Clone Name | rbasdd15 |
---|---|
Clone Library Name | barley_pub |
>gb|DQ128063.1| Triticum monococcum clone tm3-1, genomic sequence Length = 499 Score = 46.1 bits (23), Expect = 0.14 Identities = 44/51 (86%) Strand = Plus / Minus Query: 316 cctctaggcgccagactctctaccgtactcttcatccatgaggtctccttc 366 |||||||||| | ||||| ||| || |||||||||||||||| || ||||| Sbjct: 345 cctctaggcgtcggactcgctatcgaactcttcatccatgagatcaccttc 295
>gb|DQ128062.1| Triticum monococcum clone p8-3, genomic sequence Length = 474 Score = 46.1 bits (23), Expect = 0.14 Identities = 44/51 (86%) Strand = Plus / Minus Query: 316 cctctaggcgccagactctctaccgtactcttcatccatgaggtctccttc 366 |||||||||| | ||||| ||| || |||||||||||||||| || ||||| Sbjct: 345 cctctaggcgtcggactcgctatcgaactcttcatccatgagatcaccttc 295
>gb|DQ128035.1| Triticum aestivum clone A3-4 Ty3/gypsy-like retrotransposon, partial sequence Length = 486 Score = 46.1 bits (23), Expect = 0.14 Identities = 44/51 (86%) Strand = Plus / Minus Query: 316 cctctaggcgccagactctctaccgtactcttcatccatgaggtctccttc 366 |||||||||| ||||||| ||| | || |||||||||||||| || ||||| Sbjct: 333 cctctaggcgtcagactcgctatcatattcttcatccatgagatcgccttc 283
>gb|AY642113.1| Dicentrarchus labrax follicle stimulating hormone receptor precursor (fshr) mRNA, complete cds Length = 3134 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 467 tgcagatgatggaggtggagt 487 ||||||||||||||||||||| Sbjct: 1278 tgcagatgatggaggtggagt 1258
>emb|CR936257.1| Natronomonas pharaonis DSM 2160 complete genome Length = 2595221 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 394 cgcgatgtcgccgacggcgtc 414 ||||||||||||||||||||| Sbjct: 1322406 cgcgatgtcgccgacggcgtc 1322426
>gb|CP000159.1| Salinibacter ruber DSM 13855, complete genome Length = 3551823 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 395 gcgatgtcgccgacggcgtcctgta 419 |||||||||||| |||||||||||| Sbjct: 3128846 gcgatgtcgccggcggcgtcctgta 3128870
>ref|XM_758721.1| Theileria parva strain Muguga chromosome 4 hypothetical protein (TP04_0179) partial mRNA Length = 1095 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 330 actctctaccgtactcttca 349 |||||||||||||||||||| Sbjct: 540 actctctaccgtactcttca 521
>emb|AL596217.6| Human DNA sequence from clone RP11-13J14 on chromosome 1 Contains a CpG island, complete sequence Length = 183774 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 471 gatgatggaggtggagtcac 490 |||||||||||||||||||| Sbjct: 111025 gatgatggaggtggagtcac 111044
>emb|AL022323.7|HS243E7 Human DNA sequence from clone CTA-243E7 on chromosome 22q12.1, complete sequence Length = 183113 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 81 gacagatatattacagtggt 100 |||||||||||||||||||| Sbjct: 1340 gacagatatattacagtggt 1359
>emb|AL008583.1|HS327J16 Human DNA sequence from clone RP3-327J16 on chromosome 22q12.3-13.2, complete sequence Length = 111746 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 549 gcagtgggatctcgatggag 568 |||||||||||||||||||| Sbjct: 49548 gcagtgggatctcgatggag 49529
>ref|XM_780757.1| PREDICTED: Strongylocentrotus purpuratus similar to Fc fragment of IgG binding protein (LOC580716), mRNA Length = 5268 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 68 acactatcataaggacagat 87 |||||||||||||||||||| Sbjct: 1049 acactatcataaggacagat 1068
>gb|AY038865.1|AY038861S05 Mus musculus protein tyrosine phosphatase receptor-like protein J (Ptprj) gene, intron 1 Length = 13896 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 agtgacgtgacatgccataa 166 |||||||||||||||||||| Sbjct: 12146 agtgacgtgacatgccataa 12127
>gb|CP000248.1| Novosphingobium aromaticivorans DSM 12444, complete genome Length = 3561584 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 602 gaagggctggtgatcgagga 621 |||||||||||||||||||| Sbjct: 303060 gaagggctggtgatcgagga 303079
>ref|NM_058178.1| Homo sapiens neuronal pentraxin receptor (NPTXR), transcript variant 2, mRNA Length = 5811 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 549 gcagtgggatctcgatggag 568 |||||||||||||||||||| Sbjct: 2168 gcagtgggatctcgatggag 2187
>ref|NM_014293.2| Homo sapiens neuronal pentraxin receptor (NPTXR), transcript variant 1, mRNA Length = 5814 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 549 gcagtgggatctcgatggag 568 |||||||||||||||||||| Sbjct: 2171 gcagtgggatctcgatggag 2190
>emb|AL954341.14| Mouse DNA sequence from clone RP23-213D14 on chromosome 2, complete sequence Length = 178273 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 agtgacgtgacatgccataa 166 |||||||||||||||||||| Sbjct: 157578 agtgacgtgacatgccataa 157597
>emb|AL939130.1|SCO939130 Streptomyces coelicolor A3(2) complete genome; segment 27/29 Length = 303450 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 396 cgatgtcgccgacggcgtcc 415 |||||||||||||||||||| Sbjct: 231486 cgatgtcgccgacggcgtcc 231467
>emb|AL162057.1|HSM802588 Homo sapiens mRNA; cDNA DKFZp761N0524 (from clone DKFZp761N0524) Length = 4459 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 549 gcagtgggatctcgatggag 568 |||||||||||||||||||| Sbjct: 812 gcagtgggatctcgatggag 831
>emb|AL161974.1|HSM802567 Homo sapiens mRNA; cDNA DKFZp761M2013 (from clone DKFZp761M2013) Length = 5140 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 549 gcagtgggatctcgatggag 568 |||||||||||||||||||| Sbjct: 1484 gcagtgggatctcgatggag 1503 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,335,770 Number of Sequences: 3902068 Number of extensions: 4335770 Number of successful extensions: 77973 Number of sequences better than 10.0: 19 Number of HSP's better than 10.0 without gapping: 19 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 77847 Number of HSP's gapped (non-prelim): 126 length of query: 654 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 631 effective length of database: 17,143,297,704 effective search space: 10817420851224 effective search space used: 10817420851224 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)