ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd3p09
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_473352.1| Oryza sativa (japonica cultivar-group), predic... 188 1e-44
2gb|AY110518.1| Zea mays CL36099_1 mRNA sequence 159 9e-36
3emb|AL606587.3|OSJN00022 Oryza sativa genomic DNA, chromosome 4,... 111 2e-21
4dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 111 2e-21
5ref|NM_119632.2| Arabidopsis thaliana clathrin binding AT4G34660... 42 1.5
6gb|BT018209.1| Zea mays clone EL01N0560D01.c mRNA sequence 42 1.5
7gb|DQ207695.1| Zea mays cultivar inbred line Mo17 IDP364 marker 42 1.5
8gb|DQ207694.1| Zea mays cultivar B73 IDP364 marker 42 1.5
9ref|XM_953652.1| Neurospora crassa OR74A hypothetical protein (N... 42 1.5
10ref|XM_332093.1| Neurospora crassa OR74A hypothetical protein (N... 42 1.5
11emb|CR388047.20| Zebrafish DNA sequence from clone DKEY-244D13, ... 42 1.5
12gb|AY096478.1| Arabidopsis thaliana unknown protein (At4g34660) ... 42 1.5
13gb|AY072132.1| Arabidopsis thaliana unknown protein (At4g34660) ... 42 1.5
14emb|AL161586.2|ATCHRIV82 Arabidopsis thaliana DNA chromosome 4, ... 42 1.5
15emb|AL161585.2|ATCHRIV81 Arabidopsis thaliana DNA chromosome 4, ... 42 1.5
16emb|AL023094.2|ATT4L20 Arabidopsis thaliana DNA chromosome 4, BA... 42 1.5
17gb|AF367774.1|AF367774 Arabidopsis thaliana SH3 domain-containin... 42 1.5
18emb|BX004816.11| Zebrafish DNA sequence from clone DKEY-30G5 in ... 42 1.5
19emb|BX827471.1|CNS0A3PF Arabidopsis thaliana Full-length cDNA Co... 42 1.5
20gb|AY087158.1| Arabidopsis thaliana clone 32357 mRNA, complete s... 42 1.5
21gb|AY104610.1| Zea mays PCO082433 mRNA sequence 42 1.5
22gb|AC112493.2| Homo sapiens X BAC RP11-2M5 (Roswell Park Cancer ... 42 1.5
23gb|AC156985.12| Mus musculus chromosome 7, clone RP23-417L14, co... 40 5.8
24gb|AC144640.3| Carollia perspicillata clone 14D2, complete sequence 40 5.8
25emb|BX957362.26| Zebrafish DNA sequence from clone CH211-122F10 ... 40 5.8
26emb|CR378664.1| Photobacterium profundum SS9; segment 2/12 40 5.8
27emb|BX511270.9| Zebrafish DNA sequence from clone DKEY-35N12 in ... 40 5.8
28gb|AC011773.9| Homo sapiens chromosome 8, clone RP11-219B4, comp... 40 5.8
29gb|AC025800.10| Homo sapiens chromosome 8, clone RP11-600N23, co... 40 5.8
30emb|AL512583.11| Mouse DNA sequence from clone RP23-444H3 on chr... 40 5.8
31gb|AC154003.4| Mus musculus 6 BAC RP24-92L16 (Roswell Park Cance... 40 5.8
32gb|AC096570.1| Homo sapiens BAC clone RP11-368O18 from 2, comple... 40 5.8
33gb|AC155842.4| Mus musculus 6 BAC RP24-122N23 (Roswell Park Canc... 40 5.8
34dbj|AP000446.5| Homo sapiens genomic DNA, chromosome 11q, clone:... 40 5.8
35gb|AC162521.4| Mus musculus chromosome 7, clone RP23-356O13, com... 40 5.8
36emb|Z66519.2|CEB0334 Caenorhabditis elegans Cosmid B0334, comple... 40 5.8
37gb|AC120846.16| Mus musculus chromosome 7, clone RP24-317L6, com... 40 5.8
38gb|AC005380.1|AC005380 Homo sapiens chromosome 19, cosmid F6156,... 40 5.8
39gb|DP000018.1| Carollia perspicillata target 1 genomic scaffold 40 5.8 
>ref|XM_473352.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1110

 Score =  188 bits (95), Expect = 1e-44
 Identities = 181/210 (86%)
 Strand = Plus / Minus

                                                                        
Query: 225  ctagaaaatatgcgggactttgctcgccagaacacgctcgcgcctttcgacgtaagcatg 284
            |||||||||||| || || ||||| || ||||| ||||| || |||||||  ||| ||||
Sbjct: 1110 ctagaaaatatgtggaaccttgctagctagaactcgctctcgtctttcgatataaccatg 1051

                                                                        
Query: 285  tgggaaccatcctgcttttcccttgcattcaccttccgcccagccgttgcttgatatctt 344
            |||||||||||||||||||||||||||||| ||||| ||||| || ||| ||||||||||
Sbjct: 1050 tgggaaccatcctgcttttcccttgcattcgccttctgcccaaccattggttgatatctt 991

                                                                        
Query: 345  tcggacgataacgatgtcaccaactgataagttgagctcaaactcactctcanccttgaa 404
             ||||| ||||| ||||| ||| |||| ||||| |||||| ||||||| ||| |||||||
Sbjct: 990  ccggacaataacaatgtctccagctgacaagttaagctcagactcactttcagccttgaa 931

                                          
Query: 405  ggaatcgagggcctctcccaggaacaaatc 434
            |||||| ||||||||||| ||||| |||||
Sbjct: 930  ggaatcaagggcctctcctaggaagaaatc 901
to top
>gb|AY110518.1| Zea mays CL36099_1 mRNA sequence
          Length = 655

 Score =  159 bits (80), Expect = 9e-36
 Identities = 172/203 (84%)
 Strand = Plus / Minus

                                                                       
Query: 232 atatgcgggactttgctcgccagaacacgctcgcgcctttcgacgtaagcatgtgggaac 291
           ||||| || |||||||| || |||||||| ||  ||||||| |  |||||||| ||||||
Sbjct: 579 atatgtggaactttgcttgctagaacacgttcctgcctttcaatataagcatgagggaac 520

                                                                       
Query: 292 catcctgcttttcccttgcattcaccttccgcccagccgttgcttgatatctttcggacg 351
           ||||||||||| ||||||||||||||||| ||||| || |||||||| ||||||||||| 
Sbjct: 519 catcctgctttgcccttgcattcaccttctgcccaaccattgcttgagatctttcggaca 460

                                                                       
Query: 352 ataacgatgtcaccaactgataagttgagctcaaactcactctcanccttgaaggaatcg 411
           || || ||||||||| |||| ||| | |||||||||||||| ||| | || || ||||| 
Sbjct: 459 attacaatgtcaccagctgacaaggtaagctcaaactcactttcagcattaaatgaatca 400

                                  
Query: 412 agggcctctcccaggaacaaatc 434
           ||||||||||| ||||| |||||
Sbjct: 399 agggcctctccaaggaagaaatc 377
to top
>emb|AL606587.3|OSJN00022 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0011L07,
             complete sequence
          Length = 143585

 Score =  111 bits (56), Expect = 2e-21
 Identities = 104/120 (86%)
 Strand = Plus / Plus

                                                                         
Query: 224   cctagaaaatatgcgggactttgctcgccagaacacgctcgcgcctttcgacgtaagcat 283
             ||||||||||||| || || ||||| || ||||| ||||| || |||||||  ||| |||
Sbjct: 56955 cctagaaaatatgtggaaccttgctagctagaactcgctctcgtctttcgatataaccat 57014

                                                                         
Query: 284   gtgggaaccatcctgcttttcccttgcattcaccttccgcccagccgttgcttgatatct 343
             ||||||||||||||||||||||||||||||| ||||| ||||| || ||| |||||||||
Sbjct: 57015 gtgggaaccatcctgcttttcccttgcattcgccttctgcccaaccattggttgatatct 57074



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 63/73 (86%)
 Strand = Plus / Plus

                                                                         
Query: 346   cggacgataacgatgtcaccaactgataagttgagctcaaactcactctcanccttgaag 405
             ||||| ||||| ||||| ||| |||| ||||| |||||| ||||||| ||| ||||||||
Sbjct: 57219 cggacaataacaatgtctccagctgacaagttaagctcagactcactttcagccttgaag 57278

                          
Query: 406   gaatcgagggcct 418
             ||||| |||||||
Sbjct: 57279 gaatcaagggcct 57291
to top
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  111 bits (56), Expect = 2e-21
 Identities = 104/120 (86%)
 Strand = Plus / Plus

                                                                            
Query: 224      cctagaaaatatgcgggactttgctcgccagaacacgctcgcgcctttcgacgtaagcat 283
                ||||||||||||| || || ||||| || ||||| ||||| || |||||||  ||| |||
Sbjct: 26989254 cctagaaaatatgtggaaccttgctagctagaactcgctctcgtctttcgatataaccat 26989313

                                                                            
Query: 284      gtgggaaccatcctgcttttcccttgcattcaccttccgcccagccgttgcttgatatct 343
                ||||||||||||||||||||||||||||||| ||||| ||||| || ||| |||||||||
Sbjct: 26989314 gtgggaaccatcctgcttttcccttgcattcgccttctgcccaaccattggttgatatct 26989373



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 63/73 (86%)
 Strand = Plus / Plus

                                                                            
Query: 346      cggacgataacgatgtcaccaactgataagttgagctcaaactcactctcanccttgaag 405
                ||||| ||||| ||||| ||| |||| ||||| |||||| ||||||| ||| ||||||||
Sbjct: 26989518 cggacaataacaatgtctccagctgacaagttaagctcagactcactttcagccttgaag 26989577

                             
Query: 406      gaatcgagggcct 418
                ||||| |||||||
Sbjct: 26989578 gaatcaagggcct 26989590
to top
>ref|NM_119632.2| Arabidopsis thaliana clathrin binding AT4G34660 mRNA, complete cds
          Length = 1610

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 286  gggaaccatcctgcttttcccttgcattcaccttccgccca 326
            |||||||| || ||||| || |||||||||||||| |||||
Sbjct: 1202 gggaaccaaccagctttgcctttgcattcaccttcggccca 1162
to top
>gb|BT018209.1| Zea mays clone EL01N0560D01.c mRNA sequence
          Length = 778

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 309 gcattcaccttccgcccagccgttg 333
           |||||| ||||||||||||||||||
Sbjct: 415 gcattctccttccgcccagccgttg 439
to top
>gb|DQ207695.1| Zea mays cultivar inbred line Mo17 IDP364 marker
          Length = 782

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 309 gcattcaccttccgcccagccgttg 333
           |||||| ||||||||||||||||||
Sbjct: 255 gcattctccttccgcccagccgttg 279
to top
>gb|DQ207694.1| Zea mays cultivar B73 IDP364 marker
          Length = 893

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 309 gcattcaccttccgcccagccgttg 333
           |||||| ||||||||||||||||||
Sbjct: 643 gcattctccttccgcccagccgttg 619
to top
>ref|XM_953652.1| Neurospora crassa OR74A hypothetical protein (NCU09402.1) partial
           mRNA
          Length = 1425

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 205 tatgttcctcctcaaaacccc 225
           |||||||||||||||||||||
Sbjct: 355 tatgttcctcctcaaaacccc 335
to top
>ref|XM_332093.1| Neurospora crassa OR74A hypothetical protein (NCU09402.1) partial
           mRNA
          Length = 1425

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 205 tatgttcctcctcaaaacccc 225
           |||||||||||||||||||||
Sbjct: 355 tatgttcctcctcaaaacccc 335
to top
>emb|CR388047.20| Zebrafish DNA sequence from clone DKEY-244D13, complete sequence
          Length = 223119

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 74    gttctgaaatgtcagatgtacatca 98
             |||||||||||||| ||||||||||
Sbjct: 90005 gttctgaaatgtcacatgtacatca 89981
to top
>gb|AY096478.1| Arabidopsis thaliana unknown protein (At4g34660) mRNA, complete cds
          Length = 1138

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 286  gggaaccatcctgcttttcccttgcattcaccttccgccca 326
            |||||||| || ||||| || |||||||||||||| |||||
Sbjct: 1046 gggaaccaaccagctttgcctttgcattcaccttcggccca 1006
to top
>gb|AY072132.1| Arabidopsis thaliana unknown protein (At4g34660) mRNA, complete cds
          Length = 1639

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 286  gggaaccatcctgcttttcccttgcattcaccttccgccca 326
            |||||||| || ||||| || |||||||||||||| |||||
Sbjct: 1204 gggaaccaaccagctttgcctttgcattcaccttcggccca 1164
to top
>emb|AL161586.2|ATCHRIV82 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 82
          Length = 195165

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 286 gggaaccatcctgcttttcccttgcattcaccttccgccca 326
           |||||||| || ||||| || |||||||||||||| |||||
Sbjct: 434 gggaaccaaccagctttgcctttgcattcaccttcggccca 474
to top
>emb|AL161585.2|ATCHRIV81 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 81
          Length = 195921

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                       
Query: 286    gggaaccatcctgcttttcccttgcattcaccttccgccca 326
              |||||||| || ||||| || |||||||||||||| |||||
Sbjct: 191355 gggaaccaaccagctttgcctttgcattcaccttcggccca 191395
to top
>emb|AL023094.2|ATT4L20 Arabidopsis thaliana DNA chromosome 4, BAC clone T4L20 (ESSA project)
          Length = 125502

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                      
Query: 286   gggaaccatcctgcttttcccttgcattcaccttccgccca 326
             |||||||| || ||||| || |||||||||||||| |||||
Sbjct: 81666 gggaaccaaccagctttgcctttgcattcaccttcggccca 81706
to top
>gb|AF367774.1|AF367774 Arabidopsis thaliana SH3 domain-containing protein 2 mRNA, complete
            cds
          Length = 1594

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 286  gggaaccatcctgcttttcccttgcattcaccttccgccca 326
            |||||||| || ||||| || |||||||||||||| |||||
Sbjct: 1209 gggaaccaaccagctttgcctttgcattcaccttcggccca 1169
to top
>emb|BX004816.11| Zebrafish DNA sequence from clone DKEY-30G5 in linkage group 3, complete
              sequence
          Length = 231341

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 74     gttctgaaatgtcagatgtacatca 98
              |||||||||||||| ||||||||||
Sbjct: 183490 gttctgaaatgtcacatgtacatca 183466
to top
>emb|BX827471.1|CNS0A3PF Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS59ZH07 of Adult vegetative tissue of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1526

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 286  gggaaccatcctgcttttcccttgcattcaccttccgccca 326
            |||||||| || ||||| || |||||||||||||| |||||
Sbjct: 1200 gggaaccaaccagctttgcctttgcattcaccttcggccca 1160
to top
>gb|AY087158.1| Arabidopsis thaliana clone 32357 mRNA, complete sequence
          Length = 1595

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 286  gggaaccatcctgcttttcccttgcattcaccttccgccca 326
            |||||||| || ||||| || |||||||||||||| |||||
Sbjct: 1187 gggaaccaaccagctttgcctttgcattcaccttcggccca 1147
to top
>gb|AY104610.1| Zea mays PCO082433 mRNA sequence
          Length = 1163

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 309 gcattcaccttccgcccagccgttg 333
           |||||| ||||||||||||||||||
Sbjct: 636 gcattctccttccgcccagccgttg 612
to top
>gb|AC112493.2| Homo sapiens X BAC RP11-2M5 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 164480

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 321   cgcccagccgttgcttgatatcttt 345
             |||||||||||||||| ||||||||
Sbjct: 75439 cgcccagccgttgcttcatatcttt 75463
to top
>gb|AC156985.12| Mus musculus chromosome 7, clone RP23-417L14, complete sequence
          Length = 179492

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 171   actgttcaactattaaaatc 190
             ||||||||||||||||||||
Sbjct: 58711 actgttcaactattaaaatc 58692
to top
>gb|AC144640.3| Carollia perspicillata clone 14D2, complete sequence
          Length = 116172

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 68    tttggtgttctgaaatgtca 87
             ||||||||||||||||||||
Sbjct: 55629 tttggtgttctgaaatgtca 55648
to top
>emb|BX957362.26| Zebrafish DNA sequence from clone CH211-122F10 in linkage group 7,
             complete sequence
          Length = 191638

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 31    tttcaaacaacaacacagag 50
             ||||||||||||||||||||
Sbjct: 70222 tttcaaacaacaacacagag 70203
to top
>emb|CR378664.1| Photobacterium profundum SS9; segment 2/12
          Length = 347994

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 31     tttcaaacaacaacacagag 50
              ||||||||||||||||||||
Sbjct: 170042 tttcaaacaacaacacagag 170061
to top
>emb|BX511270.9| Zebrafish DNA sequence from clone DKEY-35N12 in linkage group 14,
              complete sequence
          Length = 246102

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 31     tttcaaacaacaacacagag 50
              ||||||||||||||||||||
Sbjct: 182137 tttcaaacaacaacacagag 182118
to top
>gb|AC011773.9| Homo sapiens chromosome 8, clone RP11-219B4, complete sequence
          Length = 160283

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 197    ctataacctatgttcctcctcaaa 220
              |||||| |||||||||||||||||
Sbjct: 146423 ctataaactatgttcctcctcaaa 146400
to top
>gb|AC025800.10| Homo sapiens chromosome 8, clone RP11-600N23, complete sequence
          Length = 185359

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 197    ctataacctatgttcctcctcaaa 220
              |||||| |||||||||||||||||
Sbjct: 159127 ctataaactatgttcctcctcaaa 159150
to top
>emb|AL512583.11| Mouse DNA sequence from clone RP23-444H3 on chromosome 2, complete
             sequence
          Length = 181847

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 291   ccatcctgcttttcccttgc 310
             ||||||||||||||||||||
Sbjct: 58586 ccatcctgcttttcccttgc 58605
to top
>gb|AC154003.4| Mus musculus 6 BAC RP24-92L16 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 200703

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 73    tgttctgaaatgtcagatgtacat 96
             |||||||| |||||||||||||||
Sbjct: 29646 tgttctgatatgtcagatgtacat 29623
to top
>gb|AC096570.1| Homo sapiens BAC clone RP11-368O18 from 2, complete sequence
          Length = 207972

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 205    tatgttcctcctcaaaacccctag 228
              ||||||||||| ||||||||||||
Sbjct: 110261 tatgttcctccacaaaacccctag 110238
to top
>gb|AC155842.4| Mus musculus 6 BAC RP24-122N23 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 177409

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 73     tgttctgaaatgtcagatgtacat 96
              |||||||| |||||||||||||||
Sbjct: 173906 tgttctgatatgtcagatgtacat 173883
to top
>dbj|AP000446.5| Homo sapiens genomic DNA, chromosome 11q, clone:CMB9-8L6, complete
             sequence
          Length = 110580

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 64    ccagtttggtgttctgaaat 83
             ||||||||||||||||||||
Sbjct: 79014 ccagtttggtgttctgaaat 78995
to top
>gb|AC162521.4| Mus musculus chromosome 7, clone RP23-356O13, complete sequence
          Length = 207307

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 171   actgttcaactattaaaatc 190
             ||||||||||||||||||||
Sbjct: 14788 actgttcaactattaaaatc 14807
to top
>emb|Z66519.2|CEB0334 Caenorhabditis elegans Cosmid B0334, complete sequence
          Length = 41812

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 188  atcaaacacctataacctat 207
            ||||||||||||||||||||
Sbjct: 3378 atcaaacacctataacctat 3359
to top
>gb|AC120846.16| Mus musculus chromosome 7, clone RP24-317L6, complete sequence
          Length = 192429

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 171    actgttcaactattaaaatc 190
              ||||||||||||||||||||
Sbjct: 112132 actgttcaactattaaaatc 112113
to top
>gb|AC005380.1|AC005380 Homo sapiens chromosome 19, cosmid F6156, complete sequence
          Length = 38757

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 126  aaaattcaatctatacacat 145
            ||||||||||||||||||||
Sbjct: 8304 aaaattcaatctatacacat 8323
to top
>gb|DP000018.1| Carollia perspicillata target 1 genomic scaffold
          Length = 1501503

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 68     tttggtgttctgaaatgtca 87
              ||||||||||||||||||||
Sbjct: 872045 tttggtgttctgaaatgtca 872064


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,535,896
Number of Sequences: 3902068
Number of extensions: 3535896
Number of successful extensions: 62371
Number of sequences better than 10.0: 39
Number of HSP's better than 10.0 without gapping: 39
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 62286
Number of HSP's gapped (non-prelim): 85
length of query: 434
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 412
effective length of database: 17,147,199,772
effective search space: 7064646306064
effective search space used: 7064646306064
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top