ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasdc20
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AK071160.1| Oryza sativa (japonica cultivar-group) cDNA clon... 281 2e-72
2gb|BT019142.1| Zea mays clone Contig793.F mRNA sequence 210 5e-51
3gb|BT017341.1| Zea mays clone EL01N0321H01.c mRNA sequence 210 5e-51
4gb|AY110161.1| Zea mays CL30467_1 mRNA sequence 210 5e-51
5dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 200 5e-48
6gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 200 5e-48
7emb|AL713900.4|CNS07YQ0 Oryza sativa chromosome 12, . BAC OJ1126... 200 5e-48
8gb|AF205131.1|AF205131 Lilium longiflorum guanylate kinase (GK-1... 76 2e-10
9gb|AF205130.1|AF205130 Nicotiana tabacum guanylate kinase (GK-1)... 58 4e-05
10gb|AC140235.3| Mus musculus BAC clone RP24-272D15 from chromosom... 46 0.16
11gb|AC121995.2| Mus musculus BAC clone RP24-310M4 from 7, complet... 46 0.16
12emb|AJ278435.1|MMU278435 Mus musculus Ranbp7 gene, Staf gene and... 46 0.16
13emb|CR382126.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso... 42 2.5
14emb|AL954667.9| Zebrafish DNA sequence from clone CH211-214K3 in... 42 2.5
15dbj|AP008934.1| Staphylococcus saprophyticus subsp. saprophyticu... 42 2.5
16ref|NM_062771.1| Caenorhabditis elegans F55C12.5a (F55C12.5) mRN... 42 2.5
17ref|NM_182235.3| Caenorhabditis elegans F55C12.5c (F55C12.5) mRN... 42 2.5
18ref|NM_062770.3| Caenorhabditis elegans F55C12.5b (F55C12.5) mRN... 42 2.5
19emb|BX120011.13| Zebrafish DNA sequence from clone DKEY-18O5 in ... 42 2.5
20emb|BX005201.7| Zebrafish DNA sequence from clone CH211-129C21 i... 42 2.5
21gb|AC110553.10| Mus musculus chromosome 3, clone RP23-248D8, com... 40 9.8
22ref|NM_115615.2| Arabidopsis thaliana AGK2 AT3G57550 (AGK2) tran... 40 9.8
23ref|NM_001035800.1| Arabidopsis thaliana AGK2 AT3G57550 (AGK2) t... 40 9.8
24gb|AC161434.2| Mus musculus chromosome 3, clone RP23-7K18, compl... 40 9.8
25gb|AY422549.1| Ulva pertusa UperHK ribulose-1,5-bisphosphate car... 40 9.8
26gb|AY422548.1| Ulva pertusa Usp99-21 ribulose-1,5-bisphosphate c... 40 9.8
27gb|AY422547.1| Ulva pertusa Ufen99-20 ribulose-1,5-bisphosphate ... 40 9.8
28gb|AC139621.4| Artibeus jamaicensis clone 47H5, complete sequence 40 9.8
29gb|DQ196177.1| Chlamydomonas raudensis ribulose-1,5-bisphosphate... 40 9.8
30emb|CT010435.4| Mouse DNA sequence from clone RP23-445H9 on chro... 40 9.8
31gb|AC130835.3| Mus musculus BAC clone RP24-132F18 from chromosom... 40 9.8
32gb|AC002287.1|HUAC002287 Homo sapiens Chromosome 16 BAC clone CI... 40 9.8
33gb|AY255876.1| Umbraulva olivascens ribulose 1,5-bisphosphate ca... 40 9.8
34gb|AY255873.1| Ulva sp. WTU344819 ribulose 1,5-bisphosphate carb... 40 9.8
35gb|AY278376.1| Uncultured phototrophic eukaryote ribulose-1,5-bi... 40 9.8
36emb|AL390774.10| Human DNA sequence from clone RP11-417B4 on chr... 40 9.8
37emb|AL353633.13| Human DNA sequence from clone RP11-452B18 on ch... 40 9.8
38emb|AL133248.1|ATT8H10 Arabidopsis thaliana DNA chromosome 3, BA... 40 9.8
39dbj|AB127988.1| Chlamydomonas parkeae chloroplast rbcL gene for ... 40 9.8
40gb|AC138012.32| Medicago truncatula clone mth2-9b15, complete se... 40 9.8
41gb|AF387108.1|AF387108 Ulva lactuca ribulose bisphosphate carbox... 40 9.8
42emb|BX322544.6| Zebrafish DNA sequence from clone DKEY-27N14 in ... 40 9.8
43gb|DP000001.1| Artibeus jamaicensis target 1 genomic scaffold 40 9.8
44gb|AE010300.1| Leptospira interrogans serovar lai str. 56601 chr... 40 9.8
45emb|BX823964.1|CNS0A5OU Arabidopsis thaliana Full-length cDNA Co... 40 9.8
46gb|AC127459.3| Homo sapiens chromosome 16 clone RP11-20G6, compl... 40 9.8
47gb|AC140675.5| Mus musculus BAC clone RP23-44J10 from chromosome... 40 9.8
48gb|AC133645.5| Mus musculus BAC clone RP23-73O10 from chromosome... 40 9.8
49gb|AF499673.1| Ulvaria obscura var. blyttii ribulose 1,5-bisphos... 40 9.8
50gb|AC069506.14| Homo sapiens 3 BAC RP11-321G3 (Roswell Park Canc... 40 9.8
51gb|AF204676.1|AF204676 Arabidopsis thaliana cultivar Columbia gu... 40 9.8
52gb|AC157819.5| Mus musculus chromosome 3, clone RP24-273H20, com... 40 9.8
53dbj|AB097628.1| Ulva pertusa chloroplast rbcL gene for ribulose ... 40 9.8
54dbj|AB097627.1| Ulva pertusa chloroplast rbcL gene for ribulose ... 40 9.8
55dbj|AB097626.1| Ulva pertusa chloroplast rbcL gene for ribulose ... 40 9.8
56dbj|AB097625.1| Ulva pertusa chloroplast rbcL gene for ribulose ... 40 9.8
57dbj|AB097624.1| Ulva pertusa chloroplast rbcL gene for ribulose ... 40 9.8
58dbj|AB097614.1| Umbraulva amamiensis chloroplast rbcL gene for r... 40 9.8
59dbj|AB097613.1| Umbraulva japonica chloroplast rbcL gene for rib... 40 9.8
60dbj|AB097612.1| Umbraulva japonica chloroplast rbcL gene for rib... 40 9.8
61dbj|AB097611.1| Ulvaria fusca chloroplast rbcL gene for ribulose... 40 9.8
62emb|AJ001888.1|PA1888 Pteromonas angulosa gene encoding ribulose... 40 9.8
63emb|AJ001887.1|PA1887 Pteromonas angulosa gene encoding ribulose... 40 9.8
64emb|AJ001886.1|PP1886 Pteromonas protracta gene encoding ribulos... 40 9.8
65emb|AJ334653.1|HSA334653 Homo sapiens genomic sequence surroundi... 40 9.8
66gb|AF089834.1|AF089834 Chloromonas sp. ANT1 ribulose-1,5-bisphos... 40 9.8
67gb|AE016823.1| Leptospira interrogans serovar Copenhageni str. F... 40 9.8
68emb|AL731747.2|CNS08C7W Oryza sativa chromosome 12, . BAC OSJNBa... 40 9.8
69dbj|AB007323.1| Chlamydomonas pulsatilla DNA for large subunit o... 40 9.8
70dbj|AB007322.1| Chlamydomonas pulsatilla DNA for large subunit o... 40 9.8
71dbj|AB003427.1| Chlamydomonas pulsatilla chloroplast DNA for rbc... 40 9.8 
>dbj|AK071160.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023076J23, full
            insert sequence
          Length = 1829

 Score =  281 bits (142), Expect = 2e-72
 Identities = 180/193 (93%)
 Strand = Plus / Minus

                                                                        
Query: 525  tgaatctttgtggtcatcatccaacgaaagcaacttcttcaaattctcatagcatgcttc 584
            |||||||| ||||||||||||||| |||||||||||||||||||| ||||| || |||||
Sbjct: 1308 tgaatcttcgtggtcatcatccaaagaaagcaacttcttcaaattttcataacaagcttc 1249

                                                                        
Query: 585  aaggtcatcatttaccaaaagatgatcaaaaagacctggtgaattggactggtcaagctc 644
            ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 1248 aaggtcatcatttaccaaaagatgatcgaaaagacctggtgaattggactggtcaagctc 1189

                                                                        
Query: 645  agcacgagcatttctcagtcgcttttggatttgttcctctgtttcagtgccccgtgcccg 704
             ||||||||||| ||||||||||| |||||||| |||||||||||||| |||||||||||
Sbjct: 1188 tgcacgagcattcctcagtcgcttctggatttgctcctctgtttcagttccccgtgcccg 1129

                         
Query: 705  aangcgctgctct 717
            || ||||| ||||
Sbjct: 1128 aaggcgcttctct 1116



 Score = 48.1 bits (24), Expect = 0.040
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                
Query: 353  tcttgagacctcttgttcgtccaggagcaccacctg 388
            ||||||| || |||||||||||||||||||| ||||
Sbjct: 1486 tcttgaggccccttgttcgtccaggagcacctcctg 1451



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                   
Query: 474  tgttttggacaggatagaataacatgcggttgctttccc 512
            ||||||||||||||| || |||||||| ||| |||||||
Sbjct: 1368 tgttttggacaggattgagtaacatgcagtttctttccc 1330
to top
>gb|BT019142.1| Zea mays clone Contig793.F mRNA sequence
          Length = 1354

 Score =  210 bits (106), Expect = 5e-51
 Identities = 174/197 (88%)
 Strand = Plus / Minus

                                                                       
Query: 521 catctgaatctttgtggtcatcatccaacgaaagcaacttcttcaaattctcatagcatg 580
           ||||||||||||  | |||||||||||  |||||||||||||||||||||||||||||||
Sbjct: 847 catctgaatcttcttcgtcatcatccagagaaagcaacttcttcaaattctcatagcatg 788

                                                                       
Query: 581 cttcaaggtcatcatttaccaaaagatgatcaaaaagacctggtgaattggactggtcaa 640
             ||||||||||| || ||||||||||||||||| |||||||||  ||||||||| ||||
Sbjct: 787 tctcaaggtcatcgttgaccaaaagatgatcaaagagacctggttcattggactgatcaa 728

                                                                       
Query: 641 gctcagcacgagcatttctcagtcgcttttggatttgttcctctgtttcagtgccccgtg 700
           | |||||  |||||||||| ||||| || |||||||| |||||||||||||| |||||||
Sbjct: 727 gttcagcctgagcatttctgagtcgtttctggatttgctcctctgtttcagtaccccgtg 668

                            
Query: 701 cccgaangcgctgctct 717
           |||||| ||||| ||||
Sbjct: 667 cccgaaggcgcttctct 651



 Score = 40.1 bits (20), Expect = 9.8
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                                
Query: 337  gagttaactgagtgtgtcttgagacctcttgttcgtccaggagcaccacctg 388
            ||||||||||||  | |||| || || |||||||||||||| ||||| ||||
Sbjct: 1040 gagttaactgagcctatcttaaggccccttgttcgtccaggcgcaccgcctg 989
to top
>gb|BT017341.1| Zea mays clone EL01N0321H01.c mRNA sequence
          Length = 981

 Score =  210 bits (106), Expect = 5e-51
 Identities = 174/197 (88%)
 Strand = Plus / Minus

                                                                       
Query: 521 catctgaatctttgtggtcatcatccaacgaaagcaacttcttcaaattctcatagcatg 580
           ||||||||||||  | |||||||||||  |||||||||||||||||||||||||||||||
Sbjct: 475 catctgaatcttcttcgtcatcatccagagaaagcaacttcttcaaattctcatagcatg 416

                                                                       
Query: 581 cttcaaggtcatcatttaccaaaagatgatcaaaaagacctggtgaattggactggtcaa 640
             ||||||||||| || ||||||||||||||||| |||||||||  ||||||||| ||||
Sbjct: 415 tctcaaggtcatcgttgaccaaaagatgatcaaagagacctggttcattggactgatcaa 356

                                                                       
Query: 641 gctcagcacgagcatttctcagtcgcttttggatttgttcctctgtttcagtgccccgtg 700
           | |||||  |||||||||| ||||| || |||||||| |||||||||||||| |||||||
Sbjct: 355 gttcagcctgagcatttctgagtcgtttctggatttgctcctctgtttcagtaccccgtg 296

                            
Query: 701 cccgaangcgctgctct 717
           |||||| ||||| ||||
Sbjct: 295 cccgaaggcgcttctct 279



 Score = 40.1 bits (20), Expect = 9.8
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                               
Query: 337 gagttaactgagtgtgtcttgagacctcttgttcgtccaggagcaccacctg 388
           ||||||||||||  | |||| || || |||||||||||||| ||||| ||||
Sbjct: 668 gagttaactgagcctatcttaaggccccttgttcgtccaggcgcaccgcctg 617
to top
>gb|AY110161.1| Zea mays CL30467_1 mRNA sequence
          Length = 914

 Score =  210 bits (106), Expect = 5e-51
 Identities = 174/197 (88%)
 Strand = Plus / Plus

                                                                       
Query: 521 catctgaatctttgtggtcatcatccaacgaaagcaacttcttcaaattctcatagcatg 580
           ||||||||||||  | |||||||||||  |||||||||||||||||||||||||||||||
Sbjct: 451 catctgaatcttcttcgtcatcatccagagaaagcaacttcttcaaattctcatagcatg 510

                                                                       
Query: 581 cttcaaggtcatcatttaccaaaagatgatcaaaaagacctggtgaattggactggtcaa 640
             ||||||||||| || ||||||||||||||||| |||||||||  ||||||||| ||||
Sbjct: 511 tctcaaggtcatcgttgaccaaaagatgatcaaagagacctggttcattggactgatcaa 570

                                                                       
Query: 641 gctcagcacgagcatttctcagtcgcttttggatttgttcctctgtttcagtgccccgtg 700
           | |||||  |||||||||| ||||| || |||||||| |||||||||||||| |||||||
Sbjct: 571 gttcagcctgagcatttctgagtcgtttctggatttgctcctctgtttcagtaccccgtg 630

                            
Query: 701 cccgaangcgctgctct 717
           |||||| ||||| ||||
Sbjct: 631 cccgaaggcgcttctct 647



 Score = 40.1 bits (20), Expect = 9.8
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                               
Query: 337 gagttaactgagtgtgtcttgagacctcttgttcgtccaggagcaccacctg 388
           ||||||||||||  | |||| || || |||||||||||||| ||||| ||||
Sbjct: 258 gagttaactgagcctatcttaaggccccttgttcgtccaggcgcaccgcctg 309
to top
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score =  200 bits (101), Expect = 5e-48
 Identities = 128/137 (93%)
 Strand = Plus / Plus

                                                                            
Query: 561      cttcaaattctcatagcatgcttcaaggtcatcatttaccaaaagatgatcaaaaagacc 620
                ||||||||| ||||| || |||||||||||||||||||||||||||||||| ||||||||
Sbjct: 20070501 cttcaaattttcataacaagcttcaaggtcatcatttaccaaaagatgatcgaaaagacc 20070560

                                                                            
Query: 621      tggtgaattggactggtcaagctcagcacgagcatttctcagtcgcttttggatttgttc 680
                |||||||||||||||||||||||| ||||||||||| ||||||||||| |||||||| ||
Sbjct: 20070561 tggtgaattggactggtcaagctctgcacgagcattcctcagtcgcttctggatttgctc 20070620

                                 
Query: 681      ctctgtttcagtgcccc 697
                |||||||||||| ||||
Sbjct: 20070621 ctctgtttcagttcccc 20070637



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                      
Query: 525      tgaatctttgtggtcatcatccaacgaaagcaacttct 562
                |||||||| ||||||||||||||| |||||||||||||
Sbjct: 20070367 tgaatcttcgtggtcatcatccaaagaaagcaacttct 20070404



 Score = 48.1 bits (24), Expect = 0.040
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                    
Query: 353      tcttgagacctcttgttcgtccaggagcaccacctg 388
                ||||||| || |||||||||||||||||||| ||||
Sbjct: 20069990 tcttgaggccccttgttcgtccaggagcacctcctg 20070025



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                       
Query: 474      tgttttggacaggatagaataacatgcggttgctttccc 512
                ||||||||||||||| || |||||||| ||| |||||||
Sbjct: 20070215 tgttttggacaggattgagtaacatgcagtttctttccc 20070253



 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 200      tccctttttctctaactaat 219
                ||||||||||||||||||||
Sbjct: 21723611 tccctttttctctaactaat 21723592
to top
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score =  200 bits (101), Expect = 5e-48
 Identities = 128/137 (93%)
 Strand = Plus / Plus

                                                                            
Query: 561      cttcaaattctcatagcatgcttcaaggtcatcatttaccaaaagatgatcaaaaagacc 620
                ||||||||| ||||| || |||||||||||||||||||||||||||||||| ||||||||
Sbjct: 19996715 cttcaaattttcataacaagcttcaaggtcatcatttaccaaaagatgatcgaaaagacc 19996774

                                                                            
Query: 621      tggtgaattggactggtcaagctcagcacgagcatttctcagtcgcttttggatttgttc 680
                |||||||||||||||||||||||| ||||||||||| ||||||||||| |||||||| ||
Sbjct: 19996775 tggtgaattggactggtcaagctctgcacgagcattcctcagtcgcttctggatttgctc 19996834

                                 
Query: 681      ctctgtttcagtgcccc 697
                |||||||||||| ||||
Sbjct: 19996835 ctctgtttcagttcccc 19996851



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                      
Query: 525      tgaatctttgtggtcatcatccaacgaaagcaacttct 562
                |||||||| ||||||||||||||| |||||||||||||
Sbjct: 19996581 tgaatcttcgtggtcatcatccaaagaaagcaacttct 19996618



 Score = 48.1 bits (24), Expect = 0.040
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                    
Query: 353      tcttgagacctcttgttcgtccaggagcaccacctg 388
                ||||||| || |||||||||||||||||||| ||||
Sbjct: 19996204 tcttgaggccccttgttcgtccaggagcacctcctg 19996239



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                       
Query: 474      tgttttggacaggatagaataacatgcggttgctttccc 512
                ||||||||||||||| || |||||||| ||| |||||||
Sbjct: 19996429 tgttttggacaggattgagtaacatgcagtttctttccc 19996467



 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 200      tccctttttctctaactaat 219
                ||||||||||||||||||||
Sbjct: 21651956 tccctttttctctaactaat 21651937
to top
>emb|AL713900.4|CNS07YQ0 Oryza sativa chromosome 12, . BAC OJ1126_F07 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 99791

 Score =  200 bits (101), Expect = 5e-48
 Identities = 128/137 (93%)
 Strand = Plus / Plus

                                                                         
Query: 561   cttcaaattctcatagcatgcttcaaggtcatcatttaccaaaagatgatcaaaaagacc 620
             ||||||||| ||||| || |||||||||||||||||||||||||||||||| ||||||||
Sbjct: 50663 cttcaaattttcataacaagcttcaaggtcatcatttaccaaaagatgatcgaaaagacc 50722

                                                                         
Query: 621   tggtgaattggactggtcaagctcagcacgagcatttctcagtcgcttttggatttgttc 680
             |||||||||||||||||||||||| ||||||||||| ||||||||||| |||||||| ||
Sbjct: 50723 tggtgaattggactggtcaagctctgcacgagcattcctcagtcgcttctggatttgctc 50782

                              
Query: 681   ctctgtttcagtgcccc 697
             |||||||||||| ||||
Sbjct: 50783 ctctgtttcagttcccc 50799



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                   
Query: 525   tgaatctttgtggtcatcatccaacgaaagcaacttct 562
             |||||||| ||||||||||||||| |||||||||||||
Sbjct: 50529 tgaatcttcgtggtcatcatccaaagaaagcaacttct 50566



 Score = 48.1 bits (24), Expect = 0.040
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                 
Query: 353   tcttgagacctcttgttcgtccaggagcaccacctg 388
             ||||||| || |||||||||||||||||||| ||||
Sbjct: 50152 tcttgaggccccttgttcgtccaggagcacctcctg 50187



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                    
Query: 474   tgttttggacaggatagaataacatgcggttgctttccc 512
             ||||||||||||||| || |||||||| ||| |||||||
Sbjct: 50377 tgttttggacaggattgagtaacatgcagtttctttccc 50415
to top
>gb|AF205131.1|AF205131 Lilium longiflorum guanylate kinase (GK-1) mRNA, complete cds
          Length = 1440

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 110/134 (82%)
 Strand = Plus / Minus

                                                                        
Query: 573  atagcatgcttcaaggtcatcatttaccaaaagatgatcaaaaagacctggtgaattgga 632
            |||||||| ||||||||||||||| ||||| |||||||| || || || || || ||   
Sbjct: 1057 atagcatgattcaaggtcatcattaaccaagagatgatcgaagaggccaggagattttcc 998

                                                                        
Query: 633  ctggtcaagctcagcacgagcatttctcagtcgcttttggatttgttcctctgtttcagt 692
             || |||||||| || |  ||||||||||||| |||||| || |||||||| || |||||
Sbjct: 997  ttgctcaagctctgctcttgcatttctcagtctcttttgtatctgttcctcggtctcagt 938

                          
Query: 693  gccccgtgcccgaa 706
            ||||||||| ||||
Sbjct: 937  gccccgtgcacgaa 924
to top
>gb|AF205130.1|AF205130 Nicotiana tabacum guanylate kinase (GK-1) mRNA, complete cds
          Length = 1260

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 582 ttcaaggtcatcatttaccaaaagatgatcaaaaagacctg 622
           |||||||||||| |||||||||| |||||||||||| ||||
Sbjct: 736 ttcaaggtcatcgtttaccaaaatatgatcaaaaagtcctg 696
to top
>gb|AC140235.3| Mus musculus BAC clone RP24-272D15 from chromosome 7, complete sequence
          Length = 185617

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 124   tcattctggtacaaagaacaaac 146
             |||||||||||||||||||||||
Sbjct: 30819 tcattctggtacaaagaacaaac 30797
to top
>gb|AC121995.2| Mus musculus BAC clone RP24-310M4 from 7, complete sequence
          Length = 126991

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 124   tcattctggtacaaagaacaaac 146
             |||||||||||||||||||||||
Sbjct: 72944 tcattctggtacaaagaacaaac 72966
to top
>emb|AJ278435.1|MMU278435 Mus musculus Ranbp7 gene, Staf gene and Wee1 gene
          Length = 192519

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 124  tcattctggtacaaagaacaaac 146
            |||||||||||||||||||||||
Sbjct: 980  tcattctggtacaaagaacaaac 1002
to top
>emb|CR382126.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome F of strain NRRL
              Y-1140 of Kluyveromyces lactis
          Length = 2602197

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 175    aatggaaataaatcccactta 195
              |||||||||||||||||||||
Sbjct: 544506 aatggaaataaatcccactta 544526
to top
>emb|AL954667.9| Zebrafish DNA sequence from clone CH211-214K3 in linkage group 25,
              complete sequence
          Length = 202657

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 167    aaatgataaatggaaataaat 187
              |||||||||||||||||||||
Sbjct: 201004 aaatgataaatggaaataaat 201024
to top
>dbj|AP008934.1| Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 DNA,
              complete genome
          Length = 2516575

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 669    ttggatttgttcctctgtttc 689
              |||||||||||||||||||||
Sbjct: 421936 ttggatttgttcctctgtttc 421916
to top
>ref|NM_062771.1| Caenorhabditis elegans F55C12.5a (F55C12.5) mRNA, complete cds
          Length = 2631

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 598 accaaaagatgatcaaaaaga 618
           |||||||||||||||||||||
Sbjct: 648 accaaaagatgatcaaaaaga 668
to top
>ref|NM_182235.3| Caenorhabditis elegans F55C12.5c (F55C12.5) mRNA, complete cds
          Length = 3179

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 598 accaaaagatgatcaaaaaga 618
           |||||||||||||||||||||
Sbjct: 846 accaaaagatgatcaaaaaga 866
to top
>ref|NM_062770.3| Caenorhabditis elegans F55C12.5b (F55C12.5) mRNA, complete cds
          Length = 3247

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 598 accaaaagatgatcaaaaaga 618
           |||||||||||||||||||||
Sbjct: 846 accaaaagatgatcaaaaaga 866
to top
>emb|BX120011.13| Zebrafish DNA sequence from clone DKEY-18O5 in linkage group 25, complete
              sequence
          Length = 225675

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 167    aaatgataaatggaaataaat 187
              |||||||||||||||||||||
Sbjct: 134868 aaatgataaatggaaataaat 134888
to top
>emb|BX005201.7| Zebrafish DNA sequence from clone CH211-129C21 in linkage group 22,
              complete sequence
          Length = 184499

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 583    tcaaggtcatcatttaccaaa 603
              |||||||||||||||||||||
Sbjct: 117955 tcaaggtcatcatttaccaaa 117935
to top
>gb|AC110553.10| Mus musculus chromosome 3, clone RP23-248D8, complete sequence
          Length = 206620

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 223   tttctgaagctgttatatctcact 246
             |||||||||||||||||| |||||
Sbjct: 81814 tttctgaagctgttatatttcact 81837
to top
>ref|NM_115615.2| Arabidopsis thaliana AGK2 AT3G57550 (AGK2) transcript variant
            AT3G57550.1 mRNA, complete cds
          Length = 1774

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 655  tttctcagtcgcttttggatttgttcctctgt 686
            ||||| || |||||||||||||| ||||||||
Sbjct: 1184 tttctaagccgcttttggatttgctcctctgt 1153
to top
>ref|NM_001035800.1| Arabidopsis thaliana AGK2 AT3G57550 (AGK2) transcript variant
            AT3G57550.2 mRNA, complete cds
          Length = 1777

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 655  tttctcagtcgcttttggatttgttcctctgt 686
            ||||| || |||||||||||||| ||||||||
Sbjct: 1184 tttctaagccgcttttggatttgctcctctgt 1153
to top
>gb|AC161434.2| Mus musculus chromosome 3, clone RP23-7K18, complete sequence
          Length = 195815

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 223    tttctgaagctgttatatctcact 246
              |||||||||||||||||| |||||
Sbjct: 144349 tttctgaagctgttatatttcact 144372
to top
>gb|AY422549.1| Ulva pertusa UperHK ribulose-1,5-bisphosphate carboxylase/oxygenase
           large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1354

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 436 acttcaccagtttcagattg 455
           ||||||||||||||||||||
Sbjct: 674 acttcaccagtttcagattg 655
to top
>gb|AY422548.1| Ulva pertusa Usp99-21 ribulose-1,5-bisphosphate
           carboxylase/oxygenase large subunit (rbcL) gene, partial
           cds; chloroplast
          Length = 1354

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 436 acttcaccagtttcagattg 455
           ||||||||||||||||||||
Sbjct: 674 acttcaccagtttcagattg 655
to top
>gb|AY422547.1| Ulva pertusa Ufen99-20 ribulose-1,5-bisphosphate
           carboxylase/oxygenase large subunit (rbcL) gene, partial
           cds; chloroplast
          Length = 1354

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 436 acttcaccagtttcagattg 455
           ||||||||||||||||||||
Sbjct: 674 acttcaccagtttcagattg 655
to top
>gb|AC139621.4| Artibeus jamaicensis clone 47H5, complete sequence
          Length = 103728

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 191   acttacatttccctttttct 210
             ||||||||||||||||||||
Sbjct: 22909 acttacatttccctttttct 22928
to top
>gb|DQ196177.1| Chlamydomonas raudensis ribulose-1,5-bisphosphate
           carboxylase/oxygenase large subunit (rbcL) gene, partial
           cds; chloroplast
          Length = 1223

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 436 acttcaccagtttcagattg 455
           ||||||||||||||||||||
Sbjct: 704 acttcaccagtttcagattg 685
to top
>emb|CT010435.4| Mouse DNA sequence from clone RP23-445H9 on chromosome 12, complete
              sequence
          Length = 183240

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 172    ataaatggaaataaatccca 191
              ||||||||||||||||||||
Sbjct: 112928 ataaatggaaataaatccca 112909
to top
>gb|AC130835.3| Mus musculus BAC clone RP24-132F18 from chromosome 19, complete
             sequence
          Length = 170078

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 587   ggtcatcatttaccaaaaga 606
             ||||||||||||||||||||
Sbjct: 22319 ggtcatcatttaccaaaaga 22300
to top
>gb|AC002287.1|HUAC002287 Homo sapiens Chromosome 16 BAC clone CIT987-SKA-237H1  ~complete
            genomic sequence, complete sequence
          Length = 188636

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 513  ataacaaccatctgaatctt 532
            ||||||||||||||||||||
Sbjct: 1480 ataacaaccatctgaatctt 1461
to top
>gb|AY255876.1| Umbraulva olivascens ribulose 1,5-bisphosphate
           carboxylase/oxygenase large subunit (rbcL) gene, partial
           cds; chloroplast gene for chloroplast product
          Length = 1354

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 436 acttcaccagtttcagattg 455
           ||||||||||||||||||||
Sbjct: 674 acttcaccagtttcagattg 655
to top
>gb|AY255873.1| Ulva sp. WTU344819 ribulose 1,5-bisphosphate carboxylase/oxygenase
           large subunit (rbcL) gene, partial cds; chloroplast gene
           for chloroplast product
          Length = 1354

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 436 acttcaccagtttcagattg 455
           ||||||||||||||||||||
Sbjct: 674 acttcaccagtttcagattg 655
to top
>gb|AY278376.1| Uncultured phototrophic eukaryote ribulose-1,5-bisphosphate
           carboxylase/oxygenase large subunit (rbcL) gene, partial
           cds; plastid gene for plastid product
          Length = 448

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 436 acttcaccagtttcagattg 455
           ||||||||||||||||||||
Sbjct: 162 acttcaccagtttcagattg 143
to top
>emb|AL390774.10| Human DNA sequence from clone RP11-417B4 on chromosome 9 Contains part of
              the gene for a novel protein (KIAA1608), a novel gene, a
              LSM5 homolog, U6 small nuclear RNA associated (S.
              cerevisiae) (LSM5) pseudogene and a phosphatidylinositol
              glycan, class F (PIGF) pseudogene, complete sequence
          Length = 197055

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 190    cacttacatttccctttttctcta 213
              ||||||||||| ||||||||||||
Sbjct: 148752 cacttacatttacctttttctcta 148775
to top
>emb|AL353633.13| Human DNA sequence from clone RP11-452B18 on chromosome 13 Contains a
             novel pseudogene and a novel gene, complete sequence
          Length = 166649

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 167   aaatgataaatggaaataaa 186
             ||||||||||||||||||||
Sbjct: 42125 aaatgataaatggaaataaa 42106
to top
>emb|AL133248.1|ATT8H10 Arabidopsis thaliana DNA chromosome 3, BAC clone T8H10
          Length = 87503

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 655   tttctcagtcgcttttggatttgttcctctgt 686
             ||||| || |||||||||||||| ||||||||
Sbjct: 62461 tttctaagccgcttttggatttgctcctctgt 62430
to top
>dbj|AB127988.1| Chlamydomonas parkeae chloroplast rbcL gene for large subunit of
           ribulose-1,5-bisphosphate carboxylase/oxygenase, partial
           cds, strain:NIES-440
          Length = 1375

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 436 acttcaccagtttcagattg 455
           ||||||||||||||||||||
Sbjct: 691 acttcaccagtttcagattg 672
to top
>gb|AC138012.32| Medicago truncatula clone mth2-9b15, complete sequence
          Length = 105092

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 299   ttttgggttatctaatgccc 318
             ||||||||||||||||||||
Sbjct: 51719 ttttgggttatctaatgccc 51738
to top
>gb|AF387108.1|AF387108 Ulva lactuca ribulose bisphosphate carboxylase large subunit (rbcL)
           gene, partial cds; chloroplast gene for chloroplast
           product
          Length = 1311

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 436 acttcaccagtttcagattg 455
           ||||||||||||||||||||
Sbjct: 671 acttcaccagtttcagattg 652
to top
>emb|BX322544.6| Zebrafish DNA sequence from clone DKEY-27N14 in linkage group 16,
             complete sequence
          Length = 102811

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 163   gaacaaatgataaatggaaa 182
             ||||||||||||||||||||
Sbjct: 34369 gaacaaatgataaatggaaa 34388
to top
>gb|DP000001.1| Artibeus jamaicensis target 1 genomic scaffold
          Length = 584809

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 191    acttacatttccctttttct 210
              ||||||||||||||||||||
Sbjct: 193740 acttacatttccctttttct 193759
to top
>gb|AE010300.1| Leptospira interrogans serovar lai str. 56601 chromosome I, complete
               sequence
          Length = 4332241

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 197     atttccctttttctctaact 216
               ||||||||||||||||||||
Sbjct: 2549654 atttccctttttctctaact 2549635
to top
>emb|BX823964.1|CNS0A5OU Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTPGH10ZF10 of Hormone Treated Callus of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1750

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 655  tttctcagtcgcttttggatttgttcctctgt 686
            ||||| || |||||||||||||| ||||||||
Sbjct: 1183 tttctaagccgcttttggatttgctcctctgt 1152
to top
>gb|AC127459.3| Homo sapiens chromosome 16 clone RP11-20G6, complete sequence
          Length = 172331

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 513    ataacaaccatctgaatctt 532
              ||||||||||||||||||||
Sbjct: 102146 ataacaaccatctgaatctt 102127
to top
>gb|AC140675.5| Mus musculus BAC clone RP23-44J10 from chromosome 5, complete sequence
          Length = 229269

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 259    tccaccagtcaacgcttctg 278
              ||||||||||||||||||||
Sbjct: 227858 tccaccagtcaacgcttctg 227839
to top
>gb|AC133645.5| Mus musculus BAC clone RP23-73O10 from chromosome 5, complete sequence
          Length = 207846

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 259   tccaccagtcaacgcttctg 278
             ||||||||||||||||||||
Sbjct: 43778 tccaccagtcaacgcttctg 43759
to top
>gb|AF499673.1| Ulvaria obscura var. blyttii ribulose 1,5-bisphosphate
           carboxylase/oxygenase large subunit (rbcL) gene, partial
           cds; chloroplast gene for chloroplast product
          Length = 1355

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 436 acttcaccagtttcagattg 455
           ||||||||||||||||||||
Sbjct: 675 acttcaccagtttcagattg 656
to top
>gb|AC069506.14| Homo sapiens 3 BAC RP11-321G3 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 131274

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 85    gataagaggtacaatacaat 104
             ||||||||||||||||||||
Sbjct: 37649 gataagaggtacaatacaat 37668
to top
>gb|AF204676.1|AF204676 Arabidopsis thaliana cultivar Columbia guanylate kinase (GK-2) mRNA,
            complete cds
          Length = 1852

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 655  tttctcagtcgcttttggatttgttcctctgt 686
            ||||| || |||||||||||||| ||||||||
Sbjct: 1184 tttctaagccgcttttggatttgctcctctgt 1153
to top
>gb|AC157819.5| Mus musculus chromosome 3, clone RP24-273H20, complete sequence
          Length = 151601

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 165    acaaatgataaatggaaata 184
              ||||||||||||||||||||
Sbjct: 136916 acaaatgataaatggaaata 136897
to top
>dbj|AB097628.1| Ulva pertusa chloroplast rbcL gene for ribulose 1,5-bisphosphate
           carboxylase large subunit, partial cds,
           specimen_voucher:Herbarium of Graduate School of
           Science, Hokkaido University, Sapporo (SAP):095070
          Length = 1336

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 436 acttcaccagtttcagattg 455
           ||||||||||||||||||||
Sbjct: 681 acttcaccagtttcagattg 662
to top
>dbj|AB097627.1| Ulva pertusa chloroplast rbcL gene for ribulose 1,5-bisphosphate
           carboxylase large subunit, partial cds,
           specimen_voucher:Herbarium of Graduate School of
           Science, Hokkaido University, Sapporo (SAP):095069
          Length = 1336

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 436 acttcaccagtttcagattg 455
           ||||||||||||||||||||
Sbjct: 681 acttcaccagtttcagattg 662
to top
>dbj|AB097626.1| Ulva pertusa chloroplast rbcL gene for ribulose 1,5-bisphosphate
           carboxylase large subunit, partial cds,
           specimen_voucher:Herbarium of Graduate School of
           Science, Hokkaido University, Sapporo (SAP):095068
          Length = 1336

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 436 acttcaccagtttcagattg 455
           ||||||||||||||||||||
Sbjct: 681 acttcaccagtttcagattg 662
to top
>dbj|AB097625.1| Ulva pertusa chloroplast rbcL gene for ribulose 1,5-bisphosphate
           carboxylase large subunit, partial cds,
           specimen_voucher:Herbarium of Graduate School of
           Science, Hokkaido University, Sapporo (SAP):095066
          Length = 1336

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 436 acttcaccagtttcagattg 455
           ||||||||||||||||||||
Sbjct: 681 acttcaccagtttcagattg 662
to top
>dbj|AB097624.1| Ulva pertusa chloroplast rbcL gene for ribulose 1,5-bisphosphate
           carboxylase large subunit, partial cds,
           specimen_voucher:Herbarium of Graduate School of
           Science, Hokkaido University, Sapporo (SAP):095065
          Length = 1336

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 436 acttcaccagtttcagattg 455
           ||||||||||||||||||||
Sbjct: 681 acttcaccagtttcagattg 662
to top
>dbj|AB097614.1| Umbraulva amamiensis chloroplast rbcL gene for ribulose
           1,5-bisphosphate carboxylase large subunit, partial cds,
           specimen_voucher:Herbarium of Graduate School of
           Science, Hokkaido University, Sapporo (SAP):095052
          Length = 1336

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 436 acttcaccagtttcagattg 455
           ||||||||||||||||||||
Sbjct: 681 acttcaccagtttcagattg 662
to top
>dbj|AB097613.1| Umbraulva japonica chloroplast rbcL gene for ribulose
           1,5-bisphosphate carboxylase large subunit, partial cds,
           specimen_voucher:Herbarium of Graduate School of
           Science, Hokkaido University, Sapporo (SAP):095051
          Length = 1336

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 436 acttcaccagtttcagattg 455
           ||||||||||||||||||||
Sbjct: 681 acttcaccagtttcagattg 662
to top
>dbj|AB097612.1| Umbraulva japonica chloroplast rbcL gene for ribulose
           1,5-bisphosphate carboxylase large subunit, partial cds,
           specimen_voucher:Herbarium of Graduate School of
           Science, Hokkaido University, Sapporo (SAP):095050
          Length = 1336

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 436 acttcaccagtttcagattg 455
           ||||||||||||||||||||
Sbjct: 681 acttcaccagtttcagattg 662
to top
>dbj|AB097611.1| Ulvaria fusca chloroplast rbcL gene for ribulose 1,5-bisphosphate
           carboxylase large subunit, partial cds,
           specimen_voucher:Herbarium of Graduate School of
           Science, Hokkaido University, Sapporo (SAP):095049
          Length = 1336

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 436 acttcaccagtttcagattg 455
           ||||||||||||||||||||
Sbjct: 681 acttcaccagtttcagattg 662
to top
>emb|AJ001888.1|PA1888 Pteromonas angulosa gene encoding ribulose bisphosphate carboxylase
           large subunit (strain KR 91/3)
          Length = 1128

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 436 acttcaccagtttcagattg 455
           ||||||||||||||||||||
Sbjct: 674 acttcaccagtttcagattg 655
to top
>emb|AJ001887.1|PA1887 Pteromonas angulosa gene encoding ribulose bisphosphate carboxylase
           large subunit (strain KR 91/2)
          Length = 1128

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 436 acttcaccagtttcagattg 455
           ||||||||||||||||||||
Sbjct: 674 acttcaccagtttcagattg 655
to top
>emb|AJ001886.1|PP1886 Pteromonas protracta gene encoding ribulose bisphosphate
           carboxylase large subunit (strain UTEX 647)
          Length = 1128

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 436 acttcaccagtttcagattg 455
           ||||||||||||||||||||
Sbjct: 674 acttcaccagtttcagattg 655
to top
>emb|AJ334653.1|HSA334653 Homo sapiens genomic sequence surrounding NotI site, clone
           NR1-IN18R
          Length = 798

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 50  ccactgaacaaatataaggtacac 73
           |||||| |||||||||||||||||
Sbjct: 555 ccactgtacaaatataaggtacac 532
to top
>gb|AF089834.1|AF089834 Chloromonas sp. ANT1 ribulose-1,5-bisphosphate
           carboxylase/oxygenase large subunit (rbcL) gene,
           chloroplast gene encoding chloroplast protein, partial
           cds
          Length = 1328

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 436 acttcaccagtttcagattg 455
           ||||||||||||||||||||
Sbjct: 649 acttcaccagtttcagattg 630
to top
>gb|AE016823.1| Leptospira interrogans serovar Copenhageni str. Fiocruz L1-130, chromosome
               I, complete sequence
          Length = 4277185

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 197     atttccctttttctctaact 216
               ||||||||||||||||||||
Sbjct: 1737584 atttccctttttctctaact 1737603
to top
>emb|AL731747.2|CNS08C7W Oryza sativa chromosome 12, . BAC OSJNBa0024C08 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 186030

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 200   tccctttttctctaactaat 219
             ||||||||||||||||||||
Sbjct: 88940 tccctttttctctaactaat 88959
to top
>dbj|AB007323.1| Chlamydomonas pulsatilla DNA for large subunit of
           ribulose-1,5-bisphosphate carboxylase/oxygenase, partial
           cds, strain:CCAP11-44
          Length = 1131

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 436 acttcaccagtttcagattg 455
           ||||||||||||||||||||
Sbjct: 677 acttcaccagtttcagattg 658
to top
>dbj|AB007322.1| Chlamydomonas pulsatilla DNA for large subunit of
           ribulose-1,5-bisphosphate carboxylase/oxygenase, partial
           cds, strain:CCAP11-106
          Length = 1114

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 436 acttcaccagtttcagattg 455
           ||||||||||||||||||||
Sbjct: 682 acttcaccagtttcagattg 663
to top
>dbj|AB003427.1| Chlamydomonas pulsatilla chloroplast DNA for rbcL, partial cds
          Length = 1110

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 436 acttcaccagtttcagattg 455
           ||||||||||||||||||||
Sbjct: 679 acttcaccagtttcagattg 660


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,479,755
Number of Sequences: 3902068
Number of extensions: 6479755
Number of successful extensions: 126591
Number of sequences better than 10.0: 72
Number of HSP's better than 10.0 without gapping: 73
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 126211
Number of HSP's gapped (non-prelim): 380
length of query: 717
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 694
effective length of database: 17,143,297,704
effective search space: 11897448606576
effective search space used: 11897448606576
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top