ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbasdb20 |
|---|---|
| Clone Library Name | barley_pub |
>emb|AL512290.11| Human DNA sequence from clone RP13-143G15 on chromosome 6 Contains a cytochrome c oxidase subunit Vb (COX5B) pseudogene, a novel gene and part of a novel gene, complete sequence Length = 133918 Score = 44.1 bits (22), Expect = 0.56 Identities = 22/22 (100%) Strand = Plus / Minus Query: 216 tcctgaaaaaccaacataaacc 237 |||||||||||||||||||||| Sbjct: 22228 tcctgaaaaaccaacataaacc 22207
>gb|BC052305.1| Homo sapiens development and differentiation enhancing factor-like 1, mRNA (cDNA clone IMAGE:6377039), partial cds Length = 2609 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 361 ccttgaggcatctccttcagtgatg 385 ||||||| ||||||||||||||||| Sbjct: 1231 ccttgagccatctccttcagtgatg 1207
>gb|BC023519.2| Homo sapiens development and differentiation enhancing factor-like 1, mRNA (cDNA clone IMAGE:4109503), complete cds Length = 2249 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 361 ccttgaggcatctccttcagtgatg 385 ||||||| ||||||||||||||||| Sbjct: 888 ccttgagccatctccttcagtgatg 864
>gb|AC160017.2| Mus musculus BAC clone RP23-172C19 from chromosome 9, complete sequence Length = 189417 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 371 tctccttcagtgatggacaacctgt 395 ||||||||||||| ||||||||||| Sbjct: 94972 tctccttcagtgaaggacaacctgt 94948
>ref|XM_513193.1| PREDICTED: Pan troglodytes similar to up-regulated in liver cancer 1; similar to development- and differentiation-enhancing factor 2 (LOC456617), mRNA Length = 2694 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 361 ccttgaggcatctccttcagtgatg 385 ||||||| ||||||||||||||||| Sbjct: 2649 ccttgagccatctccttcagtgatg 2625
>gb|AF064864.1| Homo sapiens chromosome 21q22.3 PAC 21L13, complete sequence Length = 120007 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 111 ttacaactcttttaagtagat 131 ||||||||||||||||||||| Sbjct: 113718 ttacaactcttttaagtagat 113738
>emb|AL163283.2|HS21C083 Homo sapiens chromosome 21 segment HS21C083 Length = 340000 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 111 ttacaactcttttaagtagat 131 ||||||||||||||||||||| Sbjct: 198981 ttacaactcttttaagtagat 199001
>emb|AL359986.15| Human DNA sequence from clone RP11-106M14 on chromosome 10 Contains the PPP1R3C gene for protein phosphatase 1 regulatory (inhibitor) subunit 3C, a glyceraldehyde-3-phosphate dehydrogenase (GAPD) pseudogene and a CpG island, complete sequence Length = 173119 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 374 ccttcagtgatggacaacctg 394 ||||||||||||||||||||| Sbjct: 4433 ccttcagtgatggacaacctg 4453
>emb|AL357134.13| Human DNA sequence from clone RP4-654C18 on chromosome 1 Contains the 5' end of the TCEA3 gene for transcription elongation factor A (SII) 3, a single-stranded DNA binding protein (SSBP1) pseudogene, the 3' end of the gene for up-regulated in liver cancer 1 (UPLC1) (FLJ34972, FLJ20199, FLJ20246) and a CpG island, complete sequence Length = 66464 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 361 ccttgaggcatctccttcagtgatg 385 ||||||| ||||||||||||||||| Sbjct: 44131 ccttgagccatctccttcagtgatg 44155
>emb|AL121987.34|HSBA536C5 Human DNA sequence from clone RP11-536C5 on chromosome 1q23.1-24.1 Contains the 5' end of the KCNJ10 gene for potassium inwardly-rectifying channel subfamily J member 10, a novel gene, the KCNJ9 gene for potassium inwardly-rectifying channel subfamily J member 9, the IGSF8 gene for immunoglobulin superfamily member 8, the ATP1A2 gene for Na+/K+ transporting ATPase alpha 2 (+) polypeptide, the ATP1A4 gene for Na+/K+ transporting ATPase alpha 4 (+) polypeptide, the CASQ1 gene for calsequestrin 1 (fast-twitch, skeletal muscle), a novel gene, the PEA15 gene for phosphoprotein enriched in astrocytes 15 and four CpG islands, complete sequence Length = 170834 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 483 aagttttggaaatgatcctgc 503 ||||||||||||||||||||| Sbjct: 113739 aagttttggaaatgatcctgc 113759
>gb|BC060786.1| Homo sapiens development and differentiation enhancing factor-like 1, mRNA (cDNA clone MGC:71572 IMAGE:5298355), complete cds Length = 4094 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 361 ccttgaggcatctccttcagtgatg 385 ||||||| ||||||||||||||||| Sbjct: 2739 ccttgagccatctccttcagtgatg 2715
>gb|AF390027.1|AF421887S3 Homo sapiens Na,K-ATPase alpha-4 subunit (ATP1A4) gene, exons 5 and 6 and partial cds Length = 949 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 483 aagttttggaaatgatcctgc 503 ||||||||||||||||||||| Sbjct: 113 aagttttggaaatgatcctgc 133
>emb|CR609624.1| full-length cDNA clone CS0DI032YN12 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 2682 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 361 ccttgaggcatctccttcagtgatg 385 ||||||| ||||||||||||||||| Sbjct: 1377 ccttgagccatctccttcagtgatg 1353
>dbj|AK092291.1| Homo sapiens cDNA FLJ34972 fis, clone NTONG2005391, weakly similar to Bos taurus differentiation enhancing factor 1 (DEF-1) mRNA Length = 3812 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 361 ccttgaggcatctccttcagtgatg 385 ||||||| ||||||||||||||||| Sbjct: 2713 ccttgagccatctccttcagtgatg 2689
>gb|AF064866.2|AF064866 Homo sapiens chromosome 21 clone PAC 198E8, map 21q22.3, complete sequence Length = 119847 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 111 ttacaactcttttaagtagat 131 ||||||||||||||||||||| Sbjct: 12292 ttacaactcttttaagtagat 12312
>dbj|AK000206.1| Homo sapiens cDNA FLJ20199 fis, clone COLF1162 Length = 2623 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 361 ccttgaggcatctccttcagtgatg 385 ||||||| ||||||||||||||||| Sbjct: 1215 ccttgagccatctccttcagtgatg 1191
>dbj|AK074319.1| Homo sapiens cDNA FLJ23739 fis, clone HEP15286 Length = 2430 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 361 ccttgaggcatctccttcagtgatg 385 ||||||| ||||||||||||||||| Sbjct: 1074 ccttgagccatctccttcagtgatg 1050
>emb|CT010449.10| Mouse DNA sequence from clone RP23-347O24 on chromosome 12, complete sequence Length = 203697 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 265 tgtacctcccattcttcttcc 285 ||||||||||||||||||||| Sbjct: 100965 tgtacctcccattcttcttcc 100985
>ref|NM_017707.2| Homo sapiens development and differentiation enhancing factor-like 1 (DDEFL1), mRNA Length = 4050 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 361 ccttgaggcatctccttcagtgatg 385 ||||||| ||||||||||||||||| Sbjct: 2712 ccttgagccatctccttcagtgatg 2688
>dbj|AB056749.1| Homo sapiens UPLC1 mRNA for up-regulated in liver cancer 1, complete cds Length = 4050 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 361 ccttgaggcatctccttcagtgatg 385 ||||||| ||||||||||||||||| Sbjct: 2712 ccttgagccatctccttcagtgatg 2688
>gb|AC117590.14| Mus musculus chromosome 3, clone RP23-225F12, complete sequence Length = 180451 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 acaactcttttagataaaag 42 |||||||||||||||||||| Sbjct: 151176 acaactcttttagataaaag 151157
>gb|AE005674.1| Shigella flexneri 2a str. 301, complete genome Length = 4607203 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 203 tactttatccatttcctgaa 222 |||||||||||||||||||| Sbjct: 2791503 tactttatccatttcctgaa 2791484
>gb|AC123613.16| Mus musculus chromosome 1, clone RP23-434L2, complete sequence Length = 204785 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 81 agaaactgatagtagtttat 100 |||||||||||||||||||| Sbjct: 42779 agaaactgatagtagtttat 42798
>gb|AC111093.10| Mus musculus chromosome 3, clone RP23-170E22, complete sequence Length = 201202 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 acaactcttttagataaaag 42 |||||||||||||||||||| Sbjct: 199327 acaactcttttagataaaag 199346
>gb|AC121302.7| Mus musculus chromosome 13, clone RP23-163B12, complete sequence Length = 190256 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 586 tcttgatttatcattgagaa 605 |||||||||||||||||||| Sbjct: 178546 tcttgatttatcattgagaa 178527
>gb|AC104231.10| Homo sapiens chromosome 15, clone RP11-96H23, complete sequence Length = 81256 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 55 cagtatcccagttttccact 74 |||||||||||||||||||| Sbjct: 49820 cagtatcccagttttccact 49839
>gb|AC122295.4| Mus musculus BAC clone RP23-263E3 from 13, complete sequence Length = 200289 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 586 tcttgatttatcattgagaa 605 |||||||||||||||||||| Sbjct: 7106 tcttgatttatcattgagaa 7087
>gb|AE014075.1| Escherichia coli CFT073, complete genome Length = 5231428 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 203 tactttatccatttcctgaa 222 |||||||||||||||||||| Sbjct: 3100200 tactttatccatttcctgaa 3100181
>gb|CP000243.1| Escherichia coli UTI89, complete genome Length = 5065741 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 203 tactttatccatttcctgaa 222 |||||||||||||||||||| Sbjct: 2976404 tactttatccatttcctgaa 2976385
>emb|AL732423.12| Human DNA sequence from clone RP11-345L8 on chromosome X Contains the 3' end of the SH3KBP1 gene for SH3-domain kinase binding protein 1 (CIN85) and the 5' end of the gene for a novel protein similar to mitogen-activated protein kinase kinase kinase 5 (MAP3K5), complete sequence Length = 173520 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 71 cactagcagcagaaactgat 90 |||||||||||||||||||| Sbjct: 73001 cactagcagcagaaactgat 73020
>emb|AL591896.6| Human DNA sequence from clone RP11-422P22 on chromosome 1 Contains a gene for a novel protein containing Kelch motif and a putative novel gene, complete sequence Length = 117320 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 257 tgctctggtgtacctcccat 276 |||||||||||||||||||| Sbjct: 102823 tgctctggtgtacctcccat 102804
>emb|AL139010.29| Human DNA sequence from clone RP11-444M10 on chromosome 1 Contains the 3' end of a novel gene, a novel gene and the KIRREL gene for kin of IRRE like (Drosophila), complete sequence Length = 189477 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 363 ttgaggcatctccttcagtg 382 |||||||||||||||||||| Sbjct: 132550 ttgaggcatctccttcagtg 132569
>dbj|AK056173.1| Homo sapiens cDNA FLJ31611 fis, clone NT2RI2002923 Length = 2167 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 257 tgctctggtgtacctcccat 276 |||||||||||||||||||| Sbjct: 719 tgctctggtgtacctcccat 700
>gb|AC093183.3| Homo sapiens chromosome 7 clone RP11-786I1, complete sequence Length = 174133 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 612 atggagatgagtgatgttcc 631 |||||||||||||||||||| Sbjct: 139593 atggagatgagtgatgttcc 139574
>gb|AC091843.3| Homo sapiens chromosome 5 clone CTD-2185O23, complete sequence Length = 177056 Score = 40.1 bits (20), Expect = 8.8 Identities = 26/28 (92%) Strand = Plus / Plus Query: 205 ctttatccatttcctgaaaaaccaacat 232 |||||| ||||| ||||||||||||||| Sbjct: 149395 ctttatacattttctgaaaaaccaacat 149422
>gb|AC069082.9| Homo sapiens chromosome 15, clone RP11-716C8, complete sequence Length = 163533 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 55 cagtatcccagttttccact 74 |||||||||||||||||||| Sbjct: 11211 cagtatcccagttttccact 11230
>gb|AC010928.7|AC010928 Homo sapiens chromosome 18, clone RP11-325K19, complete sequence Length = 213552 Score = 40.1 bits (20), Expect = 8.8 Identities = 26/28 (92%) Strand = Plus / Minus Query: 205 ctttatccatttcctgaaaaaccaacat 232 |||||| ||||| ||||||||||||||| Sbjct: 144875 ctttatacattttctgaaaaaccaacat 144848
>gb|AC069272.18|AC069272 Homo sapiens chromosome 4 clone RP11-76G10, complete sequence Length = 160359 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 acaactcttttagataaaag 42 |||||||||||||||||||| Sbjct: 121424 acaactcttttagataaaag 121405
>gb|AC018638.5|AC018638 Homo sapiens chromosome 7 clone RP11-274B21, complete sequence Length = 176875 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 612 atggagatgagtgatgttcc 631 |||||||||||||||||||| Sbjct: 96176 atggagatgagtgatgttcc 96195
>gb|AC068274.5| Homo sapiens BAC clone RP11-119B15 from 2, complete sequence Length = 118955 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 34 agataaaagggagactagac 53 |||||||||||||||||||| Sbjct: 38512 agataaaagggagactagac 38493
>gb|AC012514.29| Homo sapiens 12 BAC RP11-837P6 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 52784 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 241 ttgatgtgactaatcttgct 260 |||||||||||||||||||| Sbjct: 22848 ttgatgtgactaatcttgct 22867
>gb|AE014073.1| Shigella flexneri 2a str. 2457T, complete genome Length = 4599354 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 203 tactttatccatttcctgaa 222 |||||||||||||||||||| Sbjct: 2786137 tactttatccatttcctgaa 2786118
>gb|AE008384.1| Methanosarcina mazei strain Goe1, complete genome Length = 4096345 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 212 catttcctgaaaaaccaaca 231 |||||||||||||||||||| Sbjct: 1696084 catttcctgaaaaaccaaca 1696103
>gb|AE005174.2| Escherichia coli O157:H7 EDL933, complete genome Length = 5528445 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 203 tactttatccatttcctgaa 222 |||||||||||||||||||| Sbjct: 3609052 tactttatccatttcctgaa 3609033
>dbj|BA000007.2| Escherichia coli O157:H7 DNA, complete genome Length = 5498450 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 203 tactttatccatttcctgaa 222 |||||||||||||||||||| Sbjct: 3541762 tactttatccatttcctgaa 3541743
>gb|CP000034.1| Shigella dysenteriae Sd197, complete genome Length = 4369232 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 203 tactttatccatttcctgaa 222 |||||||||||||||||||| Sbjct: 2671651 tactttatccatttcctgaa 2671632
>emb|AL844590.3| Mouse DNA sequence from clone RP23-335P15 on chromosome 2, complete sequence Length = 231459 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 213 atttcctgaaaaaccaacat 232 |||||||||||||||||||| Sbjct: 174937 atttcctgaaaaaccaacat 174956
>gb|CP000036.1| Shigella boydii Sb227, complete genome Length = 4519823 Score = 40.1 bits (20), Expect = 8.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 203 tactttatccatttcctgaa 222 |||||||||||||||||||| Sbjct: 2834142 tactttatccatttcctgaa 2834161 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,776,097 Number of Sequences: 3902068 Number of extensions: 5776097 Number of successful extensions: 132918 Number of sequences better than 10.0: 48 Number of HSP's better than 10.0 without gapping: 48 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 132702 Number of HSP's gapped (non-prelim): 216 length of query: 644 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 621 effective length of database: 17,143,297,704 effective search space: 10645987874184 effective search space used: 10645987874184 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
