ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasdd17
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|U34207.1|PPU34207 Photobacterium phosphoreum methylenetetrahy... 48 0.041
2gb|AF127936.2|AF127936 Homo sapiens chromosome 21 clone PAC 153I... 44 0.64
3emb|AL163207.2|HS21C007 Homo sapiens chromosome 21 segment HS21C007 44 0.64
4ref|NM_126258.2| Arabidopsis thaliana transporter AT2G01970 mRNA... 42 2.5
5ref|XM_633905.1| Dictyostelium discoideum rhodanese-like domain-... 42 2.5
6ref|XM_629929.1| Dictyostelium discoideum hypothetical protein (... 42 2.5
7ref|XM_519704.1| PREDICTED: Pan troglodytes similar to pH sensit... 42 2.5
8emb|AL445123.11| Human DNA sequence from clone RP11-242F11 on ch... 42 2.5
9gb|BC028701.2| Homo sapiens potassium channel, subfamily U, memb... 42 2.5
10gb|AC006532.5| Arabidopsis thaliana chromosome 2 clone F14H20 ma... 42 2.5
11gb|AY060579.1| Arabidopsis thaliana At2g01970/F14H20.4 mRNA sequ... 42 2.5
12gb|AY058869.1| Arabidopsis thaliana At2g01970/F14H20.4 mRNA, com... 42 2.5
13dbj|AK221852.1| Arabidopsis thaliana mRNA for putative endosomal... 42 2.5
14emb|BX820415.1|CNS0A9N9 Arabidopsis thaliana Full-length cDNA Co... 42 2.5
15emb|BX822006.1|CNS0A962 Arabidopsis thaliana Full-length cDNA Co... 42 2.5
16gb|AC124076.5| Homo sapiens chromosome 8, clone RP11-962G15, com... 42 2.5
17dbj|AB039883.2| Dictyostelium discoideum gene for tyrosine phosp... 42 2.5
18dbj|AP006205.1| Homo sapiens genomic DNA, chromosome 8, clone:RP... 42 2.5
19dbj|AP006204.1| Homo sapiens genomic DNA, chromosome 8, clone:RP... 42 2.5
20dbj|AP000075.1| Homo sapiens genomic DNA, chromosome 8p11.2, sen... 42 2.5
21gb|CP000025.1| Campylobacter jejuni RM1221, complete genome 40 9.9
22gb|AY445519.1| Mus musculus transient receptor potential cation ... 40 9.9
23gb|AY452084.1| Mus musculus TRPV1beta (Trpv1) mRNA, complete cds... 40 9.9
24gb|AY452083.1| Mus musculus TRPV1alpha (Trpv1) mRNA, complete cd... 40 9.9
25ref|XM_457954.1| Debaryomyces hansenii CBS767 hypothetical prote... 40 9.9
26ref|NM_001001445.1| Mus musculus transient receptor potential ca... 40 9.9
27gb|AC007598.7| Homo sapiens chromosome 16 clone RP11-165M1, comp... 40 9.9
28gb|AC122392.3| Mus musculus BAC clone RP24-81I14 from chromosome... 40 9.9
29gb|AC121993.2| Mus musculus BAC clone RP24-301F19 from 3, comple... 40 9.9
30gb|AC158684.7| Mus musculus 6 BAC RP23-332N21 (Roswell Park Canc... 40 9.9
31emb|CR382135.1| Debaryomyces hansenii chromosome C of strain CBS... 40 9.9
32emb|AL662903.10| Mouse DNA sequence from clone RP23-419P16 on ch... 40 9.9
33emb|AL139075.2|CJ11168X2 Campylobacter jejuni subsp. jejuni NCTC... 40 9.9
34gb|AC161888.5| Mus musculus 6 BAC RP23-448G18 (Roswell Park Canc... 40 9.9
35emb|AL663116.7| Mouse DNA sequence from clone RP23-214D6 on chro... 40 9.9
36gb|AC130458.2| Homo sapiens chromosome 16 clone CTA-388D4, compl... 40 9.9
37ref|NM_031982.1| Rattus norvegicus transient receptor potential ... 40 9.9
38gb|AC099753.2| Homo sapiens chromosome 3 clone RP11-466A13, comp... 40 9.9
39emb|AJ620495.1| Mus musculus partial mRNA for non-selective cati... 40 9.9
40gb|AF158248.2|AF158248 Rattus norvegicus vanilloid receptor spli... 40 9.9
41dbj|AK051315.1| Mus musculus 12 days embryo spinal ganglion cDNA... 40 9.9
42dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co... 40 9.9
43gb|AY965006.1| Mus musculus Trpv1 gene, partial sequence 40 9.9
44dbj|AB180097.1| Mus musculus TRPV1 mRNA for transient receptor p... 40 9.9
45gb|U95737.1|HUU95737 Human Chromosome 16 BAC clone CIT987SK-A-38... 40 9.9
46dbj|AK112700.1| Ciona intestinalis cDNA, clone:cieg036c01, full ... 40 9.9
47gb|AF029310.1|AF029310 Rattus norvegicus vanilloid receptor subt... 40 9.9
48gb|AC140393.3| Mus musculus BAC clone RP24-179D17 from 14, compl... 40 9.9
49gb|AC145947.3| Gallus gallus BAC clone CH261-24O5 from chromosom... 40 9.9
50emb|AL645547.14| Mouse DNA sequence from clone RP23-158M12 on ch... 40 9.9
51dbj|AB041029.1| Rattus norvegicus VR1L2 mRNA for vanilloid recep... 40 9.9
52dbj|AB040873.1| Rattus norvegicus VR1L1 mRNA for vanilloid recep... 40 9.9
53dbj|AP001017.5| Homo sapiens genomic DNA, chromosome 18p clone:R... 40 9.9

>gb|U34207.1|PPU34207 Photobacterium phosphoreum methylenetetrahydrofolate
           dehydrogenase-cyclohydrolase gene, complete cds
          Length = 970

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 217 gcttttgaattttcattaacggta 240
           ||||||||||||||||||||||||
Sbjct: 938 gcttttgaattttcattaacggta 915



to top

>gb|AF127936.2|AF127936 Homo sapiens chromosome 21 clone PAC 153I22 map21q11.2, complete sequence
          Length = 149684

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 213    gcctgcttttgaattttcatta 234
              ||||||||||||||||||||||
Sbjct: 118188 gcctgcttttgaattttcatta 118167



to top

>emb|AL163207.2|HS21C007 Homo sapiens chromosome 21 segment HS21C007
          Length = 340000

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 213    gcctgcttttgaattttcatta 234
              ||||||||||||||||||||||
Sbjct: 154353 gcctgcttttgaattttcatta 154332



to top

>ref|NM_126258.2| Arabidopsis thaliana transporter AT2G01970 mRNA, complete cds
          Length = 2171

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 296  gatcaacaggatgatgaagac 316
            |||||||||||||||||||||
Sbjct: 1554 gatcaacaggatgatgaagac 1534



to top

>ref|XM_633905.1| Dictyostelium discoideum rhodanese-like domain-containing protein
            (DDB0191424), partial mRNA
          Length = 3162

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 286  acaagatgaagatcaacaggatgat 310
            ||||||| |||||||||||||||||
Sbjct: 2577 acaagatcaagatcaacaggatgat 2601



to top

>ref|XM_629929.1| Dictyostelium discoideum hypothetical protein (DDB0184067), partial
            mRNA
          Length = 3351

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                             
Query: 286  acaagatgaagatcaacaggatgatgaagacag 318
            |||| |||||||| |||| ||||||||||||||
Sbjct: 1830 acaaaatgaagatgaacaagatgatgaagacag 1862



to top

>ref|XM_519704.1| PREDICTED: Pan troglodytes similar to pH sensitive maxi K+ channel
           (LOC464107), mRNA
          Length = 4359

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 292 tgaagatcaacaggatgatga 312
           |||||||||||||||||||||
Sbjct: 412 tgaagatcaacaggatgatga 392



to top

>emb|AL445123.11| Human DNA sequence from clone RP11-242F11 on chromosome 6 Contains the
             3' part of a novel gene and a novel gene, complete
             sequence
          Length = 120709

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 466   ctctgtcctttccctgacaagagat 490
             |||| ||||||||||||||||||||
Sbjct: 62991 ctctttcctttccctgacaagagat 62967



to top

>gb|BC028701.2| Homo sapiens potassium channel, subfamily U, member 1, mRNA (cDNA
           clone IMAGE:4828672)
          Length = 3759

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 292 tgaagatcaacaggatgatga 312
           |||||||||||||||||||||
Sbjct: 164 tgaagatcaacaggatgatga 144



to top

>gb|AC006532.5| Arabidopsis thaliana chromosome 2 clone F14H20 map CIC11A04, complete
             sequence
          Length = 76976

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 296   gatcaacaggatgatgaagac 316
             |||||||||||||||||||||
Sbjct: 24321 gatcaacaggatgatgaagac 24341



to top

>gb|AY060579.1| Arabidopsis thaliana At2g01970/F14H20.4 mRNA sequence
          Length = 2170

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 296  gatcaacaggatgatgaagac 316
            |||||||||||||||||||||
Sbjct: 1553 gatcaacaggatgatgaagac 1533



to top

>gb|AY058869.1| Arabidopsis thaliana At2g01970/F14H20.4 mRNA, complete cds
          Length = 2131

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 296  gatcaacaggatgatgaagac 316
            |||||||||||||||||||||
Sbjct: 1552 gatcaacaggatgatgaagac 1532



to top

>dbj|AK221852.1| Arabidopsis thaliana mRNA for putative endosomal protein, partial
           cds, clone: RAFL22-07-O07
          Length = 713

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 296 gatcaacaggatgatgaagac 316
           |||||||||||||||||||||
Sbjct: 85  gatcaacaggatgatgaagac 65



to top

>emb|BX820415.1|CNS0A9N9 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH2ZG12 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 752

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 296 gatcaacaggatgatgaagac 316
           |||||||||||||||||||||
Sbjct: 169 gatcaacaggatgatgaagac 149



to top

>emb|BX822006.1|CNS0A962 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL91ZF08 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 754

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 296 gatcaacaggatgatgaagac 316
           |||||||||||||||||||||
Sbjct: 169 gatcaacaggatgatgaagac 149



to top

>gb|AC124076.5| Homo sapiens chromosome 8, clone RP11-962G15, complete sequence
          Length = 183098

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 292   tgaagatcaacaggatgatga 312
             |||||||||||||||||||||
Sbjct: 74863 tgaagatcaacaggatgatga 74883



to top

>dbj|AB039883.2| Dictyostelium discoideum gene for tyrosine phosphatase CDC25,
            complete cds
          Length = 2961

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 286  acaagatgaagatcaacaggatgat 310
            ||||||| |||||||||||||||||
Sbjct: 2376 acaagatcaagatcaacaggatgat 2400



to top

>dbj|AP006205.1| Homo sapiens genomic DNA, chromosome 8, clone:RP11-441L16, complete
              sequence
          Length = 157665

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 292    tgaagatcaacaggatgatga 312
              |||||||||||||||||||||
Sbjct: 156554 tgaagatcaacaggatgatga 156534



to top

>dbj|AP006204.1| Homo sapiens genomic DNA, chromosome 8, clone:RP11-112G7, complete
             sequence
          Length = 169075

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 292   tgaagatcaacaggatgatga 312
             |||||||||||||||||||||
Sbjct: 94213 tgaagatcaacaggatgatga 94193



to top

>dbj|AP000075.1| Homo sapiens genomic DNA, chromosome 8p11.2, senescence gene region,
             section 11/19, complete sequence
          Length = 100000

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 292   tgaagatcaacaggatgatga 312
             |||||||||||||||||||||
Sbjct: 63348 tgaagatcaacaggatgatga 63368



to top

>gb|CP000025.1| Campylobacter jejuni RM1221, complete genome
          Length = 1777831

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 129    taaatgcttcactgtccagatggc 152
              |||||||||||||||| |||||||
Sbjct: 683133 taaatgcttcactgtctagatggc 683110



to top

>gb|AY445519.1| Mus musculus transient receptor potential cation channel V1 (Trpv1)
            mRNA, complete cds
          Length = 2520

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 300  aacaggatgatgaagacagc 319
            ||||||||||||||||||||
Sbjct: 1991 aacaggatgatgaagacagc 1972



to top

>gb|AY452084.1| Mus musculus TRPV1beta (Trpv1) mRNA, complete cds, alternatively
            spliced
          Length = 2530

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 300  aacaggatgatgaagacagc 319
            ||||||||||||||||||||
Sbjct: 1994 aacaggatgatgaagacagc 1975



to top

>gb|AY452083.1| Mus musculus TRPV1alpha (Trpv1) mRNA, complete cds, alternatively
            spliced
          Length = 2560

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 300  aacaggatgatgaagacagc 319
            ||||||||||||||||||||
Sbjct: 2024 aacaggatgatgaagacagc 2005



to top

>ref|XM_457954.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0C06875g)
            partial mRNA
          Length = 1731

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                
Query: 280  agaggtacaagatgaagatcaacaggatgatgaaga 315
            |||||||||||| ||||||||| |||| ||| ||||
Sbjct: 1140 agaggtacaagaggaagatcaagaggaagatcaaga 1175



to top

>ref|NM_001001445.1| Mus musculus transient receptor potential cation channel, subfamily
            V, member 1 (Trpv1), mRNA
          Length = 2520

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 300  aacaggatgatgaagacagc 319
            ||||||||||||||||||||
Sbjct: 1991 aacaggatgatgaagacagc 1972



to top

>gb|AC007598.7| Homo sapiens chromosome 16 clone RP11-165M1, complete sequence
          Length = 186120

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 547   aacacttcccattttcacca 566
             ||||||||||||||||||||
Sbjct: 26660 aacacttcccattttcacca 26679



to top

>gb|AC122392.3| Mus musculus BAC clone RP24-81I14 from chromosome 16, complete sequence
          Length = 195550

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 541   ataaacaacacttcccattt 560
             ||||||||||||||||||||
Sbjct: 75819 ataaacaacacttcccattt 75838



to top

>gb|AC121993.2| Mus musculus BAC clone RP24-301F19 from 3, complete sequence
          Length = 163385

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 500    tgccaattcaggataatgaagctt 523
              ||||| ||||||||||||||||||
Sbjct: 121695 tgccacttcaggataatgaagctt 121672



to top

>gb|AC158684.7| Mus musculus 6 BAC RP23-332N21 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 210307

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 367    gcctctccatgacagtctccttac 390
              ||||| ||||||||||||||||||
Sbjct: 163387 gcctcaccatgacagtctccttac 163410



to top

>emb|CR382135.1| Debaryomyces hansenii chromosome C of strain CBS767 of Debaryomyces
              hansenii
          Length = 1592360

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                  
Query: 280    agaggtacaagatgaagatcaacaggatgatgaaga 315
              |||||||||||| ||||||||| |||| ||| ||||
Sbjct: 570955 agaggtacaagaggaagatcaagaggaagatcaaga 570920



to top

>emb|AL662903.10| Mouse DNA sequence from clone RP23-419P16 on chromosome 11 Contain the
             gene for olfactory receptor MOR278-1,  an olfactory
             receptor pseudogene, three novel genes,  the gene for
             olfactory receptor MOR222-2, an olfactory receptor
             pseudogene (MOR222-4P), the gene for olfactory receptor
             MOR222-1, part of a novel gene, a novel gene
             (2810021J22Rik) and a novel zinc finger gene, complete
             sequence
          Length = 146349

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 203   agatgatctggcctgctttt 222
             ||||||||||||||||||||
Sbjct: 37344 agatgatctggcctgctttt 37325



to top

>emb|AL139075.2|CJ11168X2 Campylobacter jejuni subsp. jejuni NCTC 11168 complete genome; segment
              2/6
          Length = 308601

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 129    taaatgcttcactgtccagatggc 152
              |||||||||||||||| |||||||
Sbjct: 292026 taaatgcttcactgtctagatggc 292003



to top

>gb|AC161888.5| Mus musculus 6 BAC RP23-448G18 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 189867

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 367    gcctctccatgacagtctccttac 390
              ||||| ||||||||||||||||||
Sbjct: 102567 gcctcaccatgacagtctccttac 102590



to top

>emb|AL663116.7| Mouse DNA sequence from clone RP23-214D6 on chromosome 11 Contains the
             5' end of the Ctns gene for nephropathic cystinosis
             protein, the Carkl gene for carbohydrate kinase-like
             protein, the gene for the ortholog of human and rat
             transient receptor potential cation channel subfamily V
             member 1 TRPV1 and a CpG island, complete sequence
          Length = 70735

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 300   aacaggatgatgaagacagc 319
             ||||||||||||||||||||
Sbjct: 55054 aacaggatgatgaagacagc 55035



to top

>gb|AC130458.2| Homo sapiens chromosome 16 clone CTA-388D4, complete sequence
          Length = 93519

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 547   aacacttcccattttcacca 566
             ||||||||||||||||||||
Sbjct: 31085 aacacttcccattttcacca 31066



to top

>ref|NM_031982.1| Rattus norvegicus transient receptor potential cation channel,
            subfamily V, member 1 (Trpv1), mRNA
          Length = 2847

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 300  aacaggatgatgaagacagc 319
            ||||||||||||||||||||
Sbjct: 2068 aacaggatgatgaagacagc 2049



to top

>gb|AC099753.2| Homo sapiens chromosome 3 clone RP11-466A13, complete sequence
          Length = 171696

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 327    aagataaaaaggatcttgct 346
              ||||||||||||||||||||
Sbjct: 109833 aagataaaaaggatcttgct 109852



to top

>emb|AJ620495.1| Mus musculus partial mRNA for non-selective cation channel TRPV1
            (trpv1 gene)
          Length = 2669

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 300  aacaggatgatgaagacagc 319
            ||||||||||||||||||||
Sbjct: 2031 aacaggatgatgaagacagc 2012



to top

>gb|AF158248.2|AF158248 Rattus norvegicus vanilloid receptor splice variant mRNA, complete
            cds
          Length = 2755

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 300  aacaggatgatgaagacagc 319
            ||||||||||||||||||||
Sbjct: 1401 aacaggatgatgaagacagc 1382



to top

>dbj|AK051315.1| Mus musculus 12 days embryo spinal ganglion cDNA, RIKEN full-length
            enriched library, clone:D130033G08 product:Vanilloid
            receptor type 1 like protein 1 homolog [Rattus
            norvegicus], full insert sequence
          Length = 3362

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 300  aacaggatgatgaagacagc 319
            ||||||||||||||||||||
Sbjct: 2101 aacaggatgatgaagacagc 2082



to top

>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 249     cgtcgcccttgggcagcccg 268
               ||||||||||||||||||||
Sbjct: 5194757 cgtcgcccttgggcagcccg 5194776



to top

>gb|AY965006.1| Mus musculus Trpv1 gene, partial sequence
          Length = 235

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 300 aacaggatgatgaagacagc 319
           ||||||||||||||||||||
Sbjct: 123 aacaggatgatgaagacagc 104



to top

>dbj|AB180097.1| Mus musculus TRPV1 mRNA for transient receptor potential cation
            channel, subfamily V, member 1, complete cds
          Length = 2520

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 300  aacaggatgatgaagacagc 319
            ||||||||||||||||||||
Sbjct: 1991 aacaggatgatgaagacagc 1972



to top

>gb|U95737.1|HUU95737 Human Chromosome 16 BAC clone CIT987SK-A-388D4, complete sequence
          Length = 93431

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 547   aacacttcccattttcacca 566
             ||||||||||||||||||||
Sbjct: 30997 aacacttcccattttcacca 30978



to top

>dbj|AK112700.1| Ciona intestinalis cDNA, clone:cieg036c01, full insert sequence
          Length = 1732

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 313  agacagctgcaaacaagataaaaa 336
            |||||||| |||||||||||||||
Sbjct: 1256 agacagctacaaacaagataaaaa 1279



to top

>gb|AF029310.1|AF029310 Rattus norvegicus vanilloid receptor subtype 1 mRNA, complete cds
          Length = 2847

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 300  aacaggatgatgaagacagc 319
            ||||||||||||||||||||
Sbjct: 2068 aacaggatgatgaagacagc 2049



to top

>gb|AC140393.3| Mus musculus BAC clone RP24-179D17 from 14, complete sequence
          Length = 184279

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 216   tgcttttgaattttcattaa 235
             ||||||||||||||||||||
Sbjct: 59901 tgcttttgaattttcattaa 59882



to top

>gb|AC145947.3| Gallus gallus BAC clone CH261-24O5 from chromosome unknown, complete
              sequence
          Length = 233033

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 309    atgaagacagctgcaaacaagataaaaaggat 340
              ||||||| | ||||||||||| ||||||||||
Sbjct: 222307 atgaagagatctgcaaacaagctaaaaaggat 222338



to top

>emb|AL645547.14| Mouse DNA sequence from clone RP23-158M12 on chromosome X, complete
              sequence
          Length = 173477

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 263    agcccgcctgacccaccagaggta 286
              ||||| ||||||||||||||||||
Sbjct: 100873 agcccacctgacccaccagaggta 100896



to top

>dbj|AB041029.1| Rattus norvegicus VR1L2 mRNA for vanilloid receptor type 1 like
            protein 2, complete cds
          Length = 2337

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 300  aacaggatgatgaagacagc 319
            ||||||||||||||||||||
Sbjct: 1808 aacaggatgatgaagacagc 1789



to top

>dbj|AB040873.1| Rattus norvegicus VR1L1 mRNA for vanilloid receptor type 1 like
            protein 1, complete cds
          Length = 2517

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 300  aacaggatgatgaagacagc 319
            ||||||||||||||||||||
Sbjct: 1988 aacaggatgatgaagacagc 1969



to top

>dbj|AP001017.5| Homo sapiens genomic DNA, chromosome 18p clone:RP11-712C7, complete
             sequences
          Length = 131000

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 210   ctggcctgcttttgaatttt 229
             ||||||||||||||||||||
Sbjct: 20094 ctggcctgcttttgaatttt 20113


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,398,362
Number of Sequences: 3902068
Number of extensions: 6398362
Number of successful extensions: 141571
Number of sequences better than 10.0: 53
Number of HSP's better than 10.0 without gapping: 53
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 141423
Number of HSP's gapped (non-prelim): 148
length of query: 725
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 702
effective length of database: 17,143,297,704
effective search space: 12034594988208
effective search space used: 12034594988208
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top