgggacgttcaggatt 362 || ||||| ||||| ||||||||||| ||||| || || | ||| ||||| |||||||| Sbjct: 33799 acaacgcatgtgctatgtccccaagctaacttaggcggtttcccggggacattcaggatc 33858 Query: 363 ctccatgtcggttt 376 ||||||| |||||| Sbjct: 33859 ctccatgacggttt 33872
>emb|BX815970.1|CNS0AEMF Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH1ZH06 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 2071 Score = 75.8 bits (38), Expect = 2e-10 Identities = 110/134 (82%) Strand = Plus / Minus Query: 243 tcattcaggatccactcctctccgctgtgtccaccaagaaccaagaccctagtgccacca 302 ||||| || ||||| ||||| || |||| |||||||| ||||| || ||||| || ||| Sbjct: 1839 tcattgagtatccattcctcaccagtgtgaccaccaaggaccaatactctagttcctcca 1780 Query: 303 accacgcaggtgctgtgtccccaagcgaacttgggtggctgccccgggacgttcaggatt 362 || ||||| ||||| ||||||||||| ||||| || || | ||| ||||| |||||||| Sbjct: 1779 acaacgcatgtgctatgtccccaagctaacttaggcggtttcccggggacattcaggatc 1720 Query: 363 ctccatgtcggttt 376 ||||||| |||||| Sbjct: 1719 ctccatgacggttt 1706
>gb|AF252296.1|AF252296 Arabidopsis thaliana Adagio 3 (ADO3) mRNA, complete cds Length = 2066 Score = 67.9 bits (34), Expect = 4e-08 Identities = 109/134 (81%) Strand = Plus / Minus Query: 243 tcattcaggatccactcctctccgctgtgtccaccaagaaccaagaccctagtgccacca 302 ||||| || ||||| ||||| || |||| |||||||| ||||| || ||||| || ||| Sbjct: 1839 tcattgagtatccattcctcaccagtgtgaccaccaaggaccaatactctagttcctcca 1780 Query: 303 accacgcaggtgctgtgtccccaagcgaacttgggtggctgccccgggacgttcaggatt 362 || ||||| ||| | ||||||||||| ||||| || || | ||| ||||| |||||||| Sbjct: 1779 acaacgcatgtgttatgtccccaagctaacttaggcggtttcccggggacattcaggatc 1720 Query: 363 ctccatgtcggttt 376 ||||||| |||||| Sbjct: 1719 ctccatgacggttt 1706
>gb|AF216523.2|AF216523 Arabidopsis thaliana FKF1 mRNA, complete cds Length = 2066 Score = 67.9 bits (34), Expect = 4e-08 Identities = 109/134 (81%) Strand = Plus / Minus Query: 243 tcattcaggatccactcctctccgctgtgtccaccaagaaccaagaccctagtgccacca 302 ||||| || ||||| ||||| || |||| |||||||| ||||| || ||||| || ||| Sbjct: 1839 tcattgagtatccattcctcaccagtgtgaccaccaaggaccaatactctagttcctcca 1780 Query: 303 accacgcaggtgctgtgtccccaagcgaacttgggtggctgccccgggacgttcaggatt 362 || ||||| ||| | ||||||||||| ||||| || || | ||| ||||| |||||||| Sbjct: 1779 acaacgcatgtgttatgtccccaagctaacttaggcggtttcccggggacattcaggatc 1720 Query: 363 ctccatgtcggttt 376 ||||||| |||||| Sbjct: 1719 ctccatgacggttt 1706
>dbj|AP004911.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT13O11, TM0069, complete sequence Length = 103659 Score = 61.9 bits (31), Expect = 3e-06 Identities = 151/191 (79%) Strand = Plus / Minus Query: 282 accaagaccctagtgccaccaaccacgcaggtgctgtgtccccaagcgaacttgggtggc 341 ||||| |||||||| || |||||||| || ||||| || |||||||| ||||| || || Sbjct: 54961 accaacaccctagtccctccaaccacacaagtgctatgaccccaagcaaacttaggaggt 54902 Query: 342 tgccccgggacgttcaggattctccatgtcggtttttcctcagccggatcaagcaagaag 401 ||||| || || || ||||| ||||||| ||||| || |||| || || | || || Sbjct: 54901 tgccctggaacattgaggatcctccatgatggtttctcttcagaagggtccaacagaaac 54842 Query: 402 agctcagcgggtgagtgcagcccagcgattgagccgccaaatatgatgatccttccacag 461 |||| || |||||||| || ||||| || || || ||||||||||||||||| ||||| Sbjct: 54841 agctgagatggtgagtgaagaccagcaatggaccctccaaatatgatgatcctcccacaa 54782 Query: 462 ggcaggctcac 472 |||| |||||| Sbjct: 54781 ggcatgctcac 54771
>gb|AY371291.1| Mesembryanthemum crystallinum FKF1 (FKF1) mRNA, complete cds Length = 2189 Score = 54.0 bits (27), Expect = 6e-04 Identities = 78/95 (82%) Strand = Plus / Minus Query: 297 ccaccaaccacgcaggtgctgtgtccccaagcgaacttgggtggctgccccgggacgttc 356 |||||||||||||| || ||||| ||||| || ||||| |||||||| || || ||||| Sbjct: 1883 ccaccaaccacgcacgtactgtggccccacgcaaacttaggtggctgaccgggaacgtta 1824 Query: 357 aggattctccatgtcggtttttcctcagccggatc 391 | ||| ||||| | |||||| ||||| | |||||| Sbjct: 1823 atgatcctccaagacggtttctcctctgacggatc 1789
>gb|AY371290.1| Mesembryanthemum crystallinum ZEITLUPE (ZTL) mRNA, complete cds Length = 2561 Score = 48.1 bits (24), Expect = 0.039 Identities = 57/68 (83%) Strand = Plus / Minus Query: 600 ccactctttgccaatccaccaaacataaatattttagtcttaccataaacagacaaggta 659 ||||| || ||||| || |||||||| |||||||| || ||||||||| ||||| ||| Sbjct: 1778 ccacttttagccaagcccccaaacatcaatattttcctcccaccataaaccgacaatgta 1719 Query: 660 tggccaag 667 |||||||| Sbjct: 1718 tggccaag 1711
>gb|AC160978.4| Mus musculus BAC clone RP23-426B17 from chromosome 13, complete sequence Length = 197652 Score = 44.1 bits (22), Expect = 0.61 Identities = 22/22 (100%) Strand = Plus / Minus Query: 617 accaaacataaatattttagtc 638 |||||||||||||||||||||| Sbjct: 110631 accaaacataaatattttagtc 110610
>gb|AC132575.3| Mus musculus BAC clone RP24-425F2 from chromosome 16, complete sequence Length = 139828 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 56 gaacaacaaggtatactaaaa 76 ||||||||||||||||||||| Sbjct: 98976 gaacaacaaggtatactaaaa 98996
>emb|AL671005.7| Mouse DNA sequence from clone RP23-76J17 on chromosome 4 Contains the Zdhhc21 gene for zinc finger and DHHC domain containing protein 21 and a CpG island, complete sequence Length = 202374 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 620 aaacataaatattttagtctt 640 ||||||||||||||||||||| Sbjct: 151899 aaacataaatattttagtctt 151879
>gb|AC007922.13| Homo sapiens chromosome 18, clone RP11-178F10, complete sequence Length = 140555 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 131 ctgagagggagatgaaatgaa 151 ||||||||||||||||||||| Sbjct: 15955 ctgagagggagatgaaatgaa 15935
>gb|AC108072.3| Homo sapiens BAC clone RP11-704A16 from 2, complete sequence Length = 36787 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 614 tccaccaaacataaatatttt 634 ||||||||||||||||||||| Sbjct: 6350 tccaccaaacataaatatttt 6330
>gb|U10429.1|TGU10429 Toxoplasma gondii RH88 actin (ACT1) gene, complete cds Length = 2586 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 484 caagccttggtggtggacaac 504 ||||||||||||||||||||| Sbjct: 666 caagccttggtggtggacaac 686
>gb|AC087799.43| Mus musculus strain C57BL/6J chromosome 16 clone rp23-198m10, complete sequence Length = 208011 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 56 gaacaacaaggtatactaaaa 76 ||||||||||||||||||||| Sbjct: 198754 gaacaacaaggtatactaaaa 198734
>gb|AC090244.17| Homo sapiens chromosome 18, clone RP11-758N17, complete sequence Length = 169144 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 131 ctgagagggagatgaaatgaa 151 ||||||||||||||||||||| Sbjct: 94193 ctgagagggagatgaaatgaa 94173
>emb|AJ538745.1|NTA538745 Nicotiana tabacum cDNA-AFLP-fragment BC4-M44-043 Length = 183 Score = 42.1 bits (21), Expect = 2.4 Identities = 45/53 (84%) Strand = Plus / Minus Query: 282 accaagaccctagtgccaccaaccacgcaggtgctgtgtccccaagcgaactt 334 ||||||||||| || || |||||||| || ||||| || |||||||| ||||| Sbjct: 86 accaagacccttgttcctccaaccacacatgtgctatgaccccaagcaaactt 34
>emb|AM055943.1| Toxoplasma gondii, strain RH, genomic DNA chromosome Ib Length = 2013089 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 484 caagccttggtggtggacaac 504 ||||||||||||||||||||| Sbjct: 1039190 caagccttggtggtggacaac 1039210
>gb|DQ192649.1| Laminaria japonica actin mRNA, complete cds Length = 1131 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 484 caagccttggtggtggacaac 504 ||||||||||||||||||||| Sbjct: 19 caagccttggtggtggacaac 39
>gb|DQ272502.1| Laminaria japonica actin gene, complete cds Length = 3487 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 484 caagccttggtggtggacaac 504 ||||||||||||||||||||| Sbjct: 19 caagccttggtggtggacaac 39
>gb|AY711249.1| Uncultured bacterium clone SIMO-1883 16S ribosomal RNA gene, partial sequence Length = 563 Score = 40.1 bits (20), Expect = 9.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 492 ggtggtggacaaccgcttggaaac 515 ||||| |||||||||||||||||| Sbjct: 61 ggtgggggacaaccgcttggaaac 84
>gb|CP000080.1| Leishmania major strain Friedlin chromosome 29, complete sequence Length = 1212674 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 221 tgcgaggcagagctcgtgga 240 |||||||||||||||||||| Sbjct: 68992 tgcgaggcagagctcgtgga 68973
>ref|XM_842586.1| Leishmania major strain Friedlin hypothetical protein (LMJ_0656) partial mRNA Length = 4731 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 221 tgcgaggcagagctcgtgga 240 |||||||||||||||||||| Sbjct: 2353 tgcgaggcagagctcgtgga 2372
>gb|AC112998.15| Mus musculus chromosome 3, clone RP23-147E7, complete sequence Length = 203273 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 123 aagaaaagctgagagggaga 142 |||||||||||||||||||| Sbjct: 180770 aagaaaagctgagagggaga 180751
>emb|CR956410.6| Pig DNA sequence from clone PigE-123H20 on chromosome 7, complete sequence Length = 175487 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 402 agctcagcgggtgagtgcag 421 |||||||||||||||||||| Sbjct: 32953 agctcagcgggtgagtgcag 32972
>emb|AL512599.33| Human DNA sequence from clone RP11-115D7 on chromosome 1 Contains the CAP1 gene for CAP, adenylate cyclase-associated protein 1 (yeast), the PPT1 gene for palmitoyl-protein thioesterase 1 (ceroid-lipofuscinosis, neuronal 1, infantile), an ornithine decarboxylase antizyme 1 (OAZ1) pseudogene, the 5' end of the RLF gene for rearranged L-myc fusion sequence and a CpG island, complete sequence Length = 157750 Score = 40.1 bits (20), Expect = 9.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 128 aagctgagagggagatgaaatgaa 151 |||||||||| ||||||||||||| Sbjct: 145970 aagctgagagtgagatgaaatgaa 145947
>emb|AL359676.19| Human DNA sequence from clone RP11-735G4 on chromosome 6 Contains part of a novel gene, complete sequence Length = 40599 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 140 agatgaaatgaaggtaaggt 159 |||||||||||||||||||| Sbjct: 14438 agatgaaatgaaggtaaggt 14457
>emb|BX021609.1|CNS08OU5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA32AB12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 754 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 418 gcagcccagcgattgagccg 437 |||||||||||||||||||| Sbjct: 432 gcagcccagcgattgagccg 413
>gb|AC106881.9| Homo sapiens BAC clone RP11-710C12 from 4, complete sequence Length = 150889 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 366 catgtcggtttttcctcagc 385 |||||||||||||||||||| Sbjct: 85185 catgtcggtttttcctcagc 85204
>gb|AC157802.8| Mus musculus chromosome 1, clone RP24-297D18, complete sequence Length = 154309 Score = 40.1 bits (20), Expect = 9.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 646 aaacagacaaggtatggccaaggc 669 |||||||||||| ||||||||||| Sbjct: 122334 aaacagacaaggcatggccaaggc 122357
>gb|AC008883.6| Homo sapiens chromosome 5 clone CTD-2215E18, complete sequence Length = 127144 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 549 tcttcaccaacatccattat 568 |||||||||||||||||||| Sbjct: 25398 tcttcaccaacatccattat 25417
>gb|AC010460.7| Homo sapiens chromosome 5 clone CTD-2272G21, complete sequence Length = 109067 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 546 ttctcttcaccaacatccat 565 |||||||||||||||||||| Sbjct: 28477 ttctcttcaccaacatccat 28458
>gb|AC027342.5| Homo sapiens chromosome 5 clone CTD-2294O13, complete sequence Length = 112904 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 119 ttgtaagaaaagctgagagg 138 |||||||||||||||||||| Sbjct: 46384 ttgtaagaaaagctgagagg 46403
>ref|XM_318537.2| Anopheles gambiae str. PEST ENSANGP00000019642 (ENSANGG00000017153), partial mRNA Length = 1578 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 418 gcagcccagcgattgagccg 437 |||||||||||||||||||| Sbjct: 1123 gcagcccagcgattgagccg 1104
>emb|BX511172.6| Zebrafish DNA sequence from clone DKEY-13K23 in linkage group 4, complete sequence Length = 249278 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 556 caacatccattatgtaggca 575 |||||||||||||||||||| Sbjct: 3553 caacatccattatgtaggca 3534
>emb|AL355835.3|CNS05TCP Human chromosome 14 DNA sequence BAC R-196N22 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 172374 Score = 40.1 bits (20), Expect = 9.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 102 ttcttttgcactcatttttgtaag 125 ||||||| |||||||||||||||| Sbjct: 115713 ttcttttccactcatttttgtaag 115736
>emb|AL161751.3|CNS01RHG Human chromosome 14 DNA sequence BAC R-96D24 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 184692 Score = 40.1 bits (20), Expect = 9.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 102 ttcttttgcactcatttttgtaag 125 ||||||| |||||||||||||||| Sbjct: 151873 ttcttttccactcatttttgtaag 151896
>gb|AC142228.4| Mus musculus BAC clone RP23-427M10 from 3, complete sequence Length = 171554 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 123 aagaaaagctgagagggaga 142 |||||||||||||||||||| Sbjct: 169538 aagaaaagctgagagggaga 169557
>gb|AC120370.9| Mus musculus chromosome 1, clone RP24-441N3, complete sequence Length = 163929 Score = 40.1 bits (20), Expect = 9.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 646 aaacagacaaggtatggccaaggc 669 |||||||||||| ||||||||||| Sbjct: 79240 aaacagacaaggcatggccaaggc 79217 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,962,408 Number of Sequences: 3902068 Number of extensions: 5962408 Number of successful extensions: 106179 Number of sequences better than 10.0: 50 Number of HSP's better than 10.0 without gapping: 50 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 106026 Number of HSP's gapped (non-prelim): 143 length of query: 692 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 669 effective length of database: 17,143,297,704 effective search space: 11468866163976 effective search space used: 11468866163976 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)