ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbasd3i02 |
|---|---|
| Clone Library Name | barley_pub |
>emb|X16000.1|HVGLN2 Hordeum vulgare mRNA for glutamine synthetase precursor (EC 6.3.1.2) Length = 1549 Score = 1328 bits (670), Expect = 0.0 Identities = 700/705 (99%), Gaps = 4/705 (0%) Strand = Plus / Minus Query: 1 ttatcgttttataataacgtagttctcnaa-tggactcaggtacagtgagtgtacagacc 59 ||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| Sbjct: 1534 ttatcgttttataataacgtagttctccaaatggactcaggtacagtgagtgtacagacc 1475 Query: 60 caacagatcaaatggactcagttcaagcggaaaaacacacgcgggagtggttctacaaac 119 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1474 caacagatcaaatggactcagttcaagcggaaaaacacacgcgggagtggttctacaaac 1415 Query: 120 tgtgaggattttgtacaggcagtgccccgacggaaccacaggatcaacaagaatggacgg 179 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1414 tgtgaggattttgtacaggcagtgccccgacggaaccacaggatcaacaagaatggacgg 1355 Query: 180 ccaacggtctcgccgctcgccgatttattttcttttccccggaagaagaattcgtccttt 239 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1354 ccaacggtctcgccgctcgccgatttattttcttttccccggaagaagaattcgtccttt 1295 Query: 240 tttcaggtccttcataccttcagcgccagcttcttggcagcgagggcctccgcctcgagg 299 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1294 tttcaggtccttcataccttcagcgccagcttcttggcagcgagggcctccgcctcgagg 1235 Query: 300 gtcggctcccacaggatcgtggtctcggccagcagcgccgtcacggtgtacgggtccatg 359 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1234 gtcggctcccacaggatcgtggtctcggccagcagcgccgtcacggtgtacgggtccatg 1175 Query: 360 ttggaggccgggcgacggtcctccaggtatcctttgcccttcgcctcggtgtctcgcccc 419 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1174 ttggaggccgggcgacggtcctccaggtatcctttgcccttcgcctcggtgtctcgcccc 1115 Query: 420 acacgaatagagcagccacggttcgccacaccccatgagaagtctgatatgctagctgtc 479 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1114 acacgaatagagcagccacggttcgccacaccccatgagaagtctgatatgctagctgtc 1055 Query: 480 tcgtgtagccctgtcaacctccgctcgtttccttcaccatatgcggctatgtgcaagtca 539 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1054 tcgtgtagccctgtcaacctccgctcgtttccttcaccatatgcggctatgtgcaagtca 995 Query: 540 tggcgaagtgaaaggttcaggattgccttcttgatcacgtcgaaacctccatcctcgcgc 599 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 994 tggcgaagtgaaaggttcaggattgccttcttgatcacgtcgaaacctccatcctcgcgc 935 Query: 600 atgctcaatgtgctgtagttttgtgtggcagccagctccgttccagtcaccctggattgg 659 |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct: 934 atgctcaatgtgctgtag-tttgtgtggcagccagctccgttccagtcaccctggattgg 876 Query: 660 tttttgggtcaagggtgagcaccacaccagcttgcttccgtgatt 704 |||||||||||||||||||||||||||||||||| ||||||||| Sbjct: 875 -ttttgggtcaagggtgagcaccacaccagcttgc-tccgtgatt 833
>gb|DQ124212.1| Triticum aestivum plastid glutamine synthetase isoform GS2a (GS2) mRNA, complete cds; nuclear gene for plastid product Length = 1713 Score = 955 bits (482), Expect = 0.0 Identities = 653/701 (93%), Gaps = 17/701 (2%) Strand = Plus / Minus Query: 9 ttataataacgtagttctcn-aatggactcaggtacagtgagtgtacagacccaacagat 67 ||||||||||||||||||| ||||||||||||||||| || |||||||||||||||||| Sbjct: 1706 ttataataacgtagttctccgaatggactcaggtacagggattgtacagacccaacagat 1647 Query: 68 caaatggactcagttcaagcggaaaaacacacgcgggagtggttctacaaactgtgagga 127 ||||||||||||||||||||| ||||||| || ||| |||||||||||| |||| || Sbjct: 1646 caaatggactcagttcaagcgaaaaaacatgcg---gagcggttctacaaaccgtgaaga 1590 Query: 128 ttttgtacaggcagtgccccgacggaaccacaggatcaacaagaatggacggccaacg-- 185 |||||||||| |||||||||||||||||||||||||||||||||||||||| | ||| Sbjct: 1589 ttttgtacagacagtgccccgacggaaccacaggatcaacaagaatggacgacggacgaa 1530 Query: 186 --gtctcgccgctcgccgatttattttcttttccccggaagaagaattcgtccttttttc 243 | |||||| | ||||||||||||||||||||||| ||||||||||| |||||| | Sbjct: 1529 cagcctcgccac-cgccgatttattttcttttcccc---agaagaattcggcctttt--c 1476 Query: 244 aggtccttcataccttcagcgccagcttcttggcagcgagggcctccgcctcgagggtcg 303 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1475 aggtccttcataccttcagcgccagcttcttggcagcgagggcctccgcctcgagggtcg 1416 Query: 304 gctcccacaggatcgtggtctcggccagcagcgccgtcacggtgtacgggtccatgttgg 363 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | Sbjct: 1415 gctcccacaggatcgtggtctcggccagcagcgccgtcacggtgtacgggtccatgttcg 1356 Query: 364 aggccgggcgacggtcctccaggtatcctttgcccttcgcctcggtgtctcgccccacac 423 | | ||||||||||||||||||||||||||||||||| |||||||| ||||| ||||||| Sbjct: 1355 acggcgggcgacggtcctccaggtatcctttgccctttgcctcggtctctcggcccacac 1296 Query: 424 gaatagagcagccacggttcgccacaccccatgagaagtctgatatgctagctgtctcgt 483 |||||||||||||||||||||| |||| ||||||||||||||| |||||||||||||||| Sbjct: 1295 gaatagagcagccacggttcgcaacacaccatgagaagtctgaaatgctagctgtctcgt 1236 Query: 484 gtagccctgtcaacctccgctcgtttccttcaccatatgcggctatgtgcaagtcatggc 543 ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Sbjct: 1235 gtagccctgtcaacctccgctcgttcccttcaccatatgcggctatgtgcaagtcatggc 1176 Query: 544 gaagtgaaaggttcaggattgccttcttgatcacgtcgaaacctccatcctcgcgcatgc 603 ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| Sbjct: 1175 gaagtgaaaggttcaggattgccttcttgatcacgtcgaaacctccatcttcgcgcatgc 1116 Query: 604 tcaatgtgctgtagttttgtgtggcagccagctccgttccagtcaccctggattggtttt 663 ||| ||| ||||| |||||||||||||||||||| |||||||||||||||||||| ||| Sbjct: 1115 tcagtgtactgta-atttgtgtggcagccagctccattccagtcaccctggattgg-ttt 1058 Query: 664 tgggtcaagggtgagcaccacaccagcttgcttccgtgatt 704 ||||||||||||||||||||||||||||||| ||||||||| Sbjct: 1057 tgggtcaagggtgagcaccacaccagcttgc-tccgtgatt 1018
>gb|DQ124213.1| Triticum aestivum plastid glutamine synthetase isoform GS2b (GS2) mRNA, complete cds; nuclear gene for plastid product Length = 1593 Score = 930 bits (469), Expect = 0.0 Identities = 620/659 (94%), Gaps = 16/659 (2%) Strand = Plus / Minus Query: 50 tgtacagacccaacagatcaaatggactcagttcaagcggaaaaacacacgcgggagtgg 109 ||||||||||||||||||||||||||||||||||||||| || || ||| |||| || || Sbjct: 1593 tgtacagacccaacagatcaaatggactcagttcaagcgaaacaa-acatgcgg-agcgg 1536 Query: 110 ttctacaaactgtgaggat----tttgtacaggcagtgccccgacggaaccacaggatca 165 ||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||| Sbjct: 1535 ttctacaaactgtgaggatggattttgtacagacagtgccccgacggaaccacaggatca 1476 Query: 166 acaagaatggacggccaacggtctcgccgctcgccgatttattttcttttccccggaaga 225 ||||||||||||||||||||||| |||||| |||||||||||||||||||| |||||||| Sbjct: 1475 acaagaatggacggccaacggtc-cgccgc-cgccgatttattttcttttcgccggaaga 1418 Query: 226 agaattcgtccttttttcaggtccttcataccttcagcgccagcttcttggcagcgaggg 285 | ||||| | |||| |||||||||||||||||||||||||||||||||| ||||||| Sbjct: 1417 a---ttcgt--tgttttgaggtccttcataccttcagcgccagcttcttggcggcgaggg 1363 Query: 286 cctccgcctcgagggtcggctcccacaggatcgtggtctcggccagcagcgccgtcacgg 345 |||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||| Sbjct: 1362 cctccgcctcaagggtcggctcccacaggatcgtggtctcggccagcagcgctgtcacgg 1303 Query: 346 tgtacgggtccatgttggaggccgggcgacggtcctccaggtatcctttgcccttcgcct 405 |||| ||||||||||| ||||||||||||||||||||||| |||||||||||||| |||| Sbjct: 1302 tgtatgggtccatgttcgaggccgggcgacggtcctccagatatcctttgccctttgcct 1243 Query: 406 cggtgtctcgccccacacgaatagagcagccacggttcgccacaccccatgagaagtctg 465 |||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||| Sbjct: 1242 cggtttctcgccccacacgaatagagcagccacggttcgcgacaccccatgagaagtctg 1183 Query: 466 atatgctagctgtctcgtgtagccctgtcaacctccgctcgtttccttcaccatatgcgg 525 |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| Sbjct: 1182 atatgctagctgtctcgtgtagccctgtcagtctccgctcgtttccttcaccatatgcgg 1123 Query: 526 ctatgtgcaagtcatggcgaagtgaaaggttcaggattgccttcttgatcacgtcgaaac 585 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1122 ctatgtgcaagtcatggcgaagtgaaaggttcaggattgccttcttgatcacgtcgaaac 1063 Query: 586 ctccatcctcgcgcatgctcaatgtgctgtagttttgtgtggcagccagctccgttccag 645 ||||||| || |||||||||||||||||||| |||||||||||||||||||| |||||| Sbjct: 1062 ctccatcttcacgcatgctcaatgtgctgta-atttgtgtggcagccagctccattccag 1004 Query: 646 tcaccctggattggtttttgggtcaagggtgagcaccacaccagcttgcttccgtgatt 704 |||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||| Sbjct: 1003 tcaccctggattgg-ttttgggtcaagggtgagcaccacaccagcttgc-tccgtgatt 947
>emb|X53580.1|HVGLN2R Barley gln mRNA for glutamine synthetase 2 (EC 6.3.1.2) Length = 1600 Score = 882 bits (445), Expect = 0.0 Identities = 466/469 (99%), Gaps = 3/469 (0%) Strand = Plus / Minus Query: 236 cttttttcaggtccttcataccttcagcgccagcttcttggcagcgagggcctccgcctc 295 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1600 cttttttcaggtccttcataccttcagcgccagcttcttggcagcgagggcctccgcctc 1541 Query: 296 gagggtcggctcccacaggatcgtggtctcggccagcagcgccgtcacggtgtacgggtc 355 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1540 gagggtcggctcccacaggatcgtggtctcggccagcagcgccgtcacggtgtacgggtc 1481 Query: 356 catgttggaggccgggcgacggtcctccaggtatcctttgcccttcgcctcggtgtctcg 415 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1480 catgttggaggccgggcgacggtcctccaggtatcctttgcccttcgcctcggtgtctcg 1421 Query: 416 ccccacacgaatagagcagccacggttcgccacaccccatgagaagtctgatatgctagc 475 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1420 ccccacacgaatagagcagccacggttcgccacaccccatgagaagtctgatatgctagc 1361 Query: 476 tgtctcgtgtagccctgtcaacctccgctcgtttccttcaccatatgcggctatgtgcaa 535 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1360 tgtctcgtgtagccctgtcaacctccgctcgtttccttcaccatatgcggctatgtgcaa 1301 Query: 536 gtcatggcgaagtgaaaggttcaggattgccttcttgatcacgtcgaaacctccatcctc 595 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1300 gtcatggcgaagtgaaaggttcaggattgccttcttgatcacgtcgaaacctccatcctc 1241 Query: 596 gcgcatgctcaatgtgctgtagttttgtgtggcagccagctccgttccagtcaccctgga 655 |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct: 1240 gcgcatgctcaatgtgctgtag-tttgtgtggcagccagctccgttccagtcaccctgga 1182 Query: 656 ttggtttttgggtcaagggtgagcaccacaccagcttgcttccgtgatt 704 |||| |||||||||||||||||||||||||||||||||| ||||||||| Sbjct: 1181 ttgg-ttttgggtcaagggtgagcaccacaccagcttgc-tccgtgatt 1135
>gb|DQ124214.1| Triticum aestivum plastid glutamine synthetase isoform GS2c (GS2) mRNA, complete cds; nuclear gene for plastid product Length = 1689 Score = 807 bits (407), Expect = 0.0 Identities = 487/508 (95%), Gaps = 8/508 (1%) Strand = Plus / Minus Query: 197 cgccgatttattttcttttccccggaagaagaattcgtccttttttcaggtccttcatac 256 |||||||||||||||||||||||||||||| |||| |||||| |||||||||||||| Sbjct: 1472 cgccgatttattttcttttccccggaagaa---ttcggcctttt--caggtccttcatac 1418 Query: 257 cttcagcgccagcttcttggcagcgagggcctccgcctcgagggtcggctcccacaggat 316 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1417 cttcagcgccagcttcttggcagcgagggcctccgcctcgagggtcggctcccacaggat 1358 Query: 317 cgtggtctcggccagcagcgccgtcacggtgtacgggtccatgttggaggccgggcgacg 376 ||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| Sbjct: 1357 cgtggtctcggccagcagcgccgtcacggtgtatgggtccatgttcgaggccgggcgacg 1298 Query: 377 gtcctccaggtatcctttgcccttcgcctcggtgtctcgccccacacgaatagagcagcc 436 |||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||| Sbjct: 1297 gtcctccaggtatcctttgccctttgcctcggtctctcgccccacacgaatagagcagcc 1238 Query: 437 acggttcgccacaccccatgagaagtctgatatgctagctgtctcgtgtagccctgtcaa 496 ||| ||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 1237 acgattcgcgacaccccatgagaagtctgatatgctagctgtctcatgtagccctgtcaa 1178 Query: 497 cctccgctcgtttccttcaccatatgcggctatgtgcaagtcatggcgaagtgaaaggtt 556 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1177 cctccgttcgtttccttcaccatatgcggctatgtgcaagtcatggcgaagtgaaaggtt 1118 Query: 557 caggattgccttcttgatcacgtcgaaacctccatcctcgcgcatgctcaatgtgctgta 616 ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| Sbjct: 1117 caggattgccttcttgatcacgtcgaaacctccatcctcacgcatgctcaatgtgctgta 1058 Query: 617 gttttgtgtggcagccagctccgttccagtcaccctggattggtttttgggtcaagggtg 676 |||||||||||||||||||| |||||||||||||||||||| |||||||||||||||| Sbjct: 1057 -atttgtgtggcagccagctccattccagtcaccctggattgg-ttttgggtcaagggtg 1000 Query: 677 agcaccacaccagcttgcttccgtgatt 704 ||||| |||||||||||| ||||||||| Sbjct: 999 agcacgacaccagcttgc-tccgtgatt 973 Score = 234 bits (118), Expect = 3e-58 Identities = 159/171 (92%), Gaps = 4/171 (2%) Strand = Plus / Minus Query: 9 ttataataacgtagttctcn-aatggactcaggtacagtgagtgtacagacccaacagat 67 ||||||||||||||||||| ||||||||||||||||| || |||||||||||||||||| Sbjct: 1647 ttataataacgtagttctccgaatggactcaggtacagggattgtacagacccaacagat 1588 Query: 68 caaatggactcagttcaagcggaaaaacacacgcgggagtggttctacaaactgtgagga 127 ||||||||||||||||||||| ||||||| || ||| |||||||||||||||||||| Sbjct: 1587 caaatggactcagttcaagcgaaaaaacatgcg---gagcggttctacaaactgtgagga 1531 Query: 128 ttttgtacaggcagtgccccgacggaaccacaggatcaacaagaatggacg 178 |||||||||| |||||||||||||||||||||||||||||||||||||||| Sbjct: 1530 ttttgtacagacagtgccccgacggaaccacaggatcaacaagaatggacg 1480
>emb|X14246.1|OSSIGS31 Oryza sativa shoot GS2 mRNA for chloroplastic glutamine synthetase (EC 6.3.1.2) (clone lambda-GS31) Length = 1649 Score = 371 bits (187), Expect = 2e-99 Identities = 384/447 (85%), Gaps = 2/447 (0%) Strand = Plus / Minus Query: 249 cttcataccttcagcgccagcttcttggcagcgagggcctccgcctcgagggtcggctcc 308 |||||||||||||| |||| |||||| ||||| || ||||||| |||||||| |||||| Sbjct: 1352 cttcataccttcagggccaacttcttagcagcaagaacctccgcttcgagggttggctcc 1293 Query: 309 cacaggatcgtggtctcggccagcagcgccgtcacggtgtacgggtccatgttggaggcc 368 || || || ||||| || |||| ||||| |||||| ||||||||||||||| || ||| Sbjct: 1292 caaagaattgtggtttcagccaatagcgctgtcacgacgtacgggtccatgtttgatgcc 1233 Query: 369 gggcgacggtcctccaggtatcctttgcccttcgcctcggtgtctcgccccacacgaata 428 ||||||||||| |||| ||| ||||| |||||||||||||||||||||||||| |||||| Sbjct: 1232 gggcgacggtcttccaagtagccttttcccttcgcctcggtgtctcgccccacccgaata 1173 Query: 429 gagcagccacggttcgccacaccccatgagaagtctgatatgctagctgtctcgtgtagc 488 ||||| |||||||| ||||||||||||||||| | ||||||||||||||||||| Sbjct: 1172 gagcatccacggtttgccacaccccatgagaaattgtcaatgctagctgtctcgtgtaaa 1113 Query: 489 cctgtcaacctccgctcgtttccttcaccatatgcggctatgtgcaagtcatggcgaagt 548 ||||||||||||| || ||||||||||||||||| ||| |||||||||||||||||| Sbjct: 1112 cctgtcaacctcctttcatttccttcaccatatgcacttatatgcaagtcatggcgaagt 1053 Query: 549 gaaaggttcaggattgccttcttgatcacgtcgaaacctccatcctcgcgcatgctcaat 608 || ||||| |||||||||||||||||||| || || |||||||| || ||||| ||| Sbjct: 1052 gataggtttaggattgccttcttgatcacctcaaatcctccatcttcacgcatactcttg 993 Query: 609 gtgctgtagttttgtgtggcagccagctccgttccagtcaccctggattggtttttgggt 668 ||||||||| ||||||||||| |||||||| |||||||| ||||| ||||| ||| |||| Sbjct: 992 gtgctgtag-tttgtgtggcacccagctccattccagtctccctgaattgg-tttggggt 935 Query: 669 caagggtgagcaccacaccagcttgct 695 ||||||| ||||| |||||||| |||| Sbjct: 934 caagggtaagcactacaccagcctgct 908
>dbj|AK099252.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013156I04, full insert sequence Length = 1639 Score = 371 bits (187), Expect = 2e-99 Identities = 384/447 (85%), Gaps = 2/447 (0%) Strand = Plus / Minus Query: 249 cttcataccttcagcgccagcttcttggcagcgagggcctccgcctcgagggtcggctcc 308 |||||||||||||| |||| |||||| ||||| || ||||||| |||||||| |||||| Sbjct: 1342 cttcataccttcagggccaacttcttagcagcaagaacctccgcttcgagggttggctcc 1283 Query: 309 cacaggatcgtggtctcggccagcagcgccgtcacggtgtacgggtccatgttggaggcc 368 || || || ||||| || |||| ||||| |||||| ||||||||||||||| || ||| Sbjct: 1282 caaagaattgtggtttcagccaatagcgctgtcacgacgtacgggtccatgtttgatgcc 1223 Query: 369 gggcgacggtcctccaggtatcctttgcccttcgcctcggtgtctcgccccacacgaata 428 ||||||||||| |||| ||| ||||| |||||||||||||||||||||||||| |||||| Sbjct: 1222 gggcgacggtcttccaagtagccttttcccttcgcctcggtgtctcgccccacccgaata 1163 Query: 429 gagcagccacggttcgccacaccccatgagaagtctgatatgctagctgtctcgtgtagc 488 ||||| |||||||| ||||||||||||||||| | ||||||||||||||||||| Sbjct: 1162 gagcatccacggtttgccacaccccatgagaaattgtcaatgctagctgtctcgtgtaaa 1103 Query: 489 cctgtcaacctccgctcgtttccttcaccatatgcggctatgtgcaagtcatggcgaagt 548 ||||||||||||| || ||||||||||||||||| ||| |||||||||||||||||| Sbjct: 1102 cctgtcaacctcctttcatttccttcaccatatgcacttatatgcaagtcatggcgaagt 1043 Query: 549 gaaaggttcaggattgccttcttgatcacgtcgaaacctccatcctcgcgcatgctcaat 608 || ||||| |||||||||||||||||||| || || |||||||| || ||||| ||| Sbjct: 1042 gataggtttaggattgccttcttgatcacctcaaatcctccatcttcacgcatactcttg 983 Query: 609 gtgctgtagttttgtgtggcagccagctccgttccagtcaccctggattggtttttgggt 668 ||||||||| ||||||||||| |||||||| |||||||| ||||| ||||| ||| |||| Sbjct: 982 gtgctgtag-tttgtgtggcacccagctccattccagtctccctgaattgg-tttggggt 925 Query: 669 caagggtgagcaccacaccagcttgct 695 ||||||| ||||| |||||||| |||| Sbjct: 924 caagggtaagcactacaccagcctgct 898
>dbj|AK065491.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013022E13, full insert sequence Length = 1677 Score = 371 bits (187), Expect = 2e-99 Identities = 384/447 (85%), Gaps = 2/447 (0%) Strand = Plus / Minus Query: 249 cttcataccttcagcgccagcttcttggcagcgagggcctccgcctcgagggtcggctcc 308 |||||||||||||| |||| |||||| ||||| || ||||||| |||||||| |||||| Sbjct: 1370 cttcataccttcagggccaacttcttagcagcaagaacctccgcttcgagggttggctcc 1311 Query: 309 cacaggatcgtggtctcggccagcagcgccgtcacggtgtacgggtccatgttggaggcc 368 || || || ||||| || |||| ||||| |||||| ||||||||||||||| || ||| Sbjct: 1310 caaagaattgtggtttcagccaatagcgctgtcacgacgtacgggtccatgtttgatgcc 1251 Query: 369 gggcgacggtcctccaggtatcctttgcccttcgcctcggtgtctcgccccacacgaata 428 ||||||||||| |||| ||| ||||| |||||||||||||||||||||||||| |||||| Sbjct: 1250 gggcgacggtcttccaagtagccttttcccttcgcctcggtgtctcgccccacccgaata 1191 Query: 429 gagcagccacggttcgccacaccccatgagaagtctgatatgctagctgtctcgtgtagc 488 ||||| |||||||| ||||||||||||||||| | ||||||||||||||||||| Sbjct: 1190 gagcatccacggtttgccacaccccatgagaaattgtcaatgctagctgtctcgtgtaaa 1131 Query: 489 cctgtcaacctccgctcgtttccttcaccatatgcggctatgtgcaagtcatggcgaagt 548 ||||||||||||| || ||||||||||||||||| ||| |||||||||||||||||| Sbjct: 1130 cctgtcaacctcctttcatttccttcaccatatgcacttatatgcaagtcatggcgaagt 1071 Query: 549 gaaaggttcaggattgccttcttgatcacgtcgaaacctccatcctcgcgcatgctcaat 608 || ||||| |||||||||||||||||||| || || |||||||| || ||||| ||| Sbjct: 1070 gataggtttaggattgccttcttgatcacctcaaatcctccatcttcacgcatactcttg 1011 Query: 609 gtgctgtagttttgtgtggcagccagctccgttccagtcaccctggattggtttttgggt 668 ||||||||| ||||||||||| |||||||| |||||||| ||||| ||||| ||| |||| Sbjct: 1010 gtgctgtag-tttgtgtggcacccagctccattccagtctccctgaattgg-tttggggt 953 Query: 669 caagggtgagcaccacaccagcttgct 695 ||||||| ||||| |||||||| |||| Sbjct: 952 caagggtaagcactacaccagcctgct 926
>ref|XM_474199.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1287 Score = 367 bits (185), Expect = 3e-98 Identities = 382/445 (85%), Gaps = 2/445 (0%) Strand = Plus / Minus Query: 251 tcataccttcagcgccagcttcttggcagcgagggcctccgcctcgagggtcggctccca 310 |||||||||||| |||| |||||| ||||| || ||||||| |||||||| |||||||| Sbjct: 1287 tcataccttcagggccaacttcttagcagcaagaacctccgcttcgagggttggctccca 1228 Query: 311 caggatcgtggtctcggccagcagcgccgtcacggtgtacgggtccatgttggaggccgg 370 || || ||||| || |||| ||||| |||||| ||||||||||||||| || ||||| Sbjct: 1227 aagaattgtggtttcagccaatagcgctgtcacgacgtacgggtccatgtttgatgccgg 1168 Query: 371 gcgacggtcctccaggtatcctttgcccttcgcctcggtgtctcgccccacacgaataga 430 ||||||||| |||| ||| ||||| |||||||||||||||||||||||||| |||||||| Sbjct: 1167 gcgacggtcttccaagtagccttttcccttcgcctcggtgtctcgccccacccgaataga 1108 Query: 431 gcagccacggttcgccacaccccatgagaagtctgatatgctagctgtctcgtgtagccc 490 ||| |||||||| ||||||||||||||||| | ||||||||||||||||||| || Sbjct: 1107 gcatccacggtttgccacaccccatgagaaattgtcaatgctagctgtctcgtgtaaacc 1048 Query: 491 tgtcaacctccgctcgtttccttcaccatatgcggctatgtgcaagtcatggcgaagtga 550 ||||||||||| || ||||||||||||||||| ||| |||||||||||||||||||| Sbjct: 1047 tgtcaacctcctttcatttccttcaccatatgcacttatatgcaagtcatggcgaagtga 988 Query: 551 aaggttcaggattgccttcttgatcacgtcgaaacctccatcctcgcgcatgctcaatgt 610 ||||| |||||||||||||||||||| || || |||||||| || ||||| ||| || Sbjct: 987 taggtttaggattgccttcttgatcacctcaaatcctccatcttcacgcatactcttggt 928 Query: 611 gctgtagttttgtgtggcagccagctccgttccagtcaccctggattggtttttgggtca 670 ||||||| ||||||||||| |||||||| |||||||| ||||| ||||| ||| |||||| Sbjct: 927 gctgtag-tttgtgtggcacccagctccattccagtctccctgaattgg-tttggggtca 870 Query: 671 agggtgagcaccacaccagcttgct 695 ||||| ||||| |||||||| |||| Sbjct: 869 agggtaagcactacaccagcctgct 845
>dbj|AB161716.1| Phragmites australis GS2 mRNA for plastidic glutamine synthetase, complete cds, clone:YGS2-4 Length = 1290 Score = 329 bits (166), Expect = 7e-87 Identities = 385/454 (84%), Gaps = 3/454 (0%) Strand = Plus / Minus Query: 251 tcataccttcagcgccagcttcttggcagcgagggcctccgcctcgagggtcggctccca 310 ||||||||||||||||| |||||| || || || ||||| | |||||||| |||||||| Sbjct: 1290 tcataccttcagcgccaacttcttagcggcaagagcctctacttcgagggttggctccca 1231 Query: 311 caggatcgtggtctcggccagcagcgccgtcacggtgtacgggtccatgttggaggccgg 370 || || ||||| || ||||| |||| ||||| || ||||||||||| || ||||| Sbjct: 1230 aagaattgtggtttcagccagtagcgatgtcacaacatatgggtccatgtttgatgccgg 1171 Query: 371 gcgacggtcctccaggtatcctttgcccttcgcctcggtgtctcgccccacacgaataga 430 ||||||||| |||||||| ||||| || || ||||| || ||||||||||| |||||||| Sbjct: 1170 gcgacggtcttccaggtagcctttcccttttgcctcagtatctcgccccacccgaataga 1111 Query: 431 gcagccacggttcgccacaccccatgagaagtctgatatgctagctgtctcgtgtagccc 490 |||||||||||| ||||||||||||||||||| ||||| |||||||| |||| ||| Sbjct: 1110 gcagccacggtttgccacaccccatgagaagttgtcaatgctcgctgtctcatgtaaccc 1051 Query: 491 tgtcaacctccgctcgtttccttcaccatatgcggctatgtgcaagtcatggcgaagtga 550 ||||||||||| || || ||||| |||||||| || ||||| ||||||||||| || Sbjct: 1050 tgtcaacctcctttcattcccttctccatatgcactaatatgcaaatcatggcgaagaga 991 Query: 551 aaggttcaggattgccttcttgatcacgtcgaaacctccatcctcgcgcatgctcaatgt 610 |||||| |||||||| ||||||||||| || || |||||||| || ||||||||| ||| Sbjct: 990 aaggttaaggattgctttcttgatcacttcaaatcctccatcttcacgcatgctctttgt 931 Query: 611 gctgtagttttgtgtggcagccagctccgttccagtcaccctggattggtttttgggtca 670 ||||||| |||||||||||||||||||| |||||||||||||| ||||| |||||| ||| Sbjct: 930 gctgtag-tttgtgtggcagccagctccattccagtcaccctgaattgg-ttttggatca 873 Query: 671 agggtgagcaccacaccagcttgcttccgtgatt 704 ||||| |||||||||||||||||| ||||||||| Sbjct: 872 agggtaagcaccacaccagcttgc-tccgtgatt 840
>dbj|AB161715.1| Phragmites australis GS2 mRNA for plastidic glutamine synthetase, complete cds, clone:YGS2-7 Length = 1290 Score = 301 bits (152), Expect = 2e-78 Identities = 348/412 (84%), Gaps = 1/412 (0%) Strand = Plus / Minus Query: 251 tcataccttcagcgccagcttcttggcagcgagggcctccgcctcgagggtcggctccca 310 |||||||||||| || | |||||| | || || || |||||||| ||||| |||||||| Sbjct: 1290 tcataccttcagtgctaacttcttagtggcaagagcttccgcctcaagggttggctccca 1231 Query: 311 caggatcgtggtctcggccagcagcgccgtcacggtgtacgggtccatgttggaggccgg 370 || || ||||| || ||||| |||| ||||| || ||||||||||| || ||||| Sbjct: 1230 aagaattgtggtttcagccagtagcgatgtcacaacatatgggtccatgtttgatgccgg 1171 Query: 371 gcgacggtcctccaggtatcctttgcccttcgcctcggtgtctcgccccacacgaataga 430 ||||||||| |||||||| ||||| || || ||||| || ||||||||||| |||||||| Sbjct: 1170 gcgacggtcttccaggtagccttttccttttgcctcagtatctcgccccacccgaataga 1111 Query: 431 gcagccacggttcgccacaccccatgagaagtctgatatgctagctgtctcgtgtagccc 490 |||||||||||| ||||||||||||||||||| ||||||||||||||| |||| || Sbjct: 1110 gcagccacggtttgccacaccccatgagaagttgtctatgctagctgtctcatgtaatcc 1051 Query: 491 tgtcaacctccgctcgtttccttcaccatatgcggctatgtgcaagtcatggcgaagtga 550 ||||||||||| || |||||||| |||||||| || |||| ||||||||||| || Sbjct: 1050 tgtcaacctcctttcatttccttctccatatgcactaatatgcagatcatggcgaagaga 991 Query: 551 aaggttcaggattgccttcttgatcacgtcgaaacctccatcctcgcgcatgctcaatgt 610 ||||||||||||||| ||||||||||| || |||||||||||||| ||||||||| ||| Sbjct: 990 aaggttcaggattgctttcttgatcacttcaaaacctccatcctcacgcatgctctttgt 931 Query: 611 gctgtagttttgtgtggcagccagctccgttccagtcaccctggattggttt 662 |||||| ||||||||||| ||||||||||||||||||||||| |||||||| Sbjct: 930 gctgta-atttgtgtggcaaccagctccgttccagtcaccctgaattggttt 880
>dbj|AB161714.1| Phragmites australis GS2 mRNA for plastidic glutamine synthetase, complete cds, clone:YGS2-16 Length = 1290 Score = 301 bits (152), Expect = 2e-78 Identities = 348/412 (84%), Gaps = 1/412 (0%) Strand = Plus / Minus Query: 251 tcataccttcagcgccagcttcttggcagcgagggcctccgcctcgagggtcggctccca 310 |||||||||||| || | |||||| | || || || |||||||| ||||| |||||||| Sbjct: 1290 tcataccttcagtgctaacttcttagtggcaagagcttccgcctcaagggttggctccca 1231 Query: 311 caggatcgtggtctcggccagcagcgccgtcacggtgtacgggtccatgttggaggccgg 370 || || ||||| || ||||| |||| ||||| || ||||||||||| || ||||| Sbjct: 1230 aagaattgtggtttcagccagtagcgatgtcacaacatatgggtccatgtttgatgccgg 1171 Query: 371 gcgacggtcctccaggtatcctttgcccttcgcctcggtgtctcgccccacacgaataga 430 ||||||||| |||||||| ||||| || || ||||| || ||||||||||| |||||||| Sbjct: 1170 gcgacggtcttccaggtagccttttccttttgcctcagtatctcgccccacccgaataga 1111 Query: 431 gcagccacggttcgccacaccccatgagaagtctgatatgctagctgtctcgtgtagccc 490 |||||||||||| ||||||||||||||||||| ||||||||||||||| |||| || Sbjct: 1110 gcagccacggtttgccacaccccatgagaagttgtctatgctagctgtctcatgtaatcc 1051 Query: 491 tgtcaacctccgctcgtttccttcaccatatgcggctatgtgcaagtcatggcgaagtga 550 ||||||||||| || |||||||| |||||||| || |||| ||||||||||| || Sbjct: 1050 tgtcaacctcctttcatttccttctccatatgcactaatatgcagatcatggcgaagaga 991 Query: 551 aaggttcaggattgccttcttgatcacgtcgaaacctccatcctcgcgcatgctcaatgt 610 ||||||||||||||| ||||||||||| || |||||||||||||| ||||||||| ||| Sbjct: 990 aaggttcaggattgctttcttgatcacttcaaaacctccatcctcacgcatgctctttgt 931 Query: 611 gctgtagttttgtgtggcagccagctccgttccagtcaccctggattggttt 662 |||||| ||||||||||| ||||||||||||||||||||||| |||||||| Sbjct: 930 gctgta-atttgtgtggcaaccagctccgttccagtcaccctgaattggttt 880
>emb|X65931.1|ZMGS2 Z.mays mRNA gs2 for glutamine synthatase Length = 1483 Score = 291 bits (147), Expect = 2e-75 Identities = 374/447 (83%), Gaps = 2/447 (0%) Strand = Plus / Minus Query: 249 cttcataccttcagcgccagcttcttggcagcgagggcctccgcctcgagggtcggctcc 308 ||||| ||||||||||||||||||||||| || || |||||||||||||||| |||| | Sbjct: 1321 cttcacaccttcagcgccagcttcttggcggcaagagcctccgcctcgagggatggctgc 1262 Query: 309 cacaggatcgtggtctcggccagcagcgccgtcacggtgtacgggtccatgttggaggcc 368 || |||||||||||||||||||| ||| ||||||| |||||||||||||||| || ||| Sbjct: 1261 cagaggatcgtggtctcggccagtagccccgtcacaatgtacgggtccatgtttgatgcc 1202 Query: 369 gggcgacggtcctccaggtatcctttgcccttcgcctcggtgtctcgccccacacgaata 428 || |||||||| |||||||| ||||| || || |||||||| || ||||||||||| ||| Sbjct: 1201 ggccgacggtcttccaggtaacctttcccttttgcctcggtatcccgccccacacggata 1142 Query: 429 gagcagccacggttcgccacaccccatgagaagtctgatatgctagctgtctcgtgtagc 488 |||||||| ||||| |||||||||||||||||| | ||||| || ||||| ||| | Sbjct: 1141 gagcagccgcggtttgccacaccccatgagaaggttccgatgctcgcagtctcatgtttc 1082 Query: 489 cctgtcaacctccgctcgtttccttcaccatatgcggctatgtgcaagtcatggcgaagt 548 || ||||| || | || |||||||| || ||||| || |||| |||||||| || Sbjct: 1081 ccagtcaatcttctttcatttccttctccgtatgcactaatatgcagatcatggcgcaga 1022 Query: 549 gaaaggttcaggattgccttcttgatcacgtcgaaacctccatcctcgcgcatgctcaat 608 ||||||||||||||||| |||||||| | || || || || || ||||||||| || | Sbjct: 1021 gaaaggttcaggattgctctcttgatctcttcaaacccgccgtcttcgcgcatggtcttt 962 Query: 609 gtgctgtagttttgtgtggcagccagctccgttccagtcaccctggattggtttttgggt 668 |||||||| ||||||||||||||||||||||||||||||||||| ||||| |||||| | Sbjct: 961 gtgctgta-atttgtgtggcagccagctccgttccagtcaccctgaattgg-ttttggat 904 Query: 669 caagggtgagcaccacaccagcttgct 695 ||||||| || || || |||||||||| Sbjct: 903 caagggtaaggacaaccccagcttgct 877
>gb|AY835456.1| Saccharum officinarum chloroplast glutamine synthetase (GS2) mRNA, partial cds; nuclear gene for chloroplast product Length = 756 Score = 252 bits (127), Expect = 1e-63 Identities = 344/415 (82%), Gaps = 1/415 (0%) Strand = Plus / Minus Query: 249 cttcataccttcagcgccagcttcttggcagcgagggcctccgcctcgagggtcggctcc 308 |||||||||||||| |||||||||||||| || || ||||||| || ||||| |||| | Sbjct: 500 cttcataccttcagtgccagcttcttggcggcaagaacctccgcttcaagggttggctgc 441 Query: 309 cacaggatcgtggtctcggccagcagcgccgtcacggtgtacgggtccatgttggaggcc 368 || || || |||||||| ||||| ||| | ||||| |||| ||||||||||| || ||| Sbjct: 440 cagagaattgtggtctcagccagtagccctgtcacaatgtatgggtccatgtttgatgcc 381 Query: 369 gggcgacggtcctccaggtatcctttgcccttcgcctcggtgtctcgccccacacgaata 428 || |||||||| |||||||| ||||| || || |||||||| |||||||||||||||| | Sbjct: 380 ggccgacggtcttccaggtaacctttcccttttgcctcggtatctcgccccacacgaaca 321 Query: 429 gagcagccacggttcgccacaccccatgagaagtctgatatgctagctgtctcgtgtagc 488 |||||||||||||| ||||| |||||||||||| |||||||| ||||| ||| | Sbjct: 320 gagcagccacggtttgccacgccccatgagaaggtgtcgatgctagcagtctcatgtttc 261 Query: 489 cctgtcaacctccgctcgtttccttcaccatatgcggctatgtgcaagtcatggcgaagt 548 |||||||| || | || |||||||| || ||||| || ||||| |||||||| || Sbjct: 260 cctgtcaatcttctttcatttccttctccgtatgcactaatatgcaaatcatggcgcaga 201 Query: 549 gaaaggttcaggattgccttcttgatcacgtcgaaacctccatcctcgcgcatgctcaat 608 ||||||||||||||||| |||||||| | || || |||||||| || ||||| || | Sbjct: 200 gaaaggttcaggattgctctcttgatctcttcaaatcctccatcttcacgcatcgtcttt 141 Query: 609 gtgctgtagttttgtgtggcagccagctccgttccagtcaccctggattggtttt 663 |||||||| ||||||||||||||||||||||||||||||||||| ||||||||| Sbjct: 140 gtgctgta-atttgtgtggcagccagctccgttccagtcaccctgaattggtttt 87
>gb|AY110796.1| Zea mays CL2183_1 mRNA sequence Length = 1541 Score = 224 bits (113), Expect = 3e-55 Identities = 188/213 (88%) Strand = Plus / Minus Query: 249 cttcataccttcagcgccagcttcttggcagcgagggcctccgcctcgagggtcggctcc 308 ||||| ||||||||||||||||||||||| || || |||||||||||||||| |||| | Sbjct: 1321 cttcacaccttcagcgccagcttcttggcggcaagagcctccgcctcgagggatggctgc 1262 Query: 309 cacaggatcgtggtctcggccagcagcgccgtcacggtgtacgggtccatgttggaggcc 368 || |||||||||||||||||||| ||| ||||||| |||||||||||||||| || ||| Sbjct: 1261 cagaggatcgtggtctcggccagtagccccgtcacaatgtacgggtccatgtttgatgcc 1202 Query: 369 gggcgacggtcctccaggtatcctttgcccttcgcctcggtgtctcgccccacacgaata 428 || |||||||| |||||||| ||||| || || |||||||| || ||||||||||| ||| Sbjct: 1201 ggccgacggtcttccaggtaacctttcccttttgcctcggtatcccgccccacacggata 1142 Query: 429 gagcagccacggttcgccacaccccatgagaag 461 |||||||| ||||| |||||||||||||||||| Sbjct: 1141 gagcagccgcggtttgccacaccccatgagaag 1109 Score = 117 bits (59), Expect = 5e-23 Identities = 136/159 (85%), Gaps = 2/159 (1%) Strand = Plus / Minus Query: 537 tcatggcgaagtgaaaggttcaggattgccttcttgatcacgtcgaaacctccatcctcg 596 |||||||| || ||||||||||||||||| |||||||| | || || || || || ||| Sbjct: 1033 tcatggcgcagagaaaggttcaggattgctctcttgatctcttcaaacccgccgtcttcg 974 Query: 597 cgcatgctcaatgtgctgtagttttgtgtggcagccagctccgttccagtcaccctggat 656 |||||| || ||||||||| ||| |||||||||||||||||||||||||||||||| || Sbjct: 973 cgcatggtctttgtgctgtaattt-gtgtggcagccagctccgttccagtcaccctgaat 915 Query: 657 tggtttttgggtcaagggtgagcaccacaccagcttgct 695 ||| |||||| |||||||| || || || |||||||||| Sbjct: 914 tgg-ttttggatcaagggtaaggacaaccccagcttgct 877
>gb|AF290454.1|AF290454 Lolium perenne clone LpGln2 unknown sequence Length = 811 Score = 157 bits (79), Expect = 6e-35 Identities = 136/155 (87%) Strand = Plus / Minus Query: 451 cccatgagaagtctgatatgctagctgtctcgtgtagccctgtcaacctccgctcgtttc 510 ||||||| ||||||||||||||||||||||| |||| ||||||||| ||||| || |||| Sbjct: 676 cccatgaaaagtctgatatgctagctgtctcatgtaaccctgtcaatctccgttcatttc 617 Query: 511 cttcaccatatgcggctatgtgcaagtcatggcgaagtgaaaggttcaggattgccttct 570 ||||||||||| | ||||||||||| || ||||||||||||||||||||||| |||| Sbjct: 616 cttcaccatattcactgatgtgcaagtcgtgacgaagtgaaaggttcaggattgctttct 557 Query: 571 tgatcacgtcgaaacctccatcctcgcgcatgctc 605 | ||||| || ||||||||||| || ||||||||| Sbjct: 556 taatcacttcaaaacctccatcttcacgcatgctc 522 Score = 60.0 bits (30), Expect = 1e-05 Identities = 33/34 (97%) Strand = Plus / Minus Query: 619 tttgtgtggcagccagctccgttccagtcaccct 652 |||||||||||||||||||| ||||||||||||| Sbjct: 145 tttgtgtggcagccagctccattccagtcaccct 112
>emb|AL662953.3|OSJN00153 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0011F23, complete sequence Length = 149353 Score = 139 bits (70), Expect = 1e-29 Identities = 118/134 (88%) Strand = Plus / Plus Query: 468 atgctagctgtctcgtgtagccctgtcaacctccgctcgtttccttcaccatatgcggct 527 ||||||||||||||||||| ||||||||||||| || ||||||||||||||||| | Sbjct: 90273 atgctagctgtctcgtgtaaacctgtcaacctcctttcatttccttcaccatatgcactt 90332 Query: 528 atgtgcaagtcatggcgaagtgaaaggttcaggattgccttcttgatcacgtcgaaacct 587 || |||||||||||||||||||| ||||| |||||||||||||||||||| || || ||| Sbjct: 90333 atatgcaagtcatggcgaagtgataggtttaggattgccttcttgatcacctcaaatcct 90392 Query: 588 ccatcctcgcgcat 601 ||||| || ||||| Sbjct: 90393 ccatcttcacgcat 90406 Score = 103 bits (52), Expect = 8e-19 Identities = 115/136 (84%) Strand = Plus / Plus Query: 249 cttcataccttcagcgccagcttcttggcagcgagggcctccgcctcgagggtcggctcc 308 |||||||||||||| |||| |||||| ||||| || ||||||| |||||||| |||||| Sbjct: 89588 cttcataccttcagggccaacttcttagcagcaagaacctccgcttcgagggttggctcc 89647 Query: 309 cacaggatcgtggtctcggccagcagcgccgtcacggtgtacgggtccatgttggaggcc 368 || || || ||||| || |||| ||||| |||||| ||||||||||||||| || ||| Sbjct: 89648 caaagaattgtggtttcagccaatagcgctgtcacgacgtacgggtccatgtttgatgcc 89707 Query: 369 gggcgacggtcctcca 384 ||||||||||| |||| Sbjct: 89708 gggcgacggtcttcca 89723 Score = 93.7 bits (47), Expect = 7e-16 Identities = 59/63 (93%) Strand = Plus / Plus Query: 390 cctttgcccttcgcctcggtgtctcgccccacacgaatagagcagccacggttcgccaca 449 ||||| |||||||||||||||||||||||||| ||||||||||| |||||||| |||||| Sbjct: 90115 ccttttcccttcgcctcggtgtctcgccccacccgaatagagcatccacggtttgccaca 90174 Query: 450 ccc 452 ||| Sbjct: 90175 ccc 90177 Score = 46.1 bits (23), Expect = 0.16 Identities = 32/35 (91%) Strand = Plus / Plus Query: 619 tttgtgtggcagccagctccgttccagtcaccctg 653 ||||||||||| |||||||| |||||||| ||||| Sbjct: 93186 tttgtgtggcacccagctccattccagtctccctg 93220
>emb|AL606608.3|OSJN00056 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0015K02, complete sequence Length = 153623 Score = 139 bits (70), Expect = 1e-29 Identities = 118/134 (88%) Strand = Plus / Plus Query: 468 atgctagctgtctcgtgtagccctgtcaacctccgctcgtttccttcaccatatgcggct 527 ||||||||||||||||||| ||||||||||||| || ||||||||||||||||| | Sbjct: 9656 atgctagctgtctcgtgtaaacctgtcaacctcctttcatttccttcaccatatgcactt 9715 Query: 528 atgtgcaagtcatggcgaagtgaaaggttcaggattgccttcttgatcacgtcgaaacct 587 || |||||||||||||||||||| ||||| |||||||||||||||||||| || || ||| Sbjct: 9716 atatgcaagtcatggcgaagtgataggtttaggattgccttcttgatcacctcaaatcct 9775 Query: 588 ccatcctcgcgcat 601 ||||| || ||||| Sbjct: 9776 ccatcttcacgcat 9789 Score = 103 bits (52), Expect = 8e-19 Identities = 115/136 (84%) Strand = Plus / Plus Query: 249 cttcataccttcagcgccagcttcttggcagcgagggcctccgcctcgagggtcggctcc 308 |||||||||||||| |||| |||||| ||||| || ||||||| |||||||| |||||| Sbjct: 8971 cttcataccttcagggccaacttcttagcagcaagaacctccgcttcgagggttggctcc 9030 Query: 309 cacaggatcgtggtctcggccagcagcgccgtcacggtgtacgggtccatgttggaggcc 368 || || || ||||| || |||| ||||| |||||| ||||||||||||||| || ||| Sbjct: 9031 caaagaattgtggtttcagccaatagcgctgtcacgacgtacgggtccatgtttgatgcc 9090 Query: 369 gggcgacggtcctcca 384 ||||||||||| |||| Sbjct: 9091 gggcgacggtcttcca 9106 Score = 93.7 bits (47), Expect = 7e-16 Identities = 59/63 (93%) Strand = Plus / Plus Query: 390 cctttgcccttcgcctcggtgtctcgccccacacgaatagagcagccacggttcgccaca 449 ||||| |||||||||||||||||||||||||| ||||||||||| |||||||| |||||| Sbjct: 9498 ccttttcccttcgcctcggtgtctcgccccacccgaatagagcatccacggtttgccaca 9557 Query: 450 ccc 452 ||| Sbjct: 9558 ccc 9560 Score = 46.1 bits (23), Expect = 0.16 Identities = 32/35 (91%) Strand = Plus / Plus Query: 619 tttgtgtggcagccagctccgttccagtcaccctg 653 ||||||||||| |||||||| |||||||| ||||| Sbjct: 12569 tttgtgtggcacccagctccattccagtctccctg 12603
>gb|AF480497.1| Oryza sativa clone BAC 24K23, complete sequence Length = 181577 Score = 139 bits (70), Expect = 1e-29 Identities = 118/134 (88%) Strand = Plus / Plus Query: 468 atgctagctgtctcgtgtagccctgtcaacctccgctcgtttccttcaccatatgcggct 527 ||||||||||||||||||| ||||||||||||| || ||||||||||||||||| | Sbjct: 90373 atgctagctgtctcgtgtaaacctgtcaacctcctttcatttccttcaccatatgcactt 90432 Query: 528 atgtgcaagtcatggcgaagtgaaaggttcaggattgccttcttgatcacgtcgaaacct 587 || |||||||||||||||||||| ||||| |||||||||||||||||||| || || ||| Sbjct: 90433 atatgcaagtcatggcgaagtgataggtttaggattgccttcttgatcacctcaaatcct 90492 Query: 588 ccatcctcgcgcat 601 ||||| || ||||| Sbjct: 90493 ccatcttcacgcat 90506 Score = 103 bits (52), Expect = 8e-19 Identities = 115/136 (84%) Strand = Plus / Plus Query: 249 cttcataccttcagcgccagcttcttggcagcgagggcctccgcctcgagggtcggctcc 308 |||||||||||||| |||| |||||| ||||| || ||||||| |||||||| |||||| Sbjct: 89688 cttcataccttcagggccaacttcttagcagcaagaacctccgcttcgagggttggctcc 89747 Query: 309 cacaggatcgtggtctcggccagcagcgccgtcacggtgtacgggtccatgttggaggcc 368 || || || ||||| || |||| ||||| |||||| ||||||||||||||| || ||| Sbjct: 89748 caaagaattgtggtttcagccaatagcgctgtcacgacgtacgggtccatgtttgatgcc 89807 Query: 369 gggcgacggtcctcca 384 ||||||||||| |||| Sbjct: 89808 gggcgacggtcttcca 89823 Score = 93.7 bits (47), Expect = 7e-16 Identities = 59/63 (93%) Strand = Plus / Plus Query: 390 cctttgcccttcgcctcggtgtctcgccccacacgaatagagcagccacggttcgccaca 449 ||||| |||||||||||||||||||||||||| ||||||||||| |||||||| |||||| Sbjct: 90215 ccttttcccttcgcctcggtgtctcgccccacccgaatagagcatccacggtttgccaca 90274 Query: 450 ccc 452 ||| Sbjct: 90275 ccc 90277 Score = 46.1 bits (23), Expect = 0.16 Identities = 32/35 (91%) Strand = Plus / Plus Query: 619 tttgtgtggcagccagctccgttccagtcaccctg 653 ||||||||||| |||||||| |||||||| ||||| Sbjct: 93286 tttgtgtggcacccagctccattccagtctccctg 93320
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 139 bits (70), Expect = 1e-29 Identities = 118/134 (88%) Strand = Plus / Plus Query: 468 atgctagctgtctcgtgtagccctgtcaacctccgctcgtttccttcaccatatgcggct 527 ||||||||||||||||||| ||||||||||||| || ||||||||||||||||| | Sbjct: 33659213 atgctagctgtctcgtgtaaacctgtcaacctcctttcatttccttcaccatatgcactt 33659272 Query: 528 atgtgcaagtcatggcgaagtgaaaggttcaggattgccttcttgatcacgtcgaaacct 587 || |||||||||||||||||||| ||||| |||||||||||||||||||| || || ||| Sbjct: 33659273 atatgcaagtcatggcgaagtgataggtttaggattgccttcttgatcacctcaaatcct 33659332 Query: 588 ccatcctcgcgcat 601 ||||| || ||||| Sbjct: 33659333 ccatcttcacgcat 33659346 Score = 103 bits (52), Expect = 8e-19 Identities = 115/136 (84%) Strand = Plus / Plus Query: 249 cttcataccttcagcgccagcttcttggcagcgagggcctccgcctcgagggtcggctcc 308 |||||||||||||| |||| |||||| ||||| || ||||||| |||||||| |||||| Sbjct: 33658528 cttcataccttcagggccaacttcttagcagcaagaacctccgcttcgagggttggctcc 33658587 Query: 309 cacaggatcgtggtctcggccagcagcgccgtcacggtgtacgggtccatgttggaggcc 368 || || || ||||| || |||| ||||| |||||| ||||||||||||||| || ||| Sbjct: 33658588 caaagaattgtggtttcagccaatagcgctgtcacgacgtacgggtccatgtttgatgcc 33658647 Query: 369 gggcgacggtcctcca 384 ||||||||||| |||| Sbjct: 33658648 gggcgacggtcttcca 33658663 Score = 93.7 bits (47), Expect = 7e-16 Identities = 59/63 (93%) Strand = Plus / Plus Query: 390 cctttgcccttcgcctcggtgtctcgccccacacgaatagagcagccacggttcgccaca 449 ||||| |||||||||||||||||||||||||| ||||||||||| |||||||| |||||| Sbjct: 33659055 ccttttcccttcgcctcggtgtctcgccccacccgaatagagcatccacggtttgccaca 33659114 Query: 450 ccc 452 ||| Sbjct: 33659115 ccc 33659117 Score = 46.1 bits (23), Expect = 0.16 Identities = 32/35 (91%) Strand = Plus / Plus Query: 619 tttgtgtggcagccagctccgttccagtcaccctg 653 ||||||||||| |||||||| |||||||| ||||| Sbjct: 33662126 tttgtgtggcacccagctccattccagtctccctg 33662160
>ref|NM_001036892.1| Arabidopsis thaliana GS2 (GLUTAMINE SYNTHETASE 2); glutamate-ammonia ligase AT5G35630 (GS2) transcript variant AT5G35630.2 mRNA, complete cds Length = 1706 Score = 117 bits (59), Expect = 5e-23 Identities = 294/371 (79%), Gaps = 1/371 (0%) Strand = Plus / Minus Query: 282 agggcctccgcctcgagggtcggctcccacaggatcgtggtctcggccagcagcgccgtc 341 ||||| || ||||| || || ||||||||||||| |||||||| |||| || | ||| Sbjct: 1372 agggcttcagcctcaagagttggctcccacaggagtgtggtctctgccaaaagtgaggtc 1313 Query: 342 acggtgtacgggtccatgttggaggccgggcgacggtcctccaggtatcctttgcccttc 401 || |||| ||||||||||| || || || || || || || | ||| ||||| || ||| Sbjct: 1312 acaatgtatgggtccatgttagatgctggacggcgatcttctaagtaaccttttcctttc 1253 Query: 402 gcctcggtgtctcgccccacacgaatagagcagccacggttcgccacaccccatgagaag 461 ||||||||||| || ||||||||||||||||| |||||||| ||||| ||||||||||| Sbjct: 1252 gcctcggtgtcacgtcccacacgaatagagcatccacggttagccacgccccatgagaac 1193 Query: 462 tctgatatgctagctgtctcgtgtagccctgtcaacctccgctcgtttccttcaccatat 521 | || |||||||||||||| || |||||||| | ||||||||||||||| || Sbjct: 1192 tggtcaatactagctgtctcgtgctttccggtcaaccttctctcgtttccttcaccgtag 1133 Query: 522 gcggctatgtgcaagtcatggcgaagtgaaaggttcaggattgccttcttgatcacgtcg 581 || |||||| | |||||||| || ||||||| ||| |||||||||||||| || Sbjct: 1132 gcactgatgtgctccttgtggcgaagcgagaggttcaagatagccttcttgatcacttca 1073 Query: 582 aaacctccatcctcgcgcatgctcaatgtgctgtagttttgtgtggcagccagctccgtt 641 || ||||| ||||| | ||||||| || ||||| || |||||||| ||||| ||||| Sbjct: 1072 aatcctccttcctctctcatgctcttggtactgta-attggtgtggcaaccagcaccgtt 1014 Query: 642 ccagtcaccct 652 ||||||||||| Sbjct: 1013 ccagtcaccct 1003
>ref|NM_122954.2| Arabidopsis thaliana GS2 (GLUTAMINE SYNTHETASE 2); glutamate-ammonia ligase AT5G35630 (GS2) transcript variant AT5G35630.1 mRNA, complete cds Length = 1642 Score = 117 bits (59), Expect = 5e-23 Identities = 294/371 (79%), Gaps = 1/371 (0%) Strand = Plus / Minus Query: 282 agggcctccgcctcgagggtcggctcccacaggatcgtggtctcggccagcagcgccgtc 341 ||||| || ||||| || || ||||||||||||| |||||||| |||| || | ||| Sbjct: 1399 agggcttcagcctcaagagttggctcccacaggagtgtggtctctgccaaaagtgaggtc 1340 Query: 342 acggtgtacgggtccatgttggaggccgggcgacggtcctccaggtatcctttgcccttc 401 || |||| ||||||||||| || || || || || || || | ||| ||||| || ||| Sbjct: 1339 acaatgtatgggtccatgttagatgctggacggcgatcttctaagtaaccttttcctttc 1280 Query: 402 gcctcggtgtctcgccccacacgaatagagcagccacggttcgccacaccccatgagaag 461 ||||||||||| || ||||||||||||||||| |||||||| ||||| ||||||||||| Sbjct: 1279 gcctcggtgtcacgtcccacacgaatagagcatccacggttagccacgccccatgagaac 1220 Query: 462 tctgatatgctagctgtctcgtgtagccctgtcaacctccgctcgtttccttcaccatat 521 | || |||||||||||||| || |||||||| | ||||||||||||||| || Sbjct: 1219 tggtcaatactagctgtctcgtgctttccggtcaaccttctctcgtttccttcaccgtag 1160 Query: 522 gcggctatgtgcaagtcatggcgaagtgaaaggttcaggattgccttcttgatcacgtcg 581 || |||||| | |||||||| || ||||||| ||| |||||||||||||| || Sbjct: 1159 gcactgatgtgctccttgtggcgaagcgagaggttcaagatagccttcttgatcacttca 1100 Query: 582 aaacctccatcctcgcgcatgctcaatgtgctgtagttttgtgtggcagccagctccgtt 641 || ||||| ||||| | ||||||| || ||||| || |||||||| ||||| ||||| Sbjct: 1099 aatcctccttcctctctcatgctcttggtactgta-attggtgtggcaaccagcaccgtt 1041 Query: 642 ccagtcaccct 652 ||||||||||| Sbjct: 1040 ccagtcaccct 1030
>gb|AY122977.1| Arabidopsis thaliana putative glutamate-ammonia ligase precursor, chloroplast (At5g35630) mRNA, complete cds Length = 1324 Score = 117 bits (59), Expect = 5e-23 Identities = 294/371 (79%), Gaps = 1/371 (0%) Strand = Plus / Minus Query: 282 agggcctccgcctcgagggtcggctcccacaggatcgtggtctcggccagcagcgccgtc 341 ||||| || ||||| || || ||||||||||||| |||||||| |||| || | ||| Sbjct: 1262 agggcttcagcctcaagagttggctcccacaggagtgtggtctctgccaaaagtgaggtc 1203 Query: 342 acggtgtacgggtccatgttggaggccgggcgacggtcctccaggtatcctttgcccttc 401 || |||| ||||||||||| || || || || || || || | ||| ||||| || ||| Sbjct: 1202 acaatgtatgggtccatgttagatgctggacggcgatcttctaagtaaccttttcctttc 1143 Query: 402 gcctcggtgtctcgccccacacgaatagagcagccacggttcgccacaccccatgagaag 461 ||||||||||| || ||||||||||||||||| |||||||| ||||| ||||||||||| Sbjct: 1142 gcctcggtgtcacgtcccacacgaatagagcatccacggttagccacgccccatgagaac 1083 Query: 462 tctgatatgctagctgtctcgtgtagccctgtcaacctccgctcgtttccttcaccatat 521 | || |||||||||||||| || |||||||| | ||||||||||||||| || Sbjct: 1082 tggtcaatactagctgtctcgtgctttccggtcaaccttctctcgtttccttcaccgtag 1023 Query: 522 gcggctatgtgcaagtcatggcgaagtgaaaggttcaggattgccttcttgatcacgtcg 581 || |||||| | |||||||| || ||||||| ||| |||||||||||||| || Sbjct: 1022 gcactgatgtgctccttgtggcgaagcgagaggttcaagatagccttcttgatcacttca 963 Query: 582 aaacctccatcctcgcgcatgctcaatgtgctgtagttttgtgtggcagccagctccgtt 641 || ||||| ||||| | ||||||| || ||||| || |||||||| ||||| ||||| Sbjct: 962 aatcctccttcctctctcatgctcttggtactgta-attggtgtggcaaccagcaccgtt 904 Query: 642 ccagtcaccct 652 ||||||||||| Sbjct: 903 ccagtcaccct 893
>gb|AY091114.1| Arabidopsis thaliana putative glutamate-ammonia ligase precursor, chloroplast (At5g35630) mRNA, complete cds Length = 1580 Score = 117 bits (59), Expect = 5e-23 Identities = 294/371 (79%), Gaps = 1/371 (0%) Strand = Plus / Minus Query: 282 agggcctccgcctcgagggtcggctcccacaggatcgtggtctcggccagcagcgccgtc 341 ||||| || ||||| || || ||||||||||||| |||||||| |||| || | ||| Sbjct: 1368 agggcttcagcctcaagagttggctcccacaggagtgtggtctctgccaaaagtgaggtc 1309 Query: 342 acggtgtacgggtccatgttggaggccgggcgacggtcctccaggtatcctttgcccttc 401 || |||| ||||||||||| || || || || || || || | ||| ||||| || ||| Sbjct: 1308 acaatgtatgggtccatgttagatgctggacggcgatcttctaagtaaccttttcctttc 1249 Query: 402 gcctcggtgtctcgccccacacgaatagagcagccacggttcgccacaccccatgagaag 461 ||||||||||| || ||||||||||||||||| |||||||| ||||| ||||||||||| Sbjct: 1248 gcctcggtgtcacgtcccacacgaatagagcatccacggttagccacgccccatgagaac 1189 Query: 462 tctgatatgctagctgtctcgtgtagccctgtcaacctccgctcgtttccttcaccatat 521 | || |||||||||||||| || |||||||| | ||||||||||||||| || Sbjct: 1188 tggtcaatactagctgtctcgtgctttccggtcaaccttctctcgtttccttcaccgtag 1129 Query: 522 gcggctatgtgcaagtcatggcgaagtgaaaggttcaggattgccttcttgatcacgtcg 581 || |||||| | |||||||| || ||||||| ||| |||||||||||||| || Sbjct: 1128 gcactgatgtgctccttgtggcgaagcgagaggttcaagatagccttcttgatcacttca 1069 Query: 582 aaacctccatcctcgcgcatgctcaatgtgctgtagttttgtgtggcagccagctccgtt 641 || ||||| ||||| | ||||||| || ||||| || |||||||| ||||| ||||| Sbjct: 1068 aatcctccttcctctctcatgctcttggtactgta-attggtgtggcaaccagcaccgtt 1010 Query: 642 ccagtcaccct 652 ||||||||||| Sbjct: 1009 ccagtcaccct 999
>gb|AY081252.1| Arabidopsis thaliana glutamate-ammonia ligase, chloroplast (At5g35630) mRNA, complete cds Length = 1519 Score = 117 bits (59), Expect = 5e-23 Identities = 294/371 (79%), Gaps = 1/371 (0%) Strand = Plus / Minus Query: 282 agggcctccgcctcgagggtcggctcccacaggatcgtggtctcggccagcagcgccgtc 341 ||||| || ||||| || || ||||||||||||| |||||||| |||| || | ||| Sbjct: 1320 agggcttcagcctcaagagttggctcccacaggagtgtggtctctgccaaaagtgaggtc 1261 Query: 342 acggtgtacgggtccatgttggaggccgggcgacggtcctccaggtatcctttgcccttc 401 || |||| ||||||||||| || || || || || || || | ||| ||||| || ||| Sbjct: 1260 acaatgtatgggtccatgttagatgctggacggcgatcttctaagtaaccttttcctttc 1201 Query: 402 gcctcggtgtctcgccccacacgaatagagcagccacggttcgccacaccccatgagaag 461 ||||||||||| || ||||||||||||||||| |||||||| ||||| ||||||||||| Sbjct: 1200 gcctcggtgtcacgtcccacacgaatagagcatccacggttagccacgccccatgagaac 1141 Query: 462 tctgatatgctagctgtctcgtgtagccctgtcaacctccgctcgtttccttcaccatat 521 | || |||||||||||||| || |||||||| | ||||||||||||||| || Sbjct: 1140 tggtcaatactagctgtctcgtgctttccggtcaaccttctctcgtttccttcaccgtag 1081 Query: 522 gcggctatgtgcaagtcatggcgaagtgaaaggttcaggattgccttcttgatcacgtcg 581 || |||||| | |||||||| || ||||||| ||| |||||||||||||| || Sbjct: 1080 gcactgatgtgctccttgtggcgaagcgagaggttcaagatagccttcttgatcacttca 1021 Query: 582 aaacctccatcctcgcgcatgctcaatgtgctgtagttttgtgtggcagccagctccgtt 641 || ||||| ||||| | ||||||| || ||||| || |||||||| ||||| ||||| Sbjct: 1020 aatcctccttcctctctcatgctcttggtactgta-attggtgtggcaaccagcaccgtt 962 Query: 642 ccagtcaccct 652 ||||||||||| Sbjct: 961 ccagtcaccct 951
>gb|AF428319.1|AF428319 Arabidopsis thaliana AT5g35630/MJE4_9 mRNA, complete cds Length = 1570 Score = 117 bits (59), Expect = 5e-23 Identities = 294/371 (79%), Gaps = 1/371 (0%) Strand = Plus / Minus Query: 282 agggcctccgcctcgagggtcggctcccacaggatcgtggtctcggccagcagcgccgtc 341 ||||| || ||||| || || ||||||||||||| |||||||| |||| || | ||| Sbjct: 1366 agggcttcagcctcaagagttggctcccacaggagtgtggtctctgccaaaagtgaggtc 1307 Query: 342 acggtgtacgggtccatgttggaggccgggcgacggtcctccaggtatcctttgcccttc 401 || |||| ||||||||||| || || || || || || || | ||| ||||| || ||| Sbjct: 1306 acaatgtatgggtccatgttagatgctggacggcgatcttctaagtaaccttttcctttc 1247 Query: 402 gcctcggtgtctcgccccacacgaatagagcagccacggttcgccacaccccatgagaag 461 ||||||||||| || ||||||||||||||||| |||||||| ||||| ||||||||||| Sbjct: 1246 gcctcggtgtcacgtcccacacgaatagagcatccacggttagccacgccccatgagaac 1187 Query: 462 tctgatatgctagctgtctcgtgtagccctgtcaacctccgctcgtttccttcaccatat 521 | || |||||||||||||| || |||||||| | ||||||||||||||| || Sbjct: 1186 tggtcaatactagctgtctcgtgctttccggtcaaccttctctcgtttccttcaccgtag 1127 Query: 522 gcggctatgtgcaagtcatggcgaagtgaaaggttcaggattgccttcttgatcacgtcg 581 || |||||| | |||||||| || ||||||| ||| |||||||||||||| || Sbjct: 1126 gcactgatgtgctccttgtggcgaagcgagaggttcaagatagccttcttgatcacttca 1067 Query: 582 aaacctccatcctcgcgcatgctcaatgtgctgtagttttgtgtggcagccagctccgtt 641 || ||||| ||||| | ||||||| || ||||| || |||||||| ||||| ||||| Sbjct: 1066 aatcctccttcctctctcatgctcttggtactgta-attggtgtggcaaccagcaccgtt 1008 Query: 642 ccagtcaccct 652 ||||||||||| Sbjct: 1007 ccagtcaccct 997
>gb|AF428461.1|AF428461 Arabidopsis thaliana AT5g35630/MJE4_9 mRNA, complete cds Length = 1473 Score = 117 bits (59), Expect = 5e-23 Identities = 294/371 (79%), Gaps = 1/371 (0%) Strand = Plus / Minus Query: 282 agggcctccgcctcgagggtcggctcccacaggatcgtggtctcggccagcagcgccgtc 341 ||||| || ||||| || || ||||||||||||| |||||||| |||| || | ||| Sbjct: 1366 agggcttcagcctcaagagttggctcccacaggagtgtggtctctgccaaaagtgaggtc 1307 Query: 342 acggtgtacgggtccatgttggaggccgggcgacggtcctccaggtatcctttgcccttc 401 || |||| ||||||||||| || || || || || || || | ||| ||||| || ||| Sbjct: 1306 acaatgtatgggtccatgttagatgctggacggcgatcttctaagtaaccttttcctttc 1247 Query: 402 gcctcggtgtctcgccccacacgaatagagcagccacggttcgccacaccccatgagaag 461 ||||||||||| || ||||||||||||||||| |||||||| ||||| ||||||||||| Sbjct: 1246 gcctcggtgtcacgtcccacacgaatagagcatccacggttagccacgccccatgagaac 1187 Query: 462 tctgatatgctagctgtctcgtgtagccctgtcaacctccgctcgtttccttcaccatat 521 | || |||||||||||||| || |||||||| | ||||||||||||||| || Sbjct: 1186 tggtcaatactagctgtctcgtgctttccggtcaaccttctctcgtttccttcaccgtag 1127 Query: 522 gcggctatgtgcaagtcatggcgaagtgaaaggttcaggattgccttcttgatcacgtcg 581 || |||||| | |||||||| || ||||||| ||| |||||||||||||| || Sbjct: 1126 gcactgatgtgctccttgtggcgaagcgagaggttcaagatagccttcttgatcacttca 1067 Query: 582 aaacctccatcctcgcgcatgctcaatgtgctgtagttttgtgtggcagccagctccgtt 641 || ||||| ||||| | ||||||| || ||||| || |||||||| ||||| ||||| Sbjct: 1066 aatcctccttcctctctcatgctcttggtactgta-attggtgtggcaaccagcaccgtt 1008 Query: 642 ccagtcaccct 652 ||||||||||| Sbjct: 1007 ccagtcaccct 997
>dbj|AK220961.1| Arabidopsis thaliana mRNA for glutamate-ammonia ligase precursor, complete cds, clone: RAFL22-55-E01 Length = 765 Score = 117 bits (59), Expect = 5e-23 Identities = 294/371 (79%), Gaps = 1/371 (0%) Strand = Plus / Minus Query: 282 agggcctccgcctcgagggtcggctcccacaggatcgtggtctcggccagcagcgccgtc 341 ||||| || ||||| || || ||||||||||||| |||||||| |||| || | ||| Sbjct: 556 agggcttcagcctcaagagttggctcccacaggagtgtggtctctgccaaaagtgaggtc 497 Query: 342 acggtgtacgggtccatgttggaggccgggcgacggtcctccaggtatcctttgcccttc 401 || |||| ||||||||||| || || || || || || || | ||| ||||| || ||| Sbjct: 496 acaatgtatgggtccatgttagatgctggacggcgatcttctaagtaaccttttcctttc 437 Query: 402 gcctcggtgtctcgccccacacgaatagagcagccacggttcgccacaccccatgagaag 461 ||||||||||| || ||||||||||||||||| |||||||| ||||| ||||||||||| Sbjct: 436 gcctcggtgtcacgtcccacacgaatagagcatccacggttagccacgccccatgagaac 377 Query: 462 tctgatatgctagctgtctcgtgtagccctgtcaacctccgctcgtttccttcaccatat 521 | || |||||||||||||| || |||||||| | ||||||||||||||| || Sbjct: 376 tggtcaatactagctgtctcgtgctttccggtcaaccttctctcgtttccttcaccgtag 317 Query: 522 gcggctatgtgcaagtcatggcgaagtgaaaggttcaggattgccttcttgatcacgtcg 581 || |||||| | |||||||| || ||||||| ||| |||||||||||||| || Sbjct: 316 gcactgatgtgctccttgtggcgaagcgagaggttcaagatagccttcttgatcacttca 257 Query: 582 aaacctccatcctcgcgcatgctcaatgtgctgtagttttgtgtggcagccagctccgtt 641 || ||||| ||||| | ||||||| || ||||| || |||||||| ||||| ||||| Sbjct: 256 aatcctccttcctctctcatgctcttggtactgta-attggtgtggcaaccagcaccgtt 198 Query: 642 ccagtcaccct 652 ||||||||||| Sbjct: 197 ccagtcaccct 187
>gb|S69727.1| light-regulated glutamine synthetase isoenzyme [Arabidopsis thaliana, mRNA, 1548 nt] Length = 1548 Score = 117 bits (59), Expect = 5e-23 Identities = 294/371 (79%), Gaps = 1/371 (0%) Strand = Plus / Minus Query: 282 agggcctccgcctcgagggtcggctcccacaggatcgtggtctcggccagcagcgccgtc 341 ||||| || ||||| || || ||||||||||||| |||||||| |||| || | ||| Sbjct: 1333 agggcttcagcctcaagagttggctcccacaggagtgtggtctctgccaaaagtgaggtc 1274 Query: 342 acggtgtacgggtccatgttggaggccgggcgacggtcctccaggtatcctttgcccttc 401 || |||| ||||||||||| || || || || || || || | ||| ||||| || ||| Sbjct: 1273 acaatgtatgggtccatgttagatgctggacggcgatcttctaagtaaccttttcctttc 1214 Query: 402 gcctcggtgtctcgccccacacgaatagagcagccacggttcgccacaccccatgagaag 461 ||||||||||| || ||||||||||||||||| |||||||| ||||| ||||||||||| Sbjct: 1213 gcctcggtgtcacgtcccacacgaatagagcatccacggttagccacgccccatgagaac 1154 Query: 462 tctgatatgctagctgtctcgtgtagccctgtcaacctccgctcgtttccttcaccatat 521 | || |||||||||||||| || |||||||| | ||||||||||||||| || Sbjct: 1153 tggtcaatactagctgtctcgtgctttccggtcaaccttctctcgtttccttcaccgtag 1094 Query: 522 gcggctatgtgcaagtcatggcgaagtgaaaggttcaggattgccttcttgatcacgtcg 581 || |||||| | |||||||| || ||||||| ||| |||||||||||||| || Sbjct: 1093 gcactgatgtgctccttgtggcgaagcgagaggttcaagatagccttcttgatcacttca 1034 Query: 582 aaacctccatcctcgcgcatgctcaatgtgctgtagttttgtgtggcagccagctccgtt 641 || ||||| ||||| | ||||||| || ||||| || |||||||| ||||| ||||| Sbjct: 1033 aatcctccttcctctctcatgctcttggtactgta-attggtgtggcaaccagcaccgtt 975 Query: 642 ccagtcaccct 652 ||||||||||| Sbjct: 974 ccagtcaccct 964
>emb|BX833085.1|CNS0A1TO Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL33ZE08 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 771 Score = 117 bits (59), Expect = 5e-23 Identities = 295/371 (79%), Gaps = 2/371 (0%) Strand = Plus / Minus Query: 282 agggcctccgcctcgagggtcggctcccacaggatcgtggtctcggccagcagcgccgtc 341 ||||| || ||||| || || ||||||||||||| |||||||| |||| || | ||| Sbjct: 559 agggcttcagcctcaagagttggctcccacaggagtgtggtctctgccaaaagtgaggtc 500 Query: 342 acggtgtacgggtccatgttggaggccgggcgacggtcctccaggtatcctttgcccttc 401 || |||| ||||||||||| || || || || || || || | ||| ||||| || ||| Sbjct: 499 acaatgtatgggtccatgttagatgctggacggcgatcttctaagtaaccttttcctttc 440 Query: 402 gcctcggtgtctcgccccacacgaatagagcagccacggttcgccacaccccatgagaag 461 ||||||||||| || ||||||||||||||||| |||||||| ||||| ||||||||||| Sbjct: 439 gcctcggtgtcacgtcccacacgaatagagcatccacggttagccacgccccatgagaac 380 Query: 462 tctgatatgctagctgtctcgtgtagccctgtcaacctccgctcgtttccttcaccatat 521 | || |||||||||||||| || |||||||| | ||||||||||||||| || Sbjct: 379 tggtcaatactagctgtctcgtgctttccggtcaaccttctctcgtttccttcaccgta- 321 Query: 522 gcggctatgtgcaagtcatggcgaagtgaaaggttcaggattgccttcttgatcacgtcg 581 || ||||||| | |||||||| || ||||||| ||| |||||||||||||| || Sbjct: 320 gcacttatgtgctccttgtggcgaagcgagaggttcaagatagccttcttgatcacttca 261 Query: 582 aaacctccatcctcgcgcatgctcaatgtgctgtagttttgtgtggcagccagctccgtt 641 || ||||| ||||| | ||||||| || ||||| || |||||||| ||||| ||||| Sbjct: 260 aatcctccttcctctctcatgctcttggtactgta-attggtgtggcaaccagcaccgtt 202 Query: 642 ccagtcaccct 652 ||||||||||| Sbjct: 201 ccagtcaccct 191
>gb|AY088222.1| Arabidopsis thaliana clone 4372 mRNA, complete sequence Length = 1598 Score = 117 bits (59), Expect = 5e-23 Identities = 294/371 (79%), Gaps = 1/371 (0%) Strand = Plus / Minus Query: 282 agggcctccgcctcgagggtcggctcccacaggatcgtggtctcggccagcagcgccgtc 341 ||||| || ||||| || || ||||||||||||| |||||||| |||| || | ||| Sbjct: 1399 agggcttcagcctcaagagttggctcccacaggagtgtggtctctgccaaaagtgaggtc 1340 Query: 342 acggtgtacgggtccatgttggaggccgggcgacggtcctccaggtatcctttgcccttc 401 || |||| ||||||||||| || || || || || || || | ||| ||||| || ||| Sbjct: 1339 acaatgtatgggtccatgttagatgctggacggcgatcttctaagtaaccttttcctttc 1280 Query: 402 gcctcggtgtctcgccccacacgaatagagcagccacggttcgccacaccccatgagaag 461 ||||||||||| || ||||||||||||||||| |||||||| ||||| ||||||||||| Sbjct: 1279 gcctcggtgtcacgtcccacacgaatagagcatccacggttagccacgccccatgagaac 1220 Query: 462 tctgatatgctagctgtctcgtgtagccctgtcaacctccgctcgtttccttcaccatat 521 | || |||||||||||||| || |||||||| | ||||||||||||||| || Sbjct: 1219 tggtcaatactagctgtctcgtgctttccggtcaaccttctctcgtttccttcaccgtag 1160 Query: 522 gcggctatgtgcaagtcatggcgaagtgaaaggttcaggattgccttcttgatcacgtcg 581 || |||||| | |||||||| || ||||||| ||| |||||||||||||| || Sbjct: 1159 gcactgatgtgctccttgtggcgaagcgagaggttcaagatagccttcttgatcacttca 1100 Query: 582 aaacctccatcctcgcgcatgctcaatgtgctgtagttttgtgtggcagccagctccgtt 641 || ||||| ||||| | ||||||| || ||||| || |||||||| ||||| ||||| Sbjct: 1099 aatcctccttcctctctcatgctcttggtactgta-attggtgtggcaaccagcaccgtt 1041 Query: 642 ccagtcaccct 652 ||||||||||| Sbjct: 1040 ccagtcaccct 1030
>gb|AF124244.2| Medicago sativa glutamine synthetase precursor (gln) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1595 Score = 81.8 bits (41), Expect = 3e-12 Identities = 270/341 (79%), Gaps = 4/341 (1%) Strand = Plus / Minus Query: 354 tccatgttggaggccgggcgacggtcctccaggtatcctttgcccttcgcctcggtgtct 413 |||||||| || ||||| || | ||| |||| ||| |||||||| ||| |||||||||| Sbjct: 1271 tccatgtttgaagccggacgcctgtcttccaagtaacctttgccattcttctcggtgtct 1212 Query: 414 cgccccacacgaatagagcagccacggttcgccacaccccatgagaagtctgat-atgct 472 | |||||||| || ||||| |||||||| ||||| ||||| || || | || | ||||| Sbjct: 1211 cttcccacacggattgagcatccacggttagccactccccaagaaaa-tgtgttgatgct 1153 Query: 473 agctgtctcgtgtagccctgtcaacctccgctcgtttccttcaccatatgcggctatgtg 532 || ||||| || ||||||||||| | ||| |||||||| |||||||| | ||||| Sbjct: 1152 ggcagtctcatgctttcctgtcaaccttctctcatttccttctccatatgcttcaatgtg 1093 Query: 533 caagtcatggcgaagtgaaaggttcaggattgccttcttgatcacgtcgaaacctccatc 592 | | |||||||| |||||||||| ||||||||||| || || || || |||||||| Sbjct: 1092 aaccttgtggcgaagggaaaggttcaaaattgccttctttattacctcaaatcctccatc 1033 Query: 593 ctcgcgcatgctcaatgtgctgtagttttgtgtggcagccagctccgttccagtcaccct 652 || | ||||||| ||| ||||| || ||||| || || || || ||||| ||||||| Sbjct: 1032 ttccctcatgctctttgtactgtaattg-gtgtgacatcctgcaccattccaatcaccct 974 Query: 653 ggattggtttttgggtcaagggtgagcaccacaccagcttg 693 ||||||||| || |||||||||||||| ||||||||||| Sbjct: 973 caattggtttt-ggatcaagggtgagcacaacaccagcttg 934
>emb|X05514.1|PSGSR2 Pea leaf mRNA for glutamine synthetase (EC 6.3.1.2) Length = 1304 Score = 79.8 bits (40), Expect = 1e-11 Identities = 267/340 (78%), Gaps = 2/340 (0%) Strand = Plus / Minus Query: 354 tccatgttggaggccgggcgacggtcctccaggtatcctttgcccttcgcctcggtgtct 413 |||||||| || ||||| || | ||| |||| ||| |||||||| ||| |||||||||| Sbjct: 1021 tccatgttcgaagccggacgcctgtcttccaagtaacctttgccattcttctcggtgtct 962 Query: 414 cgccccacacgaatagagcagccacggttcgccacaccccatgagaagtctgatatgcta 473 | |||||||| || ||||| || ||||| ||||| ||||| || ||||| ||||| Sbjct: 961 cttcccacacggattgagcatccccggttagccactccccaagaaaagtcgttaatgctg 902 Query: 474 gctgtctcgtgtagccctgtcaacctccgctcgtttccttcaccatatgcggctatgtgc 533 |||||||| || ||||||||||| | ||||||||||| || ||||| | ||||| Sbjct: 901 gctgtctcatgctttcctgtcaaccttctttcgtttccttctccgtatgcttcaatgtgg 842 Query: 534 aagtcatggcgaagtgaaaggttcaggattgccttcttgatcacgtcgaaacctccatcc 593 | | |||||||| |||||||||| || |||||||| ||||| || || |||||||| Sbjct: 841 atcttgtggcgaagggaaaggttcaaaatggccttctttatcacctcaaaccctccatct 782 Query: 594 tcgcgcatgctcaatgtgctgtagttttgtgtggcagccagctccgttccagtcaccctg 653 || | ||||||| ||| ||||| || ||||| || || || || ||||| ||||||| Sbjct: 781 tccctcatgctctttgtactgtaattg-gtgtgacatcctgcaccattccaatcaccctc 723 Query: 654 gattggtttttgggtcaagggtgagcaccacaccagcttg 693 ||||||||| || ||||| |||||||| ||||||||||| Sbjct: 722 tattggtttt-ggatcaagagtgagcacaacaccagcttg 684
>gb|M20664.1|PEACHGS2A Pisum sativum glutamine synthetase (chloroplast GS2) mRNA, complete cds Length = 1540 Score = 79.8 bits (40), Expect = 1e-11 Identities = 267/340 (78%), Gaps = 2/340 (0%) Strand = Plus / Minus Query: 354 tccatgttggaggccgggcgacggtcctccaggtatcctttgcccttcgcctcggtgtct 413 |||||||| || ||||| || | ||| |||| ||| |||||||| ||| |||||||||| Sbjct: 1257 tccatgttcgaagccggacgcctgtcttccaagtaacctttgccattcttctcggtgtct 1198 Query: 414 cgccccacacgaatagagcagccacggttcgccacaccccatgagaagtctgatatgcta 473 | |||||||| || ||||| || ||||| ||||| ||||| || ||||| ||||| Sbjct: 1197 cttcccacacggattgagcatccccggttagccactccccaagaaaagtcgttaatgctg 1138 Query: 474 gctgtctcgtgtagccctgtcaacctccgctcgtttccttcaccatatgcggctatgtgc 533 |||||||| || ||||||||||| | ||||||||||| || ||||| | ||||| Sbjct: 1137 gctgtctcatgctttcctgtcaaccttctttcgtttccttctccgtatgcttcaatgtgg 1078 Query: 534 aagtcatggcgaagtgaaaggttcaggattgccttcttgatcacgtcgaaacctccatcc 593 | | |||||||| |||||||||| || |||||||| ||||| || || |||||||| Sbjct: 1077 atcttgtggcgaagggaaaggttcaaaatggccttctttatcacctcaaaccctccatct 1018 Query: 594 tcgcgcatgctcaatgtgctgtagttttgtgtggcagccagctccgttccagtcaccctg 653 || | ||||||| ||| ||||| || ||||| || || || || ||||| ||||||| Sbjct: 1017 tccctcatgctctttgtactgtaattg-gtgtgacatcctgcaccattccaatcaccctc 959 Query: 654 gattggtttttgggtcaagggtgagcaccacaccagcttg 693 ||||||||| || ||||| |||||||| ||||||||||| Sbjct: 958 tattggtttt-ggatcaagagtgagcacaacaccagcttg 920
>dbj|AK063706.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-119-H04, full insert sequence Length = 1425 Score = 73.8 bits (37), Expect = 7e-10 Identities = 68/77 (88%), Gaps = 1/77 (1%) Strand = Plus / Minus Query: 619 tttgtgtggcagccagctccgttccagtcaccctggattggtttttgggtcaagggtgag 678 ||||||||||| |||||||| |||||||| ||||| ||||| ||| ||||||||||| || Sbjct: 1001 tttgtgtggcacccagctccattccagtctccctgaattgg-tttggggtcaagggtaag 943 Query: 679 caccacaccagcttgct 695 ||| |||||||| |||| Sbjct: 942 cactacaccagcctgct 926
>gb|AY773090.1| Cucumis melo glutamine synthetase mRNA, complete cds Length = 1807 Score = 71.9 bits (36), Expect = 3e-09 Identities = 103/124 (83%), Gaps = 1/124 (0%) Strand = Plus / Minus Query: 540 tggcgaagtgaaaggttcaggattgccttcttgatcacgtcgaaacctccatcctcgcgc 599 |||||||| || || ||||| |||||||||||||| || || || ||||| ||||| | | Sbjct: 1180 tggcgaagagacagattcagaattgccttcttgatgacttcaaagcctccttcctctctc 1121 Query: 600 atgctcaatgtgctgtagttttgtgtggcagccagctccgttccagtcaccctggattgg 659 |||||| ||| ||||| || |||||||| |||||||| ||||||||||||| ||||| Sbjct: 1120 atgctctttgtactgtaattg-gtgtggcatccagctccattccagtcaccctcaattgg 1062 Query: 660 tttt 663 |||| Sbjct: 1061 tttt 1058 Score = 48.1 bits (24), Expect = 0.040 Identities = 84/104 (80%) Strand = Plus / Minus Query: 351 gggtccatgttggaggccgggcgacggtcctccaggtatcctttgcccttcgcctcggtg 410 ||||||||||| || ||||| || ||||| |||| || |||||||| | | ||| ||| Sbjct: 1369 gggtccatgtttgaagccggacgtcggtcttccaaataacctttgccttgcttctcagtg 1310 Query: 411 tctcgccccacacgaatagagcagccacggttcgccacacccca 454 || || |||||||| || || ||||||||||| ||||| ||||| Sbjct: 1309 tcacgtcccacacggattgaacagccacggttagccactcccca 1266
>gb|AY162465.1| Crataegus crus-galli putative plastidic glutamine synthetase (GS2) mRNA, complete cds; nuclear gene for chloroplast product Length = 1640 Score = 71.9 bits (36), Expect = 3e-09 Identities = 128/156 (82%), Gaps = 2/156 (1%) Strand = Plus / Minus Query: 538 catggcgaagtgaaaggttcaggattgccttcttgatcacgtcgaaacctccatcctcgc 597 ||||||||||||| ||||||| ||||||||||| || || || || |||||||| || | Sbjct: 1096 catggcgaagtgacaggttcaaaattgccttcttaataacttcaaagcctccatcttccc 1037 Query: 598 gcatgctcaatgtgctgtagttttgtgtggcagccagctccgttccagtcaccctggatt 657 ||||||| ||| ||||| || |||||||| || || |||||||||||||||| || Sbjct: 1036 tcatgctctttgtactgta-attggtgtggcaccctgcaccgttccagtcaccctctatc 978 Query: 658 ggtttttgggtcaagggtgagcaccacaccagcttg 693 || |||||| ||||| ||||| || ||||||||||| Sbjct: 977 gg-ttttggatcaagtgtgagaacaacaccagcttg 943 Score = 40.1 bits (20), Expect = 9.6 Identities = 56/68 (82%) Strand = Plus / Minus Query: 327 gccagcagcgccgtcacggtgtacgggtccatgttggaggccgggcgacggtcctccagg 386 |||||||||| ||||| |||| ||||||||||| || || || ||||| |||||||| Sbjct: 1307 gccagcagcgaggtcacaatgtaagggtccatgtttgaagctggacgacgatcctccaga 1248 Query: 387 tatccttt 394 || ||||| Sbjct: 1247 taaccttt 1240
>gb|AF005223.1|AF005223 Helianthus annuus chloroplastic glutamine synthetase (ggs2) gene, ggs2a allele, mRNA, nuclear gene encoding chloroplast protein, partial cds Length = 718 Score = 71.9 bits (36), Expect = 3e-09 Identities = 159/200 (79%) Strand = Plus / Minus Query: 258 ttcagcgccagcttcttggcagcgagggcctccgcctcgagggtcggctcccacaggatc 317 |||| ||||| ||||| ||||||||||| || |||||||| || |||||||||||||| Sbjct: 518 ttcaacgccaacttctgagcagcgagggcttcagcctcgagtgtaggctcccacaggatg 459 Query: 318 gtggtctcggccagcagcgccgtcacggtgtacgggtccatgttggaggccgggcgacgg 377 ||||| || || || | | ||||| || |||||||||||||| || ||||| || | | Sbjct: 458 gtggtttccgcaagtaatcctgtcactgtatacgggtccatgtttgatgccggacgcctg 399 Query: 378 tcctccaggtatcctttgcccttcgcctcggtgtctcgccccacacgaatagagcagcca 437 || |||| ||| |||||||| ||| ||||| ||||||||||| || ||||||||| Sbjct: 398 tcttccaagtaacctttgcctgctttctcagtgtcacgccccacacggattgagcagcca 339 Query: 438 cggttcgccacaccccatga 457 || || || || |||||||| Sbjct: 338 cgattagctactccccatga 319
>dbj|AB013393.2| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MJE4 Length = 63989 Score = 69.9 bits (35), Expect = 1e-08 Identities = 53/59 (89%) Strand = Plus / Minus Query: 390 cctttgcccttcgcctcggtgtctcgccccacacgaatagagcagccacggttcgccac 448 ||||| || |||||||||||||| || ||||||||||||||||| |||||||| ||||| Sbjct: 42912 ccttttcctttcgcctcggtgtcacgtcccacacgaatagagcatccacggttagccac 42854 Score = 65.9 bits (33), Expect = 2e-07 Identities = 94/113 (83%), Gaps = 1/113 (0%) Strand = Plus / Minus Query: 540 tggcgaagtgaaaggttcaggattgccttcttgatcacgtcgaaacctccatcctcgcgc 599 |||||||| || ||||||| ||| |||||||||||||| || || ||||| ||||| | | Sbjct: 42676 tggcgaagcgagaggttcaagatagccttcttgatcacttcaaatcctccttcctctctc 42617 Query: 600 atgctcaatgtgctgtagttttgtgtggcagccagctccgttccagtcaccct 652 |||||| || ||||| || |||||||| ||||| |||||||||||||||| Sbjct: 42616 atgctcttggtactgta-attggtgtggcaaccagcaccgttccagtcaccct 42565
>dbj|AB015045.1| Arabidopsis thaliana gene for Glutamine Synthetase, complete cds Length = 7498 Score = 69.9 bits (35), Expect = 1e-08 Identities = 53/59 (89%) Strand = Plus / Minus Query: 390 cctttgcccttcgcctcggtgtctcgccccacacgaatagagcagccacggttcgccac 448 ||||| || |||||||||||||| || ||||||||||||||||| |||||||| ||||| Sbjct: 3591 ccttttcctttcgcctcggtgtcacgtcccacacgaatagagcatccacggttagccac 3533 Score = 65.9 bits (33), Expect = 2e-07 Identities = 94/113 (83%), Gaps = 1/113 (0%) Strand = Plus / Minus Query: 540 tggcgaagtgaaaggttcaggattgccttcttgatcacgtcgaaacctccatcctcgcgc 599 |||||||| || ||||||| ||| |||||||||||||| || || ||||| ||||| | | Sbjct: 3355 tggcgaagcgagaggttcaagatagccttcttgatcacttcaaatcctccttcctctctc 3296 Query: 600 atgctcaatgtgctgtagttttgtgtggcagccagctccgttccagtcaccct 652 |||||| || ||||| || |||||||| ||||| |||||||||||||||| Sbjct: 3295 atgctcttggtactgta-attggtgtggcaaccagcaccgttccagtcaccct 3244
>emb|X72751.1|BNGLUS B.napus mRNA for plastidic glutamine synthetase isoform (BnGSR1-1) related to the A-genome type of Brassica campestris Length = 1575 Score = 67.9 bits (34), Expect = 4e-08 Identities = 136/170 (80%) Strand = Plus / Minus Query: 291 gcctcgagggtcggctcccacaggatcgtggtctcggccagcagcgccgtcacggtgtac 350 ||||| ||||| |||||||| || | |||||||| |||| ||| | ||||| |||| Sbjct: 1341 gcctcaagggttggctcccagagaagtgtggtctctgccaacagtgaagtcacaatgtat 1282 Query: 351 gggtccatgttggaggccgggcgacggtcctccaggtatcctttgcccttcgcctcggtg 410 ||||||||||| || || || || || || |||| ||| ||||| || ||| |||||| Sbjct: 1281 gggtccatgttagacgctggacgccgatcttccaagtaaccttttcctttcttctcggta 1222 Query: 411 tctcgccccacacgaatagagcagccacggttcgccacaccccatgagaa 460 || || ||||||||||| ||||| |||||||| ||||| ||||||||||| Sbjct: 1221 tcacgtcccacacgaattgagcatccacggttagccactccccatgagaa 1172 Score = 60.0 bits (30), Expect = 1e-05 Identities = 91/110 (82%), Gaps = 1/110 (0%) Strand = Plus / Minus Query: 543 cgaagtgaaaggttcaggattgccttcttgatcacgtcgaaacctccatcctcgcgcatg 602 ||||| || ||||||| ||||||||| || ||||| || || ||||| ||||| | |||| Sbjct: 1089 cgaagcgagaggttcaagattgcctttttaatcacctcaaatcctccgtcctctctcatg 1030 Query: 603 ctcaatgtgctgtagttttgtgtggcagccagctccgttccagtcaccct 652 ||| ||||||||| || || ||||| ||||| |||||||||||||||| Sbjct: 1029 ctctttgtgctgtaattg-gtatggcaaccagcaccgttccagtcaccct 981
>emb|Y12458.1|BNGSL2 Brassica napus mRNA for plastidic glutamine synthetase isoform (BnGSL2) Length = 1597 Score = 67.9 bits (34), Expect = 4e-08 Identities = 136/170 (80%) Strand = Plus / Minus Query: 291 gcctcgagggtcggctcccacaggatcgtggtctcggccagcagcgccgtcacggtgtac 350 ||||| |||||||||||||| || | |||||||| |||| || | ||||| |||| Sbjct: 1343 gcctcaagggtcggctcccagagaagtgtggtctctgccaagagtgaagtcacaatgtat 1284 Query: 351 gggtccatgttggaggccgggcgacggtcctccaggtatcctttgcccttcgcctcggtg 410 ||||||||||| || || || || || || |||| ||| ||||| || ||| |||||| Sbjct: 1283 gggtccatgtttgatgctggacgtcgatcttccaagtaaccttttcctttcttctcggta 1224 Query: 411 tctcgccccacacgaatagagcagccacggttcgccacaccccatgagaa 460 || || ||||||||||| ||||| |||||||| ||||| ||||||||||| Sbjct: 1223 tcacgtcccacacgaattgagcatccacggttagccacgccccatgagaa 1174 Score = 40.1 bits (20), Expect = 9.6 Identities = 26/28 (92%) Strand = Plus / Minus Query: 625 tggcagccagctccgttccagtcaccct 652 ||||| ||||| |||||||||||||||| Sbjct: 1010 tggcaaccagcaccgttccagtcaccct 983
>emb|AJ271909.1|BNA271909 Brassica napus gln gene for plastid glutamine synthetase, exons 1-12 Length = 5232 Score = 65.9 bits (33), Expect = 2e-07 Identities = 94/113 (83%), Gaps = 1/113 (0%) Strand = Plus / Minus Query: 540 tggcgaagtgaaaggttcaggattgccttcttgatcacgtcgaaacctccatcctcgcgc 599 |||||||| || ||||||| ||||||||| || ||||| || || ||||| ||||| | | Sbjct: 3793 tggcgaagcgagaggttcaagattgcctttttaatcacctcaaatcctccgtcctctctc 3734 Query: 600 atgctcaatgtgctgtagttttgtgtggcagccagctccgttccagtcaccct 652 |||||| ||||||||| || || ||||| ||||| |||||||||||||||| Sbjct: 3733 atgctctttgtgctgtaattg-gtatggcaaccagcaccgttccagtcaccct 3682 Score = 42.1 bits (21), Expect = 2.4 Identities = 39/45 (86%) Strand = Plus / Minus Query: 404 ctcggtgtctcgccccacacgaatagagcagccacggttcgccac 448 |||||| || || ||||||||||| ||||| |||||||| ||||| Sbjct: 4008 ctcggtatcacgtcccacacgaattgagcatccacggttagccac 3964
>gb|AY225150.1| Medicago truncatula glutamine synthetase (GS2) mRNA, complete cds; nuclear gene for plastid product Length = 1552 Score = 65.9 bits (33), Expect = 2e-07 Identities = 164/205 (80%), Gaps = 2/205 (0%) Strand = Plus / Minus Query: 489 cctgtcaacctccgctcgtttccttcaccatatgcggctatgtgcaagtcatggcgaagt 548 ||||||||||| | ||| |||||||| |||||||| | ||||| | | |||||||| Sbjct: 1089 cctgtcaaccttctctcatttccttctccatatgcttcaatgtggatcttgtggcgaagg 1030 Query: 549 gaaaggttcaggattgccttcttgatcacgtcgaaacctccatcctcgcgcatgctcaat 608 |||||||||| || |||||||| || || || || |||||||| || | ||||||| | Sbjct: 1029 gaaaggttcaaaatagccttctttattacctcaaatcctccatcttccctcatgctcttt 970 Query: 609 gtgctgtagttttgtgtggcagccagctccgttccagtcaccctggattggtttttgggt 668 || ||||| || ||||| || || || || ||||| ||||||| ||||||||| || | Sbjct: 969 gtactgtaattg-gtgtgacatcctgcaccattccaatcaccctcaattggtttt-ggat 912 Query: 669 caagggtgagcaccacaccagcttg 693 ||||||||||||| ||||||||||| Sbjct: 911 caagggtgagcacaacaccagcttg 887
>gb|AY920930.1| Glycine max clone pGNGS7-3 chloroplast glutamine synthetase (GS) mRNA, partial cds; nuclear gene for chloroplast product Length = 843 Score = 63.9 bits (32), Expect = 7e-07 Identities = 127/156 (81%), Gaps = 2/156 (1%) Strand = Plus / Minus Query: 540 tggcgaagtgaaaggttcaggattgccttcttgatcacgtcgaaacctccatcctcgcgc 599 |||||||| || || |||| ||||||||||| || || || || |||||||| || | | Sbjct: 662 tggcgaagcgatagattcaatattgccttctttattacctcaaagcctccatcttccctc 603 Query: 600 atgctcaatgtgctgtagttttgtgtggcagccagctccgttccagtcaccctggattgg 659 |||||| ||| ||||| || |||||||| || ||||| ||||||||||||| ||||| Sbjct: 602 atgctctttgtactgtaattg-gtgtggcatcctgctccattccagtcaccctctattgg 544 Query: 660 tttttgggtcaagggtgagcaccacaccagcttgct 695 |||||| ||||| | |||||| ||||||||||||| Sbjct: 543 -ttttggatcaagagagagcacaacaccagcttgct 509
>gb|AF019561.1|AF019561 Daucus carota clone CGS201 glutamine synthetase (GS2) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1537 Score = 63.9 bits (32), Expect = 7e-07 Identities = 127/156 (81%), Gaps = 2/156 (1%) Strand = Plus / Minus Query: 540 tggcgaagtgaaaggttcaggattgccttcttgatcacgtcgaaacctccatcctcgcgc 599 ||||||||||||||||| | |||||| ||||| || || || || ||||| ||||| | | Sbjct: 1026 tggcgaagtgaaaggtttaagattgctttcttaattacttcaaagcctccctcctctctc 967 Query: 600 atgctcaatgtgctgtagttttgtgtggcagccagctccgttccagtcaccctggattgg 659 || || ||| |||||||| ||||||||||| ||||| ||||||||||| | ||||| Sbjct: 966 atactttttgtactgtagttg-gtgtggcagcctgctccattccagtcaccatcaattgg 908 Query: 660 tttttgggtcaagggtgagcaccacaccagcttgct 695 ||| |||||||| ||||| || || |||||||||| Sbjct: 907 -tttcgggtcaagtgtgagaacgaccccagcttgct 873 Score = 46.1 bits (23), Expect = 0.16 Identities = 74/91 (81%) Strand = Plus / Minus Query: 351 gggtccatgttggaggccgggcgacggtcctccaggtatcctttgcccttcgcctcggtg 410 ||||||||||| || || ||||| || ||||||| ||| |||||||| | | ||| || Sbjct: 1215 gggtccatgtttgaagcagggcgccgatcctccaagtaacctttgccttccttctcagta 1156 Query: 411 tctcgccccacacgaatagagcagccacggt 441 || ||||||||||| || ||||| ||||||| Sbjct: 1155 tcacgccccacacggattgagcaaccacggt 1125
>gb|DQ427814.1| Sorghum propinquum locus HHU39 genomic sequence Length = 816 Score = 61.9 bits (31), Expect = 3e-06 Identities = 34/35 (97%) Strand = Plus / Minus Query: 619 tttgtgtggcagccagctccgttccagtcaccctg 653 |||||||||||||||||||| |||||||||||||| Sbjct: 506 tttgtgtggcagccagctccattccagtcaccctg 472
>gb|DQ427813.1| Sorghum bicolor voucher PI585454 locus HHU39 genomic sequence Length = 837 Score = 61.9 bits (31), Expect = 3e-06 Identities = 34/35 (97%) Strand = Plus / Minus Query: 619 tttgtgtggcagccagctccgttccagtcaccctg 653 |||||||||||||||||||| |||||||||||||| Sbjct: 527 tttgtgtggcagccagctccattccagtcaccctg 493
>gb|DQ427812.1| Sorghum bicolor voucher PI267539 locus HHU39 genomic sequence Length = 837 Score = 61.9 bits (31), Expect = 3e-06 Identities = 34/35 (97%) Strand = Plus / Minus Query: 619 tttgtgtggcagccagctccgttccagtcaccctg 653 |||||||||||||||||||| |||||||||||||| Sbjct: 527 tttgtgtggcagccagctccattccagtcaccctg 493
>gb|DQ427811.1| Sorghum bicolor voucher PI267408 locus HHU39 genomic sequence Length = 826 Score = 61.9 bits (31), Expect = 3e-06 Identities = 34/35 (97%) Strand = Plus / Minus Query: 619 tttgtgtggcagccagctccgttccagtcaccctg 653 |||||||||||||||||||| |||||||||||||| Sbjct: 516 tttgtgtggcagccagctccattccagtcaccctg 482
>gb|DQ427810.1| Sorghum bicolor voucher PI221607 locus HHU39 genomic sequence Length = 837 Score = 61.9 bits (31), Expect = 3e-06 Identities = 34/35 (97%) Strand = Plus / Minus Query: 619 tttgtgtggcagccagctccgttccagtcaccctg 653 |||||||||||||||||||| |||||||||||||| Sbjct: 527 tttgtgtggcagccagctccattccagtcaccctg 493
>gb|DQ427809.1| Sorghum bicolor voucher PI152702 locus HHU39 genomic sequence Length = 837 Score = 61.9 bits (31), Expect = 3e-06 Identities = 34/35 (97%) Strand = Plus / Minus Query: 619 tttgtgtggcagccagctccgttccagtcaccctg 653 |||||||||||||||||||| |||||||||||||| Sbjct: 527 tttgtgtggcagccagctccattccagtcaccctg 493
>gb|DQ427808.1| Sorghum bicolor voucher NSL92371 locus HHU39 genomic sequence Length = 837 Score = 61.9 bits (31), Expect = 3e-06 Identities = 34/35 (97%) Strand = Plus / Minus Query: 619 tttgtgtggcagccagctccgttccagtcaccctg 653 |||||||||||||||||||| |||||||||||||| Sbjct: 527 tttgtgtggcagccagctccattccagtcaccctg 493
>gb|DQ427807.1| Sorghum bicolor voucher NSL87902b locus HHU39 genomic sequence Length = 829 Score = 61.9 bits (31), Expect = 3e-06 Identities = 34/35 (97%) Strand = Plus / Minus Query: 619 tttgtgtggcagccagctccgttccagtcaccctg 653 |||||||||||||||||||| |||||||||||||| Sbjct: 519 tttgtgtggcagccagctccattccagtcaccctg 485
>gb|DQ427806.1| Sorghum bicolor voucher NSL87902a locus HHU39 genomic sequence Length = 837 Score = 61.9 bits (31), Expect = 3e-06 Identities = 34/35 (97%) Strand = Plus / Minus Query: 619 tttgtgtggcagccagctccgttccagtcaccctg 653 |||||||||||||||||||| |||||||||||||| Sbjct: 527 tttgtgtggcagccagctccattccagtcaccctg 493
>gb|DQ427805.1| Sorghum bicolor voucher NSL87666 locus HHU39 genomic sequence Length = 837 Score = 61.9 bits (31), Expect = 3e-06 Identities = 34/35 (97%) Strand = Plus / Minus Query: 619 tttgtgtggcagccagctccgttccagtcaccctg 653 |||||||||||||||||||| |||||||||||||| Sbjct: 527 tttgtgtggcagccagctccattccagtcaccctg 493
>gb|DQ427804.1| Sorghum bicolor voucher NSL77217 locus HHU39 genomic sequence Length = 837 Score = 61.9 bits (31), Expect = 3e-06 Identities = 34/35 (97%) Strand = Plus / Minus Query: 619 tttgtgtggcagccagctccgttccagtcaccctg 653 |||||||||||||||||||| |||||||||||||| Sbjct: 527 tttgtgtggcagccagctccattccagtcaccctg 493
>gb|DQ427803.1| Sorghum bicolor voucher NSL77034 locus HHU39 genomic sequence Length = 826 Score = 61.9 bits (31), Expect = 3e-06 Identities = 34/35 (97%) Strand = Plus / Minus Query: 619 tttgtgtggcagccagctccgttccagtcaccctg 653 |||||||||||||||||||| |||||||||||||| Sbjct: 516 tttgtgtggcagccagctccattccagtcaccctg 482
>gb|DQ427802.1| Sorghum bicolor voucher NSL56174 locus HHU39 genomic sequence Length = 826 Score = 61.9 bits (31), Expect = 3e-06 Identities = 34/35 (97%) Strand = Plus / Minus Query: 619 tttgtgtggcagccagctccgttccagtcaccctg 653 |||||||||||||||||||| |||||||||||||| Sbjct: 516 tttgtgtggcagccagctccattccagtcaccctg 482
>gb|DQ427801.1| Sorghum bicolor voucher NSL56003 locus HHU39 genomic sequence Length = 837 Score = 61.9 bits (31), Expect = 3e-06 Identities = 34/35 (97%) Strand = Plus / Minus Query: 619 tttgtgtggcagccagctccgttccagtcaccctg 653 |||||||||||||||||||| |||||||||||||| Sbjct: 527 tttgtgtggcagccagctccattccagtcaccctg 493
>gb|DQ427800.1| Sorghum bicolor voucher NSL55243 locus HHU39 genomic sequence Length = 837 Score = 61.9 bits (31), Expect = 3e-06 Identities = 34/35 (97%) Strand = Plus / Minus Query: 619 tttgtgtggcagccagctccgttccagtcaccctg 653 |||||||||||||||||||| |||||||||||||| Sbjct: 527 tttgtgtggcagccagctccattccagtcaccctg 493
>gb|DQ427799.1| Sorghum bicolor voucher NSL51365 locus HHU39 genomic sequence Length = 837 Score = 61.9 bits (31), Expect = 3e-06 Identities = 34/35 (97%) Strand = Plus / Minus Query: 619 tttgtgtggcagccagctccgttccagtcaccctg 653 |||||||||||||||||||| |||||||||||||| Sbjct: 527 tttgtgtggcagccagctccattccagtcaccctg 493
>gb|DQ427798.1| Sorghum bicolor voucher NSL51030 locus HHU39 genomic sequence Length = 837 Score = 61.9 bits (31), Expect = 3e-06 Identities = 34/35 (97%) Strand = Plus / Minus Query: 619 tttgtgtggcagccagctccgttccagtcaccctg 653 |||||||||||||||||||| |||||||||||||| Sbjct: 527 tttgtgtggcagccagctccattccagtcaccctg 493
>gb|DQ427797.1| Sorghum bicolor voucher NSL50875 locus HHU39 genomic sequence Length = 837 Score = 61.9 bits (31), Expect = 3e-06 Identities = 34/35 (97%) Strand = Plus / Minus Query: 619 tttgtgtggcagccagctccgttccagtcaccctg 653 |||||||||||||||||||| |||||||||||||| Sbjct: 527 tttgtgtggcagccagctccattccagtcaccctg 493
>gb|DQ427796.1| Sorghum bicolor voucher BTx623 locus HHU39 genomic sequence Length = 837 Score = 61.9 bits (31), Expect = 3e-06 Identities = 34/35 (97%) Strand = Plus / Minus Query: 619 tttgtgtggcagccagctccgttccagtcaccctg 653 |||||||||||||||||||| |||||||||||||| Sbjct: 527 tttgtgtggcagccagctccattccagtcaccctg 493
>gb|AF353620.1|AF353620 Glycine max glutamine synthetase precursor, mRNA, complete cds; nuclear gene for chloroplast product Length = 1541 Score = 61.9 bits (31), Expect = 3e-06 Identities = 111/135 (82%), Gaps = 2/135 (1%) Strand = Plus / Minus Query: 561 attgccttcttgatcacgtcgaaacctccatcctcgcgcatgctcaatgtgctgtagttt 620 ||||||||||| || || || || |||||||| || | ||||||| ||| ||||| || Sbjct: 1018 attgccttctttattacctcaaagcctccatcttccctcatgctctttgtactgtaattg 959 Query: 621 tgtgtggcagccagctccgttccagtcaccctggattggtttttgggtcaagggtgagca 680 |||||||| || ||||| ||||||||||||| ||||| |||||| ||||| | ||||| Sbjct: 958 -gtgtggcatcctgctccattccagtcaccctctattgg-ttttggatcaagagagagca 901 Query: 681 ccacaccagcttgct 695 | ||||||||||||| Sbjct: 900 caacaccagcttgct 886
>emb|X12738.1|PVGSCH French Bean mRNA for plastid-located glutamine synthetase (EC 6.3.1.2) Length = 1510 Score = 60.0 bits (30), Expect = 1e-05 Identities = 125/154 (81%), Gaps = 2/154 (1%) Strand = Plus / Minus Query: 540 tggcgaagtgaaaggttcaggattgccttcttgatcacgtcgaaacctccatcctcgcgc 599 ||||||||||| || |||| ||||||||||| || || || || |||||||| || | | Sbjct: 1064 tggcgaagtgatagattcaaaattgccttctttattacctcaaagcctccatcttccctc 1005 Query: 600 atgctcaatgtgctgtagttttgtgtggcagccagctccgttccagtcaccctggattgg 659 |||||| ||| ||||| || |||||||| || || || ||||||||||||| ||||| Sbjct: 1004 atgctctttgtactgta-attggtgtggcatcctgcaccattccagtcaccctctattgg 946 Query: 660 tttttgggtcaagggtgagcaccacaccagcttg 693 |||||| ||||| | |||||| ||||||||||| Sbjct: 945 -ttttggatcaagagagagcacaacaccagcttg 913 Score = 52.0 bits (26), Expect = 0.003 Identities = 71/86 (82%) Strand = Plus / Minus Query: 354 tccatgttggaggccgggcgacggtcctccaggtatcctttgcccttcgcctcggtgtct 413 |||||||| || || ||||| | |||||||| ||| |||||||| ||| |||||||||| Sbjct: 1250 tccatgtttgaagcagggcgcctgtcctccaagtaacctttgccattcttctcggtgtct 1191 Query: 414 cgccccacacgaatagagcagccacg 439 | |||||||| || ||||| ||||| Sbjct: 1190 cttcccacacggattgagcaaccacg 1165
>gb|AF222308.1|AF222308 Schizophyllum commune glutamine synthetase (gln1) mRNA, partial cds Length = 1159 Score = 60.0 bits (30), Expect = 1e-05 Identities = 36/38 (94%) Strand = Plus / Minus Query: 351 gggtccatgttggaggccgggcgacggtcctccaggta 388 ||||| ||||||||||| |||||||||||||||||||| Sbjct: 1006 gggtcaatgttggaggctgggcgacggtcctccaggta 969
>gb|DQ173921.1| Leptolegnia chapmanii glutamine synthetase mRNA, complete cds Length = 1220 Score = 58.0 bits (29), Expect = 4e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 347 gtacgggtccatgttggaggccgggcgacggtc 379 ||||||||||||||||||||||||||| ||||| Sbjct: 1063 gtacgggtccatgttggaggccgggcgtcggtc 1031
>gb|AF424638.1| Phytophthora infestans clone MY-01-A-07 glutamine synthetase mRNA, complete cds Length = 1340 Score = 58.0 bits (29), Expect = 4e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 347 gtacgggtccatgttggaggccgggcgacggtcctccaggtatcctttgccct 399 |||||||||||||||||| || |||||||||||||| | ||| || ||||||| Sbjct: 1081 gtacgggtccatgttggacgctgggcgacggtcctcgaagtagcccttgccct 1029 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Minus Query: 622 gtgtggcagccagctccgttccagtc 647 |||||||||||||| ||||||||||| Sbjct: 807 gtgtggcagccagcgccgttccagtc 782
>gb|AF169795.1|AF169795 Juglans nigra glutamine synthetase precursor (plGS) mRNA, complete cds; nuclear gene for chloroplast product Length = 1666 Score = 58.0 bits (29), Expect = 4e-05 Identities = 102/125 (81%), Gaps = 1/125 (0%) Strand = Plus / Minus Query: 539 atggcgaagtgaaaggttcaggattgccttcttgatcacgtcgaaacctccatcctcgcg 598 |||||||||||| || |||| ||||||||||| || || || || ||||||||||| | Sbjct: 1106 atggcgaagtgacagattcaaaattgccttctttataacttcaaagcctccatcctccct 1047 Query: 599 catgctcaatgtgctgtagttttgtgtggcagccagctccgttccagtcaccctggattg 658 ||||||| ||| ||||| ||||||||||| || || ||||||| ||||||| |||| Sbjct: 1046 catgctctttgtactgta-atttgtgtggcatcctgcaccgttccgatcaccctctattg 988 Query: 659 gtttt 663 ||||| Sbjct: 987 gtttt 983
>gb|BT013265.1| Lycopersicon esculentum clone 134810R, mRNA sequence Length = 1632 Score = 56.0 bits (28), Expect = 2e-04 Identities = 101/124 (81%), Gaps = 1/124 (0%) Strand = Plus / Minus Query: 540 tggcgaagtgaaaggttcaggattgccttcttgatcacgtcgaaacctccatcctcgcgc 599 |||||||| || || ||||| ||||| ||||| || || || |||||||| || || | | Sbjct: 1079 tggcgaagggatagattcagaattgctttctttataacttcaaaacctccctcttctctc 1020 Query: 600 atgctcaatgtgctgtagttttgtgtggcagccagctccgttccagtcaccctggattgg 659 || |||| ||| |||||||| |||||||| || || |||||||||||||||| ||||| Sbjct: 1019 atactcagtgtactgtagtta-gtgtggcatcctgcaccgttccagtcaccctcaattgg 961 Query: 660 tttt 663 |||| Sbjct: 960 tttt 957 Score = 46.1 bits (23), Expect = 0.16 Identities = 86/107 (80%) Strand = Plus / Minus Query: 351 gggtccatgttggaggccgggcgacggtcctccaggtatcctttgcccttcgcctcggtg 410 ||||||||||| || || ||||| ||||| |||| || || ||||| | | ||| ||| Sbjct: 1268 gggtccatgtttgaagctgggcggcggtcttccaaataacccttgccttccttctcagtg 1209 Query: 411 tctcgccccacacgaatagagcagccacggttcgccacaccccatga 457 || ||||||||||| || ||||| |||||||| || || |||||||| Sbjct: 1208 tcacgccccacacggattgagcaaccacggttagcaactccccatga 1162
>gb|AY919612.1| Glycine max clone pGRGS1-2 chloroplast glutamine synthetase (GS) mRNA, partial cds; nuclear gene for chloroplast product Length = 843 Score = 56.0 bits (28), Expect = 2e-04 Identities = 126/156 (80%), Gaps = 2/156 (1%) Strand = Plus / Minus Query: 540 tggcgaagtgaaaggttcaggattgccttcttgatcacgtcgaaacctccatcctcgcgc 599 |||||||| || || |||| ||||||||||| || || || || |||||||| || | | Sbjct: 662 tggcgaagcgatagattcaatattgccttctttattacctcaaagcctccatcttccctc 603 Query: 600 atgctcaatgtgctgtagttttgtgtggcagccagctccgttccagtcaccctggattgg 659 |||||| ||| ||||| || |||| ||| || ||||| ||||||||||||| ||||| Sbjct: 602 atgctctttgtactgtaattg-gtgtagcatcctgctccattccagtcaccctctattgg 544 Query: 660 tttttgggtcaagggtgagcaccacaccagcttgct 695 |||| || ||||| | |||||| ||||||||||||| Sbjct: 543 tttt-ggatcaagagagagcacaacaccagcttgct 509
>emb|X65927.1|ZMGS12 Z.mays mRNA gs1-2 for glutamine synthetase Length = 1369 Score = 54.0 bits (27), Expect = 6e-04 Identities = 63/75 (84%) Strand = Plus / Minus Query: 347 gtacgggtccatgttggaggccgggcgacggtcctccaggtatcctttgcccttcgcctc 406 |||||||||||||||||| ||||| | |||||||| | ||| |||||||| | | ||| Sbjct: 1122 gtacgggtccatgttggacgccggcctccggtcctcgaagtagcctttgccttccttctc 1063 Query: 407 ggtgtctcgccccac 421 ||||||||| ||||| Sbjct: 1062 ggtgtctcggcccac 1048
>gb|AY857489.1| Paxillus involutus strain ATCC 200175 glutamine synthetase (glnA) mRNA, complete cds Length = 1241 Score = 54.0 bits (27), Expect = 6e-04 Identities = 43/47 (91%), Gaps = 1/47 (2%) Strand = Plus / Minus Query: 609 gtgctgtagttttgtgtggcagccagctccgttccagtcaccctgga 655 ||||||||||| |||||||| ||||| ||||||||||||||||||| Sbjct: 815 gtgctgtagttg-gtgtggcaaccagcgccgttccagtcaccctgga 770 Score = 48.1 bits (24), Expect = 0.040 Identities = 27/28 (96%) Strand = Plus / Minus Query: 357 atgttggaggccgggcgacggtcctcca 384 |||||||| ||||||||||||||||||| Sbjct: 1067 atgttggaagccgggcgacggtcctcca 1040
>emb|AJ509092.1|SBO509092 Suillus bovinus glnA gene for glutamine synthetase Length = 3652 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 357 atgttggaggccgggcgacggtcctccaggtatcc 391 |||||||| ||||| |||||||||||||||||||| Sbjct: 2592 atgttggaagccggacgacggtcctccaggtatcc 2558 Score = 46.1 bits (23), Expect = 0.16 Identities = 39/43 (90%), Gaps = 1/43 (2%) Strand = Plus / Minus Query: 609 gtgctgtagttttgtgtggcagccagctccgttccagtcaccc 651 ||||||||||| |||||||| ||||| ||||||||||||||| Sbjct: 2340 gtgctgtagttg-gtgtggcaaccagcaccgttccagtcaccc 2299
>gb|AY187006.1| Lotus corniculatus var. japonicus glutamine synthetase PR2 mutant mRNA, complete cds Length = 1293 Score = 52.0 bits (26), Expect = 0.003 Identities = 124/154 (80%), Gaps = 2/154 (1%) Strand = Plus / Minus Query: 540 tggcgaagtgaaaggttcaggattgccttcttgatcacgtcgaaacctccatcctcgcgc 599 |||||||| || || |||| |||||||||||||| || || || ||||| || || | | Sbjct: 1004 tggcgaagggatagattcaaaattgccttcttgattacctcaaagcctccctcttccctc 945 Query: 600 atgctcaatgtgctgtagttttgtgtggcagccagctccgttccagtcaccctggattgg 659 |||||| ||||||||| || |||||| || || |||||||||||||||| ||||| Sbjct: 944 atgctctttgtgctgtaattg-gtgtgggctccggcaccgttccagtcaccctcaattgg 886 Query: 660 tttttgggtcaagggtgagcaccacaccagcttg 693 |||||| ||||| ||||| || ||||||||||| Sbjct: 885 -ttttggatcaagagtgaggacaacaccagcttg 853
>gb|AY187005.1| Lotus corniculatus var. japonicus glutamine synthetase PR1 mutant mRNA, complete cds Length = 1293 Score = 52.0 bits (26), Expect = 0.003 Identities = 124/154 (80%), Gaps = 2/154 (1%) Strand = Plus / Minus Query: 540 tggcgaagtgaaaggttcaggattgccttcttgatcacgtcgaaacctccatcctcgcgc 599 |||||||| || || |||| |||||||||||||| || || || ||||| || || | | Sbjct: 1004 tggcgaagggatagattcaaaattgccttcttgattacctcaaagcctccctcttccctc 945 Query: 600 atgctcaatgtgctgtagttttgtgtggcagccagctccgttccagtcaccctggattgg 659 |||||| ||||||||| || |||||| || || |||||||||||||||| ||||| Sbjct: 944 atgctctttgtgctgtaattg-gtgtgggctccggcaccgttccagtcaccctcaattgg 886 Query: 660 tttttgggtcaagggtgagcaccacaccagcttg 693 |||||| ||||| ||||| || ||||||||||| Sbjct: 885 -ttttggatcaagagtgaggacaacaccagcttg 853
>gb|AF459587.1|AF459587 Lotus japonicus glutamine synthetase precursor, mRNA, complete cds; nuclear gene for chloroplast product Length = 1696 Score = 52.0 bits (26), Expect = 0.003 Identities = 124/154 (80%), Gaps = 2/154 (1%) Strand = Plus / Minus Query: 540 tggcgaagtgaaaggttcaggattgccttcttgatcacgtcgaaacctccatcctcgcgc 599 |||||||| || || |||| |||||||||||||| || || || ||||| || || | | Sbjct: 1150 tggcgaagggatagattcaaaattgccttcttgattacctcaaagcctccctcttccctc 1091 Query: 600 atgctcaatgtgctgtagttttgtgtggcagccagctccgttccagtcaccctggattgg 659 |||||| ||||||||| || |||||| || || |||||||||||||||| ||||| Sbjct: 1090 atgctctttgtgctgtaattg-gtgtgggctccggcaccgttccagtcaccctcaattgg 1032 Query: 660 tttttgggtcaagggtgagcaccacaccagcttg 693 |||||| ||||| ||||| || ||||||||||| Sbjct: 1031 -ttttggatcaagagtgaggacaacaccagcttg 999
>gb|AY162467.1| Gazania splendens putative plastidic glutamine synthetase (GS2) mRNA, partial cds; nuclear gene for chloroplast product Length = 989 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Minus Query: 408 gtgtctcgccccacacgaatagagcagccacggttcgccacaccccatga 457 ||||| |||||||||||||| ||||| ||||| || || ||||||||||| Sbjct: 519 gtgtcacgccccacacgaatcgagcaaccacgattagctacaccccatga 470 Score = 40.1 bits (20), Expect = 9.6 Identities = 87/108 (80%), Gaps = 1/108 (0%) Strand = Plus / Minus Query: 540 tggcgaagtgaaaggttcaggattgccttcttgatcacgtcgaaacctccatcctcgcgc 599 ||||||||||| |||||||| || ||||| || || || || ||||| ||||| || | | Sbjct: 387 tggcgaagtgagaggttcagaatcgcctttttaattacttcaaaaccaccatcttctctc 328 Query: 600 atgctcaatgtgctgtagttttgtgtggcagccagctccgttccagtc 647 ||| ||| || |||||| || |||||||| || ||||| |||||||| Sbjct: 327 atggccaaagtactgtag-ttagtgtggcatcctgctccattccagtc 281
>gb|AY187004.2| Lotus corniculatus var. japonicus glutamine synthetase mRNA, complete cds Length = 1436 Score = 52.0 bits (26), Expect = 0.003 Identities = 124/154 (80%), Gaps = 2/154 (1%) Strand = Plus / Minus Query: 540 tggcgaagtgaaaggttcaggattgccttcttgatcacgtcgaaacctccatcctcgcgc 599 |||||||| || || |||| |||||||||||||| || || || ||||| || || | | Sbjct: 1004 tggcgaagggatagattcaaaattgccttcttgattacctcaaagcctccctcttccctc 945 Query: 600 atgctcaatgtgctgtagttttgtgtggcagccagctccgttccagtcaccctggattgg 659 |||||| ||||||||| || |||||| || || |||||||||||||||| ||||| Sbjct: 944 atgctctttgtgctgtaattg-gtgtgggctccggcaccgttccagtcaccctcaattgg 886 Query: 660 tttttgggtcaagggtgagcaccacaccagcttg 693 |||||| ||||| ||||| || ||||||||||| Sbjct: 885 -ttttggatcaagagtgaggacaacaccagcttg 853
>gb|AF005032.1|AF005032 Helianthus annuus cytosolic glutamine synthetase (ggs1.3) mRNA, partial cds Length = 679 Score = 52.0 bits (26), Expect = 0.003 Identities = 88/106 (83%), Gaps = 2/106 (1%) Strand = Plus / Minus Query: 351 gggtccatgttggaggccgggcgacggtcctccaggtatcctttgcccttcgcctcggtg 410 |||||||||||||| ||||| | ||||||||| | ||| || || || | | ||||||| Sbjct: 425 gggtccatgttggaagccggcctacggtcctcgaagtaaccctttccgtccttctcggtg 366 Query: 411 tctcgccccacacgaataga-gcagccacggttcgccacaccccat 455 || | ||| |||||||| || ||| ||||||||||||||||||||| Sbjct: 365 tccctcccaacacgaatggatgca-ccacggttcgccacaccccat 321
>emb|X65930.1|ZMGS15 Z.mays mRNA gs1-5 for glutamine synthatase Length = 895 Score = 50.1 bits (25), Expect = 0.010 Identities = 85/105 (80%) Strand = Plus / Minus Query: 351 gggtccatgttggaggccgggcgacggtcctccaggtatcctttgcccttcgcctcggtg 410 |||||||||||||| ||||| | |||||||| | ||||| ||||||| | ||||||| Sbjct: 683 gggtccatgttggaagccggcctgcggtcctcgaaatatcccttgccctccttctcggtg 624 Query: 411 tctcgccccacacgaatagagcagccacggttcgccacaccccat 455 || || || || || || |||| ||| ||||||||||| |||||| Sbjct: 623 tcgcggccgacgcggatggagccgccgcggttcgccacgccccat 579
>gb|AC139882.29| Medicago truncatula clone mth2-32f21, complete sequence Length = 115770 Score = 50.1 bits (25), Expect = 0.010 Identities = 49/57 (85%) Strand = Plus / Plus Query: 477 gtctcgtgtagccctgtcaacctccgctcgtttccttcaccatatgcggctatgtgc 533 ||||| ||| ||||||||||||| |||||||| ||||| ||||| || || |||||| Sbjct: 36477 gtctcatgtcgccctgtcaacctacgctcgttgccttctccataagcagcaatgtgc 36533
>emb|Y10268.1|MTY10268 M.truncatula mRNA for glutamine synthetase, 1488bp Length = 1488 Score = 50.1 bits (25), Expect = 0.010 Identities = 49/57 (85%) Strand = Plus / Minus Query: 477 gtctcgtgtagccctgtcaacctccgctcgtttccttcaccatatgcggctatgtgc 533 ||||| ||| ||||||||||||| |||||||| ||||| ||||| || || |||||| Sbjct: 1037 gtctcatgtcgccctgtcaacctacgctcgttgccttctccataagcagcaatgtgc 981
>emb|X76736.1|BNGLUTS B.napus mRNA for cytosolic glutamine synthetase isoform (BnGSR1-1) related to the A-genome type of Brassica campestris Length = 1400 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 631 ccagctccgttccagtcaccctggattggtttt 663 ||||||||||||||||||||| | ||||||||| Sbjct: 807 ccagctccgttccagtcacccggaattggtttt 775
>emb|Y12459.1|BNGSR12 Brassica napus mRNA for cytosolic glutamine synthetase isoform (BnGSR1-2) Length = 1344 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 631 ccagctccgttccagtcaccctggattggtttt 663 ||||||||||||||||||||| | ||||||||| Sbjct: 771 ccagctccgttccagtcacccggaattggtttt 739
>emb|CT030177.6| M.truncatula DNA sequence from clone MTH2-154J16 on chromosome 3, complete sequence Length = 126881 Score = 50.1 bits (25), Expect = 0.010 Identities = 49/57 (85%) Strand = Plus / Minus Query: 477 gtctcgtgtagccctgtcaacctccgctcgtttccttcaccatatgcggctatgtgc 533 ||||| ||| ||||||||||||| |||||||| ||||| ||||| || || |||||| Sbjct: 117245 gtctcatgtcgccctgtcaacctacgctcgttgccttctccataagcagcaatgtgc 117189
>ref|XM_469528.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1113 Score = 48.1 bits (24), Expect = 0.040 Identities = 57/68 (83%) Strand = Plus / Minus Query: 303 ggctcccacaggatcgtggtctcggccagcagcgccgtcacggtgtacgggtccatgttg 362 |||||||| ||||| ||||||||||| | || || ||||| |||||||||||||||| Sbjct: 1073 ggctcccagaggatggtggtctcggcgatcatggcggtcaccaggtacgggtccatgttg 1014 Query: 363 gaggccgg 370 || ||||| Sbjct: 1013 gacgccgg 1006
>gb|AY773089.1| Brassica rapa subsp. pekinensis glutamine synthetase mRNA, complete cds Length = 1426 Score = 48.1 bits (24), Expect = 0.040 Identities = 30/32 (93%) Strand = Plus / Minus Query: 631 ccagctccgttccagtcaccctggattggttt 662 ||||||||||||||||||||| | |||||||| Sbjct: 828 ccagctccgttccagtcacccggaattggttt 797
>gb|BT012720.1| Lycopersicon esculentum clone 113612F, mRNA sequence Length = 1416 Score = 48.1 bits (24), Expect = 0.040 Identities = 30/32 (93%) Strand = Plus / Minus Query: 501 cgctcgtttccttcaccatatgcggctatgtg 532 |||||||| |||||||||||||| |||||||| Sbjct: 924 cgctcgttgccttcaccatatgcagctatgtg 893
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 48.1 bits (24), Expect = 0.040 Identities = 57/68 (83%) Strand = Plus / Plus Query: 303 ggctcccacaggatcgtggtctcggccagcagcgccgtcacggtgtacgggtccatgttg 362 |||||||| ||||| ||||||||||| | || || ||||| |||||||||||||||| Sbjct: 28527797 ggctcccagaggatggtggtctcggcgatcatggcggtcaccaggtacgggtccatgttg 28527856 Query: 363 gaggccgg 370 || ||||| Sbjct: 28527857 gacgccgg 28527864
>emb|Y08681.1|AGGLN1 A.glutinosa mRNA for glutamine synthetase Length = 1346 Score = 48.1 bits (24), Expect = 0.040 Identities = 52/60 (86%), Gaps = 1/60 (1%) Strand = Plus / Minus Query: 631 ccagctccgttccagtcaccctggattggtttttgggtcaagggtgagcaccacaccagc 690 |||||||| ||||| |||||||||||||| || || |||||| |||||||||| ||||| Sbjct: 789 ccagctccattccaatcaccctggattgg-cttgggatcaaggctgagcaccaccccagc 731
>emb|X65928.1|ZMGS13 Z.mays mRNA gs1-3 for glutamine synthetase Length = 1317 Score = 48.1 bits (24), Expect = 0.040 Identities = 30/32 (93%) Strand = Plus / Minus Query: 351 gggtccatgttggaggccgggcgacggtcctc 382 |||||||||||||| |||||||| |||||||| Sbjct: 1081 gggtccatgttggacgccgggcggcggtcctc 1050
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 48.1 bits (24), Expect = 0.040 Identities = 57/68 (83%) Strand = Plus / Plus Query: 303 ggctcccacaggatcgtggtctcggccagcagcgccgtcacggtgtacgggtccatgttg 362 |||||||| ||||| ||||||||||| | || || ||||| |||||||||||||||| Sbjct: 28619121 ggctcccagaggatggtggtctcggcgatcatggcggtcaccaggtacgggtccatgttg 28619180 Query: 363 gaggccgg 370 || ||||| Sbjct: 28619181 gacgccgg 28619188
>gb|AC082645.13|AC082645 Oryza sativa chromosome 3 BAC OSJNBb0033N16 genomic sequence, complete sequence Length = 143681 Score = 48.1 bits (24), Expect = 0.040 Identities = 57/68 (83%) Strand = Plus / Plus Query: 303 ggctcccacaggatcgtggtctcggccagcagcgccgtcacggtgtacgggtccatgttg 362 |||||||| ||||| ||||||||||| | || || ||||| |||||||||||||||| Sbjct: 121927 ggctcccagaggatggtggtctcggcgatcatggcggtcaccaggtacgggtccatgttg 121986 Query: 363 gaggccgg 370 || ||||| Sbjct: 121987 gacgccgg 121994
>dbj|AB180689.1| Oryza sativa (japonica cultivar-group) OsGS1;3 mRNA for cytosolic glutamine synthetase 1;3, complete cds Length = 1543 Score = 48.1 bits (24), Expect = 0.040 Identities = 57/68 (83%) Strand = Plus / Minus Query: 303 ggctcccacaggatcgtggtctcggccagcagcgccgtcacggtgtacgggtccatgttg 362 |||||||| ||||| ||||||||||| | || || ||||| |||||||||||||||| Sbjct: 1241 ggctcccagaggatggtggtctcggcgatcatggcggtcaccaggtacgggtccatgttg 1182 Query: 363 gaggccgg 370 || ||||| Sbjct: 1181 gacgccgg 1174
>dbj|AK099290.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023127P21, full insert sequence Length = 1457 Score = 48.1 bits (24), Expect = 0.040 Identities = 57/68 (83%) Strand = Plus / Minus Query: 303 ggctcccacaggatcgtggtctcggccagcagcgccgtcacggtgtacgggtccatgttg 362 |||||||| ||||| ||||||||||| | || || ||||| |||||||||||||||| Sbjct: 1194 ggctcccagaggatggtggtctcggcgatcatggcggtcaccaggtacgggtccatgttg 1135 Query: 363 gaggccgg 370 || ||||| Sbjct: 1134 gacgccgg 1127
>dbj|AK063913.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-123-A09, full insert sequence Length = 1494 Score = 48.1 bits (24), Expect = 0.040 Identities = 57/68 (83%) Strand = Plus / Minus Query: 303 ggctcccacaggatcgtggtctcggccagcagcgccgtcacggtgtacgggtccatgttg 362 |||||||| ||||| ||||||||||| | || || ||||| |||||||||||||||| Sbjct: 1194 ggctcccagaggatggtggtctcggcgatcatggcggtcaccaggtacgggtccatgttg 1135 Query: 363 gaggccgg 370 || ||||| Sbjct: 1134 gacgccgg 1127
>dbj|D14577.1|MZEGS1B Zea mays mRNA for glutamine synthetase, complete cds Length = 1350 Score = 48.1 bits (24), Expect = 0.040 Identities = 30/32 (93%) Strand = Plus / Minus Query: 351 gggtccatgttggaggccgggcgacggtcctc 382 |||||||||||||| |||||||| |||||||| Sbjct: 1046 gggtccatgttggacgccgggcggcggtcctc 1015
>gb|U15059.1|LEU15059 Lycopersicon esculentum chloroplast glutamine synthetase (gs) mRNA, partial cds Length = 824 Score = 48.1 bits (24), Expect = 0.040 Identities = 100/124 (80%), Gaps = 1/124 (0%) Strand = Plus / Minus Query: 540 tggcgaagtgaaaggttcaggattgccttcttgatcacgtcgaaacctccatcctcgcgc 599 |||||||| || || ||||| ||||| ||||| || || || |||||||| || | | | Sbjct: 288 tggcgaagggatagattcagaattgctttctttataacttcaaaacctccctctcctctc 229 Query: 600 atgctcaatgtgctgtagttttgtgtggcagccagctccgttccagtcaccctggattgg 659 || |||| ||| |||||||| |||||||| || || |||||||||||||||| ||||| Sbjct: 228 atactcagtgtactgtagtta-gtgtggcatcctgcaccgttccagtcaccctcaattgg 170 Query: 660 tttt 663 |||| Sbjct: 169 tttt 166 Score = 46.1 bits (23), Expect = 0.16 Identities = 86/107 (80%) Strand = Plus / Minus Query: 351 gggtccatgttggaggccgggcgacggtcctccaggtatcctttgcccttcgcctcggtg 410 ||||||||||| || || ||||| ||||| |||| || || ||||| | | ||| ||| Sbjct: 477 gggtccatgtttgaagctgggcggcggtcttccaaataacccttgccttccttctcagtg 418 Query: 411 tctcgccccacacgaatagagcagccacggttcgccacaccccatga 457 || ||||||||||| || ||||| |||||||| || || |||||||| Sbjct: 417 tcacgccccacacggattgagcaaccacggttagcaactccccatga 371
>gb|U14754.1|LEU14754 Lycopersicon esculentum glutamine synthetase mRNA, partial cds Length = 804 Score = 48.1 bits (24), Expect = 0.040 Identities = 30/32 (93%) Strand = Plus / Minus Query: 501 cgctcgtttccttcaccatatgcggctatgtg 532 |||||||| |||||||||||||| |||||||| Sbjct: 327 cgctcgttgccttcaccatatgcagctatgtg 296
>gb|AY426758.1| Nicotiana attenuata glutamine synthetase GS58 mRNA, complete cds; nuclear gene for plastid product Length = 1523 Score = 46.1 bits (23), Expect = 0.16 Identities = 86/107 (80%) Strand = Plus / Minus Query: 351 gggtccatgttggaggccgggcgacggtcctccaggtatcctttgcccttcgcctcggtg 410 ||||||||||| || || ||||||||||| |||| || |||||||| | | ||| ||| Sbjct: 1249 gggtccatgtttgaagctgggcgacggtcttccaaataacctttgccttgcttctcagtg 1190 Query: 411 tctcgccccacacgaatagagcagccacggttcgccacaccccatga 457 || ||||||||||| || ||| |||||||| || || |||||||| Sbjct: 1189 tcacgccccacacggattgaggcaccacggttagcaactccccatga 1143
>emb|X15280.1|DSGS Dunaliella salina mRNA for gluatmine synthetase Length = 1301 Score = 46.1 bits (23), Expect = 0.16 Identities = 32/35 (91%) Strand = Plus / Minus Query: 429 gagcagccacggttcgccacaccccatgagaagtc 463 |||||||| ||||| ||||||||||| |||||||| Sbjct: 586 gagcagccgcggttggccacaccccaggagaagtc 552
>gb|AY189922.1| Teramnus labialis clone 2 glutamine synthetase gene, partial cds; nuclear gene for chloroplast product Length = 1072 Score = 46.1 bits (23), Expect = 0.16 Identities = 32/35 (91%) Strand = Plus / Minus Query: 661 ttttgggtcaagggtgagcaccacaccagcttgct 695 |||||| ||||||| |||||| ||||||||||||| Sbjct: 821 ttttggatcaagggagagcacaacaccagcttgct 787
>gb|AY189919.2| Pseudovigna argentea glutamine synthetase gene, partial cds; nuclear gene for chloroplast product Length = 1118 Score = 46.1 bits (23), Expect = 0.16 Identities = 29/31 (93%) Strand = Plus / Minus Query: 622 gtgtggcagccagctccgttccagtcaccct 652 |||||||| |||||||| ||||||||||||| Sbjct: 981 gtgtggcatccagctccattccagtcaccct 951
>gb|AY189918.2| Pseudeminia comosa glutamine synthetase gene, partial cds; nuclear gene for chloroplast product Length = 1128 Score = 46.1 bits (23), Expect = 0.16 Identities = 29/31 (93%) Strand = Plus / Minus Query: 622 gtgtggcagccagctccgttccagtcaccct 652 |||||||| |||||||| ||||||||||||| Sbjct: 991 gtgtggcatccagctccattccagtcaccct 961
>gb|AY189916.1| Amphicarpaea edgeworthii glutamine synthetase gene, partial cds; nuclear gene for chloroplast product Length = 1066 Score = 46.1 bits (23), Expect = 0.16 Identities = 32/35 (91%) Strand = Plus / Minus Query: 661 ttttgggtcaagggtgagcaccacaccagcttgct 695 |||||||||||| ||||| || ||||||||||||| Sbjct: 803 ttttgggtcaagagtgagaacaacaccagcttgct 769
>gb|AF411820.1| Hebeloma cylindrosporum glutamine synthetase mRNA, complete cds Length = 1218 Score = 46.1 bits (23), Expect = 0.16 Identities = 29/31 (93%) Strand = Plus / Minus Query: 625 tggcagccagctccgttccagtcaccctgga 655 ||||||||||| ||||||||||| ||||||| Sbjct: 813 tggcagccagcgccgttccagtcgccctgga 783
>gb|AF031082.1|AF031082 Canavalia lineata glutamine synthetase (gln) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1577 Score = 46.1 bits (23), Expect = 0.16 Identities = 32/35 (91%) Strand = Plus / Minus Query: 489 cctgtcaacctccgctcgtttccttcaccatatgc 523 ||||||||||| | ||| ||||||||||||||||| Sbjct: 1145 cctgtcaaccttctctcatttccttcaccatatgc 1111
>gb|AY104270.1| Zea mays PCO127708 mRNA sequence Length = 1538 Score = 46.1 bits (23), Expect = 0.16 Identities = 44/51 (86%) Strand = Plus / Minus Query: 347 gtacgggtccatgttggaggccgggcgacggtcctccaggtatcctttgcc 397 |||||||||||||||||| ||||| | |||||||| | ||| |||||||| Sbjct: 1122 gtacgggtccatgttggacgccggcctccggtcctcgaagtagcctttgcc 1072
>gb|AF145480.1|AF145480 Mesembryanthemum crystallinum glutamine synthetase leaf isozyme precursor, mRNA, complete cds Length = 1579 Score = 46.1 bits (23), Expect = 0.16 Identities = 51/59 (86%), Gaps = 1/59 (1%) Strand = Plus / Minus Query: 637 ccgttccagtcaccctggattggtttttgggtcaagggtgagcaccacaccagcttgct 695 |||||||| ||||||| ||||||||| || ||||||||||| || |||||| |||||| Sbjct: 1004 ccgttccaatcaccctcaattggtttt-ggatcaagggtgagaactacaccaacttgct 947
>gb|AF005224.1|AF005224 Helianthus annuus chloroplastic glutamine synthetase (ggs2) gene, ggs2b allele, mRNA, nuclear gene encoding chloroplast protein, partial cds Length = 714 Score = 46.1 bits (23), Expect = 0.16 Identities = 50/59 (84%) Strand = Plus / Minus Query: 339 gtcacggtgtacgggtccatgttggaggccgggcgacggtcctccaggtatcctttgcc 397 ||||||||||| ||||||||||| || ||||| || | ||| |||| ||| |||||||| Sbjct: 437 gtcacggtgtatgggtccatgtttgatgccggacgcctgtcttccaagtaacctttgcc 379
>ref|NM_103743.2| Arabidopsis thaliana GLN1;5; glutamate-ammonia ligase AT1G48470 (GLN1;5) mRNA, complete cds Length = 1307 Score = 44.1 bits (22), Expect = 0.62 Identities = 28/30 (93%) Strand = Plus / Minus Query: 634 gctccgttccagtcaccctggattggtttt 663 ||||| ||||| |||||||||||||||||| Sbjct: 810 gctccattccaatcaccctggattggtttt 781
>gb|BT015449.1| Arabidopsis thaliana At1g48470 mRNA sequence Length = 1059 Score = 44.1 bits (22), Expect = 0.62 Identities = 28/30 (93%) Strand = Plus / Minus Query: 634 gctccgttccagtcaccctggattggtttt 663 ||||| ||||| |||||||||||||||||| Sbjct: 734 gctccattccaatcaccctggattggtttt 705
>gb|AY422225.1| Datisca glomerata glutamine synthetase 2 (GS1-2) mRNA, partial cds Length = 867 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Minus Query: 435 ccacggttcgccacaccccatgagaa 460 ||||||||||||||||||||| |||| Sbjct: 770 ccacggttcgccacaccccataagaa 745
>gb|AY835454.1| Saccharum officinarum glutamine synthetase (GS1.b) mRNA, complete cds Length = 1422 Score = 44.1 bits (22), Expect = 0.62 Identities = 52/62 (83%) Strand = Plus / Minus Query: 351 gggtccatgttggaggccgggcgacggtcctccaggtatcctttgcccttcgcctcggtg 410 |||||||||||| | ||||| | |||||||||| |||||| ||||||| | ||||||| Sbjct: 1085 gggtccatgttgaatgccggcctgcggtcctccaagtatcccttgccctcccgctcggtg 1026 Query: 411 tc 412 || Sbjct: 1025 tc 1024 Score = 40.1 bits (20), Expect = 9.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 637 ccgttccagtcaccctggat 656 |||||||||||||||||||| Sbjct: 800 ccgttccagtcaccctggat 781
>gb|BT006245.1| Arabidopsis thaliana At1g48470 mRNA, complete cds Length = 1062 Score = 44.1 bits (22), Expect = 0.62 Identities = 28/30 (93%) Strand = Plus / Minus Query: 634 gctccgttccagtcaccctggattggtttt 663 ||||| ||||| |||||||||||||||||| Sbjct: 737 gctccattccaatcaccctggattggtttt 708
>gb|AF302113.1| Solanum tuberosum glutamine synthetase GS2 (gln) mRNA, partial cds; nuclear gene for plastid product Length = 1199 Score = 44.1 bits (22), Expect = 0.62 Identities = 37/42 (88%) Strand = Plus / Minus Query: 622 gtgtggcagccagctccgttccagtcaccctggattggtttt 663 |||||||| || || |||||||||||||||| ||||||||| Sbjct: 542 gtgtggcatcctgcaccgttccagtcaccctcaattggtttt 501 Score = 40.1 bits (20), Expect = 9.6 Identities = 38/44 (86%) Strand = Plus / Minus Query: 414 cgccccacacgaatagagcagccacggttcgccacaccccatga 457 ||||||||||| || ||||| |||||||| || || |||||||| Sbjct: 749 cgccccacacggattgagcaaccacggttagcaactccccatga 706
>gb|AY085540.1| Arabidopsis thaliana clone 156550 mRNA, complete sequence Length = 1224 Score = 44.1 bits (22), Expect = 0.62 Identities = 28/30 (93%) Strand = Plus / Minus Query: 634 gctccgttccagtcaccctggattggtttt 663 ||||| ||||| |||||||||||||||||| Sbjct: 777 gctccattccaatcaccctggattggtttt 748
>dbj|AK118005.1| Arabidopsis thaliana At1g48470 mRNA for putative glutamine synthetase, complete cds, clone: RAFL19-20-O14 Length = 1308 Score = 44.1 bits (22), Expect = 0.62 Identities = 28/30 (93%) Strand = Plus / Minus Query: 634 gctccgttccagtcaccctggattggtttt 663 ||||| ||||| |||||||||||||||||| Sbjct: 810 gctccattccaatcaccctggattggtttt 781
>dbj|D14578.1|MZEGS1C Zea mays mRNA for glutamine synthetase, complete cds Length = 1433 Score = 44.1 bits (22), Expect = 0.62 Identities = 52/62 (83%) Strand = Plus / Minus Query: 351 gggtccatgttggaggccgggcgacggtcctccaggtatcctttgcccttcgcctcggtg 410 |||||||||||||| ||||| | |||||||| | |||||| ||||||| | ||||||| Sbjct: 1114 gggtccatgttggaagccggcctgcggtcctcgaagtatcccttgccctccttctcggtg 1055 Query: 411 tc 412 || Sbjct: 1054 tc 1053
>gb|M96798.1|PNLGTSYN Panulirus argus glutamine synthetase mRNA, complete cds Length = 2045 Score = 44.1 bits (22), Expect = 0.62 Identities = 28/30 (93%) Strand = Plus / Minus Query: 359 gttggaggccgggcgacggtcctccaggta 388 |||||||| |||||||||||||||||||| Sbjct: 1081 gttggaggaagggcgacggtcctccaggta 1052
>gb|AC102062.9| Mus musculus chromosome 19, clone RP23-217B9, complete sequence Length = 253774 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 616 agttttgtgtggcagccagct 636 ||||||||||||||||||||| Sbjct: 162921 agttttgtgtggcagccagct 162941
>gb|AY261534.1| Adenia sp. Gilbert 9135 glutamine synthetase GS2 (ncpGS) gene, partial cds; nuclear gene for chloroplast product Length = 523 Score = 42.1 bits (21), Expect = 2.4 Identities = 30/33 (90%) Strand = Plus / Minus Query: 661 ttttgggtcaagggtgagcaccacaccagcttg 693 |||||| ||||||||||| || ||||||||||| Sbjct: 354 ttttggatcaagggtgaggacaacaccagcttg 322
>ref|XM_754581.1| Ustilago maydis 521 hypothetical protein (UM03527.1) partial mRNA Length = 1200 Score = 42.1 bits (21), Expect = 2.4 Identities = 27/29 (93%) Strand = Plus / Minus Query: 622 gtgtggcagccagctccgttccagtcacc 650 |||||||| ||||| |||||||||||||| Sbjct: 884 gtgtggcaaccagcgccgttccagtcacc 856
>gb|AC124357.3| Mus musculus BAC clone RP24-490K11 from chromosome 19, complete sequence Length = 154460 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 616 agttttgtgtggcagccagct 636 ||||||||||||||||||||| Sbjct: 44768 agttttgtgtggcagccagct 44748
>ref|XM_661336.1| Cryptosporidium hominis TU502 hypothetical protein (Chro.40415) partial mRNA Length = 3129 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 132 gtacaggcagtgccccgacgg 152 ||||||||||||||||||||| Sbjct: 1097 gtacaggcagtgccccgacgg 1117
>emb|CR450730.4| Zebrafish DNA sequence from clone DKEY-43P5 in linkage group 4, complete sequence Length = 121826 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 623 tgtggcagccagctccgttccagtc 647 |||||||||| |||||||||||||| Sbjct: 73902 tgtggcagccggctccgttccagtc 73926
>gb|BC095274.1| Danio rerio similar to glutamine synthetase, mRNA (cDNA clone IMAGE:7229721), partial cds Length = 1329 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 623 tgtggcagccagctccgttccagtc 647 |||||||||| |||||||||||||| Sbjct: 759 tgtggcagccggctccgttccagtc 735
>dbj|AB112466.1| Drosera tokaiensis DtCGS-1 mRNA for cytosolic glutamine synthetase, partial cds Length = 341 Score = 42.1 bits (21), Expect = 2.4 Identities = 27/29 (93%) Strand = Plus / Minus Query: 504 tcgtttccttcaccatatgcggctatgtg 532 |||||||||||||||||||| || ||||| Sbjct: 288 tcgtttccttcaccatatgcagcaatgtg 260
>ref|XM_689439.1| PREDICTED: Danio rerio similar to glutamine synthetase (LOC566165), mRNA Length = 1471 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 623 tgtggcagccagctccgttccagtc 647 |||||||||| |||||||||||||| Sbjct: 766 tgtggcagccggctccgttccagtc 742
>gb|DQ323125.1| Helicosporidium sp. ex Simulium jonesii glutamine synthetase mRNA, complete cds Length = 1354 Score = 42.1 bits (21), Expect = 2.4 Identities = 27/29 (93%) Strand = Plus / Minus Query: 351 gggtccatgttggaggccgggcgacggtc 379 ||||||| ||||||||||||||| ||||| Sbjct: 1214 gggtccaggttggaggccgggcgtcggtc 1186
>gb|AC007145.10| Drosophila melanogaster, chromosome 2L, region 37D, BAC clone BACR10I09, complete sequence Length = 169289 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 539 atggcgaagtgaaaggttcag 559 ||||||||||||||||||||| Sbjct: 77388 atggcgaagtgaaaggttcag 77408
>gb|AF390022.1| Oncorhynchus mykiss glutamine synthetase (GS02) mRNA, complete cds Length = 1840 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 622 gtgtggcagccagctccgttccagt 646 |||||||||||||| |||||||||| Sbjct: 836 gtgtggcagccagcaccgttccagt 812
>gb|AE003662.3| Drosophila melanogaster chromosome 2L, section 71 of 83 of the complete sequence Length = 266205 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 539 atggcgaagtgaaaggttcag 559 ||||||||||||||||||||| Sbjct: 72569 atggcgaagtgaaaggttcag 72589
>dbj|D25325.1|RADGS1BB Raphanus sativus gs1 beta mRNA for glutamine synthetase, complete cds Length = 1484 Score = 42.1 bits (21), Expect = 2.4 Identities = 30/33 (90%) Strand = Plus / Minus Query: 631 ccagctccgttccagtcaccctggattggtttt 663 |||||||||||||||||||| | ||||||||| Sbjct: 909 ccagctccgttccagtcaccaggaattggtttt 877
>dbj|D25324.1|RADGS1AA Raphanus sativus gs1 alpha mRNA for glutamine synthetase, complete cds Length = 1333 Score = 42.1 bits (21), Expect = 2.4 Identities = 30/33 (90%) Strand = Plus / Minus Query: 631 ccagctccgttccagtcaccctggattggtttt 663 ||||| ||||||||||||||| ||| ||||||| Sbjct: 776 ccagccccgttccagtcacccgggactggtttt 744
>emb|X71361.1|AOGLNS A.officinalis mRNA for glutamine synthetase Length = 1651 Score = 42.1 bits (21), Expect = 2.4 Identities = 27/29 (93%) Strand = Plus / Minus Query: 492 gtcaacctccgctcgtttccttcaccata 520 |||||||| |||||||||||||| ||||| Sbjct: 1158 gtcaaccttcgctcgtttccttctccata 1130
>gb|BT020432.1| Arabidopsis thaliana At3g17820 mRNA, complete cds Length = 1065 Score = 40.1 bits (20), Expect = 9.6 Identities = 29/32 (90%) Strand = Plus / Minus Query: 631 ccagctccgttccagtcaccctggattggttt 662 |||||||| |||||||||||| ||| |||||| Sbjct: 740 ccagctccattccagtcacccgggactggttt 709
>ref|NM_112663.2| Arabidopsis thaliana ATGSKB6; glutamate-ammonia ligase AT3G17820 (ATGSKB6) mRNA, complete cds Length = 1341 Score = 40.1 bits (20), Expect = 9.6 Identities = 29/32 (90%) Strand = Plus / Minus Query: 631 ccagctccgttccagtcaccctggattggttt 662 |||||||| |||||||||||| ||| |||||| Sbjct: 829 ccagctccattccagtcacccgggactggttt 798
>gb|BT020327.1| Arabidopsis thaliana At3g17820 gene, complete cds Length = 1135 Score = 40.1 bits (20), Expect = 9.6 Identities = 29/32 (90%) Strand = Plus / Minus Query: 631 ccagctccgttccagtcaccctggattggttt 662 |||||||| |||||||||||| ||| |||||| Sbjct: 744 ccagctccattccagtcacccgggactggttt 713
>gb|AC154844.2| Mus musculus BAC clone RP23-46K13 from chromosome 16, complete sequence Length = 196946 Score = 40.1 bits (20), Expect = 9.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 625 tggcagccagctccgttcca 644 |||||||||||||||||||| Sbjct: 127141 tggcagccagctccgttcca 127160
>gb|AC145323.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0018N12, complete sequence Length = 137127 Score = 40.1 bits (20), Expect = 9.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 207 ttttcttttccccggaagaa 226 |||||||||||||||||||| Sbjct: 3978 ttttcttttccccggaagaa 3997
>gb|AC145321.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0094P07, complete sequence Length = 162311 Score = 40.1 bits (20), Expect = 9.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 207 ttttcttttccccggaagaa 226 |||||||||||||||||||| Sbjct: 143724 ttttcttttccccggaagaa 143743
>gb|AC147358.2| Xenopus tropicalis clone CH216-71J8, complete sequence Length = 170238 Score = 40.1 bits (20), Expect = 9.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 109 gttctacaaactgtgaggat 128 |||||||||||||||||||| Sbjct: 97736 gttctacaaactgtgaggat 97717
>gb|AC147893.2| Xenopus tropicalis clone CH216-36J13, complete sequence Length = 159658 Score = 40.1 bits (20), Expect = 9.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 109 gttctacaaactgtgaggat 128 |||||||||||||||||||| Sbjct: 153251 gttctacaaactgtgaggat 153270
>gb|AY422224.1| Datisca glomerata glutamine synthetase 1 (GS1-1) mRNA, complete cds Length = 1445 Score = 40.1 bits (20), Expect = 9.6 Identities = 44/52 (84%) Strand = Plus / Minus Query: 404 ctcggtgtctcgccccacacgaatagagcagccacggttcgccacaccccat 455 ||||||||||| ||| |||||||| || |||||||| |||||||||||| Sbjct: 1042 ctcggtgtctctcccaacacgaatggacgctccacggttagccacaccccat 991 Score = 40.1 bits (20), Expect = 9.6 Identities = 29/32 (90%) Strand = Plus / Minus Query: 631 ccagctccgttccagtcaccctggattggttt 662 ||||| || |||||||||||||| |||||||| Sbjct: 816 ccagcaccattccagtcaccctgaattggttt 785
>ref|XM_960053.1| Neurospora crassa OR74A hypothetical protein (NCU00953.1) partial mRNA Length = 1530 Score = 40.1 bits (20), Expect = 9.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 580 cgaaacctccatcctcgcgc 599 |||||||||||||||||||| Sbjct: 1119 cgaaacctccatcctcgcgc 1100
>ref|XM_325132.1| Neurospora crassa OR74A hypothetical protein (NCU00953.1) partial mRNA Length = 1530 Score = 40.1 bits (20), Expect = 9.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 580 cgaaacctccatcctcgcgc 599 |||||||||||||||||||| Sbjct: 1119 cgaaacctccatcctcgcgc 1100
>gb|AE007260.1| Sinorhizobium meliloti 1021 plasmid pSymA section 66 of 121 of the complete plasmid sequence Length = 11000 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 560 gattgccttcttgatcacgtcgaa 583 |||||||||| ||||||||||||| Sbjct: 8668 gattgccttcatgatcacgtcgaa 8691
>gb|AY835453.1| Saccharum officinarum glutamine synthetase (GS1.a) mRNA, complete cds Length = 1596 Score = 40.1 bits (20), Expect = 9.6 Identities = 29/32 (90%) Strand = Plus / Minus Query: 351 gggtccatgttggaggccgggcgacggtcctc 382 |||||||||||||| ||||| || |||||||| Sbjct: 1101 gggtccatgttggacgccggccggcggtcctc 1070
>gb|AY360451.1| Glomus mosseae glutamine synthetase (Gln1) mRNA, complete cds Length = 1065 Score = 40.1 bits (20), Expect = 9.6 Identities = 38/44 (86%) Strand = Plus / Minus Query: 619 tttgtgtggcagccagctccgttccagtcaccctggattggttt 662 ||||||||||| || || |||||||| || |||| ||||||||| Sbjct: 755 tttgtgtggcatcctgcaccgttccaatctcccttgattggttt 712
>gb|AY261565.1| Passiflora coccinea Morse-200000042 glutamine synthetase GS2 (ncpGS) gene, partial cds; nuclear gene for chloroplast product Length = 503 Score = 40.1 bits (20), Expect = 9.6 Identities = 29/32 (90%) Strand = Plus / Minus Query: 622 gtgtggcagccagctccgttccagtcaccctg 653 |||||||| || ||||||||||| |||||||| Sbjct: 474 gtgtggcatcctgctccgttccaatcaccctg 443
>gb|AY491969.1| Triticum aestivum glutamine synthetase isoform GSr2 (GS) gene, complete cds Length = 1341 Score = 40.1 bits (20), Expect = 9.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 351 gggtccatgttggaggccgg 370 |||||||||||||||||||| Sbjct: 1046 gggtccatgttggaggccgg 1027
>gb|AY491968.1| Triticum aestivum glutamine synthetase isoform GSr1 (GS) gene, complete cds Length = 1397 Score = 40.1 bits (20), Expect = 9.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 351 gggtccatgttggaggccgg 370 |||||||||||||||||||| Sbjct: 1096 gggtccatgttggaggccgg 1077
>gb|AF503208.1| Oreochromis niloticus glutamine synthetase mRNA, complete cds Length = 1926 Score = 40.1 bits (20), Expect = 9.6 Identities = 26/28 (92%) Strand = Plus / Minus Query: 619 tttgtgtggcagccagctccgttccagt 646 ||||| ||||||||||| |||||||||| Sbjct: 857 tttgtatggcagccagcaccgttccagt 830
>emb|CR731883.2|CNS0GRO0 Tetraodon nigroviridis full-length cDNA Length = 540 Score = 40.1 bits (20), Expect = 9.6 Identities = 26/28 (92%) Strand = Plus / Minus Query: 619 tttgtgtggcagccagctccgttccagt 646 |||||||||||||| || |||||||||| Sbjct: 499 tttgtgtggcagcccgcgccgttccagt 472
>emb|CR730333.2|CNS0GQGY Tetraodon nigroviridis full-length cDNA Length = 540 Score = 40.1 bits (20), Expect = 9.6 Identities = 26/28 (92%) Strand = Plus / Minus Query: 619 tttgtgtggcagccagctccgttccagt 646 |||||||||||||| || |||||||||| Sbjct: 499 tttgtgtggcagcccgcgccgttccagt 472
>emb|CR730219.2|CNS0GQDT Tetraodon nigroviridis full-length cDNA Length = 540 Score = 40.1 bits (20), Expect = 9.6 Identities = 26/28 (92%) Strand = Plus / Minus Query: 619 tttgtgtggcagccagctccgttccagt 646 |||||||||||||| || |||||||||| Sbjct: 499 tttgtgtggcagcccgcgccgttccagt 472
>emb|CR729434.2|CNS0GPS0 Tetraodon nigroviridis full-length cDNA Length = 541 Score = 40.1 bits (20), Expect = 9.6 Identities = 26/28 (92%) Strand = Plus / Minus Query: 619 tttgtgtggcagccagctccgttccagt 646 |||||||||||||| || |||||||||| Sbjct: 500 tttgtgtggcagcccgcgccgttccagt 473
>emb|CR728408.2|CNS0GOZI Tetraodon nigroviridis full-length cDNA Length = 540 Score = 40.1 bits (20), Expect = 9.6 Identities = 26/28 (92%) Strand = Plus / Minus Query: 619 tttgtgtggcagccagctccgttccagt 646 |||||||||||||| || |||||||||| Sbjct: 499 tttgtgtggcagcccgcgccgttccagt 472
>emb|CR728040.2|CNS0GOPA Tetraodon nigroviridis full-length cDNA Length = 540 Score = 40.1 bits (20), Expect = 9.6 Identities = 26/28 (92%) Strand = Plus / Minus Query: 619 tttgtgtggcagccagctccgttccagt 646 |||||||||||||| || |||||||||| Sbjct: 499 tttgtgtggcagcccgcgccgttccagt 472
>emb|CR727856.2|CNS0GOK6 Tetraodon nigroviridis full-length cDNA Length = 540 Score = 40.1 bits (20), Expect = 9.6 Identities = 26/28 (92%) Strand = Plus / Minus Query: 619 tttgtgtggcagccagctccgttccagt 646 |||||||||||||| || |||||||||| Sbjct: 499 tttgtgtggcagcccgcgccgttccagt 472
>emb|CR727212.2|CNS0GO2A Tetraodon nigroviridis full-length cDNA Length = 540 Score = 40.1 bits (20), Expect = 9.6 Identities = 26/28 (92%) Strand = Plus / Minus Query: 619 tttgtgtggcagccagctccgttccagt 646 |||||||||||||| || |||||||||| Sbjct: 499 tttgtgtggcagcccgcgccgttccagt 472
>emb|CR725798.2|CNS0GMZ0 Tetraodon nigroviridis full-length cDNA Length = 540 Score = 40.1 bits (20), Expect = 9.6 Identities = 26/28 (92%) Strand = Plus / Minus Query: 619 tttgtgtggcagccagctccgttccagt 646 |||||||||||||| || |||||||||| Sbjct: 499 tttgtgtggcagcccgcgccgttccagt 472
>emb|CR702784.2|CNS0G57W Tetraodon nigroviridis full-length cDNA Length = 1614 Score = 40.1 bits (20), Expect = 9.6 Identities = 26/28 (92%) Strand = Plus / Minus Query: 619 tttgtgtggcagccagctccgttccagt 646 ||||| ||||||||||| |||||||||| Sbjct: 596 tttgtatggcagccagcgccgttccagt 569
>emb|CR700036.1|CNS0G33K Tetraodon nigroviridis full-length cDNA Length = 1862 Score = 40.1 bits (20), Expect = 9.6 Identities = 26/28 (92%) Strand = Plus / Minus Query: 619 tttgtgtggcagccagctccgttccagt 646 ||||| ||||||||||| |||||||||| Sbjct: 861 tttgtatggcagccagcgccgttccagt 834
>emb|CR685084.2|CNS0FRK8 Tetraodon nigroviridis full-length cDNA Length = 2002 Score = 40.1 bits (20), Expect = 9.6 Identities = 26/28 (92%) Strand = Plus / Minus Query: 619 tttgtgtggcagccagctccgttccagt 646 ||||| ||||||||||| |||||||||| Sbjct: 868 tttgtatggcagccagcgccgttccagt 841
>emb|CR662510.1|CNS0FA5W Tetraodon nigroviridis full-length cDNA Length = 1568 Score = 40.1 bits (20), Expect = 9.6 Identities = 26/28 (92%) Strand = Plus / Minus Query: 619 tttgtgtggcagccagctccgttccagt 646 ||||| ||||||||||| |||||||||| Sbjct: 877 tttgtatggcagccagcgccgttccagt 850
>emb|CR657814.2|CNS0F6JG Tetraodon nigroviridis full-length cDNA Length = 541 Score = 40.1 bits (20), Expect = 9.6 Identities = 26/28 (92%) Strand = Plus / Minus Query: 619 tttgtgtggcagccagctccgttccagt 646 |||||||||||||| || |||||||||| Sbjct: 500 tttgtgtggcagcccgcgccgttccagt 473
>emb|CR657385.2|CNS0F67J Tetraodon nigroviridis full-length cDNA Length = 1564 Score = 40.1 bits (20), Expect = 9.6 Identities = 26/28 (92%) Strand = Plus / Minus Query: 619 tttgtgtggcagccagctccgttccagt 646 ||||| ||||||||||| |||||||||| Sbjct: 878 tttgtatggcagccagcgccgttccagt 851
>ref|XM_504822.1| Yarrowia lipolytica CLIB122, YALI0F00506g predicted mRNA Length = 1095 Score = 40.1 bits (20), Expect = 9.6 Identities = 29/32 (90%) Strand = Plus / Minus Query: 622 gtgtggcagccagctccgttccagtcaccctg 653 ||||| ||||| |||||||||||||| ||||| Sbjct: 725 gtgtgacagccggctccgttccagtctccctg 694
>gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, complete sequence Length = 4895836 Score = 40.1 bits (20), Expect = 9.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 311 caggatcgtggtctcggcca 330 |||||||||||||||||||| Sbjct: 4562044 caggatcgtggtctcggcca 4562025
>emb|X69087.1|HVCGSA H.vulgare mRNA for cytoplasmic glutamine synthetase Length = 1456 Score = 40.1 bits (20), Expect = 9.6 Identities = 29/32 (90%) Strand = Plus / Minus Query: 351 gggtccatgttggaggccgggcgacggtcctc 382 |||||||||||||| ||||| || |||||||| Sbjct: 1076 gggtccatgttggacgccggccggcggtcctc 1045
>emb|X05515.1|PSGSR3 Pea nodule mRNA for glutamine synthetase (EC 6.3.1.2) Length = 1065 Score = 40.1 bits (20), Expect = 9.6 Identities = 51/60 (85%), Gaps = 1/60 (1%) Strand = Plus / Minus Query: 631 ccagctccgttccagtcaccctggattggtttttgggtcaagggtgagcaccacaccagc 690 ||||| || ||||||||||||| ||||| ||| ||||||| ||| || ||||||||||| Sbjct: 450 ccagcaccattccagtcacccttaattgg-tttagggtcaaaggtaagaaccacaccagc 392
>gb|DQ124211.1| Triticum aestivum glutamine synthetase isoform GS1c (GS1) mRNA, complete cds Length = 1223 Score = 40.1 bits (20), Expect = 9.6 Identities = 29/32 (90%) Strand = Plus / Minus Query: 351 gggtccatgttggaggccgggcgacggtcctc 382 |||||||||||||| ||||| || |||||||| Sbjct: 1019 gggtccatgttggacgccggccggcggtcctc 988
>gb|DQ124210.1| Triticum aestivum glutamine synthetase isoform GS1b (GS1) mRNA, complete cds Length = 1496 Score = 40.1 bits (20), Expect = 9.6 Identities = 29/32 (90%) Strand = Plus / Minus Query: 351 gggtccatgttggaggccgggcgacggtcctc 382 |||||||||||||| ||||| || |||||||| Sbjct: 1094 gggtccatgttggacgccggccggcggtcctc 1063
>gb|DQ124209.1| Triticum aestivum glutamine synthetase isoform GS1a (GS1) mRNA, complete cds Length = 1292 Score = 40.1 bits (20), Expect = 9.6 Identities = 29/32 (90%) Strand = Plus / Minus Query: 351 gggtccatgttggaggccgggcgacggtcctc 382 |||||||||||||| ||||| || |||||||| Sbjct: 1082 gggtccatgttggacgccggccggcggtcctc 1051
>emb|BX842629.1| Neurospora crassa DNA linkage group I BAC contig B20J13 Length = 126048 Score = 40.1 bits (20), Expect = 9.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 580 cgaaacctccatcctcgcgc 599 |||||||||||||||||||| Sbjct: 17676 cgaaacctccatcctcgcgc 17657
>gb|AY065571.1|AY065570S2 Zea mays clone tac 907.49 3' Ac insertion site sequence Length = 386 Score = 40.1 bits (20), Expect = 9.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 ccttcagcgccagcttcttg 275 |||||||||||||||||||| Sbjct: 138 ccttcagcgccagcttcttg 157
>gb|AF098984.2| Oxalis ortgiesii EE458 glutamine synthetase gene, partial cds; nuclear gene for chloroplast product Length = 669 Score = 40.1 bits (20), Expect = 9.6 Identities = 29/32 (90%) Strand = Plus / Minus Query: 622 gtgtggcagccagctccgttccagtcaccctg 653 ||||||||||||||||| ||||| || ||||| Sbjct: 511 gtgtggcagccagctccattccaatcgccctg 480
>gb|CP000249.1| Frankia sp. CcI3, complete genome Length = 5433628 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 311 caggatcgtggtctcggccagcag 334 |||||||| ||||||||||||||| Sbjct: 4541257 caggatcgcggtctcggccagcag 4541280
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 40.1 bits (20), Expect = 9.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 207 ttttcttttccccggaagaa 226 |||||||||||||||||||| Sbjct: 5153735 ttttcttttccccggaagaa 5153716
>emb|BX825803.1|CNS0A4SH Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL63ZG08 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1264 Score = 40.1 bits (20), Expect = 9.6 Identities = 29/32 (90%) Strand = Plus / Minus Query: 631 ccagctccgttccagtcaccctggattggttt 662 |||||||| |||||||||||| ||| |||||| Sbjct: 776 ccagctccattccagtcacccgggactggttt 745
>gb|AY207394.1| Homo sapiens unknown protein mRNA, partial sequence Length = 429 Score = 40.1 bits (20), Expect = 9.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 202 atttattttcttttccccgg 221 |||||||||||||||||||| Sbjct: 399 atttattttcttttccccgg 418
>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome Length = 9025608 Score = 40.1 bits (20), Expect = 9.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 328 ccagcagcgccgtcacggtg 347 |||||||||||||||||||| Sbjct: 3266855 ccagcagcgccgtcacggtg 3266874
>gb|BT004249.1| Arabidopsis thaliana clone RAFL14-96-E19 (R20303) putative glutamine synthetase (At3g17820) mRNA, complete cds Length = 1313 Score = 40.1 bits (20), Expect = 9.6 Identities = 29/32 (90%) Strand = Plus / Minus Query: 631 ccagctccgttccagtcaccctggattggttt 662 |||||||| |||||||||||| ||| |||||| Sbjct: 792 ccagctccattccagtcacccgggactggttt 761
>gb|AY088312.1| Arabidopsis thaliana clone 5507 mRNA, complete sequence Length = 1310 Score = 40.1 bits (20), Expect = 9.6 Identities = 29/32 (90%) Strand = Plus / Minus Query: 631 ccagctccgttccagtcaccctggattggttt 662 |||||||| |||||||||||| ||| |||||| Sbjct: 829 ccagctccattccagtcacccgggactggttt 798
>gb|AF118103.1|AF118103 Opsanus beta glutamine synthetase (GSase) mRNA, complete cds; nuclear gene for mitochondrial product Length = 1668 Score = 40.1 bits (20), Expect = 9.6 Identities = 26/28 (92%) Strand = Plus / Minus Query: 619 tttgtgtggcagccagctccgttccagt 646 ||||| ||||||||||| |||||||||| Sbjct: 833 tttgtatggcagccagcaccgttccagt 806
>gb|AY162466.1| Spiraea nipponica putative plastidic glutamine synthetase (GS2) mRNA, complete cds; nuclear gene for chloroplast product Length = 1665 Score = 40.1 bits (20), Expect = 9.6 Identities = 60/72 (83%), Gaps = 1/72 (1%) Strand = Plus / Minus Query: 622 gtgtggcagccagctccgttccagtcaccctggattggtttttgggtcaagggtgagcac 681 |||||||| || || || ||||||||||||| || |||||| || ||||| ||||| || Sbjct: 1014 gtgtggcatcctgcaccattccagtcaccctctatcggtttt-ggatcaagtgtgagaac 956 Query: 682 cacaccagcttg 693 ||||||||||| Sbjct: 955 aacaccagcttg 944
>emb|CR388011.14| Zebrafish DNA sequence from clone CH211-135J15 in linkage group 19, complete sequence Length = 163300 Score = 40.1 bits (20), Expect = 9.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 606 aatgtgctgtagttttgtgt 625 |||||||||||||||||||| Sbjct: 87591 aatgtgctgtagttttgtgt 87572
>gb|AY103627.1| Zea mays PCO073484 mRNA sequence Length = 1571 Score = 40.1 bits (20), Expect = 9.6 Identities = 29/32 (90%) Strand = Plus / Minus Query: 351 gggtccatgttggaggccgggcgacggtcctc 382 |||||||||||||| ||||| || |||||||| Sbjct: 1105 gggtccatgttggacgccggccggcggtcctc 1074
>emb|AL157911.4|CNS01RGB Human chromosome 14 DNA sequence BAC R-16B13 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 175548 Score = 40.1 bits (20), Expect = 9.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 606 aatgtgctgtagttttgtgt 625 |||||||||||||||||||| Sbjct: 123053 aatgtgctgtagttttgtgt 123034
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 40.1 bits (20), Expect = 9.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 207 ttttcttttccccggaagaa 226 |||||||||||||||||||| Sbjct: 5220152 ttttcttttccccggaagaa 5220133
>emb|AJ459666.1|SPU459666 Sinningia pusilla chloroplast partial ncpGS gene for glutamine synthetase, exons 7-11 Length = 636 Score = 40.1 bits (20), Expect = 9.6 Identities = 29/32 (90%) Strand = Plus / Minus Query: 622 gtgtggcagccagctccgttccagtcaccctg 653 |||||||| || || ||||||||||||||||| Sbjct: 515 gtgtggcatccggcaccgttccagtcaccctg 484
>emb|AJ459659.1|SRI459659 Sinningia richii chloroplast partial ncpGS gene for glutamine synthetase, exons 7-11 Length = 641 Score = 40.1 bits (20), Expect = 9.6 Identities = 29/32 (90%) Strand = Plus / Minus Query: 622 gtgtggcagccagctccgttccagtcaccctg 653 |||||||| ||||| || |||||||||||||| Sbjct: 524 gtgtggcatccagcaccattccagtcaccctg 493
>emb|AJ459657.1|SVA459657 Sinningia valsuganensis chloroplast partial ncpGS gene for glutamine synthetase, exons 7-11 Length = 623 Score = 40.1 bits (20), Expect = 9.6 Identities = 29/32 (90%) Strand = Plus / Minus Query: 622 gtgtggcagccagctccgttccagtcaccctg 653 |||||||| ||||| || |||||||||||||| Sbjct: 501 gtgtggcatccagcaccattccagtcaccctg 470
>emb|AJ459644.1|STU459644 Sinningia tuberosa chloroplast partial ncpGS gene for glutamine synthetase, exons 7-11 Length = 637 Score = 40.1 bits (20), Expect = 9.6 Identities = 29/32 (90%) Strand = Plus / Minus Query: 622 gtgtggcagccagctccgttccagtcaccctg 653 |||||||| ||||| || |||||||||||||| Sbjct: 515 gtgtggcatccagcaccattccagtcaccctg 484
>emb|AJ459618.1|SBR459618 Sinningia brasiliensis chloroplast partial ncpGS gene for glutamine synthetase, exons 7-11 Length = 623 Score = 40.1 bits (20), Expect = 9.6 Identities = 29/32 (90%) Strand = Plus / Minus Query: 622 gtgtggcagccagctccgttccagtcaccctg 653 |||||||| ||||| || |||||||||||||| Sbjct: 501 gtgtggcatccagcaccattccagtcaccctg 470
>emb|AJ459683.1|GHU459683 Gesneria humilis chloroplast partial ncpGS gene for glutamine synthetase, exons 7-11 Length = 644 Score = 40.1 bits (20), Expect = 9.6 Identities = 29/32 (90%) Strand = Plus / Minus Query: 622 gtgtggcagccagctccgttccagtcaccctg 653 |||||||| ||||| || |||||||||||||| Sbjct: 522 gtgtggcatccagcaccattccagtcaccctg 491
>emb|AJ459689.1|AAD459689 Achimenes admirabilis chloroplast partial ncpGS gene for glutamine synthetase, exons 7-11 Length = 618 Score = 40.1 bits (20), Expect = 9.6 Identities = 29/32 (90%) Strand = Plus / Minus Query: 622 gtgtggcagccagctccgttccagtcaccctg 653 |||||||| ||||| || |||||||||||||| Sbjct: 497 gtgtggcatccagcaccattccagtcaccctg 466
>emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB122 of Yarrowia lipolytica Length = 4003362 Score = 40.1 bits (20), Expect = 9.6 Identities = 29/32 (90%) Strand = Plus / Minus Query: 622 gtgtggcagccagctccgttccagtcaccctg 653 ||||| ||||| |||||||||||||| ||||| Sbjct: 83577 gtgtgacagccggctccgttccagtctccctg 83546
>gb|U46208.1|CRU46208 Chlamydomonas reinhardtii glutamine synthetase (GS2) mRNA, nuclear gene encoding putative chloroplast protein, complete cds Length = 1604 Score = 40.1 bits (20), Expect = 9.6 Identities = 41/48 (85%) Strand = Plus / Minus Query: 341 cacggtgtacgggtccatgttggaggccgggcgacggtcctccaggta 388 ||||||||| ||||| | ||||| || ||||| |||||||||||||| Sbjct: 1118 cacggtgtaggggtcgacgttggcagcggggcggcggtcctccaggta 1071
>emb|AL163853.4|CNS05TBM Human chromosome 14 DNA sequence BAC R-248B10 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 157985 Score = 40.1 bits (20), Expect = 9.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 606 aatgtgctgtagttttgtgt 625 |||||||||||||||||||| Sbjct: 31946 aatgtgctgtagttttgtgt 31927
>gb|M20663.1|PEAGSCY1A Pisum satiivum glutamine synthetase (cytosolic GS1) mRNA, complete cds Length = 1434 Score = 40.1 bits (20), Expect = 9.6 Identities = 51/60 (85%), Gaps = 1/60 (1%) Strand = Plus / Minus Query: 631 ccagctccgttccagtcaccctggattggtttttgggtcaagggtgagcaccacaccagc 690 ||||| || ||||||||||||| ||||| ||| ||||||| ||| || ||||||||||| Sbjct: 819 ccagcaccattccagtcacccttaattgg-tttagggtcaaaggtaagaaccacaccagc 761 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,441,317 Number of Sequences: 3902068 Number of extensions: 5441317 Number of successful extensions: 98760 Number of sequences better than 10.0: 206 Number of HSP's better than 10.0 without gapping: 197 Number of HSP's successfully gapped in prelim test: 9 Number of HSP's that attempted gapping in prelim test: 97841 Number of HSP's gapped (non-prelim): 827 length of query: 704 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 681 effective length of database: 17,143,297,704 effective search space: 11674585736424 effective search space used: 11674585736424 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
