Clone Name | rbasd3g15 |
---|---|
Clone Library Name | barley_pub |
No. | Definition | Score (bits) |
E Value |
1 | gb|BC095614.1| Danio rerio NADH dehydrogenase (ubiquinone) Fe-S ... | 38 | 6.4 | 2 | ref|NM_001020633.1| Danio rerio NADH dehydrogenase (ubiquinone) ... | 38 | 6.4 | 3 | emb|CR753876.17| Zebrafish DNA sequence from clone DKEYP-116A7 i... | 38 | 6.4 |
---|
>gb|BC095614.1| Danio rerio NADH dehydrogenase (ubiquinone) Fe-S protein 5, mRNA (cDNA clone MGC:111955 IMAGE:7248997), complete cds Length = 541 Score = 38.2 bits (19), Expect = 6.4 Identities = 21/22 (95%) Strand = Plus / Plus Query: 89 tggacaagtggntgctggctca 110 ||||||||||| |||||||||| Sbjct: 110 tggacaagtggctgctggctca 131
>ref|NM_001020633.1| Danio rerio NADH dehydrogenase (ubiquinone) Fe-S protein 5 (ndufs5), mRNA Length = 541 Score = 38.2 bits (19), Expect = 6.4 Identities = 21/22 (95%) Strand = Plus / Plus Query: 89 tggacaagtggntgctggctca 110 ||||||||||| |||||||||| Sbjct: 110 tggacaagtggctgctggctca 131
>emb|CR753876.17| Zebrafish DNA sequence from clone DKEYP-116A7 in linkage group 19, complete sequence Length = 118451 Score = 38.2 bits (19), Expect = 6.4 Identities = 21/22 (95%) Strand = Plus / Minus Query: 89 tggacaagtggntgctggctca 110 ||||||||||| |||||||||| Sbjct: 57921 tggacaagtggctgctggctca 57900 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 459,359 Number of Sequences: 3902068 Number of extensions: 459359 Number of successful extensions: 27868 Number of sequences better than 10.0: 3 Number of HSP's better than 10.0 without gapping: 3 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 27865 Number of HSP's gapped (non-prelim): 3 length of query: 136 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 115 effective length of database: 17,151,101,840 effective search space: 1972376711600 effective search space used: 1972376711600 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)