Clone Name | rbasdd17 |
---|---|
Clone Library Name | barley_pub |
>gb|U34207.1|PPU34207 Photobacterium phosphoreum methylenetetrahydrofolate dehydrogenase-cyclohydrolase gene, complete cds Length = 970 Score = 48.1 bits (24), Expect = 0.041 Identities = 24/24 (100%) Strand = Plus / Minus Query: 217 gcttttgaattttcattaacggta 240 |||||||||||||||||||||||| Sbjct: 938 gcttttgaattttcattaacggta 915
>gb|AF127936.2|AF127936 Homo sapiens chromosome 21 clone PAC 153I22 map21q11.2, complete sequence Length = 149684 Score = 44.1 bits (22), Expect = 0.64 Identities = 22/22 (100%) Strand = Plus / Minus Query: 213 gcctgcttttgaattttcatta 234 |||||||||||||||||||||| Sbjct: 118188 gcctgcttttgaattttcatta 118167
>emb|AL163207.2|HS21C007 Homo sapiens chromosome 21 segment HS21C007 Length = 340000 Score = 44.1 bits (22), Expect = 0.64 Identities = 22/22 (100%) Strand = Plus / Minus Query: 213 gcctgcttttgaattttcatta 234 |||||||||||||||||||||| Sbjct: 154353 gcctgcttttgaattttcatta 154332
>ref|NM_126258.2| Arabidopsis thaliana transporter AT2G01970 mRNA, complete cds Length = 2171 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 296 gatcaacaggatgatgaagac 316 ||||||||||||||||||||| Sbjct: 1554 gatcaacaggatgatgaagac 1534
>ref|XM_633905.1| Dictyostelium discoideum rhodanese-like domain-containing protein (DDB0191424), partial mRNA Length = 3162 Score = 42.1 bits (21), Expect = 2.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 286 acaagatgaagatcaacaggatgat 310 ||||||| ||||||||||||||||| Sbjct: 2577 acaagatcaagatcaacaggatgat 2601
>ref|XM_629929.1| Dictyostelium discoideum hypothetical protein (DDB0184067), partial mRNA Length = 3351 Score = 42.1 bits (21), Expect = 2.5 Identities = 30/33 (90%) Strand = Plus / Plus Query: 286 acaagatgaagatcaacaggatgatgaagacag 318 |||| |||||||| |||| |||||||||||||| Sbjct: 1830 acaaaatgaagatgaacaagatgatgaagacag 1862
>ref|XM_519704.1| PREDICTED: Pan troglodytes similar to pH sensitive maxi K+ channel (LOC464107), mRNA Length = 4359 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 292 tgaagatcaacaggatgatga 312 ||||||||||||||||||||| Sbjct: 412 tgaagatcaacaggatgatga 392
>emb|AL445123.11| Human DNA sequence from clone RP11-242F11 on chromosome 6 Contains the 3' part of a novel gene and a novel gene, complete sequence Length = 120709 Score = 42.1 bits (21), Expect = 2.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 466 ctctgtcctttccctgacaagagat 490 |||| |||||||||||||||||||| Sbjct: 62991 ctctttcctttccctgacaagagat 62967
>gb|BC028701.2| Homo sapiens potassium channel, subfamily U, member 1, mRNA (cDNA clone IMAGE:4828672) Length = 3759 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 292 tgaagatcaacaggatgatga 312 ||||||||||||||||||||| Sbjct: 164 tgaagatcaacaggatgatga 144
>gb|AC006532.5| Arabidopsis thaliana chromosome 2 clone F14H20 map CIC11A04, complete sequence Length = 76976 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 296 gatcaacaggatgatgaagac 316 ||||||||||||||||||||| Sbjct: 24321 gatcaacaggatgatgaagac 24341
>gb|AY060579.1| Arabidopsis thaliana At2g01970/F14H20.4 mRNA sequence Length = 2170 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 296 gatcaacaggatgatgaagac 316 ||||||||||||||||||||| Sbjct: 1553 gatcaacaggatgatgaagac 1533
>gb|AY058869.1| Arabidopsis thaliana At2g01970/F14H20.4 mRNA, complete cds Length = 2131 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 296 gatcaacaggatgatgaagac 316 ||||||||||||||||||||| Sbjct: 1552 gatcaacaggatgatgaagac 1532
>dbj|AK221852.1| Arabidopsis thaliana mRNA for putative endosomal protein, partial cds, clone: RAFL22-07-O07 Length = 713 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 296 gatcaacaggatgatgaagac 316 ||||||||||||||||||||| Sbjct: 85 gatcaacaggatgatgaagac 65
>emb|BX820415.1|CNS0A9N9 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH2ZG12 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 752 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 296 gatcaacaggatgatgaagac 316 ||||||||||||||||||||| Sbjct: 169 gatcaacaggatgatgaagac 149
>emb|BX822006.1|CNS0A962 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL91ZF08 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 754 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 296 gatcaacaggatgatgaagac 316 ||||||||||||||||||||| Sbjct: 169 gatcaacaggatgatgaagac 149
>gb|AC124076.5| Homo sapiens chromosome 8, clone RP11-962G15, complete sequence Length = 183098 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 292 tgaagatcaacaggatgatga 312 ||||||||||||||||||||| Sbjct: 74863 tgaagatcaacaggatgatga 74883
>dbj|AB039883.2| Dictyostelium discoideum gene for tyrosine phosphatase CDC25, complete cds Length = 2961 Score = 42.1 bits (21), Expect = 2.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 286 acaagatgaagatcaacaggatgat 310 ||||||| ||||||||||||||||| Sbjct: 2376 acaagatcaagatcaacaggatgat 2400
>dbj|AP006205.1| Homo sapiens genomic DNA, chromosome 8, clone:RP11-441L16, complete sequence Length = 157665 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 292 tgaagatcaacaggatgatga 312 ||||||||||||||||||||| Sbjct: 156554 tgaagatcaacaggatgatga 156534
>dbj|AP006204.1| Homo sapiens genomic DNA, chromosome 8, clone:RP11-112G7, complete sequence Length = 169075 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 292 tgaagatcaacaggatgatga 312 ||||||||||||||||||||| Sbjct: 94213 tgaagatcaacaggatgatga 94193
>dbj|AP000075.1| Homo sapiens genomic DNA, chromosome 8p11.2, senescence gene region, section 11/19, complete sequence Length = 100000 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 292 tgaagatcaacaggatgatga 312 ||||||||||||||||||||| Sbjct: 63348 tgaagatcaacaggatgatga 63368
>gb|CP000025.1| Campylobacter jejuni RM1221, complete genome Length = 1777831 Score = 40.1 bits (20), Expect = 9.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 129 taaatgcttcactgtccagatggc 152 |||||||||||||||| ||||||| Sbjct: 683133 taaatgcttcactgtctagatggc 683110
>gb|AY445519.1| Mus musculus transient receptor potential cation channel V1 (Trpv1) mRNA, complete cds Length = 2520 Score = 40.1 bits (20), Expect = 9.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 300 aacaggatgatgaagacagc 319 |||||||||||||||||||| Sbjct: 1991 aacaggatgatgaagacagc 1972
>gb|AY452084.1| Mus musculus TRPV1beta (Trpv1) mRNA, complete cds, alternatively spliced Length = 2530 Score = 40.1 bits (20), Expect = 9.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 300 aacaggatgatgaagacagc 319 |||||||||||||||||||| Sbjct: 1994 aacaggatgatgaagacagc 1975
>gb|AY452083.1| Mus musculus TRPV1alpha (Trpv1) mRNA, complete cds, alternatively spliced Length = 2560 Score = 40.1 bits (20), Expect = 9.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 300 aacaggatgatgaagacagc 319 |||||||||||||||||||| Sbjct: 2024 aacaggatgatgaagacagc 2005
>ref|XM_457954.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0C06875g) partial mRNA Length = 1731 Score = 40.1 bits (20), Expect = 9.9 Identities = 32/36 (88%) Strand = Plus / Plus Query: 280 agaggtacaagatgaagatcaacaggatgatgaaga 315 |||||||||||| ||||||||| |||| ||| |||| Sbjct: 1140 agaggtacaagaggaagatcaagaggaagatcaaga 1175
>ref|NM_001001445.1| Mus musculus transient receptor potential cation channel, subfamily V, member 1 (Trpv1), mRNA Length = 2520 Score = 40.1 bits (20), Expect = 9.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 300 aacaggatgatgaagacagc 319 |||||||||||||||||||| Sbjct: 1991 aacaggatgatgaagacagc 1972
>gb|AC007598.7| Homo sapiens chromosome 16 clone RP11-165M1, complete sequence Length = 186120 Score = 40.1 bits (20), Expect = 9.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 547 aacacttcccattttcacca 566 |||||||||||||||||||| Sbjct: 26660 aacacttcccattttcacca 26679
>gb|AC122392.3| Mus musculus BAC clone RP24-81I14 from chromosome 16, complete sequence Length = 195550 Score = 40.1 bits (20), Expect = 9.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 541 ataaacaacacttcccattt 560 |||||||||||||||||||| Sbjct: 75819 ataaacaacacttcccattt 75838
>gb|AC121993.2| Mus musculus BAC clone RP24-301F19 from 3, complete sequence Length = 163385 Score = 40.1 bits (20), Expect = 9.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 500 tgccaattcaggataatgaagctt 523 ||||| |||||||||||||||||| Sbjct: 121695 tgccacttcaggataatgaagctt 121672
>gb|AC158684.7| Mus musculus 6 BAC RP23-332N21 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 210307 Score = 40.1 bits (20), Expect = 9.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 367 gcctctccatgacagtctccttac 390 ||||| |||||||||||||||||| Sbjct: 163387 gcctcaccatgacagtctccttac 163410
>emb|CR382135.1| Debaryomyces hansenii chromosome C of strain CBS767 of Debaryomyces hansenii Length = 1592360 Score = 40.1 bits (20), Expect = 9.9 Identities = 32/36 (88%) Strand = Plus / Minus Query: 280 agaggtacaagatgaagatcaacaggatgatgaaga 315 |||||||||||| ||||||||| |||| ||| |||| Sbjct: 570955 agaggtacaagaggaagatcaagaggaagatcaaga 570920
>emb|AL662903.10| Mouse DNA sequence from clone RP23-419P16 on chromosome 11 Contain the gene for olfactory receptor MOR278-1, an olfactory receptor pseudogene, three novel genes, the gene for olfactory receptor MOR222-2, an olfactory receptor pseudogene (MOR222-4P), the gene for olfactory receptor MOR222-1, part of a novel gene, a novel gene (2810021J22Rik) and a novel zinc finger gene, complete sequence Length = 146349 Score = 40.1 bits (20), Expect = 9.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 203 agatgatctggcctgctttt 222 |||||||||||||||||||| Sbjct: 37344 agatgatctggcctgctttt 37325
>emb|AL139075.2|CJ11168X2 Campylobacter jejuni subsp. jejuni NCTC 11168 complete genome; segment 2/6 Length = 308601 Score = 40.1 bits (20), Expect = 9.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 129 taaatgcttcactgtccagatggc 152 |||||||||||||||| ||||||| Sbjct: 292026 taaatgcttcactgtctagatggc 292003
>gb|AC161888.5| Mus musculus 6 BAC RP23-448G18 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 189867 Score = 40.1 bits (20), Expect = 9.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 367 gcctctccatgacagtctccttac 390 ||||| |||||||||||||||||| Sbjct: 102567 gcctcaccatgacagtctccttac 102590
>emb|AL663116.7| Mouse DNA sequence from clone RP23-214D6 on chromosome 11 Contains the 5' end of the Ctns gene for nephropathic cystinosis protein, the Carkl gene for carbohydrate kinase-like protein, the gene for the ortholog of human and rat transient receptor potential cation channel subfamily V member 1 TRPV1 and a CpG island, complete sequence Length = 70735 Score = 40.1 bits (20), Expect = 9.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 300 aacaggatgatgaagacagc 319 |||||||||||||||||||| Sbjct: 55054 aacaggatgatgaagacagc 55035
>gb|AC130458.2| Homo sapiens chromosome 16 clone CTA-388D4, complete sequence Length = 93519 Score = 40.1 bits (20), Expect = 9.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 547 aacacttcccattttcacca 566 |||||||||||||||||||| Sbjct: 31085 aacacttcccattttcacca 31066
>ref|NM_031982.1| Rattus norvegicus transient receptor potential cation channel, subfamily V, member 1 (Trpv1), mRNA Length = 2847 Score = 40.1 bits (20), Expect = 9.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 300 aacaggatgatgaagacagc 319 |||||||||||||||||||| Sbjct: 2068 aacaggatgatgaagacagc 2049
>gb|AC099753.2| Homo sapiens chromosome 3 clone RP11-466A13, complete sequence Length = 171696 Score = 40.1 bits (20), Expect = 9.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 327 aagataaaaaggatcttgct 346 |||||||||||||||||||| Sbjct: 109833 aagataaaaaggatcttgct 109852
>emb|AJ620495.1| Mus musculus partial mRNA for non-selective cation channel TRPV1 (trpv1 gene) Length = 2669 Score = 40.1 bits (20), Expect = 9.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 300 aacaggatgatgaagacagc 319 |||||||||||||||||||| Sbjct: 2031 aacaggatgatgaagacagc 2012
>gb|AF158248.2|AF158248 Rattus norvegicus vanilloid receptor splice variant mRNA, complete cds Length = 2755 Score = 40.1 bits (20), Expect = 9.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 300 aacaggatgatgaagacagc 319 |||||||||||||||||||| Sbjct: 1401 aacaggatgatgaagacagc 1382
>dbj|AK051315.1| Mus musculus 12 days embryo spinal ganglion cDNA, RIKEN full-length enriched library, clone:D130033G08 product:Vanilloid receptor type 1 like protein 1 homolog [Rattus norvegicus], full insert sequence Length = 3362 Score = 40.1 bits (20), Expect = 9.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 300 aacaggatgatgaagacagc 319 |||||||||||||||||||| Sbjct: 2101 aacaggatgatgaagacagc 2082
>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome Length = 9025608 Score = 40.1 bits (20), Expect = 9.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 249 cgtcgcccttgggcagcccg 268 |||||||||||||||||||| Sbjct: 5194757 cgtcgcccttgggcagcccg 5194776
>gb|AY965006.1| Mus musculus Trpv1 gene, partial sequence Length = 235 Score = 40.1 bits (20), Expect = 9.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 300 aacaggatgatgaagacagc 319 |||||||||||||||||||| Sbjct: 123 aacaggatgatgaagacagc 104
>dbj|AB180097.1| Mus musculus TRPV1 mRNA for transient receptor potential cation channel, subfamily V, member 1, complete cds Length = 2520 Score = 40.1 bits (20), Expect = 9.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 300 aacaggatgatgaagacagc 319 |||||||||||||||||||| Sbjct: 1991 aacaggatgatgaagacagc 1972
>gb|U95737.1|HUU95737 Human Chromosome 16 BAC clone CIT987SK-A-388D4, complete sequence Length = 93431 Score = 40.1 bits (20), Expect = 9.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 547 aacacttcccattttcacca 566 |||||||||||||||||||| Sbjct: 30997 aacacttcccattttcacca 30978
>dbj|AK112700.1| Ciona intestinalis cDNA, clone:cieg036c01, full insert sequence Length = 1732 Score = 40.1 bits (20), Expect = 9.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 313 agacagctgcaaacaagataaaaa 336 |||||||| ||||||||||||||| Sbjct: 1256 agacagctacaaacaagataaaaa 1279
>gb|AF029310.1|AF029310 Rattus norvegicus vanilloid receptor subtype 1 mRNA, complete cds Length = 2847 Score = 40.1 bits (20), Expect = 9.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 300 aacaggatgatgaagacagc 319 |||||||||||||||||||| Sbjct: 2068 aacaggatgatgaagacagc 2049
>gb|AC140393.3| Mus musculus BAC clone RP24-179D17 from 14, complete sequence Length = 184279 Score = 40.1 bits (20), Expect = 9.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 tgcttttgaattttcattaa 235 |||||||||||||||||||| Sbjct: 59901 tgcttttgaattttcattaa 59882
>gb|AC145947.3| Gallus gallus BAC clone CH261-24O5 from chromosome unknown, complete sequence Length = 233033 Score = 40.1 bits (20), Expect = 9.9 Identities = 29/32 (90%) Strand = Plus / Plus Query: 309 atgaagacagctgcaaacaagataaaaaggat 340 ||||||| | ||||||||||| |||||||||| Sbjct: 222307 atgaagagatctgcaaacaagctaaaaaggat 222338
>emb|AL645547.14| Mouse DNA sequence from clone RP23-158M12 on chromosome X, complete sequence Length = 173477 Score = 40.1 bits (20), Expect = 9.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 263 agcccgcctgacccaccagaggta 286 ||||| |||||||||||||||||| Sbjct: 100873 agcccacctgacccaccagaggta 100896
>dbj|AB041029.1| Rattus norvegicus VR1L2 mRNA for vanilloid receptor type 1 like protein 2, complete cds Length = 2337 Score = 40.1 bits (20), Expect = 9.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 300 aacaggatgatgaagacagc 319 |||||||||||||||||||| Sbjct: 1808 aacaggatgatgaagacagc 1789
>dbj|AB040873.1| Rattus norvegicus VR1L1 mRNA for vanilloid receptor type 1 like protein 1, complete cds Length = 2517 Score = 40.1 bits (20), Expect = 9.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 300 aacaggatgatgaagacagc 319 |||||||||||||||||||| Sbjct: 1988 aacaggatgatgaagacagc 1969
>dbj|AP001017.5| Homo sapiens genomic DNA, chromosome 18p clone:RP11-712C7, complete sequences Length = 131000 Score = 40.1 bits (20), Expect = 9.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 210 ctggcctgcttttgaatttt 229 |||||||||||||||||||| Sbjct: 20094 ctggcctgcttttgaatttt 20113 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 6,398,362 Number of Sequences: 3902068 Number of extensions: 6398362 Number of successful extensions: 141571 Number of sequences better than 10.0: 53 Number of HSP's better than 10.0 without gapping: 53 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 141423 Number of HSP's gapped (non-prelim): 148 length of query: 725 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 702 effective length of database: 17,143,297,704 effective search space: 12034594988208 effective search space used: 12034594988208 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)