ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd3h13
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_479168.1| Oryza sativa (japonica cultivar-group), mRNA 470 e-129
2dbj|AK071047.1| Oryza sativa (japonica cultivar-group) cDNA clon... 470 e-129
3dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 232 1e-57
4dbj|AP004988.3| Oryza sativa (japonica cultivar-group) genomic D... 232 1e-57
5dbj|AP004308.3| Oryza sativa (japonica cultivar-group) genomic D... 232 1e-57
6gb|AY664419.1| Zea mays cultivar Mo17 locus 9009, complete sequence 224 3e-55
7gb|AY664415.1| Zea mays cultivar B73 locus 9009, complete sequence 224 3e-55
8gb|AC150204.30| Medicago truncatula clone mth2-69i3, complete se... 64 6e-07
9ref|NM_001036033.1| Arabidopsis thaliana zinc ion binding AT1G29... 62 2e-06
10ref|NM_102720.3| Arabidopsis thaliana zinc ion binding AT1G29800... 62 2e-06
11gb|BT001911.1| Arabidopsis thaliana clone C105091 unknown protei... 62 2e-06
12gb|AY080740.1| Arabidopsis thaliana At1g29800 mRNA sequence 62 2e-06
13gb|AC123022.4| Homo sapiens 3 BAC RP11-36C14 (Roswell Park Cance... 46 0.15
14emb|BX816210.1|CNS0ABO3 Arabidopsis thaliana Full-length cDNA Co... 46 0.15
15gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N... 46 0.15
16emb|AL359816.16| Human DNA sequence from clone RP11-37P5 on chro... 44 0.58
17gb|AC016251.9| Homo sapiens chromosome 15, clone RP11-759A24, co... 44 0.58
18ref|XM_944087.1| PREDICTED: Homo sapiens hypothetical protein LO... 44 0.58
19ref|XM_932046.1| PREDICTED: Homo sapiens hypothetical protein LO... 44 0.58
20gb|AC007589.8| Drosophila melanogaster clone BACR20D10, complete... 42 2.3
21gb|AC105763.5| Homo sapiens BAC clone RP11-698H21 from 4, comple... 42 2.3
22gb|AC009212.5| Drosophila melanogaster, chromosome 3R, region 82... 42 2.3
23gb|AC154213.3| Mus musculus BAC clone RP24-120I12 from chromosom... 42 2.3
24gb|AE003604.4| Drosophila melanogaster chromosome 3R, section 4 ... 42 2.3
25gb|AC168214.7| Mus musculus chromosome 15, clone RP24-373K19, co... 40 9.1
26ref|XM_477400.1| Oryza sativa (japonica cultivar-group), mRNA 40 9.1
27gb|DQ080710.1| Anopheles gambiae isolate S9 haplotype 2 GPROR39 ... 40 9.1
28gb|DQ080709.1| Anopheles gambiae isolate S9 haplotype 1 GPROR39 ... 40 9.1
29gb|DQ080708.1| Anopheles gambiae isolate S8 haplotype 1 GPROR39 ... 40 9.1
30gb|DQ080707.1| Anopheles gambiae isolate S8 haplotype 2 GPROR39 ... 40 9.1
31gb|DQ080704.1| Anopheles gambiae isolate S6 haplotype 2 GPROR39 ... 40 9.1
32gb|DQ080703.1| Anopheles gambiae isolate S6 haplotype 1 GPROR39 ... 40 9.1
33gb|DQ080702.1| Anopheles gambiae isolate S5 haplotype 2 GPROR39 ... 40 9.1
34gb|DQ080701.1| Anopheles gambiae isolate S5 haplotype 1 GPROR39 ... 40 9.1
35gb|DQ080697.1| Anopheles gambiae isolate S3 haplotype 1 GPROR39 ... 40 9.1
36gb|DQ080694.1| Anopheles gambiae isolate S13 haplotype 2 GPROR39... 40 9.1
37gb|DQ080693.1| Anopheles gambiae isolate S13 haplotype 1 GPROR39... 40 9.1
38gb|DQ080692.1| Anopheles gambiae isolate S10 haplotype 2 GPROR39... 40 9.1
39gb|DQ080690.1| Anopheles gambiae isolate S1 haplotype 2 GPROR39 ... 40 9.1
40gb|DQ080689.1| Anopheles gambiae isolate S1 haplotype 1 GPROR39 ... 40 9.1
41gb|DQ080688.1| Anopheles gambiae isolate M9 haplotype 2 GPROR39 ... 40 9.1
42gb|DQ080687.1| Anopheles gambiae isolate M9 haplotype 1 GPROR39 ... 40 9.1
43gb|DQ080686.1| Anopheles gambiae isolate M8 haplotype 2 GPROR39 ... 40 9.1
44gb|DQ080685.1| Anopheles gambiae isolate M8 haplotype 1 GPROR39 ... 40 9.1
45gb|DQ080684.1| Anopheles gambiae isolate M7 haplotype 2 GPROR39 ... 40 9.1
46gb|DQ080683.1| Anopheles gambiae isolate M7 haplotype 1 GPROR39 ... 40 9.1
47gb|DQ080682.1| Anopheles gambiae isolate M6 haplotype 2 GPROR39 ... 40 9.1
48gb|DQ080681.1| Anopheles gambiae isolate M6 haplotype 1 GPROR39 ... 40 9.1
49gb|DQ080680.1| Anopheles gambiae isolate M5 haplotype 2 GPROR39 ... 40 9.1
50gb|DQ080679.1| Anopheles gambiae isolate M5 haplotype 1 GPROR39 ... 40 9.1
51gb|DQ080678.1| Anopheles gambiae isolate M4 haplotype 2 GPROR39 ... 40 9.1
52gb|DQ080677.1| Anopheles gambiae isolate M4 haplotype 1 GPROR39 ... 40 9.1
53gb|DQ080676.1| Anopheles gambiae isolate M3 haplotype 2 GPROR39 ... 40 9.1
54gb|DQ080675.1| Anopheles gambiae isolate M3 haplotype 1 GPROR39 ... 40 9.1
55gb|DQ080674.1| Anopheles gambiae isolate M2 haplotype 2 GPROR39 ... 40 9.1
56gb|DQ080673.1| Anopheles gambiae isolate M2 haplotype 1 GPROR39 ... 40 9.1
57gb|DQ080672.1| Anopheles gambiae isolate M17 haplotype 2 GPROR39... 40 9.1
58gb|DQ080671.1| Anopheles gambiae isolate M17 haplotype 1 GPROR39... 40 9.1
59gb|DQ080670.1| Anopheles gambiae isolate M15 haplotype 2 GPROR39... 40 9.1
60gb|DQ080669.1| Anopheles gambiae isolate M15 haplotype 1 GPROR39... 40 9.1
61gb|DQ080668.1| Anopheles gambiae isolate M11 haplotype 2 GPROR39... 40 9.1
62gb|DQ080667.1| Anopheles gambiae isolate M11 haplotype 1 GPROR39... 40 9.1
63gb|DQ080666.1| Anopheles gambiae isolate M10 haplotype 2 GPROR39... 40 9.1
64gb|DQ080665.1| Anopheles gambiae isolate M10 haplotype 1 GPROR39... 40 9.1
65gb|DQ080664.1| Anopheles gambiae isolate M1 haplotype 2 GPROR39 ... 40 9.1
66gb|AC145799.2| Xenopus tropicalis clone CH216-55B16, complete se... 40 9.1
67emb|BX324230.15| Zebrafish DNA sequence from clone CH211-42C5 in... 40 9.1
68emb|AL592423.8| Human DNA sequence from clone RP11-1A24 on chrom... 40 9.1
69emb|AL353871.1|ATF7K15 Arabidopsis thaliana DNA chromosome 3, BA... 40 9.1
70gb|AC123595.1| Homo sapiens chromosome 5 clone RP11-213H15, comp... 40 9.1
71gb|AC093281.2| Homo sapiens chromosome 5 clone RP11-414H23, comp... 40 9.1
72gb|AC092227.1|AC092227 Drosophila melanogaster, chromosome 2L, r... 40 9.1
73ref|XM_341818.2| PREDICTED: Rattus norvegicus ryanodine receptor... 40 9.1
74dbj|AK121387.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 9.1
75dbj|AK106524.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 9.1
76dbj|AK102876.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 9.1
77gb|AY810759.1| Schistosoma japonicum clone SJCHGC03070 unknown mRNA 40 9.1
78gb|AC154455.2| Mus musculus BAC clone RP23-185H13 from 14, compl... 40 9.1
79gb|AE003642.3| Drosophila melanogaster chromosome 2L, section 51... 40 9.1
80emb|AJ550897.1|TRU550897 Takifugu rubripes ptr1 gene for parathy... 40 9.1
81gb|AC123689.8| Mus musculus chromosome 15, clone RP23-321P10, co... 40 9.1
82dbj|AP006658.1| Lotus japonicus genomic DNA, chromosome 4, clone... 40 9.1
83gb|AC168312.8| Mus musculus chromosome 15, clone RP24-288F21, co... 40 9.1
84emb|AL732547.8| Mouse DNA sequence from clone RP23-24E11 on chro... 40 9.1 
>ref|XM_479168.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1859

 Score =  470 bits (237), Expect = e-129
 Identities = 378/425 (88%)
 Strand = Plus / Minus

                                                                        
Query: 242  tagaactagcaaaccatttttgagaatagatcatccagagctgagtacaagggttgcgca 301
            ||||||||| |||||||||| |||||||||||||| ||||||||||||| ||| || || 
Sbjct: 1550 tagaactagtaaaccattttagagaatagatcatctagagctgagtacaggggctgggcg 1491

                                                                        
Query: 302  gctctgggcttctccaccctcccaaacaggatatcggtcgtggtcaagtaggcgtcccca 361
            |||||||| ||||||||| |||||||||||||||| || ||||||||||| || || |||
Sbjct: 1490 gctctgggtttctccaccttcccaaacaggatatcagttgtggtcaagtaagcatcgcca 1431

                                                                        
Query: 362  tagaagcgcagattggtgtccgatctggttgtcaccacatttccttccagagagacccca 421
            |||||||| |||||||| || |||||||||||||| |||||||||||||  |||||||||
Sbjct: 1430 tagaagcgtagattggtctctgatctggttgtcacgacatttccttccaatgagacccca 1371

                                                                        
Query: 422  acaaatgcacctttgctgcagctgtaagtgtagcatatcccagaacctttttcacttgct 481
            ||||| ||||||||||| ||||||||||||||||| | |||||||||||||||||| || 
Sbjct: 1370 acaaaggcacctttgctacagctgtaagtgtagcagagcccagaacctttttcactggcc 1311

                                                                        
Query: 482  cgaacatctgcttcaagggctctgccaatcgggcctgctgccgcactcaatcctgcccca 541
            | |||||||||||||| ||| |||||||| || |||||||| ||||| ||||||||||||
Sbjct: 1310 ctaacatctgcttcaaaggccctgccaattggtcctgctgctgcacttaatcctgcccca 1251

                                                                        
Query: 542  agagaaagatgcatgcggctgctgaatgccttgacaactttaagatcatgaagcacaatt 601
            ||||||||||||||||| |||||||||||||||||| | ||| |||||||||| ||||||
Sbjct: 1250 agagaaagatgcatgcgactgctgaatgccttgacagccttacgatcatgaagtacaatt 1191

                                                                        
Query: 602  ataaaatctgtcaattctcctccaatctgcactccccatcccaatccaacagataaaatt 661
            ||||||||||||| ||| || |||| ||| |||||||||||||  |||||||||  ||||
Sbjct: 1190 ataaaatctgtcagttcgccaccaaactgaactccccatcccaggccaacagatgcaatt 1131

                 
Query: 662  gctga 666
            |||||
Sbjct: 1130 gctga 1126
to top
>dbj|AK071047.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023077A06, full
            insert sequence
          Length = 1859

 Score =  470 bits (237), Expect = e-129
 Identities = 378/425 (88%)
 Strand = Plus / Minus

                                                                        
Query: 242  tagaactagcaaaccatttttgagaatagatcatccagagctgagtacaagggttgcgca 301
            ||||||||| |||||||||| |||||||||||||| ||||||||||||| ||| || || 
Sbjct: 1550 tagaactagtaaaccattttagagaatagatcatctagagctgagtacaggggctgggcg 1491

                                                                        
Query: 302  gctctgggcttctccaccctcccaaacaggatatcggtcgtggtcaagtaggcgtcccca 361
            |||||||| ||||||||| |||||||||||||||| || ||||||||||| || || |||
Sbjct: 1490 gctctgggtttctccaccttcccaaacaggatatcagttgtggtcaagtaagcatcgcca 1431

                                                                        
Query: 362  tagaagcgcagattggtgtccgatctggttgtcaccacatttccttccagagagacccca 421
            |||||||| |||||||| || |||||||||||||| |||||||||||||  |||||||||
Sbjct: 1430 tagaagcgtagattggtctctgatctggttgtcacgacatttccttccaatgagacccca 1371

                                                                        
Query: 422  acaaatgcacctttgctgcagctgtaagtgtagcatatcccagaacctttttcacttgct 481
            ||||| ||||||||||||||||||||||||||||| | ||||||||||||||| || || 
Sbjct: 1370 acaaaggcacctttgctgcagctgtaagtgtagcagagcccagaacctttttccctggcc 1311

                                                                        
Query: 482  cgaacatctgcttcaagggctctgccaatcgggcctgctgccgcactcaatcctgcccca 541
            | |||||||||||||| ||| |||||||| || |||||||| ||||| ||||||||||||
Sbjct: 1310 ctaacatctgcttcaaaggccctgccaattggtcctgctgctgcacttaatcctgcccca 1251

                                                                        
Query: 542  agagaaagatgcatgcggctgctgaatgccttgacaactttaagatcatgaagcacaatt 601
            ||||||||||||||||| |||||||||||||||||| | ||| |||||||||| ||||||
Sbjct: 1250 agagaaagatgcatgcgactgctgaatgccttgacagccttacgatcatgaagtacaatt 1191

                                                                        
Query: 602  ataaaatctgtcaattctcctccaatctgcactccccatcccaatccaacagataaaatt 661
            ||||||||||||| ||| || |||| ||| |||||||||||||  |||||||||  ||||
Sbjct: 1190 ataaaatctgtcagttcgccaccaaactgaactccccatcccaggccaacagatgcaatt 1131

                 
Query: 662  gctga 666
            |||||
Sbjct: 1130 gctga 1126
to top
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  232 bits (117), Expect = 1e-57
 Identities = 168/185 (90%)
 Strand = Plus / Minus

                                                                            
Query: 430      acctttgctgcagctgtaagtgtagcatatcccagaacctttttcacttgctcgaacatc 489
                ||||||||| ||||||||||||||||| | |||||||||||||||||| || | ||||||
Sbjct: 25384890 acctttgctacagctgtaagtgtagcagagcccagaacctttttcactggccctaacatc 25384831

                                                                            
Query: 490      tgcttcaagggctctgccaatcgggcctgctgccgcactcaatcctgccccaagagaaag 549
                |||||||| ||| |||||||| || |||||||| ||||| ||||||||||||||||||||
Sbjct: 25384830 tgcttcaaaggccctgccaattggtcctgctgctgcacttaatcctgccccaagagaaag 25384771

                                                                            
Query: 550      atgcatgcggctgctgaatgccttgacaactttaagatcatgaagcacaattataaaatc 609
                ||||||||| |||||||||||||||||| | ||| |||||||||| ||||||||||||||
Sbjct: 25384770 atgcatgcgactgctgaatgccttgacagccttacgatcatgaagtacaattataaaatc 25384711

                     
Query: 610      tgtca 614
                |||||
Sbjct: 25384710 tgtca 25384706



 Score =  214 bits (108), Expect = 3e-52
 Identities = 171/192 (89%)
 Strand = Plus / Minus

                                                                            
Query: 242      tagaactagcaaaccatttttgagaatagatcatccagagctgagtacaagggttgcgca 301
                ||||||||| |||||||||| |||||||||||||| ||||||||||||| ||| || || 
Sbjct: 25385772 tagaactagtaaaccattttagagaatagatcatctagagctgagtacaggggctgggcg 25385713

                                                                            
Query: 302      gctctgggcttctccaccctcccaaacaggatatcggtcgtggtcaagtaggcgtcccca 361
                |||||||| ||||||||| |||||||||||||||| || ||||||||||| || || |||
Sbjct: 25385712 gctctgggtttctccaccttcccaaacaggatatcagttgtggtcaagtaagcatcgcca 25385653

                                                                            
Query: 362      tagaagcgcagattggtgtccgatctggttgtcaccacatttccttccagagagacccca 421
                |||||||| |||||||| || |||||||||||||| |||||||||||||  |||||||||
Sbjct: 25385652 tagaagcgtagattggtctctgatctggttgtcacgacatttccttccaatgagacccca 25385593

                            
Query: 422      acaaatgcacct 433
                ||||| ||||||
Sbjct: 25385592 acaaaggcacct 25385581
to top
>dbj|AP004988.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:B1056G08
          Length = 168173

 Score =  232 bits (117), Expect = 1e-57
 Identities = 168/185 (90%)
 Strand = Plus / Minus

                                                                         
Query: 430   acctttgctgcagctgtaagtgtagcatatcccagaacctttttcacttgctcgaacatc 489
             ||||||||| ||||||||||||||||| | |||||||||||||||||| || | ||||||
Sbjct: 77980 acctttgctacagctgtaagtgtagcagagcccagaacctttttcactggccctaacatc 77921

                                                                         
Query: 490   tgcttcaagggctctgccaatcgggcctgctgccgcactcaatcctgccccaagagaaag 549
             |||||||| ||| |||||||| || |||||||| ||||| ||||||||||||||||||||
Sbjct: 77920 tgcttcaaaggccctgccaattggtcctgctgctgcacttaatcctgccccaagagaaag 77861

                                                                         
Query: 550   atgcatgcggctgctgaatgccttgacaactttaagatcatgaagcacaattataaaatc 609
             ||||||||| |||||||||||||||||| | ||| |||||||||| ||||||||||||||
Sbjct: 77860 atgcatgcgactgctgaatgccttgacagccttacgatcatgaagtacaattataaaatc 77801

                  
Query: 610   tgtca 614
             |||||
Sbjct: 77800 tgtca 77796



 Score =  214 bits (108), Expect = 3e-52
 Identities = 171/192 (89%)
 Strand = Plus / Minus

                                                                         
Query: 242   tagaactagcaaaccatttttgagaatagatcatccagagctgagtacaagggttgcgca 301
             ||||||||| |||||||||| |||||||||||||| ||||||||||||| ||| || || 
Sbjct: 78862 tagaactagtaaaccattttagagaatagatcatctagagctgagtacaggggctgggcg 78803

                                                                         
Query: 302   gctctgggcttctccaccctcccaaacaggatatcggtcgtggtcaagtaggcgtcccca 361
             |||||||| ||||||||| |||||||||||||||| || ||||||||||| || || |||
Sbjct: 78802 gctctgggtttctccaccttcccaaacaggatatcagttgtggtcaagtaagcatcgcca 78743

                                                                         
Query: 362   tagaagcgcagattggtgtccgatctggttgtcaccacatttccttccagagagacccca 421
             |||||||| |||||||| || |||||||||||||| |||||||||||||  |||||||||
Sbjct: 78742 tagaagcgtagattggtctctgatctggttgtcacgacatttccttccaatgagacccca 78683

                         
Query: 422   acaaatgcacct 433
             ||||| ||||||
Sbjct: 78682 acaaaggcacct 78671
to top
>dbj|AP004308.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
            clone:P0552F09
          Length = 134659

 Score =  232 bits (117), Expect = 1e-57
 Identities = 168/185 (90%)
 Strand = Plus / Minus

                                                                        
Query: 430  acctttgctgcagctgtaagtgtagcatatcccagaacctttttcacttgctcgaacatc 489
            ||||||||| ||||||||||||||||| | |||||||||||||||||| || | ||||||
Sbjct: 8607 acctttgctacagctgtaagtgtagcagagcccagaacctttttcactggccctaacatc 8548

                                                                        
Query: 490  tgcttcaagggctctgccaatcgggcctgctgccgcactcaatcctgccccaagagaaag 549
            |||||||| ||| |||||||| || |||||||| ||||| ||||||||||||||||||||
Sbjct: 8547 tgcttcaaaggccctgccaattggtcctgctgctgcacttaatcctgccccaagagaaag 8488

                                                                        
Query: 550  atgcatgcggctgctgaatgccttgacaactttaagatcatgaagcacaattataaaatc 609
            ||||||||| |||||||||||||||||| | ||| |||||||||| ||||||||||||||
Sbjct: 8487 atgcatgcgactgctgaatgccttgacagccttacgatcatgaagtacaattataaaatc 8428

                 
Query: 610  tgtca 614
            |||||
Sbjct: 8427 tgtca 8423



 Score =  214 bits (108), Expect = 3e-52
 Identities = 171/192 (89%)
 Strand = Plus / Minus

                                                                        
Query: 242  tagaactagcaaaccatttttgagaatagatcatccagagctgagtacaagggttgcgca 301
            ||||||||| |||||||||| |||||||||||||| ||||||||||||| ||| || || 
Sbjct: 9489 tagaactagtaaaccattttagagaatagatcatctagagctgagtacaggggctgggcg 9430

                                                                        
Query: 302  gctctgggcttctccaccctcccaaacaggatatcggtcgtggtcaagtaggcgtcccca 361
            |||||||| ||||||||| |||||||||||||||| || ||||||||||| || || |||
Sbjct: 9429 gctctgggtttctccaccttcccaaacaggatatcagttgtggtcaagtaagcatcgcca 9370

                                                                        
Query: 362  tagaagcgcagattggtgtccgatctggttgtcaccacatttccttccagagagacccca 421
            |||||||| |||||||| || |||||||||||||| |||||||||||||  |||||||||
Sbjct: 9369 tagaagcgtagattggtctctgatctggttgtcacgacatttccttccaatgagacccca 9310

                        
Query: 422  acaaatgcacct 433
            ||||| ||||||
Sbjct: 9309 acaaaggcacct 9298
to top
>gb|AY664419.1| Zea mays cultivar Mo17 locus 9009, complete sequence
          Length = 405672

 Score =  224 bits (113), Expect = 3e-55
 Identities = 179/201 (89%)
 Strand = Plus / Minus

                                                                         
Query: 430   acctttgctgcagctgtaagtgtagcatatcccagaacctttttcacttgctcgaacatc 489
             ||||||| ||||||||||||||||||||||||||||||| |||||||| || ||||| ||
Sbjct: 41429 acctttggtgcagctgtaagtgtagcatatcccagaacccttttcactggcccgaacgtc 41370

                                                                         
Query: 490   tgcttcaagggctctgccaatcgggcctgctgccgcactcaatcctgccccaagagaaag 549
             ||| ||||  ||||||||||| || |||||||| |||||||||||||||||||| |||||
Sbjct: 41369 tgcctcaaatgctctgccaatgggtcctgctgcagcactcaatcctgccccaagtgaaag 41310

                                                                         
Query: 550   atgcatgcggctgctgaatgccttgacaactttaagatcatgaagcacaattataaaatc 609
             ||| ||||| |||||||| ||||||||| ||||| | |||||||||||||| || || ||
Sbjct: 41309 atgaatgcgactgctgaaagccttgacagctttacggtcatgaagcacaatgatgaagtc 41250

                                  
Query: 610   tgtcaattctcctccaatctg 630
             ||||| |||||||||||||||
Sbjct: 41249 tgtcagttctcctccaatctg 41229



 Score =  172 bits (87), Expect = 1e-39
 Identities = 162/187 (86%)
 Strand = Plus / Minus

                                                                         
Query: 247   ctagcaaaccatttttgagaatagatcatccagagctgagtacaagggttgcgcagctct 306
             ||||||||||||||| ||||| |||||||| ||||||||||||||||| || ||||||| 
Sbjct: 42018 ctagcaaaccattttggagaacagatcatctagagctgagtacaagggctgggcagctcg 41959

                                                                         
Query: 307   gggcttctccaccctcccaaacaggatatcggtcgtggtcaagtaggcgtccccatagaa 366
             ||||  ||||||||||||||||||||||||||| |  |||| ||| || || || |||||
Sbjct: 41958 gggccgctccaccctcccaaacaggatatcggttgccgtcaggtatgcatcaccgtagaa 41899

                                                                         
Query: 367   gcgcagattggtgtccgatctggttgtcaccacatttccttccagagagaccccaacaaa 426
             ||| |||||||| |||  |||||||||||||||||| |||||||| || |||||||| ||
Sbjct: 41898 gcgtagattggtctccattctggttgtcaccacattcccttccagtgaaaccccaacgaa 41839

                    
Query: 427   tgcacct 433
              ||||||
Sbjct: 41838 ggcacct 41832



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                 
Query: 628   ctgcactccccatcccaatccaacagataaaattgc 663
             |||||||||||||||||  |||||||||||||||||
Sbjct: 40770 ctgcactccccatcccaggccaacagataaaattgc 40735
to top
>gb|AY664415.1| Zea mays cultivar B73 locus 9009, complete sequence
          Length = 323584

 Score =  224 bits (113), Expect = 3e-55
 Identities = 179/201 (89%)
 Strand = Plus / Minus

                                                                         
Query: 430   acctttgctgcagctgtaagtgtagcatatcccagaacctttttcacttgctcgaacatc 489
             ||||||| ||||||||||||||||||||||||||||||| |||||||| || ||||| ||
Sbjct: 22081 acctttggtgcagctgtaagtgtagcatatcccagaacccttttcactggcccgaacgtc 22022

                                                                         
Query: 490   tgcttcaagggctctgccaatcgggcctgctgccgcactcaatcctgccccaagagaaag 549
             ||| ||||  ||||||||||| || |||||||| |||||||||||||||||||| |||||
Sbjct: 22021 tgcctcaaatgctctgccaatgggtcctgctgcagcactcaatcctgccccaagtgaaag 21962

                                                                         
Query: 550   atgcatgcggctgctgaatgccttgacaactttaagatcatgaagcacaattataaaatc 609
             ||| ||||| |||||||| ||||||||| ||||| | |||||||||||||| || || ||
Sbjct: 21961 atgaatgcgactgctgaaagccttgacagctttacggtcatgaagcacaatgatgaagtc 21902

                                  
Query: 610   tgtcaattctcctccaatctg 630
             ||||| |||||||||||||||
Sbjct: 21901 tgtcagttctcctccaatctg 21881



 Score =  172 bits (87), Expect = 1e-39
 Identities = 162/187 (86%)
 Strand = Plus / Minus

                                                                         
Query: 247   ctagcaaaccatttttgagaatagatcatccagagctgagtacaagggttgcgcagctct 306
             ||||||||||||||| ||||| |||||||| ||||||||||||||||| || ||||||| 
Sbjct: 22670 ctagcaaaccattttggagaacagatcatctagagctgagtacaagggctgggcagctcg 22611

                                                                         
Query: 307   gggcttctccaccctcccaaacaggatatcggtcgtggtcaagtaggcgtccccatagaa 366
             ||||  ||||||||||||||||||||||||||| |  |||| ||| || || || |||||
Sbjct: 22610 gggccgctccaccctcccaaacaggatatcggttgccgtcaggtatgcatcaccgtagaa 22551

                                                                         
Query: 367   gcgcagattggtgtccgatctggttgtcaccacatttccttccagagagaccccaacaaa 426
             ||| |||||||| |||  |||||||||||||||||| |||||||| || |||||||| ||
Sbjct: 22550 gcgtagattggtctccattctggttgtcaccacattcccttccagtgaaaccccaacgaa 22491

                    
Query: 427   tgcacct 433
              ||||||
Sbjct: 22490 ggcacct 22484



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                 
Query: 628   ctgcactccccatcccaatccaacagataaaattgc 663
             |||||||||||||||||  |||||||||||||||||
Sbjct: 21422 ctgcactccccatcccaggccaacagataaaattgc 21387
to top
>gb|AC150204.30| Medicago truncatula clone mth2-69i3, complete sequence
          Length = 115027

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 143/180 (79%)
 Strand = Plus / Minus

                                                                        
Query: 430  acctttgctgcagctgtaagtgtagcatatcccagaacctttttcacttgctcgaacatc 489
            |||||| ||||| ||||||||||| || || ||||| ||  | ||||  || |||| |||
Sbjct: 3576 acctttactgcaactgtaagtgtaacacatgccagagcccctgtcaccggcacgaagatc 3517

                                                                        
Query: 490  tgcttcaagggctctgccaatcgggcctgctgccgcactcaatcctgccccaagagaaag 549
            ||| |||||  |||| ||||  || |||||||| |||||  | || ||||||||||||| 
Sbjct: 3516 tgcctcaagcactctcccaacaggccctgctgcagcactacaaccagccccaagagaaaa 3457

                                                                        
Query: 550  atgcatgcggctgctgaatgccttgacaactttaagatcatgaagcacaattataaaatc 609
            ||||||||| |||| ||||| ||| ||  ||||   ||||||||| |||| |||||||||
Sbjct: 3456 atgcatgcgactgcagaatgtcttcacggcttttgtatcatgaagaacaactataaaatc 3397
to top
>ref|NM_001036033.1| Arabidopsis thaliana zinc ion binding AT1G29800 transcript variant
            AT1G29800.2 mRNA, complete cds
          Length = 1916

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                               
Query: 422  acaaatgcacctttgctgcagctgtaagtgtagca 456
            |||||||||||||||||||||||||| ||||||||
Sbjct: 1451 acaaatgcacctttgctgcagctgtaggtgtagca 1417
to top
>ref|NM_102720.3| Arabidopsis thaliana zinc ion binding AT1G29800 transcript variant
            AT1G29800.1 mRNA, complete cds
          Length = 1932

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                               
Query: 422  acaaatgcacctttgctgcagctgtaagtgtagca 456
            |||||||||||||||||||||||||| ||||||||
Sbjct: 1451 acaaatgcacctttgctgcagctgtaggtgtagca 1417
to top
>gb|BT001911.1| Arabidopsis thaliana clone C105091 unknown protein (At1g29800) mRNA,
            complete cds
          Length = 1564

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                               
Query: 422  acaaatgcacctttgctgcagctgtaagtgtagca 456
            |||||||||||||||||||||||||| ||||||||
Sbjct: 1316 acaaatgcacctttgctgcagctgtaggtgtagca 1282
to top
>gb|AY080740.1| Arabidopsis thaliana At1g29800 mRNA sequence
          Length = 1861

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                               
Query: 422  acaaatgcacctttgctgcagctgtaagtgtagca 456
            |||||||||||||||||||||||||| ||||||||
Sbjct: 1372 acaaatgcacctttgctgcagctgtaggtgtagca 1338
to top
>gb|AC123022.4| Homo sapiens 3 BAC RP11-36C14 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 152395

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 590  tgaagcacaattataaaatctgt 612
            |||||||||||||||||||||||
Sbjct: 2617 tgaagcacaattataaaatctgt 2639
to top
>emb|BX816210.1|CNS0ABO3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTPGH34ZD06 of Hormone Treated Callus of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1754

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 422  acaaatgcacctttgctgcagctgtaagtgtagca 456
            |||||||||||||||| ||||| ||| ||||||||
Sbjct: 1416 acaaatgcacctttgcggcagcggtaggtgtagca 1382
to top
>gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N18 genomic sequence, complete
             sequence
          Length = 101075

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 430   acctttgctgcagctgtaagtgtagca 456
             |||||||||||||||||| ||||||||
Sbjct: 60358 acctttgctgcagctgtaggtgtagca 60384
to top
>emb|AL359816.16| Human DNA sequence from clone RP11-37P5 on chromosome 10 Contains a
             ferritin light polypeptide (FTL) pseudogene, complete
             sequence
          Length = 102101

 Score = 44.1 bits (22), Expect = 0.58
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 409   cagagagaccccaacaaatgcacctttgct 438
             ||||||| |||||||| |||||||||||||
Sbjct: 18025 cagagagtccccaacagatgcacctttgct 17996
to top
>gb|AC016251.9| Homo sapiens chromosome 15, clone RP11-759A24, complete sequence
          Length = 182943

 Score = 44.1 bits (22), Expect = 0.58
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 299   gcagctctgggcttctccaccc 320
             ||||||||||||||||||||||
Sbjct: 19070 gcagctctgggcttctccaccc 19091
to top
>ref|XM_944087.1| PREDICTED: Homo sapiens hypothetical protein LOC650203 (LOC650203),
           mRNA
          Length = 1113

 Score = 44.1 bits (22), Expect = 0.58
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 299 gcagctctgggcttctccaccc 320
           ||||||||||||||||||||||
Sbjct: 461 gcagctctgggcttctccaccc 482
to top
>ref|XM_932046.1| PREDICTED: Homo sapiens hypothetical protein LOC644209 (LOC644209),
           mRNA
          Length = 1113

 Score = 44.1 bits (22), Expect = 0.58
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 299 gcagctctgggcttctccaccc 320
           ||||||||||||||||||||||
Sbjct: 461 gcagctctgggcttctccaccc 482
to top
>gb|AC007589.8| Drosophila melanogaster clone BACR20D10, complete sequence
          Length = 164712

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 621   ctccaatctgcactccccatcccaatcca 649
             |||||||||||| |||||||||| |||||
Sbjct: 88612 ctccaatctgcaatccccatccccatcca 88584
to top
>gb|AC105763.5| Homo sapiens BAC clone RP11-698H21 from 4, complete sequence
          Length = 147214

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 311    ttctccaccctcccaaacagg 331
              |||||||||||||||||||||
Sbjct: 132866 ttctccaccctcccaaacagg 132846
to top
>gb|AC009212.5| Drosophila melanogaster, chromosome 3R, region 82E-82F, BAC clone
             BACR01A18, complete sequence
          Length = 190801

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 621   ctccaatctgcactccccatcccaatcca 649
             |||||||||||| |||||||||| |||||
Sbjct: 55396 ctccaatctgcaatccccatccccatcca 55368
to top
>gb|AC154213.3| Mus musculus BAC clone RP24-120I12 from chromosome 14, complete sequence
          Length = 183773

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 301    agctctgggcttctccaccct 321
              |||||||||||||||||||||
Sbjct: 126745 agctctgggcttctccaccct 126765
to top
>gb|AE003604.4| Drosophila melanogaster chromosome 3R, section 4 of 118 of the complete
              sequence
          Length = 303434

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 621    ctccaatctgcactccccatcccaatcca 649
              |||||||||||| |||||||||| |||||
Sbjct: 183593 ctccaatctgcaatccccatccccatcca 183565
to top
>gb|AC168214.7| Mus musculus chromosome 15, clone RP24-373K19, complete sequence
          Length = 166835

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 275   tccagagctgagtacaaggg 294
             ||||||||||||||||||||
Sbjct: 87154 tccagagctgagtacaaggg 87173
to top
>ref|XM_477400.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2122

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 425  aatgcacctttgctgcagct 444
            ||||||||||||||||||||
Sbjct: 1666 aatgcacctttgctgcagct 1647
to top
>gb|DQ080710.1| Anopheles gambiae isolate S9 haplotype 2 GPROR39 olfactory receptor
           (GPRor39) gene, partial sequence
          Length = 548

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 459 tcccagaacctttttcactt 478
           ||||||||||||||||||||
Sbjct: 89  tcccagaacctttttcactt 108
to top
>gb|DQ080709.1| Anopheles gambiae isolate S9 haplotype 1 GPROR39 olfactory receptor
           (GPRor39) gene, partial sequence
          Length = 548

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 459 tcccagaacctttttcactt 478
           ||||||||||||||||||||
Sbjct: 89  tcccagaacctttttcactt 108
to top
>gb|DQ080708.1| Anopheles gambiae isolate S8 haplotype 1 GPROR39 olfactory receptor
           (GPRor39) gene, partial sequence
          Length = 502

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 459 tcccagaacctttttcactt 478
           ||||||||||||||||||||
Sbjct: 43  tcccagaacctttttcactt 62
to top
>gb|DQ080707.1| Anopheles gambiae isolate S8 haplotype 2 GPROR39 olfactory receptor
           (GPRor39) gene, partial sequence
          Length = 502

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 459 tcccagaacctttttcactt 478
           ||||||||||||||||||||
Sbjct: 43  tcccagaacctttttcactt 62
to top
>gb|DQ080704.1| Anopheles gambiae isolate S6 haplotype 2 GPROR39 olfactory receptor
           (GPRor39) gene, partial sequence
          Length = 544

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 459 tcccagaacctttttcactt 478
           ||||||||||||||||||||
Sbjct: 85  tcccagaacctttttcactt 104
to top
>gb|DQ080703.1| Anopheles gambiae isolate S6 haplotype 1 GPROR39 olfactory receptor
           (GPRor39) gene, partial sequence
          Length = 544

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 459 tcccagaacctttttcactt 478
           ||||||||||||||||||||
Sbjct: 85  tcccagaacctttttcactt 104
to top
>gb|DQ080702.1| Anopheles gambiae isolate S5 haplotype 2 GPROR39 olfactory receptor
           (GPRor39) gene, partial sequence
          Length = 548

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 459 tcccagaacctttttcactt 478
           ||||||||||||||||||||
Sbjct: 89  tcccagaacctttttcactt 108
to top
>gb|DQ080701.1| Anopheles gambiae isolate S5 haplotype 1 GPROR39 olfactory receptor
           (GPRor39) gene, partial sequence
          Length = 548

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 459 tcccagaacctttttcactt 478
           ||||||||||||||||||||
Sbjct: 89  tcccagaacctttttcactt 108
to top
>gb|DQ080697.1| Anopheles gambiae isolate S3 haplotype 1 GPROR39 olfactory receptor
           (GPRor39) gene, partial sequence
          Length = 548

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 459 tcccagaacctttttcactt 478
           ||||||||||||||||||||
Sbjct: 89  tcccagaacctttttcactt 108
to top
>gb|DQ080694.1| Anopheles gambiae isolate S13 haplotype 2 GPROR39 olfactory
           receptor (GPRor39) gene, partial sequence
          Length = 548

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 459 tcccagaacctttttcactt 478
           ||||||||||||||||||||
Sbjct: 89  tcccagaacctttttcactt 108
to top
>gb|DQ080693.1| Anopheles gambiae isolate S13 haplotype 1 GPROR39 olfactory
           receptor (GPRor39) gene, partial sequence
          Length = 548

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 459 tcccagaacctttttcactt 478
           ||||||||||||||||||||
Sbjct: 89  tcccagaacctttttcactt 108
to top
>gb|DQ080692.1| Anopheles gambiae isolate S10 haplotype 2 GPROR39 olfactory
           receptor (GPRor39) gene, partial sequence
          Length = 546

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 459 tcccagaacctttttcactt 478
           ||||||||||||||||||||
Sbjct: 87  tcccagaacctttttcactt 106
to top
>gb|DQ080690.1| Anopheles gambiae isolate S1 haplotype 2 GPROR39 olfactory receptor
           (GPRor39) gene, partial sequence
          Length = 548

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 459 tcccagaacctttttcactt 478
           ||||||||||||||||||||
Sbjct: 89  tcccagaacctttttcactt 108
to top
>gb|DQ080689.1| Anopheles gambiae isolate S1 haplotype 1 GPROR39 olfactory receptor
           (GPRor39) gene, partial sequence
          Length = 548

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 459 tcccagaacctttttcactt 478
           ||||||||||||||||||||
Sbjct: 89  tcccagaacctttttcactt 108
to top
>gb|DQ080688.1| Anopheles gambiae isolate M9 haplotype 2 GPROR39 olfactory receptor
           (GPRor39) gene, partial sequence
          Length = 548

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 459 tcccagaacctttttcactt 478
           ||||||||||||||||||||
Sbjct: 89  tcccagaacctttttcactt 108
to top
>gb|DQ080687.1| Anopheles gambiae isolate M9 haplotype 1 GPROR39 olfactory receptor
           (GPRor39) gene, partial sequence
          Length = 548

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 459 tcccagaacctttttcactt 478
           ||||||||||||||||||||
Sbjct: 89  tcccagaacctttttcactt 108
to top
>gb|DQ080686.1| Anopheles gambiae isolate M8 haplotype 2 GPROR39 olfactory receptor
           (GPRor39) gene, partial sequence
          Length = 548

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 459 tcccagaacctttttcactt 478
           ||||||||||||||||||||
Sbjct: 89  tcccagaacctttttcactt 108
to top
>gb|DQ080685.1| Anopheles gambiae isolate M8 haplotype 1 GPROR39 olfactory receptor
           (GPRor39) gene, partial sequence
          Length = 548

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 459 tcccagaacctttttcactt 478
           ||||||||||||||||||||
Sbjct: 89  tcccagaacctttttcactt 108
to top
>gb|DQ080684.1| Anopheles gambiae isolate M7 haplotype 2 GPROR39 olfactory receptor
           (GPRor39) gene, partial sequence
          Length = 548

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 459 tcccagaacctttttcactt 478
           ||||||||||||||||||||
Sbjct: 89  tcccagaacctttttcactt 108
to top
>gb|DQ080683.1| Anopheles gambiae isolate M7 haplotype 1 GPROR39 olfactory receptor
           (GPRor39) gene, partial sequence
          Length = 548

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 459 tcccagaacctttttcactt 478
           ||||||||||||||||||||
Sbjct: 89  tcccagaacctttttcactt 108
to top
>gb|DQ080682.1| Anopheles gambiae isolate M6 haplotype 2 GPROR39 olfactory receptor
           (GPRor39) gene, partial sequence
          Length = 548

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 459 tcccagaacctttttcactt 478
           ||||||||||||||||||||
Sbjct: 89  tcccagaacctttttcactt 108
to top
>gb|DQ080681.1| Anopheles gambiae isolate M6 haplotype 1 GPROR39 olfactory receptor
           (GPRor39) gene, partial sequence
          Length = 548

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 459 tcccagaacctttttcactt 478
           ||||||||||||||||||||
Sbjct: 89  tcccagaacctttttcactt 108
to top
>gb|DQ080680.1| Anopheles gambiae isolate M5 haplotype 2 GPROR39 olfactory receptor
           (GPRor39) gene, partial sequence
          Length = 546

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 459 tcccagaacctttttcactt 478
           ||||||||||||||||||||
Sbjct: 87  tcccagaacctttttcactt 106
to top
>gb|DQ080679.1| Anopheles gambiae isolate M5 haplotype 1 GPROR39 olfactory receptor
           (GPRor39) gene, partial sequence
          Length = 546

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 459 tcccagaacctttttcactt 478
           ||||||||||||||||||||
Sbjct: 87  tcccagaacctttttcactt 106
to top
>gb|DQ080678.1| Anopheles gambiae isolate M4 haplotype 2 GPROR39 olfactory receptor
           (GPRor39) gene, partial sequence
          Length = 545

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 459 tcccagaacctttttcactt 478
           ||||||||||||||||||||
Sbjct: 86  tcccagaacctttttcactt 105
to top
>gb|DQ080677.1| Anopheles gambiae isolate M4 haplotype 1 GPROR39 olfactory receptor
           (GPRor39) gene, partial sequence
          Length = 545

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 459 tcccagaacctttttcactt 478
           ||||||||||||||||||||
Sbjct: 86  tcccagaacctttttcactt 105
to top
>gb|DQ080676.1| Anopheles gambiae isolate M3 haplotype 2 GPROR39 olfactory receptor
           (GPRor39) gene, partial sequence
          Length = 548

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 459 tcccagaacctttttcactt 478
           ||||||||||||||||||||
Sbjct: 89  tcccagaacctttttcactt 108
to top
>gb|DQ080675.1| Anopheles gambiae isolate M3 haplotype 1 GPROR39 olfactory receptor
           (GPRor39) gene, partial sequence
          Length = 548

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 459 tcccagaacctttttcactt 478
           ||||||||||||||||||||
Sbjct: 89  tcccagaacctttttcactt 108
to top
>gb|DQ080674.1| Anopheles gambiae isolate M2 haplotype 2 GPROR39 olfactory receptor
           (GPRor39) gene, partial sequence
          Length = 548

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 459 tcccagaacctttttcactt 478
           ||||||||||||||||||||
Sbjct: 89  tcccagaacctttttcactt 108
to top
>gb|DQ080673.1| Anopheles gambiae isolate M2 haplotype 1 GPROR39 olfactory receptor
           (GPRor39) gene, partial sequence
          Length = 548

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 459 tcccagaacctttttcactt 478
           ||||||||||||||||||||
Sbjct: 89  tcccagaacctttttcactt 108
to top
>gb|DQ080672.1| Anopheles gambiae isolate M17 haplotype 2 GPROR39 olfactory
           receptor (GPRor39) gene, partial sequence
          Length = 548

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 459 tcccagaacctttttcactt 478
           ||||||||||||||||||||
Sbjct: 89  tcccagaacctttttcactt 108
to top
>gb|DQ080671.1| Anopheles gambiae isolate M17 haplotype 1 GPROR39 olfactory
           receptor (GPRor39) gene, partial sequence
          Length = 548

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 459 tcccagaacctttttcactt 478
           ||||||||||||||||||||
Sbjct: 89  tcccagaacctttttcactt 108
to top
>gb|DQ080670.1| Anopheles gambiae isolate M15 haplotype 2 GPROR39 olfactory
           receptor (GPRor39) gene, partial sequence
          Length = 546

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 459 tcccagaacctttttcactt 478
           ||||||||||||||||||||
Sbjct: 87  tcccagaacctttttcactt 106
to top
>gb|DQ080669.1| Anopheles gambiae isolate M15 haplotype 1 GPROR39 olfactory
           receptor (GPRor39) gene, partial sequence
          Length = 546

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 459 tcccagaacctttttcactt 478
           ||||||||||||||||||||
Sbjct: 87  tcccagaacctttttcactt 106
to top
>gb|DQ080668.1| Anopheles gambiae isolate M11 haplotype 2 GPROR39 olfactory
           receptor (GPRor39) gene, partial sequence
          Length = 548

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 459 tcccagaacctttttcactt 478
           ||||||||||||||||||||
Sbjct: 89  tcccagaacctttttcactt 108
to top
>gb|DQ080667.1| Anopheles gambiae isolate M11 haplotype 1 GPROR39 olfactory
           receptor (GPRor39) gene, partial sequence
          Length = 548

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 459 tcccagaacctttttcactt 478
           ||||||||||||||||||||
Sbjct: 89  tcccagaacctttttcactt 108
to top
>gb|DQ080666.1| Anopheles gambiae isolate M10 haplotype 2 GPROR39 olfactory
           receptor (GPRor39) gene, partial sequence
          Length = 548

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 459 tcccagaacctttttcactt 478
           ||||||||||||||||||||
Sbjct: 89  tcccagaacctttttcactt 108
to top
>gb|DQ080665.1| Anopheles gambiae isolate M10 haplotype 1 GPROR39 olfactory
           receptor (GPRor39) gene, partial sequence
          Length = 548

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 459 tcccagaacctttttcactt 478
           ||||||||||||||||||||
Sbjct: 89  tcccagaacctttttcactt 108
to top
>gb|DQ080664.1| Anopheles gambiae isolate M1 haplotype 2 GPROR39 olfactory receptor
           (GPRor39) gene, partial sequence
          Length = 456

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 459 tcccagaacctttttcactt 478
           ||||||||||||||||||||
Sbjct: 45  tcccagaacctttttcactt 64
to top
>gb|AC145799.2| Xenopus tropicalis clone CH216-55B16, complete sequence
          Length = 163674

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 17    aaaagggtgaaatgttttaa 36
             ||||||||||||||||||||
Sbjct: 28458 aaaagggtgaaatgttttaa 28477
to top
>emb|BX324230.15| Zebrafish DNA sequence from clone CH211-42C5 in linkage group 7,
            complete sequence
          Length = 179902

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 196  tttagagatatatatgtaca 215
            ||||||||||||||||||||
Sbjct: 5656 tttagagatatatatgtaca 5637
to top
>emb|AL592423.8| Human DNA sequence from clone RP11-1A24 on chromosome 6 Contains part
             of the GRM1 gene for metabotropic glutamate receptor 1 and
             a novel pseudogene, complete sequence
          Length = 53728

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 420   caacaaatgcacctttgctg 439
             ||||||||||||||||||||
Sbjct: 31133 caacaaatgcacctttgctg 31152
to top
>emb|AL353871.1|ATF7K15 Arabidopsis thaliana DNA chromosome 3, BAC clone F7K15
          Length = 110800

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                     
Query: 430   acctttgctgcagctgtaagtgtagcatatcccagaacctttttcacttgctcgaa 485
             ||||||||||| ||||||||| ||||| |  ||||| ||||| ||||  |||||||
Sbjct: 44921 acctttgctgcggctgtaagtatagcagacaccagagcctttgtcaccagctcgaa 44866
to top
>gb|AC123595.1| Homo sapiens chromosome 5 clone RP11-213H15, complete sequence
          Length = 174874

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 557    cggctgctgaatgccttgac 576
              ||||||||||||||||||||
Sbjct: 157996 cggctgctgaatgccttgac 158015
to top
>gb|AC093281.2| Homo sapiens chromosome 5 clone RP11-414H23, complete sequence
          Length = 167455

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 557    cggctgctgaatgccttgac 576
              ||||||||||||||||||||
Sbjct: 145934 cggctgctgaatgccttgac 145915
to top
>gb|AC092227.1|AC092227 Drosophila melanogaster, chromosome 2L, region 35X-35X, BAC clone
             BACR20P10, complete sequence
          Length = 157482

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 82    tgatatcctgacaatattta 101
             ||||||||||||||||||||
Sbjct: 71132 tgatatcctgacaatattta 71113
to top
>ref|XM_341818.2| PREDICTED: Rattus norvegicus ryanodine receptor 1, skeletal muscle
           (Ryr1), mRNA
          Length = 3621

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 393 tcaccacatttccttccaga 412
           ||||||||||||||||||||
Sbjct: 516 tcaccacatttccttccaga 497
to top
>dbj|AK121387.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023127P05, full
            insert sequence
          Length = 1962

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 422  acaaatgcacctttgctgcagctgtaagtgta 453
            |||||||| ||||||||||| ||||| |||||
Sbjct: 1532 acaaatgcccctttgctgcaactgtatgtgta 1501
to top
>dbj|AK106524.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-107-D09, full
            insert sequence
          Length = 3237

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 422  acaaatgcacctttgctgcagctgtaagtgta 453
            |||||||| ||||||||||| ||||| |||||
Sbjct: 2807 acaaatgcccctttgctgcaactgtatgtgta 2776
to top
>dbj|AK102876.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033112D24, full
            insert sequence
          Length = 2122

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 425  aatgcacctttgctgcagct 444
            ||||||||||||||||||||
Sbjct: 1666 aatgcacctttgctgcagct 1647
to top
>gb|AY810759.1| Schistosoma japonicum clone SJCHGC03070 unknown mRNA
          Length = 714

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 215 accactgaatgctgagacta 234
           ||||||||||||||||||||
Sbjct: 604 accactgaatgctgagacta 623
to top
>gb|AC154455.2| Mus musculus BAC clone RP23-185H13 from 14, complete sequence
          Length = 215308

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 170    tctcccaggtagggttccta 189
              ||||||||||||||||||||
Sbjct: 163147 tctcccaggtagggttccta 163166
to top
>gb|AE003642.3| Drosophila melanogaster chromosome 2L, section 51 of 83 of the complete
              sequence
          Length = 276521

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 82     tgatatcctgacaatattta 101
              ||||||||||||||||||||
Sbjct: 264819 tgatatcctgacaatattta 264838
to top
>emb|AJ550897.1|TRU550897 Takifugu rubripes ptr1 gene for parathyroid hormone receptor 1, exons
             1-13
          Length = 31774

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 436   gctgcagctgtaagtgtagcatat 459
             |||||||||||||||||| |||||
Sbjct: 10755 gctgcagctgtaagtgtatcatat 10778
to top
>gb|AC123689.8| Mus musculus chromosome 15, clone RP23-321P10, complete sequence
          Length = 218071

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 275   tccagagctgagtacaaggg 294
             ||||||||||||||||||||
Sbjct: 31199 tccagagctgagtacaaggg 31218
to top
>dbj|AP006658.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT27P02, TM0343,
             complete sequence
          Length = 92507

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 101/128 (78%)
 Strand = Plus / Plus

                                                                         
Query: 482   cgaacatctgcttcaagggctctgccaatcgggcctgctgccgcactcaatcctgcccca 541
             |||| |||||| |||||  |||| ||||  || |||||||| |||||  | || || |||
Sbjct: 65517 cgaatatctgcctcaagcactctcccaacaggccctgctgcagcactacaaccagcacca 65576

                                                                         
Query: 542   agagaaagatgcatgcggctgctgaatgccttgacaactttaagatcatgaagcacaatt 601
             ||||||| ||||||||| ||||  |||| ||| ||| |||| | |||  | || ||||||
Sbjct: 65577 agagaaaaatgcatgcgactgcaaaatgtcttcacagctttcatatcccggagaacaatt 65636

                     
Query: 602   ataaaatc 609
             ||||||||
Sbjct: 65637 ataaaatc 65644
to top
>gb|AC168312.8| Mus musculus chromosome 15, clone RP24-288F21, complete sequence
          Length = 167239

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 275   tccagagctgagtacaaggg 294
             ||||||||||||||||||||
Sbjct: 36422 tccagagctgagtacaaggg 36403
to top
>emb|AL732547.8| Mouse DNA sequence from clone RP23-24E11 on chromosome 4, complete
             sequence
          Length = 206741

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 397   cacatttccttccagagaga 416
             ||||||||||||||||||||
Sbjct: 47972 cacatttccttccagagaga 47991


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,666,107
Number of Sequences: 3902068
Number of extensions: 6666107
Number of successful extensions: 120881
Number of sequences better than 10.0: 84
Number of HSP's better than 10.0 without gapping: 83
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 120688
Number of HSP's gapped (non-prelim): 193
length of query: 668
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 645
effective length of database: 17,143,297,704
effective search space: 11057427019080
effective search space used: 11057427019080
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top