ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbasd3m15 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_472753.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1032 Score = 149 bits (75), Expect = 1e-32 Identities = 146/169 (86%), Gaps = 3/169 (1%) Strand = Plus / Minus Query: 242 ttagtagccccacggcgcgggctcgtggtcgaacgacttttggcccaaggaagaagagat 301 |||||||||||| |||||| |||||||||||| |||||||| |||| || ||||| Sbjct: 1032 ttagtagccccatagcgcggcctcgtggtcgaat---ttttggccggaggatgacgagat 976 Query: 302 ctcggggttcacgtcggaggtgagcccggtgtcctgcgacgcgctcagcttctcccgctc 361 ||| |||||||||||||||||||| |||||||||||||||||||| ||| |||||||||| Sbjct: 975 ctccgggttcacgtcggaggtgaggccggtgtcctgcgacgcgctaagcctctcccgctc 916 Query: 362 gcccctgcacgcggccggctgctgctggttgccgcacggcgccatgtcg 410 ||| | |||||| ||||||||| ||||| ||||| ||| ||||||||| Sbjct: 915 gccgccgcacgccgccggctgcagctggctgccggacgctgccatgtcg 867 Score = 63.9 bits (32), Expect = 6e-07 Identities = 57/64 (89%), Gaps = 6/64 (9%) Strand = Plus / Minus Query: 552 gccgtcgggttgaagaactggcccgcctccagcgcgttgttggagaagcaggtcacgtgc 611 ||||||||||| |||||||||||| |||||||||||| |||||||||||||||||| Sbjct: 740 gccgtcgggttaaagaactggccc---tccagcgcgttg---gagaagcaggtcacgtgc 687 Query: 612 gccg 615 |||| Sbjct: 686 gccg 683 Score = 56.0 bits (28), Expect = 1e-04 Identities = 28/28 (100%) Strand = Plus / Minus Query: 461 caggctcacgccgtggtgcagctgcccg 488 |||||||||||||||||||||||||||| Sbjct: 825 caggctcacgccgtggtgcagctgcccg 798
>emb|AL606460.3|OSJN00003 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0072F16, complete sequence Length = 176383 Score = 149 bits (75), Expect = 1e-32 Identities = 146/169 (86%), Gaps = 3/169 (1%) Strand = Plus / Minus Query: 242 ttagtagccccacggcgcgggctcgtggtcgaacgacttttggcccaaggaagaagagat 301 |||||||||||| |||||| |||||||||||| |||||||| |||| || ||||| Sbjct: 65452 ttagtagccccatagcgcggcctcgtggtcgaat---ttttggccggaggatgacgagat 65396 Query: 302 ctcggggttcacgtcggaggtgagcccggtgtcctgcgacgcgctcagcttctcccgctc 361 ||| |||||||||||||||||||| |||||||||||||||||||| ||| |||||||||| Sbjct: 65395 ctccgggttcacgtcggaggtgaggccggtgtcctgcgacgcgctaagcctctcccgctc 65336 Query: 362 gcccctgcacgcggccggctgctgctggttgccgcacggcgccatgtcg 410 ||| | |||||| ||||||||| ||||| ||||| ||| ||||||||| Sbjct: 65335 gccgccgcacgccgccggctgcagctggctgccggacgctgccatgtcg 65287 Score = 63.9 bits (32), Expect = 6e-07 Identities = 57/64 (89%), Gaps = 6/64 (9%) Strand = Plus / Minus Query: 552 gccgtcgggttgaagaactggcccgcctccagcgcgttgttggagaagcaggtcacgtgc 611 ||||||||||| |||||||||||| |||||||||||| |||||||||||||||||| Sbjct: 65160 gccgtcgggttaaagaactggccc---tccagcgcgttg---gagaagcaggtcacgtgc 65107 Query: 612 gccg 615 |||| Sbjct: 65106 gccg 65103 Score = 56.0 bits (28), Expect = 1e-04 Identities = 28/28 (100%) Strand = Plus / Minus Query: 461 caggctcacgccgtggtgcagctgcccg 488 |||||||||||||||||||||||||||| Sbjct: 65245 caggctcacgccgtggtgcagctgcccg 65218
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 149 bits (75), Expect = 1e-32 Identities = 146/169 (86%), Gaps = 3/169 (1%) Strand = Plus / Minus Query: 242 ttagtagccccacggcgcgggctcgtggtcgaacgacttttggcccaaggaagaagagat 301 |||||||||||| |||||| |||||||||||| |||||||| |||| || ||||| Sbjct: 22970996 ttagtagccccatagcgcggcctcgtggtcgaat---ttttggccggaggatgacgagat 22970940 Query: 302 ctcggggttcacgtcggaggtgagcccggtgtcctgcgacgcgctcagcttctcccgctc 361 ||| |||||||||||||||||||| |||||||||||||||||||| ||| |||||||||| Sbjct: 22970939 ctccgggttcacgtcggaggtgaggccggtgtcctgcgacgcgctaagcctctcccgctc 22970880 Query: 362 gcccctgcacgcggccggctgctgctggttgccgcacggcgccatgtcg 410 ||| | |||||| ||||||||| ||||| ||||| ||| ||||||||| Sbjct: 22970879 gccgccgcacgccgccggctgcagctggctgccggacgctgccatgtcg 22970831 Score = 63.9 bits (32), Expect = 6e-07 Identities = 57/64 (89%), Gaps = 6/64 (9%) Strand = Plus / Minus Query: 552 gccgtcgggttgaagaactggcccgcctccagcgcgttgttggagaagcaggtcacgtgc 611 ||||||||||| |||||||||||| |||||||||||| |||||||||||||||||| Sbjct: 22970704 gccgtcgggttaaagaactggccc---tccagcgcgttg---gagaagcaggtcacgtgc 22970651 Query: 612 gccg 615 |||| Sbjct: 22970650 gccg 22970647 Score = 56.0 bits (28), Expect = 1e-04 Identities = 28/28 (100%) Strand = Plus / Minus Query: 461 caggctcacgccgtggtgcagctgcccg 488 |||||||||||||||||||||||||||| Sbjct: 22970789 caggctcacgccgtggtgcagctgcccg 22970762
>dbj|AK104626.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-310-B03, full insert sequence Length = 1401 Score = 149 bits (75), Expect = 1e-32 Identities = 146/169 (86%), Gaps = 3/169 (1%) Strand = Plus / Minus Query: 242 ttagtagccccacggcgcgggctcgtggtcgaacgacttttggcccaaggaagaagagat 301 |||||||||||| |||||| |||||||||||| |||||||| |||| || ||||| Sbjct: 1136 ttagtagccccatagcgcggcctcgtggtcgaat---ttttggccggaggatgacgagat 1080 Query: 302 ctcggggttcacgtcggaggtgagcccggtgtcctgcgacgcgctcagcttctcccgctc 361 ||| |||||||||||||||||||| |||||||||||||||||||| ||| |||||||||| Sbjct: 1079 ctccgggttcacgtcggaggtgaggccggtgtcctgcgacgcgctaagcctctcccgctc 1020 Query: 362 gcccctgcacgcggccggctgctgctggttgccgcacggcgccatgtcg 410 ||| | |||||| ||||||||| ||||| ||||| ||| ||||||||| Sbjct: 1019 gccgccgcacgccgccggctgcagctggctgccggacgctgccatgtcg 971 Score = 63.9 bits (32), Expect = 6e-07 Identities = 57/64 (89%), Gaps = 6/64 (9%) Strand = Plus / Minus Query: 552 gccgtcgggttgaagaactggcccgcctccagcgcgttgttggagaagcaggtcacgtgc 611 ||||||||||| |||||||||||| |||||||||||| |||||||||||||||||| Sbjct: 844 gccgtcgggttaaagaactggccc---tccagcgcgttg---gagaagcaggtcacgtgc 791 Query: 612 gccg 615 |||| Sbjct: 790 gccg 787 Score = 56.0 bits (28), Expect = 1e-04 Identities = 28/28 (100%) Strand = Plus / Minus Query: 461 caggctcacgccgtggtgcagctgcccg 488 |||||||||||||||||||||||||||| Sbjct: 929 caggctcacgccgtggtgcagctgcccg 902
>dbj|AK071020.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023080H09, full insert sequence Length = 1548 Score = 149 bits (75), Expect = 1e-32 Identities = 146/169 (86%), Gaps = 3/169 (1%) Strand = Plus / Minus Query: 242 ttagtagccccacggcgcgggctcgtggtcgaacgacttttggcccaaggaagaagagat 301 |||||||||||| |||||| |||||||||||| |||||||| |||| || ||||| Sbjct: 1260 ttagtagccccatagcgcggcctcgtggtcgaat---ttttggccggaggatgacgagat 1204 Query: 302 ctcggggttcacgtcggaggtgagcccggtgtcctgcgacgcgctcagcttctcccgctc 361 ||| |||||||||||||||||||| |||||||||||||||||||| ||| |||||||||| Sbjct: 1203 ctccgggttcacgtcggaggtgaggccggtgtcctgcgacgcgctaagcctctcccgctc 1144 Query: 362 gcccctgcacgcggccggctgctgctggttgccgcacggcgccatgtcg 410 ||| | |||||| ||||||||| ||||| ||||| ||| ||||||||| Sbjct: 1143 gccgccgcacgccgccggctgcagctggctgccggacgctgccatgtcg 1095 Score = 63.9 bits (32), Expect = 6e-07 Identities = 57/64 (89%), Gaps = 6/64 (9%) Strand = Plus / Minus Query: 552 gccgtcgggttgaagaactggcccgcctccagcgcgttgttggagaagcaggtcacgtgc 611 ||||||||||| |||||||||||| |||||||||||| |||||||||||||||||| Sbjct: 968 gccgtcgggttaaagaactggccc---tccagcgcgttg---gagaagcaggtcacgtgc 915 Query: 612 gccg 615 |||| Sbjct: 914 gccg 911 Score = 56.0 bits (28), Expect = 1e-04 Identities = 28/28 (100%) Strand = Plus / Minus Query: 461 caggctcacgccgtggtgcagctgcccg 488 |||||||||||||||||||||||||||| Sbjct: 1053 caggctcacgccgtggtgcagctgcccg 1026
>dbj|AK061745.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-F10, full insert sequence Length = 1401 Score = 149 bits (75), Expect = 1e-32 Identities = 146/169 (86%), Gaps = 3/169 (1%) Strand = Plus / Minus Query: 242 ttagtagccccacggcgcgggctcgtggtcgaacgacttttggcccaaggaagaagagat 301 |||||||||||| |||||| |||||||||||| |||||||| |||| || ||||| Sbjct: 1136 ttagtagccccatagcgcggcctcgtggtcgaat---ttttggccggaggatgacgagat 1080 Query: 302 ctcggggttcacgtcggaggtgagcccggtgtcctgcgacgcgctcagcttctcccgctc 361 ||| |||||||||||||||||||| |||||||||||||||||||| ||| |||||||||| Sbjct: 1079 ctccgggttcacgtcggaggtgaggccggtgtcctgcgacgcgctaagcctctcccgctc 1020 Query: 362 gcccctgcacgcggccggctgctgctggttgccgcacggcgccatgtcg 410 ||| | |||||| ||||||||| ||||| ||||| ||| ||||||||| Sbjct: 1019 gccgccgcacgccgccggctgcagctggctgccggacgctgccatgtcg 971 Score = 63.9 bits (32), Expect = 6e-07 Identities = 57/64 (89%), Gaps = 6/64 (9%) Strand = Plus / Minus Query: 552 gccgtcgggttgaagaactggcccgcctccagcgcgttgttggagaagcaggtcacgtgc 611 ||||||||||| |||||||||||| |||||||||||| |||||||||||||||||| Sbjct: 844 gccgtcgggttaaagaactggccc---tccagcgcgttg---gagaagcaggtcacgtgc 791 Query: 612 gccg 615 |||| Sbjct: 790 gccg 787 Score = 56.0 bits (28), Expect = 1e-04 Identities = 28/28 (100%) Strand = Plus / Minus Query: 461 caggctcacgccgtggtgcagctgcccg 488 |||||||||||||||||||||||||||| Sbjct: 929 caggctcacgccgtggtgcagctgcccg 902
>dbj|AB028181.1| Oryza sativa mRNA for OsNAC2 protein, complete cds Length = 1377 Score = 149 bits (75), Expect = 1e-32 Identities = 146/169 (86%), Gaps = 3/169 (1%) Strand = Plus / Minus Query: 242 ttagtagccccacggcgcgggctcgtggtcgaacgacttttggcccaaggaagaagagat 301 |||||||||||| |||||| |||||||||||| |||||||| |||| || ||||| Sbjct: 1131 ttagtagccccatagcgcggcctcgtggtcgaat---ttttggccggaggatgacgagat 1075 Query: 302 ctcggggttcacgtcggaggtgagcccggtgtcctgcgacgcgctcagcttctcccgctc 361 ||| |||||||||||||||||||| |||||||||||||||||||| ||| |||||||||| Sbjct: 1074 ctccgggttcacgtcggaggtgaggccggtgtcctgcgacgcgctaagcctctcccgctc 1015 Query: 362 gcccctgcacgcggccggctgctgctggttgccgcacggcgccatgtcg 410 ||| | |||||| ||||||||| ||||| ||||| ||| ||||||||| Sbjct: 1014 gccgccgcacgccgccggctgcagctggctgccggacgctgccatgtcg 966 Score = 63.9 bits (32), Expect = 6e-07 Identities = 57/64 (89%), Gaps = 6/64 (9%) Strand = Plus / Minus Query: 552 gccgtcgggttgaagaactggcccgcctccagcgcgttgttggagaagcaggtcacgtgc 611 ||||||||||| |||||||||||| |||||||||||| |||||||||||||||||| Sbjct: 839 gccgtcgggttaaagaactggccc---tccagcgcgttg---gagaagcaggtcacgtgc 786 Query: 612 gccg 615 |||| Sbjct: 785 gccg 782 Score = 56.0 bits (28), Expect = 1e-04 Identities = 28/28 (100%) Strand = Plus / Minus Query: 461 caggctcacgccgtggtgcagctgcccg 488 |||||||||||||||||||||||||||| Sbjct: 924 caggctcacgccgtggtgcagctgcccg 897
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 48.1 bits (24), Expect = 0.035 Identities = 24/24 (100%) Strand = Plus / Minus Query: 590 gttggagaagcaggtcacgtgcgc 613 |||||||||||||||||||||||| Sbjct: 22279506 gttggagaagcaggtcacgtgcgc 22279483
>dbj|AP006161.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:B1267B06 Length = 156989 Score = 48.1 bits (24), Expect = 0.035 Identities = 24/24 (100%) Strand = Plus / Minus Query: 590 gttggagaagcaggtcacgtgcgc 613 |||||||||||||||||||||||| Sbjct: 38150 gttggagaagcaggtcacgtgcgc 38127
>dbj|AK108080.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-138-E10, full insert sequence Length = 1308 Score = 48.1 bits (24), Expect = 0.035 Identities = 24/24 (100%) Strand = Plus / Minus Query: 590 gttggagaagcaggtcacgtgcgc 613 |||||||||||||||||||||||| Sbjct: 763 gttggagaagcaggtcacgtgcgc 740
>dbj|AB028180.1| Oryza sativa mRNA for OsNAC1 protein, complete cds Length = 1294 Score = 48.1 bits (24), Expect = 0.035 Identities = 24/24 (100%) Strand = Plus / Minus Query: 590 gttggagaagcaggtcacgtgcgc 613 |||||||||||||||||||||||| Sbjct: 856 gttggagaagcaggtcacgtgcgc 833
>emb|AL354829.8| Human DNA sequence from clone RP11-218B22 on chromosome 13 Contains the 3' end of the DIAPH3 gene for diaphanous homolog 3 (Drosophila), complete sequence Length = 154212 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Plus Query: 183 atccatcgatccatccatccttc 205 ||||||||||||||||||||||| Sbjct: 43308 atccatcgatccatccatccttc 43330
>emb|AL662846.18| Mouse DNA sequence from clone RP23-399N2 on chromosome 11 Contains a zinc finger protein of the cerebellum 5 (Zic5) pseudogene, complete sequence Length = 189287 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatccttc 205 ||||||||||||||||||||||| Sbjct: 101669 atccatcgatccatccatccttc 101647
>emb|BX663525.6| Zebrafish DNA sequence from clone DKEY-97A13 in linkage group 2, complete sequence Length = 261927 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Plus Query: 181 taatccatcgatccatccatcct 203 ||||||||||||||||||||||| Sbjct: 258152 taatccatcgatccatccatcct 258174
>gb|AC116559.30| Papio anubis clone rp41-339c10, complete sequence Length = 162030 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatccttc 205 ||||||||||||||||||||||| Sbjct: 152858 atccatcgatccatccatccttc 152836
>gb|AC006450.13|AC006450 Homo sapiens chromosome 9, clone RP11-85O21, complete sequence Length = 177555 Score = 44.1 bits (22), Expect = 0.55 Identities = 22/22 (100%) Strand = Plus / Minus Query: 184 tccatcgatccatccatccttc 205 |||||||||||||||||||||| Sbjct: 140973 tccatcgatccatccatccttc 140952
>emb|BX890602.8| Zebrafish DNA sequence from clone DKEYP-109H9 in linkage group 18, complete sequence Length = 191296 Score = 44.1 bits (22), Expect = 0.55 Identities = 25/26 (96%) Strand = Plus / Minus Query: 180 ataatccatcgatccatccatccttc 205 |||||||||| ||||||||||||||| Sbjct: 3950 ataatccatccatccatccatccttc 3925
>emb|BX323886.7| Zebrafish DNA sequence from clone CH211-127B11 in linkage group 4, complete sequence Length = 158224 Score = 44.1 bits (22), Expect = 0.55 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcctt 204 |||||||||||||||||||||| Sbjct: 45051 atccatcgatccatccatcctt 45030 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 105362 atccatcgatccatccatcc 105381
>emb|CR788314.7| Zebrafish DNA sequence from clone DKEY-205J18 in linkage group 8, complete sequence Length = 164950 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcct 203 ||||||||||||||||||||| Sbjct: 104123 atccatcgatccatccatcct 104103 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcct 203 ||||||||||||||||||||| Sbjct: 103645 atccatcgatccatccatcct 103625 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcct 203 ||||||||||||||||||||| Sbjct: 103191 atccatcgatccatccatcct 103171
>emb|BX569792.15| Zebrafish DNA sequence from clone CH211-197I17 in linkage group 16, complete sequence Length = 234579 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 178 taataatccatcgatccatccatcc 202 |||||||||||| |||||||||||| Sbjct: 127701 taataatccatccatccatccatcc 127725
>gb|AC020913.9| Homo sapiens chromosome 19 clone CTD-3032J10, complete sequence Length = 117751 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 182 aatccatcgatccatccatcc 202 ||||||||||||||||||||| Sbjct: 43213 aatccatcgatccatccatcc 43193
>gb|AC009123.7| Homo sapiens chromosome 16 clone RP11-486L19, complete sequence Length = 197046 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 177 ctaataatccatcgatccatccatc 201 ||||| ||||||||||||||||||| Sbjct: 184640 ctaatcatccatcgatccatccatc 184664
>gb|AC011471.6|AC011471 Homo sapiens chromosome 19 clone CTC-503J8, complete sequence Length = 154702 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccatcgatccatccatccttc 205 ||||||||||||||||||||| Sbjct: 73771 ccatcgatccatccatccttc 73791
>gb|AC091301.3| Danio rerio clone 1K20, complete sequence Length = 48082 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 183 atccatcgatccatccatcct 203 ||||||||||||||||||||| Sbjct: 37386 atccatcgatccatccatcct 37406 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 36446 atccatcgatccatccatcc 36465
>gb|AY105702.1| Zea mays PCO125609 mRNA sequence Length = 1889 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 179 aataatccatcgatccatcca 199 ||||||||||||||||||||| Sbjct: 166 aataatccatcgatccatcca 186
>emb|BX927333.11| Zebrafish DNA sequence from clone CH211-69C15 in linkage group 10, complete sequence Length = 146168 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 180 ataatccatcgatccatccatcctt 204 |||||||||| |||||||||||||| Sbjct: 110649 ataatccatccatccatccatcctt 110673
>emb|BX005145.8| Zebrafish DNA sequence from clone CH211-120O1, complete sequence Length = 181056 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 183 atccatcgatccatccatccttcgc 207 |||||||||||||||||||| |||| Sbjct: 55699 atccatcgatccatccatccatcgc 55675 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 55719 atccatcgatccatccatcc 55700 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 55656 atccatcgatccatccatcc 55637 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 55632 atccatcgatccatccatcc 55613
>emb|AL929194.8| Mouse DNA sequence from clone RP23-385L14 on chromosome 2, complete sequence Length = 120827 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcct 203 ||||||||||||||||||||| Sbjct: 104421 atccatcgatccatccatcct 104401
>emb|AL591490.12| Mouse DNA sequence from clone RP23-144O20 on chromosome 2, complete sequence Length = 192082 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 181 taatccatcgatccatccatc 201 ||||||||||||||||||||| Sbjct: 190493 taatccatcgatccatccatc 190473
>emb|AL731698.10| Mouse DNA sequence from clone RP23-161B3 on chromosome 2, complete sequence Length = 61072 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 181 taatccatcgatccatccatc 201 ||||||||||||||||||||| Sbjct: 411 taatccatcgatccatccatc 391
>gb|AC122357.4| Mus musculus BAC clone RP23-403O8 from chromosome 13, complete sequence Length = 203039 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 83114 atccatcgatccatccatcc 83095 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 83098 atccatcgatccatccatcc 83079
>gb|AC123720.32| Mus musculus chromosome 10, clone RP23-413G8, complete sequence Length = 192037 Score = 40.1 bits (20), Expect = 8.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 179 aataatccatcgatccatccatcc 202 ||||||||||| |||||||||||| Sbjct: 64802 aataatccatccatccatccatcc 64825
>gb|AC132396.6| Mus musculus BAC clone RP23-394F17 from chromosome 6, complete sequence Length = 190146 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 164043 atccatcgatccatccatcc 164062
>gb|AC103672.7| Mus musculus chromosome 15, clone RP24-351G3, complete sequence Length = 192753 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 284 gcccaaggaagaagagatct 303 |||||||||||||||||||| Sbjct: 146494 gcccaaggaagaagagatct 146475
>gb|DQ198488.1| Elephas maximus clone LaT26 microsatellite sequence Length = 286 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 214 atccatcgatccatccatcc 195
>gb|AC101852.7| Mus musculus chromosome 1, clone RP23-279P3, complete sequence Length = 185975 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 7204 atccatcgatccatccatcc 7185
>gb|AC091453.2| Mus musculus chromosome X clones RP21-19N11, RP21-667A15, RP21-395M8 complete sequence Length = 350000 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 342834 atccatcgatccatccatcc 342853
>ref|XM_359745.1| Magnaporthe grisea 70-15 hypothetical protein (MG05032.4) partial mRNA Length = 3501 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 403 ccatgtcgtcggcgagacca 422 |||||||||||||||||||| Sbjct: 2581 ccatgtcgtcggcgagacca 2562
>ref|XM_365840.1| Magnaporthe grisea 70-15 hypothetical protein (MG10060.4) partial mRNA Length = 1083 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 440 ctcgaggagctgcaccaggc 459 |||||||||||||||||||| Sbjct: 103 ctcgaggagctgcaccaggc 122
>ref|XM_604036.2| PREDICTED: Bos taurus similar to transient receptor potential cation channel, subfamily M, member 4 (LOC525683), mRNA Length = 2835 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 298 agatctcggggttcacgtcg 317 |||||||||||||||||||| Sbjct: 1205 agatctcggggttcacgtcg 1186
>gb|AC124027.2| Mus musculus chromosome X clone RP21-282L18 map qA7.2, complete sequence Length = 147432 Score = 40.1 bits (20), Expect = 8.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 182 aatccatcgatccatccatccttc 205 |||||||| ||||||||||||||| Sbjct: 108812 aatccatccatccatccatccttc 108789
>gb|AC124026.2| Mus musculus chromosome X clone RP21-564N13 map qA7.2, complete sequence Length = 178239 Score = 40.1 bits (20), Expect = 8.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 182 aatccatcgatccatccatccttc 205 |||||||| ||||||||||||||| Sbjct: 82184 aatccatccatccatccatccttc 82161
>gb|AC124020.2| Mus musculus chromosome X clone RP21-564N13 map qA7.2, complete sequence Length = 155466 Score = 40.1 bits (20), Expect = 8.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 182 aatccatcgatccatccatccttc 205 |||||||| ||||||||||||||| Sbjct: 74240 aatccatccatccatccatccttc 74217
>gb|AC126453.5| Mus musculus BAC clone RP23-244A6 from chromosome 6, complete sequence Length = 172616 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 60671 atccatcgatccatccatcc 60690
>gb|AC115000.7| Mus musculus chromosome 1, clone RP24-103F2, complete sequence Length = 191603 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 125445 atccatcgatccatccatcc 125426
>gb|AC162527.5| Mus musculus BAC clone RP23-30M17 from chromosome 14, complete sequence Length = 200348 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 62672 atccatcgatccatccatcc 62653
>gb|AC005528.43| Mus musculus strain 129S6/SvEvTac clone rp21-493n6 map 11a2, complete sequence Length = 199326 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 444 aggagctgcaccaggctcag 463 |||||||||||||||||||| Sbjct: 32434 aggagctgcaccaggctcag 32415
>emb|CR376775.7| Zebrafish DNA sequence from clone CH211-197C5 in linkage group 23, complete sequence Length = 196846 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 178414 atccatcgatccatccatcc 178395
>emb|CR848707.6| Zebrafish DNA sequence from clone CH211-276P5 in linkage group 11, complete sequence Length = 158349 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 182 aatccatcgatccatccatc 201 |||||||||||||||||||| Sbjct: 107461 aatccatcgatccatccatc 107442 Score = 40.1 bits (20), Expect = 8.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 182 aatccatcgatccatccatccttc 205 |||||||| ||||||||||||||| Sbjct: 107190 aatccatccatccatccatccttc 107167
>emb|BX000523.24| Zebrafish DNA sequence from clone CH211-161N23 in linkage group 7, complete sequence Length = 157480 Score = 40.1 bits (20), Expect = 8.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 182 aatccatcgatccatccatccttc 205 |||||||| ||||||||||||||| Sbjct: 48912 aatccatccatccatccatccttc 48935
>emb|CR394563.17| Zebrafish DNA sequence from clone CH211-147P18, complete sequence Length = 165013 Score = 40.1 bits (20), Expect = 8.6 Identities = 26/28 (92%) Strand = Plus / Plus Query: 178 taataatccatcgatccatccatccttc 205 |||| |||||||||||||||||| |||| Sbjct: 80709 taattatccatcgatccatccatacttc 80736
>gb|AC127250.3| Mus musculus BAC clone RP24-482H23 from chromosome 3, complete sequence Length = 136942 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 98320 atccatcgatccatccatcc 98301
>gb|AC124426.4| Mus musculus BAC clone RP24-231B8 from chromosome 13, complete sequence Length = 199585 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 190785 atccatcgatccatccatcc 190766 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 190769 atccatcgatccatccatcc 190750
>gb|AC124684.3| Mus musculus BAC clone RP24-375D13 from chromosome 1, complete sequence Length = 167927 Score = 40.1 bits (20), Expect = 8.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 182 aatccatcgatccatccatccttc 205 |||||||| ||||||||||||||| Sbjct: 26782 aatccatccatccatccatccttc 26805
>gb|AC126555.3| Mus musculus BAC clone RP23-474A17 from chromosome 13, complete sequence Length = 187704 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 11165 atccatcgatccatccatcc 11146
>gb|AC121853.3| Mus musculus BAC clone RP24-96P15 from chromosome 17, complete sequence Length = 144510 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 50687 atccatcgatccatccatcc 50706
>gb|AC124183.4| Mus musculus BAC clone RP23-213I18 from 13, complete sequence Length = 215251 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 49654 atccatcgatccatccatcc 49673
>gb|AC099413.3| Mus musculus BAC clone RP23-2O10 from 4, complete sequence Length = 208798 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 36316 atccatcgatccatccatcc 36297
>gb|AC121869.2| Mus musculus BAC clone RP24-121C10 from 17, complete sequence Length = 182237 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 167114 atccatcgatccatccatcc 167095
>gb|AC116458.9| Mus musculus chromosome 16, clone RP23-11L14, complete sequence Length = 219241 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 161805 atccatcgatccatccatcc 161786
>gb|AC144541.12| Medicago truncatula clone mth2-28a1, complete sequence Length = 123800 Score = 40.1 bits (20), Expect = 8.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 588 ttgttggagaagcaggtcacgtgc 611 |||||||||||||||| ||||||| Sbjct: 12790 ttgttggagaagcagggcacgtgc 12813
>emb|BX928756.13| Zebrafish DNA sequence from clone CH211-113K9 in linkage group 21, complete sequence Length = 157210 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 72176 atccatcgatccatccatcc 72195
>emb|CR847786.13| Zebrafish DNA sequence from clone DKEYP-9B4 in linkage group 13, complete sequence Length = 156551 Score = 40.1 bits (20), Expect = 8.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 182 aatccatcgatccatccatccttc 205 |||||||| ||||||||||||||| Sbjct: 70519 aatccatccatccatccatccttc 70496
>emb|CR392025.7| Zebrafish DNA sequence from clone CH211-248P17 in linkage group 17, complete sequence Length = 158863 Score = 40.1 bits (20), Expect = 8.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 180 ataatccatcgatccatccatcct 203 |||||||||| ||||||||||||| Sbjct: 151662 ataatccatccatccatccatcct 151639
>emb|CR391930.9| Zebrafish DNA sequence from clone CH211-154B16 in linkage group 15, complete sequence Length = 175972 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 66974 atccatcgatccatccatcc 66993
>emb|Z98743.1|HS181C9 Human DNA sequence from clone RP1-181C9 on chromosome 22q13.2-13.33, complete sequence Length = 92472 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 6294 atccatcgatccatccatcc 6275
>emb|Z79999.2|HS111A3 Human DNA sequence from clone CITF22-111A3 on chromosome 22, complete sequence Length = 42776 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 26648 atccatcgatccatccatcc 26667
>emb|AL513327.34| Human DNA sequence from clone RP11-415J8 on chromosome 1 Contains the gene for a novel protein (FLJ35476), the gene for a novel protein similar to ABO family protein, two novel genes, the PHC2 gene for polyhomeotic-like 2 (Drosophila) and two CpG islands, complete sequence Length = 188665 Score = 40.1 bits (20), Expect = 8.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 182 aatccatcgatccatccatccttc 205 |||||||| ||||||||||||||| Sbjct: 111844 aatccatccatccatccatccttc 111867
>gb|AC182351.3| Ateles geoffroyi clone UC1-76C3, complete sequence Length = 212614 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 1 tatatatatactagtatatc 20 |||||||||||||||||||| Sbjct: 2191 tatatatatactagtatatc 2172
>emb|AL445933.32| Human DNA sequence from clone RP11-486B10 on chromosome 1 Contains the EDN2 gene for endothelin 2, the 3' end of the HIVEP3 gene for human immunodeficiency virus type I enhancer binding protein 3 and a novel gene, complete sequence Length = 154153 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 55198 atccatcgatccatccatcc 55217
>emb|AL354898.10| Human DNA sequence from clone RP11-618A20 on chromosome 9 Contains a novel gene (DKFZp434P0216), the ASS gene for argininosuccinate synthetase (ASS1,CTLN1) and three CpG islands, complete sequence Length = 173023 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 107045 atccatcgatccatccatcc 107064
>emb|AL160409.12| Human DNA sequence from clone RP11-406D17 on chromosome 10 Contains the 3' end of the PARD3 gene for par-3 partitioning defective 3 homolog (C.elegans), complete sequence Length = 106198 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 62554 atccatcgatccatccatcc 62535
>emb|AL109809.18|HSJ673D20 Human DNA sequence from clone RP4-673D20 on chromosome 20 Contains a PTPNS (protein tyrosine phosphatase, non-receptor type substrate) family pseudogene, the 5' end of the SIRPB2 gene for signal-regulatory protein beta 2 and a CpG island, complete sequence Length = 132396 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 14259 atccatcgatccatccatcc 14278
>emb|BX548051.11| Zebrafish DNA sequence from clone CH211-203M19 in linkage group 16, complete sequence Length = 162546 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 116219 atccatcgatccatccatcc 116238
>gb|CP000088.1| Thermobifida fusca YX, complete genome Length = 3642249 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 607 cgtgcgccgcctggtcgaag 626 |||||||||||||||||||| Sbjct: 3306692 cgtgcgccgcctggtcgaag 3306673
>gb|AC158962.4| Mus musculus chromosome 1, clone RP23-443N21, complete sequence Length = 180337 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 152589 atccatcgatccatccatcc 152608
>emb|AL645845.14| Mouse DNA sequence from clone RP23-338J18 on chromosome 11 Contains the Ewsh gene for Ewing sarcoma homolog, a novel gene, gene Emu1 and two CpG islands, complete sequence Length = 109446 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 444 aggagctgcaccaggctcag 463 |||||||||||||||||||| Sbjct: 92512 aggagctgcaccaggctcag 92531
>emb|BX897714.6| Zebrafish DNA sequence from clone DKEY-218L23 in linkage group 25, complete sequence Length = 184435 Score = 40.1 bits (20), Expect = 8.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 179 aataatccatcgatccatccatcc 202 ||||||||||| |||||||||||| Sbjct: 146431 aataatccatccatccatccatcc 146454
>emb|CR407560.11| Zebrafish DNA sequence from clone CH211-180L14, complete sequence Length = 127482 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 116652 atccatcgatccatccatcc 116671
>emb|BX510991.10| Zebrafish DNA sequence from clone RP71-44C4 in linkage group 17, complete sequence Length = 116313 Score = 40.1 bits (20), Expect = 8.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 182 aatccatcgatccatccatccttc 205 |||||||| ||||||||||||||| Sbjct: 69760 aatccatccatccatccatccttc 69737
>emb|BX510656.7| Zebrafish DNA sequence from clone CH211-132N7 in linkage group 7, complete sequence Length = 174960 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 101760 atccatcgatccatccatcc 101741 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 101468 atccatcgatccatccatcc 101449
>emb|CR354594.13| Zebrafish DNA sequence from clone DKEY-173F1 in linkage group 13, complete sequence Length = 196408 Score = 40.1 bits (20), Expect = 8.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 179 aataatccatcgatccatccatcc 202 ||||||||||| |||||||||||| Sbjct: 172024 aataatccatccatccatccatcc 172001
>emb|AL929349.10| Zebrafish DNA sequence from clone CH211-207D24 in linkage group 20 Contains eight CpG islands, complete sequence Length = 196371 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 122221 atccatcgatccatccatcc 122240
>gb|AC154873.6| Mus musculus chromosome 1, clone RP23-71J17, complete sequence Length = 256719 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 176476 atccatcgatccatccatcc 176457
>emb|BX901978.14| Zebrafish DNA sequence from clone DKEY-155M6 in linkage group 18, complete sequence Length = 168101 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 111290 atccatcgatccatccatcc 111271 Score = 40.1 bits (20), Expect = 8.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 182 aatccatcgatccatccatccttc 205 |||||||| ||||||||||||||| Sbjct: 17217 aatccatccatccatccatccttc 17194
>emb|CR376829.10| Zebrafish DNA sequence from clone CH211-218I18 in linkage group 8, complete sequence Length = 197983 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 159316 atccatcgatccatccatcc 159297
>emb|BX470184.9| Zebrafish DNA sequence from clone CH211-214H13 in linkage group 23, complete sequence Length = 205568 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 190121 atccatcgatccatccatcc 190102
>emb|BX548162.12| Zebrafish DNA sequence from clone DKEYP-90D11 in linkage group 11, complete sequence Length = 180422 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 102322 atccatcgatccatccatcc 102341
>emb|CR387987.6| Zebrafish DNA sequence from clone CH211-35M4 in linkage group 3, complete sequence Length = 60218 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 6268 atccatcgatccatccatcc 6287
>emb|BX571727.8| Zebrafish DNA sequence from clone DKEY-14I22 in linkage group 5, complete sequence Length = 102670 Score = 40.1 bits (20), Expect = 8.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 182 aatccatcgatccatccatccttc 205 |||||||| ||||||||||||||| Sbjct: 58478 aatccatcaatccatccatccttc 58501
>emb|BX571718.9| Zebrafish DNA sequence from clone DKEYP-111A10 in linkage group 14, complete sequence Length = 168697 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 88129 atccatcgatccatccatcc 88148
>emb|AL935031.12| Zebrafish DNA sequence from clone CH211-93I23, complete sequence Length = 178457 Score = 40.1 bits (20), Expect = 8.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 183 atccatcgatccatccatccttcg 206 ||||||| |||||||||||||||| Sbjct: 111542 atccatccatccatccatccttcg 111519
>emb|CR352231.8| Zebrafish DNA sequence from clone CH211-216G8 in linkage group 16, complete sequence Length = 202686 Score = 40.1 bits (20), Expect = 8.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 182 aatccatcgatccatccatccttc 205 |||||||| ||||||||||||||| Sbjct: 73926 aatccatccatccatccatccttc 73949
>emb|BX537338.9| Zebrafish DNA sequence from clone DKEY-258E8 in linkage group 16, complete sequence Length = 309004 Score = 40.1 bits (20), Expect = 8.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 182 aatccatcgatccatccatccttc 205 |||||||| ||||||||||||||| Sbjct: 84966 aatccatccatccatccatccttc 84989
>gb|AC093689.4| Homo sapiens BAC clone RP11-725M22 from 4, complete sequence Length = 167590 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 73 taatctacaactatacagat 92 |||||||||||||||||||| Sbjct: 112213 taatctacaactatacagat 112232
>gb|AC069308.21| Mus musculus Strain C57BL6/J Chromosome 8 RP23-21B7, complete sequence Length = 239821 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 174864 atccatcgatccatccatcc 174845 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 174656 atccatcgatccatccatcc 174637
>gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome Length = 4712337 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 575 cgcctccagcgcgttgttgg 594 |||||||||||||||||||| Sbjct: 4077234 cgcctccagcgcgttgttgg 4077253
>ref|NM_164972.1| Drosophila melanogaster CG31757-RA (CG31757), mRNA Length = 1898 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 379 gctgctgctggttgccgcac 398 |||||||||||||||||||| Sbjct: 323 gctgctgctggttgccgcac 304
>gb|AC110995.2| Homo sapiens X BAC RP11-733O18 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 83175 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 10396 atccatcgatccatccatcc 10415
>gb|AY084186.1| Drosophila melanogaster RE69157 full insert cDNA Length = 3876 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 379 gctgctgctggttgccgcac 398 |||||||||||||||||||| Sbjct: 323 gctgctgctggttgccgcac 304
>gb|AC009009.5| Homo sapiens chromosome 5 clone P1_1246B1, complete sequence Length = 79297 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 22871 atccatcgatccatccatcc 22890
>gb|AC009335.10| Homo sapiens chromosome 17, clone RP11-20O2, complete sequence Length = 159611 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 117326 atccatcgatccatccatcc 117345
>gb|AC022832.13| Homo sapiens chromosome 8, clone RP11-145O15, complete sequence Length = 166236 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 85177 atccatcgatccatccatcc 85158
>emb|BX571675.5| Zebrafish DNA sequence from clone DKEY-235D17 in linkage group 11, complete sequence Length = 207497 Score = 40.1 bits (20), Expect = 8.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 182 aatccatcgatccatccatccttc 205 |||||||| ||||||||||||||| Sbjct: 6687 aatccatccatccatccatccttc 6710
>emb|BX663513.13| Zebrafish DNA sequence from clone DKEY-234F12 in linkage group 15, complete sequence Length = 249413 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 29628 atccatcgatccatccatcc 29609
>emb|BX649487.7| Zebrafish DNA sequence from clone DKEY-148C4 in linkage group 9, complete sequence Length = 201933 Score = 40.1 bits (20), Expect = 8.6 Identities = 26/28 (92%) Strand = Plus / Minus Query: 177 ctaataatccatcgatccatccatcctt 204 ||||| ||||||| |||||||||||||| Sbjct: 172634 ctaatcatccatccatccatccatcctt 172607
>gb|AC161867.6| Mus musculus chromosome 8, clone RP24-281E22, complete sequence Length = 180410 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 68755 atccatcgatccatccatcc 68736 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 68452 atccatcgatccatccatcc 68433
>gb|AC093199.1| Drosophila melanogaster, chromosome 2L, region 33A-33A, BAC clone BACR05B13, complete sequence Length = 168641 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 379 gctgctgctggttgccgcac 398 |||||||||||||||||||| Sbjct: 40094 gctgctgctggttgccgcac 40075
>gb|DQ090016.1| Corylus avellana clone CaT-B511 microsatellite sequence Length = 320 Score = 40.1 bits (20), Expect = 8.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 588 ttgttggagaagcaggtcacgtgc 611 |||||||||||||||| ||||||| Sbjct: 227 ttgttggagaagcagggcacgtgc 250
>emb|BX294388.5| Zebrafish DNA sequence from clone DKEYP-35F11 in linkage group 8, complete sequence Length = 106763 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 4490 atccatcgatccatccatcc 4471
>emb|BX276087.14| Zebrafish DNA sequence from clone CH211-270M20 in linkage group 10, complete sequence Length = 167208 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 122251 atccatcgatccatccatcc 122270
>emb|BX539340.7| Zebrafish DNA sequence from clone DKEY-57K2 in linkage group 2, complete sequence Length = 234470 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 50149 atccatcgatccatccatcc 50130
>emb|BX247950.12| Zebrafish DNA sequence from clone CH211-51G21, complete sequence Length = 172752 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 29887 atccatcgatccatccatcc 29868
>gb|AC007224.5| Homo sapiens chromosome 16 clone RP11-475D10, complete sequence Length = 185327 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 43994 atccatcgatccatccatcc 43975
>gb|AC092850.13| Homo sapiens 12 BAC RP11-346B9 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 176733 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 147935 atccatcgatccatccatcc 147954
>gb|AC093771.3| Homo sapiens BAC clone RP11-121I23 from 4, complete sequence Length = 165420 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 73 taatctacaactatacagat 92 |||||||||||||||||||| Sbjct: 158820 taatctacaactatacagat 158839
>gb|AC093865.2| Homo sapiens BAC clone RP11-560C24 from 2, complete sequence Length = 186218 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 279 ttttggcccaaggaagaaga 298 |||||||||||||||||||| Sbjct: 180790 ttttggcccaaggaagaaga 180809
>gb|AC073082.6| Homo sapiens BAC clone RP11-310N16 from 2, complete sequence Length = 177047 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 120785 atccatcgatccatccatcc 120766
>gb|AC013734.4|AC013734 Homo sapiens BAC clone RP11-557B9 from Y, complete sequence Length = 180019 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 164345 atccatcgatccatccatcc 164364
>emb|BX248399.5| Zebrafish DNA sequence from clone CH211-233A1 in linkage group 10, complete sequence Length = 158884 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 59934 atccatcgatccatccatcc 59953 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 59590 atccatcgatccatccatcc 59609
>gb|AF221943.1|AF221943 Homo sapiens leukotriene B4 omega hydroxylase (CYP4F2) gene, exons 1 through 5 and partial cds; CYP4F3 gene, exon 4 Length = 6740 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 2601 atccatcgatccatccatcc 2582
>gb|AC093124.3| Papio anubis clone RP41-216E17, complete sequence Length = 190322 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 282 tggcccaaggaagaagagat 301 |||||||||||||||||||| Sbjct: 140330 tggcccaaggaagaagagat 140311
>emb|AL805956.22| Mouse DNA sequence from clone RP23-239F1 on chromosome 4, complete sequence Length = 167440 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 43698 atccatcgatccatccatcc 43717
>emb|BX248131.6| Zebrafish DNA sequence from clone CH211-236P5, complete sequence Length = 162685 Score = 40.1 bits (20), Expect = 8.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 179 aataatccatcgatccatccatcc 202 ||||||||||| |||||||||||| Sbjct: 91761 aataatccatccatccatccatcc 91784
>emb|BX510327.10| Zebrafish DNA sequence from clone CH211-253J24 in linkage group 20, complete sequence Length = 200187 Score = 40.1 bits (20), Expect = 8.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 179 aataatccatcgatccatccatcc 202 ||||||||||| |||||||||||| Sbjct: 159166 aataatccatccatccatccatcc 159189
>emb|BX088540.6| Zebrafish DNA sequence from clone CH211-225B7 in linkage group 15, complete sequence Length = 176569 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 31797 atccatcgatccatccatcc 31778
>emb|AL954130.8| Zebrafish DNA sequence from clone CH211-214D1 in linkage group 16, complete sequence Length = 235236 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 55034 atccatcgatccatccatcc 55053
>emb|AL672029.7| Mouse DNA sequence from clone RP23-416F22 on chromosome X, complete sequence Length = 189958 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 4986 atccatcgatccatccatcc 4967
>emb|BX537134.5| Zebrafish DNA sequence from clone CH211-205J6, complete sequence Length = 192029 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 100233 atccatcgatccatccatcc 100252
>emb|AL935324.8| Zebrafish DNA sequence from clone CH211-197B6 in linkage group 10, complete sequence Length = 197730 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 174160 atccatcgatccatccatcc 174141
>ref|XM_312896.2| Anopheles gambiae str. PEST ENSANGP00000003257 (ENSANGG00000002631), partial mRNA Length = 3228 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 375 gccggctgctgctggttgcc 394 |||||||||||||||||||| Sbjct: 2486 gccggctgctgctggttgcc 2467
>gb|AC154265.2| Mus musculus BAC clone RP24-319O20 from 16, complete sequence Length = 206136 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 72602 atccatcgatccatccatcc 72583
>emb|CR854984.10| Zebrafish DNA sequence from clone DKEY-62B6 in linkage group 16, complete sequence Length = 223943 Score = 40.1 bits (20), Expect = 8.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 182 aatccatcgatccatccatccttc 205 |||||||| ||||||||||||||| Sbjct: 71795 aatccatccatccatccatccttc 71772
>emb|CR855395.11| Zebrafish DNA sequence from clone CH211-106P4 in linkage group 18, complete sequence Length = 55248 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 10592 atccatcgatccatccatcc 10611
>emb|CR628405.8| Zebrafish DNA sequence from clone CH211-170A5 in linkage group 10, complete sequence Length = 75121 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 5678 atccatcgatccatccatcc 5659
>emb|CR352306.11| Zebrafish DNA sequence from clone CH211-161N3 in linkage group 4, complete sequence Length = 97766 Score = 40.1 bits (20), Expect = 8.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 182 aatccatcgatccatccatccttc 205 |||||||| ||||||||||||||| Sbjct: 77351 aatccatctatccatccatccttc 77328
>emb|BX571946.9| Zebrafish DNA sequence from clone DKEY-232H18 in linkage group 22, complete sequence Length = 179796 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 150655 atccatcgatccatccatcc 150636 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 150639 atccatcgatccatccatcc 150620 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 150408 atccatcgatccatccatcc 150389
>emb|BX470205.12| Zebrafish DNA sequence from clone DKEYP-118B7 in linkage group 9, complete sequence Length = 41140 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 23100 atccatcgatccatccatcc 23081 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 22987 atccatcgatccatccatcc 22968
>emb|BX248090.11| Zebrafish DNA sequence from clone DKEY-156K12 in linkage group 20, complete sequence Length = 212314 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 161057 atccatcgatccatccatcc 161038
>emb|AL845526.25| Zebrafish DNA sequence from clone CH211-11P18 in linkage group 22, complete sequence Length = 165617 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 84517 atccatcgatccatccatcc 84498
>emb|AL606705.23| Zebrafish DNA sequence from clone BUSM1-175P5 in linkage group 15, complete sequence Length = 92464 Score = 40.1 bits (20), Expect = 8.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 179 aataatccatcgatccatccatcc 202 ||||||||||| |||||||||||| Sbjct: 41528 aataatccatccatccatccatcc 41551
>emb|BX247899.17| Zebrafish DNA sequence from clone CH211-229B6 in linkage group 19, complete sequence Length = 150160 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 34713 atccatcgatccatccatcc 34732
>emb|AL732411.14| Zebrafish DNA sequence from clone XX-51I9 in linkage group 9, complete sequence Length = 64799 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 9582 atccatcgatccatccatcc 9563
>emb|BX465846.14| Zebrafish DNA sequence from clone CH211-215B21 in linkage group 18, complete sequence Length = 109342 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 22349 atccatcgatccatccatcc 22368
>emb|BX323889.13| Zebrafish DNA sequence from clone CH211-14G4 in linkage group 20, complete sequence Length = 177017 Score = 40.1 bits (20), Expect = 8.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 179 aataatccatcgatccatccatcc 202 ||||||||||| |||||||||||| Sbjct: 30610 aataatccatccatccatccatcc 30587
>emb|AL928817.5| Zebrafish DNA sequence from clone CH211-244H4 in linkage group 22, complete sequence Length = 153594 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 86263 atccatcgatccatccatcc 86282
>emb|CR774199.4| Zebrafish DNA sequence from clone CH211-42H24 in linkage group 14, complete sequence Length = 162722 Score = 40.1 bits (20), Expect = 8.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 179 aataatccatcgatccatccatcc 202 ||||||||||| |||||||||||| Sbjct: 19687 aataatccatccatccatccatcc 19710
>gb|AE003634.2| Drosophila melanogaster chromosome 2L, section 43 of 83 of the complete sequence Length = 265341 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 379 gctgctgctggttgccgcac 398 |||||||||||||||||||| Sbjct: 14335 gctgctgctggttgccgcac 14354
>gb|AC006240.1|AC006240 Drosophila melanogaster, chromosome 2L, region 33A3-33B2, P1 clones DS06189, DS04362, and DS07071, complete sequence Length = 170056 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 379 gctgctgctggttgccgcac 398 |||||||||||||||||||| Sbjct: 125443 gctgctgctggttgccgcac 125424
>emb|CR556714.4| Zebrafish DNA sequence from clone DKEY-29P13 in linkage group 11, complete sequence Length = 124598 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 52791 atccatcgatccatccatcc 52810
>emb|CR407543.6| Zebrafish DNA sequence from clone CH211-63M22 in linkage group 10, complete sequence Length = 105526 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 70520 atccatcgatccatccatcc 70501
>emb|AL935293.11| Zebrafish DNA sequence from clone CH211-251D10 in linkage group 10, complete sequence Length = 188908 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 160136 atccatcgatccatccatcc 160155
>emb|BX004776.4| Zebrafish DNA sequence from clone CH211-137A8 in linkage group 15, complete sequence Length = 195462 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 156091 atccatcgatccatccatcc 156110
>gb|AC148187.3| Saimiri boliviensis boliviensis clone CH254-373M5, complete sequence Length = 180635 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 1 tatatatatactagtatatc 20 |||||||||||||||||||| Sbjct: 129431 tatatatatactagtatatc 129412
>emb|BX005254.9| Zebrafish DNA sequence from clone DKEY-81P22 in linkage group 23, complete sequence Length = 160012 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 46456 atccatcgatccatccatcc 46437
>emb|AL805897.13| Mouse DNA sequence from clone RP23-63D8 on chromosome 4, complete sequence Length = 231989 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 192630 atccatcgatccatccatcc 192611
>emb|BX005339.7| Zebrafish DNA sequence from clone DKEY-71C4, complete sequence Length = 172485 Score = 40.1 bits (20), Expect = 8.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 179 aataatccatcgatccatccatcc 202 ||||||||||| |||||||||||| Sbjct: 44147 aataatccatccatccatccatcc 44170
>gb|AC163671.5| Mus musculus BAC clone RP23-21K2 from chromosome 3, complete sequence Length = 215382 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 162758 atccatcgatccatccatcc 162777
>emb|CT030722.6| Mouse DNA sequence from clone RP23-191N15 on chromosome 13, complete sequence Length = 187837 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 141056 atccatcgatccatccatcc 141075 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 141040 atccatcgatccatccatcc 141059
>gb|AC147236.3| Mus musculus BAC clone RP23-357C20 from 1, complete sequence Length = 217902 Score = 40.1 bits (20), Expect = 8.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 182 aatccatcgatccatccatccttc 205 |||||||| ||||||||||||||| Sbjct: 72141 aatccatccatccatccatccttc 72118
>emb|CR391944.10| Zebrafish DNA sequence from clone CH211-95K19 in linkage group 3, complete sequence Length = 172806 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 20887 atccatcgatccatccatcc 20906
>gb|AC151373.4| Aotus nancymaae clone CH258-480P12, complete sequence Length = 171933 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 1 tatatatatactagtatatc 20 |||||||||||||||||||| Sbjct: 65656 tatatatatactagtatatc 65637
>emb|AL683876.5| Mouse DNA sequence from clone RP23-100E6 on chromosome 2, complete sequence Length = 207486 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 188147 atccatcgatccatccatcc 188128
>emb|AL808110.7| Mouse DNA sequence from clone RP23-62O13 on chromosome X, complete sequence Length = 175963 Score = 40.1 bits (20), Expect = 8.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 182 aatccatcgatccatccatccttc 205 |||||||| ||||||||||||||| Sbjct: 52129 aatccatccatccatccatccttc 52106
>emb|AL808103.8| Mouse DNA sequence from clone RP23-301G2 on chromosome 4, complete sequence Length = 232070 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 131113 atccatcgatccatccatcc 131132
>emb|AL805924.5| Mouse DNA sequence from clone RP23-329M9 on chromosome X, complete sequence Length = 222134 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 210434 atccatcgatccatccatcc 210453
>emb|AL606925.16| Mouse DNA sequence from clone RP23-12J1 on chromosome 4, complete sequence Length = 239244 Score = 40.1 bits (20), Expect = 8.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 atccatcgatccatccatcc 202 |||||||||||||||||||| Sbjct: 173702 atccatcgatccatccatcc 173683 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,887,968 Number of Sequences: 3902068 Number of extensions: 4887968 Number of successful extensions: 253716 Number of sequences better than 10.0: 167 Number of HSP's better than 10.0 without gapping: 167 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 249154 Number of HSP's gapped (non-prelim): 4540 length of query: 628 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 605 effective length of database: 17,143,297,704 effective search space: 10371695110920 effective search space used: 10371695110920 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
