>gb|AC097175.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1119_H02,
             complete sequence
          Length = 138584

 Score =  135 bits (68), Expect = 3e-29
 Identities = 106/119 (89%)
 Strand = Plus / Plus

                                                                         
Query: 5     tcatcaagacaaactgaacagctgacaacctcttcgattttgacagtgggcagggcttcn 64
             |||||||| || ||||||||||||||||||||||||||||| ||||||||||| ||||| 
Sbjct: 83257 tcatcaaggcagactgaacagctgacaacctcttcgattttcacagtgggcagcgcttca 83316

                                                                        
Query: 65    actgcttctttcttcgcgggaggggtaccataccggcttgggtcattctcagccaaatg 123
             || || |||||||| || ||||||||||||| ||| ||||||||  |||||||||||||
Sbjct: 83317 accgcctctttctttgcaggaggggtaccattccgacttgggtcgctctcagccaaatg 83375

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  135 bits (68), Expect = 3e-29
 Identities = 106/119 (89%)
 Strand = Plus / Plus

                                                                            
Query: 5        tcatcaagacaaactgaacagctgacaacctcttcgattttgacagtgggcagggcttcn 64
                |||||||| || ||||||||||||||||||||||||||||| ||||||||||| ||||| 
Sbjct: 23879422 tcatcaaggcagactgaacagctgacaacctcttcgattttcacagtgggcagcgcttca 23879481

                                                                           
Query: 65       actgcttctttcttcgcgggaggggtaccataccggcttgggtcattctcagccaaatg 123
                || || |||||||| || ||||||||||||| ||| ||||||||  |||||||||||||
Sbjct: 23879482 accgcctctttctttgcaggaggggtaccattccgacttgggtcgctctcagccaaatg 23879540

>gb|AY107485.1| Zea mays PCO090409 mRNA sequence
          Length = 615

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                       
Query: 46  gacagtgggcagggcttcnactgcttctttcttcgcgggaggggtaccataccggcttgg 105
           |||||||||||| ||||| || || ||| ||||||| |||||||| || |||||| | ||
Sbjct: 176 gacagtgggcagagcttcgaccgcctctctcttcgccggaggggtgccgtaccggttcgg 117

                                
Query: 106 gtcattctcagccaaatgctg 126
           ||| ||||| |||| ||||||
Sbjct: 116 gtcgttctcggccagatgctg 96

>ref|NM_125017.3| Arabidopsis thaliana protein binding / ubiquitin-protein ligase/
           zinc ion binding AT5G56340 mRNA, complete cds
          Length = 1484

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 107 tcattctcagccaaatgctg 126
           ||||||||||||||||||||
Sbjct: 772 tcattctcagccaaatgctg 753

>gb|AY091194.1| Arabidopsis thaliana unknown protein (At5g56340) mRNA, complete cds
          Length = 1222

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 107 tcattctcagccaaatgctg 126
           ||||||||||||||||||||
Sbjct: 692 tcattctcagccaaatgctg 673

>gb|AY063905.1| Arabidopsis thaliana unknown protein (At5g56340) mRNA, complete cds
          Length = 1478

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 107 tcattctcagccaaatgctg 126
           ||||||||||||||||||||
Sbjct: 779 tcattctcagccaaatgctg 760

>emb|AL731896.10| Mouse DNA sequence from clone RP23-348D11 on chromosome 11 Contains a
              ribosomal protein L15 (Rpl15) pseudogene and a SNARE
              protein Ykt (0610042I15Rik) pseudogene, complete sequence
          Length = 226786

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 2      aggtcatcaagacaaactgaacag 25
              |||||||||||||||||| |||||
Sbjct: 221121 aggtcatcaagacaaactaaacag 221144

>emb|BX829891.1|CNS0A06A Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB44ZB10 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 755

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 107 tcattctcagccaaatgctg 126
           ||||||||||||||||||||
Sbjct: 88  tcattctcagccaaatgctg 69

>dbj|AB009049.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MCD7
          Length = 87685

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 107   tcattctcagccaaatgctg 126
             ||||||||||||||||||||
Sbjct: 32064 tcattctcagccaaatgctg 32045

>gb|AC154514.2| Mus musculus BAC clone RP24-77G11 from chromosome 9, complete sequence
          Length = 188944

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 107    tcattctcagccaaatgct 125
              |||||||||||||||||||
Sbjct: 106671 tcattctcagccaaatgct 106689

>gb|AC150866.2| Bos taurus  BAC CH240-290G4 (Children's Hospital Oakland Research
              Institute Bovine BAC Library (male)) complete sequence
          Length = 170911

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 45     tgacagtgggcagggcttc 63
              |||||||||||||||||||
Sbjct: 134667 tgacagtgggcagggcttc 134649

>gb|AE008839.1| Salmonella typhimurium LT2, section 143 of 220 of the complete genome
          Length = 22400

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 42    ttttgacagtgggcagggc 60
             |||||||||||||||||||
Sbjct: 10963 ttttgacagtgggcagggc 10945

>emb|AL627277.1| Salmonella enterica serovar Typhi (Salmonella typhi) strain CT18,
             complete chromosome; segment 13/20
          Length = 230050

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 42    ttttgacagtgggcagggc 60
             |||||||||||||||||||
Sbjct: 71326 ttttgacagtgggcagggc 71308

>ref|XM_688693.1| PREDICTED: Danio rerio similar to Tripartite motif protein 25 (Zinc
           finger protein 147) (Estrogen responsive finger protein)
           (Efp) (RING finger protein 147) (LOC565414), mRNA
          Length = 1836

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 11  agacaaactgaacagctga 29
           |||||||||||||||||||
Sbjct: 200 agacaaactgaacagctga 182

>gb|CP000026.1| Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150
          Length = 4585229

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 42      ttttgacagtgggcagggc 60
               |||||||||||||||||||
Sbjct: 3007969 ttttgacagtgggcagggc 3007951

>gb|AE014613.1| Salmonella enterica subsp. enterica serovar Typhi Ty2, complete genome
          Length = 4791961

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 42      ttttgacagtgggcagggc 60
               |||||||||||||||||||
Sbjct: 3033233 ttttgacagtgggcagggc 3033215

>gb|AE017220.1| Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67,
               complete genome
          Length = 4755700

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 42      ttttgacagtgggcagggc 60
               |||||||||||||||||||
Sbjct: 3149231 ttttgacagtgggcagggc 3149213


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 944,732
Number of Sequences: 3902068
Number of extensions: 944732
Number of successful extensions: 63679
Number of sequences better than 10.0: 17
Number of HSP's better than 10.0 without gapping: 17
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 63621
Number of HSP's gapped (non-prelim): 58
length of query: 126
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 105
effective length of database: 17,151,101,840
effective search space: 1800865693200
effective search space used: 1800865693200
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)