ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd2p15
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|U86763.1|TAU86763 Triticum aestivum delta-type tonoplast intr... 444 e-121
2gb|AY525640.1| Triticum aestivum delta tonoplast intrinsic prote... 420 e-114
3gb|AY525641.1| Triticum aestivum delta tonoplast intrinsic prote... 416 e-113
4gb|AY525639.1| Triticum aestivum delta tonoplast intrinsic prote... 412 e-112
5dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 303 3e-79
6dbj|AP005449.3| Oryza sativa (japonica cultivar-group) genomic D... 303 3e-79
7dbj|AP004784.3| Oryza sativa (japonica cultivar-group) genomic D... 303 3e-79
8dbj|AK104464.1| Oryza sativa (japonica cultivar-group) cDNA clon... 303 3e-79
9dbj|AK104270.1| Oryza sativa (japonica cultivar-group) cDNA clon... 303 3e-79
10dbj|AK099616.1| Oryza sativa (japonica cultivar-group) cDNA clon... 303 3e-79
11dbj|AK099141.1| Oryza sativa (japonica cultivar-group) cDNA clon... 303 3e-79
12dbj|AK099015.1| Oryza sativa (japonica cultivar-group) cDNA clon... 303 3e-79
13dbj|AK073531.1| Oryza sativa (japonica cultivar-group) cDNA clon... 303 3e-79
14dbj|AK104377.1| Oryza sativa (japonica cultivar-group) cDNA clon... 295 7e-77
15dbj|AK100193.1| Oryza sativa (japonica cultivar-group) cDNA clon... 295 7e-77
16gb|AF326502.1|AF326502 Zea mays tonoplast membrane integral prot... 180 3e-42
17gb|AF326501.1|AF326501 Zea mays tonoplast membrane integral prot... 170 3e-39
18gb|AY105015.1| Zea mays PCO137646 mRNA sequence 170 3e-39
19ref|XM_467137.1| Oryza sativa (japonica cultivar-group), mRNA 167 5e-38
20dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 167 5e-38
21dbj|AP005006.3| Oryza sativa (japonica cultivar-group) genomic D... 167 5e-38
22dbj|AP005289.2| Oryza sativa (japonica cultivar-group) genomic D... 167 5e-38
23dbj|AB114830.1| Oryza sativa (japonica cultivar-group) OsTIP2 mR... 167 5e-38
24dbj|AK064728.1| Oryza sativa (japonica cultivar-group) cDNA clon... 167 5e-38
25emb|AJ307662.1|OSA307662 Oryza sativa genomic DNA fragment, chro... 167 5e-38
26gb|AY106931.1| Zea mays PCO140073 mRNA sequence 139 1e-29
27gb|AF057183.1|AF057183 Zea mays putative tonoplast aquaporin mRN... 139 1e-29
28gb|AY243804.1| Zea mays tonoplast water channel mRNA, complete cds 131 3e-27
29gb|AF326503.1|AF326503 Zea mays tonoplast membrane integral prot... 131 3e-27
30ref|XM_473424.1| Oryza sativa (japonica cultivar-group), predic... 123 6e-25
31emb|AL663000.4|OSJN00201 Oryza sativa genomic DNA, chromosome 4,... 123 6e-25
32dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 123 6e-25
33gb|AF254799.1|AF254799 Hordeum vulgare tonoplast intrinsic prote... 121 2e-24
34emb|X80266.1|HVGTIPP H.vulgare mRNA for gamma-TIP-like protein 119 1e-23
35ref|XM_470213.1| Oryza sativa (japonica cultivar-group), predic... 107 4e-20
36gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 107 4e-20
37gb|AC090485.3|AC090485 Genomic Sequence for Oryza sativa, Nippon... 107 4e-20
38dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 107 4e-20
39dbj|D25534.1|RICYK333 Oryza sativa yk333 mRNA for gamma-Tip, com... 107 4e-20
40dbj|AK110727.1| Oryza sativa (japonica cultivar-group) cDNA clon... 107 4e-20
41dbj|AK104123.1| Oryza sativa (japonica cultivar-group) cDNA clon... 107 4e-20
42dbj|AK068986.1| Oryza sativa (japonica cultivar-group) cDNA clon... 107 4e-20
43dbj|AK059438.1| Oryza sativa (japonica cultivar-group) cDNA clon... 107 4e-20
44dbj|AK058322.1| Oryza sativa (japonica cultivar-group) cDNA clon... 107 4e-20
45emb|AJ242805.1|SST242805 Sporobolus stapfianus mRNA for putative... 103 6e-19
46emb|AJ005078.2|PAAJ5078 Picea abies mRNA for aquaporin-like protein 103 6e-19
47gb|U86762.1|TAU86762 Triticum aestivum gamma-type tonoplast intr... 103 6e-19
48gb|AY243803.1| Zea mays tonoplast water channel (TIP1-1) mRNA, c... 96 1e-16
49gb|BT016300.1| Zea mays clone Contig133 mRNA sequence 88 3e-14
50gb|AY104464.1| Zea mays PCO114899 mRNA sequence 88 3e-14
51gb|AF037061.1|AF037061 Zea mays tonoplast intrinsic protein (ZmT... 88 3e-14
52ref|NM_189497.1| Oryza sativa (japonica cultivar-group), predic... 86 1e-13
53dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 86 1e-13
54gb|AF326500.1|AF326500 Zea mays tonoplast membrane integral prot... 86 1e-13
55dbj|AP003627.3| Oryza sativa (japonica cultivar-group) genomic D... 86 1e-13
56dbj|AK111768.1| Oryza sativa (japonica cultivar-group) cDNA clon... 86 1e-13
57dbj|AK111747.1| Oryza sativa (japonica cultivar-group) cDNA clon... 86 1e-13
58dbj|AB114829.1| Oryza sativa (japonica cultivar-group) OsTIP1 mR... 86 1e-13
59gb|AY112388.1| Zea mays CL24208_1 mRNA sequence 86 1e-13
60gb|AF271661.1|AF271661 Vitis berlandieri x Vitis rupestris putat... 68 3e-08
61gb|U62778.1|GHU62778 Gossypium hirsutum delta-tonoplast intrinsi... 66 1e-07
62gb|AF009567.1|AF009567 Gossypium hirsutum delta-TIP homolog (MIP... 66 1e-07
63gb|AY389618.1| Hyacinthus orientalis mitochondrial tonoplast int... 64 5e-07
64ref|NM_112495.2| Arabidopsis thaliana DELTA-TIP; water channel A... 62 2e-06
65ref|NM_124117.2| Arabidopsis thaliana AtTIP2;3; water channel AT... 62 2e-06
66ref|NM_112496.2| Arabidopsis thaliana electron carrier/ electron... 62 2e-06
67gb|BT011663.1| Arabidopsis thaliana At5g47450 mRNA, complete cds 62 2e-06
68gb|BT011212.1| Arabidopsis thaliana At5g47450 gene, complete cds 62 2e-06
69gb|AY081622.1| Arabidopsis thaliana delta tonoplast intrinsic pr... 62 2e-06
70gb|AY065181.1| Arabidopsis thaliana delta tonoplast intrinsic pr... 62 2e-06
71emb|BX823177.1|CNS0A5ZD Arabidopsis thaliana Full-length cDNA Co... 62 2e-06
72emb|BX823081.1|CNS0A5VY Arabidopsis thaliana Full-length cDNA Co... 62 2e-06
73emb|BX823757.1|CNS0A5CX Arabidopsis thaliana Full-length cDNA Co... 62 2e-06
74gb|AY085921.1| Arabidopsis thaliana clone 19689 mRNA, complete s... 62 2e-06
75dbj|AB025628.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 62 2e-06
76dbj|AB023046.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 62 2e-06
77gb|U39485.1|ATU39485 Arabidopsis thaliana delta tonoplast integr... 62 2e-06
78dbj|AB010416.1| Raphanus sativus VIP3 mRNA for delta-VM23, compl... 62 2e-06
79emb|AJ289866.2|VVI289866 Vitis vinifera mRNA for putative aquapo... 60 8e-06
80dbj|AB012270.1| Aster tripolium mRNA for SAMIPD, partial cds 56 1e-04
81gb|AC183494.1| Brassica oleracea Contig C, complete sequence 54 5e-04
82dbj|AB012269.1| Aster tripolium mRNA for SAMIPC, partial cds 54 5e-04
83gb|AF133532.1|AF133532 Mesembryanthemum crystallinum water chann... 52 0.002
84gb|L12257.1|SOYNODA Glycine max nodulin-26 mRNA, complete cds 50 0.007
85dbj|AB012271.1| Aster tripolium mRNA for SAMIPE, partial cds 50 0.007
86dbj|AB012267.1| Aster tripolium mRNA for SAMIPA, partial cds 50 0.007
87ref|NM_188624.1| Oryza sativa (japonica cultivar-group), Ozsa822... 48 0.029
88emb|X95650.1|TGTIP1GEN T.gesneriana mRNA for tonoplast intrinsic... 48 0.029
89emb|AJ314583.1|POC314583 Posidonia oceanica mRNA for putative to... 48 0.029
90emb|AJ289696.1|POC289696 Posidonia oceanica partial mRNA for put... 48 0.029
91dbj|AP001550.1| Oryza sativa (japonica cultivar-group) genomic D... 48 0.029
92dbj|AK069192.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.029
93gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete ge... 48 0.029
94gb|AF047173.1| Vernicia fordii aquaporin mRNA, complete cds 48 0.029
95gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome 46 0.11
96dbj|AK060994.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.11
97ref|NM_117838.2| Arabidopsis thaliana DELTA-TIP2/TIP2;2; water c... 44 0.45
98emb|Z97343.1|ATFCA8 Arabidopsis thaliana DNA chromosome 4, ESSA ... 44 0.45
99emb|AL161546.2|ATCHRIV46 Arabidopsis thaliana DNA chromosome 4, ... 44 0.45
100gb|AY056063.1| Arabidopsis thaliana AT4g17340/dl4705w mRNA, comp... 44 0.45
101gb|AF367283.1|AF367283 Arabidopsis thaliana AT4g17340/dl4705w mR... 44 0.45
102gb|AF326508.1|AF326508 Zea mays tonoplast membrane integral prot... 44 0.45
103gb|AF326505.1|AF326505 Zea mays tonoplast membrane integral prot... 44 0.45
104emb|BX825196.1|CNS0A4OU Arabidopsis thaliana Full-length cDNA Co... 44 0.45
105emb|BX828364.1|CNS0A340 Arabidopsis thaliana Full-length cDNA Co... 44 0.45
106gb|AY088929.1| Arabidopsis thaliana clone 99796 mRNA, complete s... 44 0.45
107gb|U39486.1|ATU39486 Arabidopsis thaliana delta tonoplast integr... 44 0.45
108dbj|AB012272.1| Aster tripolium mRNA for SAMIPF, partial cds 44 0.45
109dbj|AB012268.1| Aster tripolium mRNA for SAMIPB, partial cds 44 0.45
110emb|BX470264.22| Zebrafish DNA sequence from clone CH211-252F13 ... 42 1.8
111emb|AJ243309.1|PSA243309 Pisum sativum mRNA for putative tonopla... 42 1.8
112emb|BX824373.1|CNS0A6WG Arabidopsis thaliana Full-length cDNA Co... 42 1.8
113ref|XM_236362.3| PREDICTED: Rattus norvegicus hect (homologous t... 42 1.8
114gb|AC165149.5| Mus musculus BAC clone RP24-114C10 from chromosom... 40 7.1
115ref|NM_020416.2| Homo sapiens protein phosphatase 2 (formerly 2A... 40 7.1
116ref|NM_181876.1| Homo sapiens protein phosphatase 2 (formerly 2A... 40 7.1
117ref|XM_470886.1| Oryza sativa (japonica cultivar-group), mRNA 40 7.1
118gb|AC121551.11| Mus musculus chromosome 1, clone RP24-144H23, co... 40 7.1
119gb|AC091787.6| Oryza sativa (japonica cultivar-group) chromosome... 40 7.1
120gb|AC147922.2| Xenopus tropicalis clone CH216-98P3, complete seq... 40 7.1
121gb|AC006012.2| Homo sapiens PAC clone RP5-942I16 from 7, complet... 40 7.1
122ref|XM_804228.1| Trypanosoma cruzi strain CL Brener hypothetical... 40 7.1
123gb|AC117212.5| Mus musculus BAC clone RP23-302A24 from chromosom... 40 7.1
124emb|X70417.1|AMDIPCDNA A.majus mRNA for integral membrane protein 40 7.1
125emb|X54855.1|NTROOTSP N. tabacum mRNA for root-specific gene 40 7.1
126gb|BC021735.2| Homo sapiens protein phosphatase 2 (formerly 2A),... 40 7.1
127gb|BC045682.1| Homo sapiens protein phosphatase 2 (formerly 2A),... 40 7.1
128emb|AL606622.3|OSJN00059 Oryza sativa genomic DNA, chromosome 4,... 40 7.1
129gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome 40 7.1
130dbj|AK127386.1| Homo sapiens cDNA FLJ45468 fis, clone BRSTN2015788 40 7.1
131gb|AC068733.12| Homo sapiens chromosome 11, clone RP11-304C12, c... 40 7.1
132gb|AC073589.6| Mus musculus strain C57BL/6J chromosome 12 clone ... 40 7.1
133gb|CP000264.1| Jannaschia sp. CCS1, complete genome 40 7.1
134gb|S45406.1| TobRB7=root-specific gene regulator [Nicotiana taba... 40 7.1
135gb|AF326509.1|AF326509 Zea mays tonoplast membrane integral prot... 40 7.1
136gb|AC084327.5| Mus musculus strain C57BL6/J chromosome 6 clone R... 40 7.1
137gb|AC116317.4| Homo sapiens BAC clone RP11-1406H17 from 4, compl... 40 7.1
138gb|AF497482.1| Micromonospora echinospora calicheamicin biosynth... 40 7.1
139dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ... 40 7.1
140dbj|AK107457.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 7.1
141gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, c... 40 7.1
142emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid compl... 40 7.1
143tpe|BN000872.1| TPA: TPA_exp: Mus musculus immunoglobulin heavy ... 40 7.1

>gb|U86763.1|TAU86763 Triticum aestivum delta-type tonoplast intrinsic protein mRNA,
           complete cds
          Length = 1067

 Score =  444 bits (224), Expect = e-121
 Identities = 356/402 (88%), Gaps = 17/402 (4%)
 Strand = Plus / Minus

                                                                       
Query: 129 gcttcgatctgaaccaaacaacatgacgttcttcacatcatcgagacattc-------tg 181
           ||||||||||||||||||||||| || ||||||||||||||||| ||||||       ||
Sbjct: 932 gcttcgatctgaaccaaacaacaggatgttcttcacatcatcgaaacattcgtgagactg 873

                                                                       
Query: 182 accaccacgcacgcacttttttatgttgccgaaggcatcatggaaaccaaacaccgaacg 241
            |||||||| ||||||||||| |||||||||||||||| |||||         |||||||
Sbjct: 872 cccaccacgtacgcacttttt-atgttgccgaaggcattatgga---------ccgaacg 823

                                                                       
Query: 242 acccttcacatggatggcttagtagtcgttgctggcgacgggggtgtggttgtcgcacat 301
           || |||| ||||| |||||||||||||||||| |||||||||| |||||| ||| |||||
Sbjct: 822 actcttcccatggctggcttagtagtcgttgccggcgacggggctgtggtcgtcccacat 763

                                                                       
Query: 302 gtacaggtaccggtagacgatgccggcgaggccaccgccgatgagcgggccggcccanta 361
           ||| ||||| ||||| |||| |||||||||||||||||||||||||||||||||||| ||
Sbjct: 762 gtataggtatcggtaaacgacgccggcgaggccaccgccgatgagcgggccggcccagta 703

                                                                       
Query: 362 gatccagatgttggngaagtcgccgctggcaacggcggggccnaatgagcgtgcagggtt 421
            | ||| ||||||| ||||||||||||||||||||||||||| || ||||||||||||||
Sbjct: 702 aacccaaatgttggtgaagtcgccgctggcaacggcggggccgaaggagcgtgcagggtt 643

                                                                       
Query: 422 catggaaccgccgganaaggggccggcaacgaggatgttggccccgacgatgaagccgat 481
           |||||| |||||||| ||||||||||| |||||||||||||| ||||| |||||||||||
Sbjct: 642 catggacccgccggaaaaggggccggccacgaggatgttggcgccgacaatgaagccgat 583

                                                     
Query: 482 ggcgatgggggcgatggtgccgagggatcccttcttggggtc 523
           ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 582 ggcgatgggggcgatggtgccgagggatcccttcttggggtc 541



 Score =  139 bits (70), Expect = 1e-29
 Identities = 96/104 (92%), Gaps = 3/104 (2%)
 Strand = Plus / Minus

                                                                        
Query: 6    tgttcttattgaatcgcataaggaaactcaactgaagaattctcaaaccccaacaacttc 65
            |||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||
Sbjct: 1039 tgttcttattgaatcgcataaggaaactcaactgaaaaattctcaaaccccaccaacttc 980

                                                        
Query: 66   acaacatcacattatattacagatagagaagcatgcatcatcca 109
            |||||||||||||   ||||||||| || | |||||||||||||
Sbjct: 979  acaacatcacatt---ttacagataaaggaacatgcatcatcca 939



to top

>gb|AY525640.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;2 mRNA,
           complete cds
          Length = 853

 Score =  420 bits (212), Expect = e-114
 Identities = 250/264 (94%)
 Strand = Plus / Minus

                                                                       
Query: 260 ttagtagtcgttgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagac 319
           |||||||||||||| |||||||| | |||||| |||||||||||||| ||||||||||||
Sbjct: 801 ttagtagtcgttgccggcgacggagctgtggtcgtcgcacatgtacacgtaccggtagac 742

                                                                       
Query: 320 gatgccggcgaggccaccgccgatgagcgggccggcccantagatccagatgttggngaa 379
           || |||||||||||||||||||||||||||||||||||| |||||||||||||||| |||
Sbjct: 741 gacgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaa 682

                                                                       
Query: 380 gtcgccgctggcaacggcggggccnaatgagcgtgcagggttcatggaaccgccgganaa 439
           |||||||||||||||||||||||| || |||||||||||||||||||| |||||||| ||
Sbjct: 681 gtcgccgctggcaacggcggggccgaaggagcgtgcagggttcatggacccgccggagaa 622

                                                                       
Query: 440 ggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggt 499
           |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 621 ggggccggcaacgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatggt 562

                                   
Query: 500 gccgagggatcccttcttggggtc 523
           ||||||||| ||||||||||||||
Sbjct: 561 gccgagggaacccttcttggggtc 538



to top

>gb|AY525641.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;3 mRNA,
           complete cds
          Length = 829

 Score =  416 bits (210), Expect = e-113
 Identities = 251/266 (94%)
 Strand = Plus / Minus

                                                                       
Query: 258 gcttagtagtcgttgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtag 317
           |||||||||||||||| |||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 800 gcttagtagtcgttgccggcgacggcggtgtggtcgtcgcacatgtacaggtaccggtag 741

                                                                       
Query: 318 acgatgccggcgaggccaccgccgatgagcgggccggcccantagatccagatgttggng 377
           |||| |||||||||||||||||||||||||||||||||||| |||||||||||||||| |
Sbjct: 740 acgacgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtg 681

                                                                       
Query: 378 aagtcgccgctggcaacggcggggccnaatgagcgtgcagggttcatggaaccgccggan 437
           |||||||||||||||||||||||||| || |||||||||||||||||||| |||||||| 
Sbjct: 680 aagtcgccgctggcaacggcggggccgaaggagcgtgcagggttcatggacccgccggag 621

                                                                       
Query: 438 aaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatg 497
           ||||||||||| |||||||||||||| ||||||||||||||||||||||| || ||||||
Sbjct: 620 aaggggccggcgacgaggatgttggcgccgacgatgaagccgatggcgattggagcgatg 561

                                     
Query: 498 gtgccgagggatcccttcttggggtc 523
           ||||||||||| ||||||||||||||
Sbjct: 560 gtgccgagggaccccttcttggggtc 535



to top

>gb|AY525639.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;1 mRNA,
           complete cds
          Length = 817

 Score =  412 bits (208), Expect = e-112
 Identities = 252/268 (94%)
 Strand = Plus / Minus

                                                                       
Query: 256 tggcttagtagtcgttgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggt 315
           |||||||||||||||||| |||||||| | |||||| |||||||||||| ||||| ||||
Sbjct: 806 tggcttagtagtcgttgccggcgacggagctgtggtcgtcgcacatgtataggtatcggt 747

                                                                       
Query: 316 agacgatgccggcgaggccaccgccgatgagcgggccggcccantagatccagatgttgg 375
           |||||| |||||||||||||||||||||||||||||||||||| |||| |||||||||||
Sbjct: 746 agacgacgccggcgaggccaccgccgatgagcgggccggcccagtagacccagatgttgg 687

                                                                       
Query: 376 ngaagtcgccgctggcaacggcggggccnaatgagcgtgcagggttcatggaaccgccgg 435
            ||||||||||||||||||||||||||| || |||||||||||||||||||| |||||||
Sbjct: 686 tgaagtcgccgctggcaacggcggggccgaaggagcgtgcagggttcatggacccgccgg 627

                                                                       
Query: 436 anaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcga 495
           | ||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 626 agaaggggccggccacgaggatgttggcgccgacgatgaagccgatggcgatgggggcga 567

                                       
Query: 496 tggtgccgagggatcccttcttggggtc 523
           ||||||||||||||||||||||||||||
Sbjct: 566 tggtgccgagggatcccttcttggggtc 539



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score =  303 bits (153), Expect = 3e-79
 Identities = 227/253 (89%)
 Strand = Plus / Minus

                                                                            
Query: 271      tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 330
                ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 13251125 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 13251066

                                                                            
Query: 331      ggccaccgccgatgagcgggccggcccantagatccagatgttggngaagtcgccgctgg 390
                |||| ||||||| ||| |||||| |||| |||||||||||||||| | ||||||||||||
Sbjct: 13251065 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 13251006

                                                                            
Query: 391      caacggcggggccnaatgagcgtgcagggttcatggaaccgccgganaaggggccggcaa 450
                | ||||||||||| || ||||| || ||||||||||| |||||||| ||||||||||| |
Sbjct: 13251005 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 13250946

                                                                            
Query: 451      cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 510
                ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || |
Sbjct: 13250945 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 13250886

                             
Query: 511      ccttcttggggtc 523
                |||||||||||||
Sbjct: 13250885 ccttcttggggtc 13250873



to top

>dbj|AP005449.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0427E01
          Length = 146395

 Score =  303 bits (153), Expect = 3e-79
 Identities = 227/253 (89%)
 Strand = Plus / Minus

                                                                         
Query: 271   tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 330
             ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 12935 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 12876

                                                                         
Query: 331   ggccaccgccgatgagcgggccggcccantagatccagatgttggngaagtcgccgctgg 390
             |||| ||||||| ||| |||||| |||| |||||||||||||||| | ||||||||||||
Sbjct: 12875 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 12816

                                                                         
Query: 391   caacggcggggccnaatgagcgtgcagggttcatggaaccgccgganaaggggccggcaa 450
             | ||||||||||| || ||||| || ||||||||||| |||||||| ||||||||||| |
Sbjct: 12815 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 12756

                                                                         
Query: 451   cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 510
             ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || |
Sbjct: 12755 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 12696

                          
Query: 511   ccttcttggggtc 523
             |||||||||||||
Sbjct: 12695 ccttcttggggtc 12683



to top

>dbj|AP004784.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
              clone:OSJNBa0012F14
          Length = 168629

 Score =  303 bits (153), Expect = 3e-79
 Identities = 227/253 (89%)
 Strand = Plus / Minus

                                                                          
Query: 271    tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 330
              ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 168313 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 168254

                                                                          
Query: 331    ggccaccgccgatgagcgggccggcccantagatccagatgttggngaagtcgccgctgg 390
              |||| ||||||| ||| |||||| |||| |||||||||||||||| | ||||||||||||
Sbjct: 168253 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 168194

                                                                          
Query: 391    caacggcggggccnaatgagcgtgcagggttcatggaaccgccgganaaggggccggcaa 450
              | ||||||||||| || ||||| || ||||||||||| |||||||| ||||||||||| |
Sbjct: 168193 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 168134

                                                                          
Query: 451    cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 510
              ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || |
Sbjct: 168133 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 168074

                           
Query: 511    ccttcttggggtc 523
              |||||||||||||
Sbjct: 168073 ccttcttggggtc 168061



to top

>dbj|AK104464.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C06, full
           insert sequence
          Length = 1194

 Score =  303 bits (153), Expect = 3e-79
 Identities = 227/253 (89%)
 Strand = Plus / Minus

                                                                       
Query: 271 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 330
           ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 825 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 766

                                                                       
Query: 331 ggccaccgccgatgagcgggccggcccantagatccagatgttggngaagtcgccgctgg 390
           |||| ||||||| ||| |||||| |||| |||||||||||||||| | ||||||||||||
Sbjct: 765 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 706

                                                                       
Query: 391 caacggcggggccnaatgagcgtgcagggttcatggaaccgccgganaaggggccggcaa 450
           | ||||||||||| || ||||| || ||||||||||| |||||||| ||||||||||| |
Sbjct: 705 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 646

                                                                       
Query: 451 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 510
           ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || |
Sbjct: 645 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 586

                        
Query: 511 ccttcttggggtc 523
           |||||||||||||
Sbjct: 585 ccttcttggggtc 573



to top

>dbj|AK104270.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-F03, full
           insert sequence
          Length = 1214

 Score =  303 bits (153), Expect = 3e-79
 Identities = 227/253 (89%)
 Strand = Plus / Minus

                                                                       
Query: 271 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 330
           ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 827 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 768

                                                                       
Query: 331 ggccaccgccgatgagcgggccggcccantagatccagatgttggngaagtcgccgctgg 390
           |||| ||||||| ||| |||||| |||| |||||||||||||||| | ||||||||||||
Sbjct: 767 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 708

                                                                       
Query: 391 caacggcggggccnaatgagcgtgcagggttcatggaaccgccgganaaggggccggcaa 450
           | ||||||||||| || ||||| || ||||||||||| |||||||| ||||||||||| |
Sbjct: 707 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 648

                                                                       
Query: 451 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 510
           ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || |
Sbjct: 647 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 588

                        
Query: 511 ccttcttggggtc 523
           |||||||||||||
Sbjct: 587 ccttcttggggtc 575



to top

>dbj|AK099616.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013050J20, full
           insert sequence
          Length = 1197

 Score =  303 bits (153), Expect = 3e-79
 Identities = 227/253 (89%)
 Strand = Plus / Minus

                                                                       
Query: 271 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 330
           ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 828 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 769

                                                                       
Query: 331 ggccaccgccgatgagcgggccggcccantagatccagatgttggngaagtcgccgctgg 390
           |||| ||||||| ||| |||||| |||| |||||||||||||||| | ||||||||||||
Sbjct: 768 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 709

                                                                       
Query: 391 caacggcggggccnaatgagcgtgcagggttcatggaaccgccgganaaggggccggcaa 450
           | ||||||||||| || ||||| || ||||||||||| |||||||| ||||||||||| |
Sbjct: 708 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 649

                                                                       
Query: 451 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 510
           ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || |
Sbjct: 648 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 589

                        
Query: 511 ccttcttggggtc 523
           |||||||||||||
Sbjct: 588 ccttcttggggtc 576



to top

>dbj|AK099141.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023055A02, full
           insert sequence
          Length = 1195

 Score =  303 bits (153), Expect = 3e-79
 Identities = 227/253 (89%)
 Strand = Plus / Minus

                                                                       
Query: 271 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 330
           ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 826 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 767

                                                                       
Query: 331 ggccaccgccgatgagcgggccggcccantagatccagatgttggngaagtcgccgctgg 390
           |||| ||||||| ||| |||||| |||| |||||||||||||||| | ||||||||||||
Sbjct: 766 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 707

                                                                       
Query: 391 caacggcggggccnaatgagcgtgcagggttcatggaaccgccgganaaggggccggcaa 450
           | ||||||||||| || ||||| || ||||||||||| |||||||| ||||||||||| |
Sbjct: 706 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 647

                                                                       
Query: 451 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 510
           ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || |
Sbjct: 646 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 587

                        
Query: 511 ccttcttggggtc 523
           |||||||||||||
Sbjct: 586 ccttcttggggtc 574



to top

>dbj|AK099015.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013116H02, full
           insert sequence
          Length = 1202

 Score =  303 bits (153), Expect = 3e-79
 Identities = 227/253 (89%)
 Strand = Plus / Minus

                                                                       
Query: 271 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 330
           ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 828 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 769

                                                                       
Query: 331 ggccaccgccgatgagcgggccggcccantagatccagatgttggngaagtcgccgctgg 390
           |||| ||||||| ||| |||||| |||| |||||||||||||||| | ||||||||||||
Sbjct: 768 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 709

                                                                       
Query: 391 caacggcggggccnaatgagcgtgcagggttcatggaaccgccgganaaggggccggcaa 450
           | ||||||||||| || ||||| || ||||||||||| |||||||| ||||||||||| |
Sbjct: 708 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 649

                                                                       
Query: 451 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 510
           ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || |
Sbjct: 648 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 589

                        
Query: 511 ccttcttggggtc 523
           |||||||||||||
Sbjct: 588 ccttcttggggtc 576



to top

>dbj|AK073531.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033044F19, full
           insert sequence
          Length = 1220

 Score =  303 bits (153), Expect = 3e-79
 Identities = 227/253 (89%)
 Strand = Plus / Minus

                                                                       
Query: 271 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 330
           ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 826 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 767

                                                                       
Query: 331 ggccaccgccgatgagcgggccggcccantagatccagatgttggngaagtcgccgctgg 390
           |||| ||||||| ||| |||||| |||| |||||||||||||||| | ||||||||||||
Sbjct: 766 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 707

                                                                       
Query: 391 caacggcggggccnaatgagcgtgcagggttcatggaaccgccgganaaggggccggcaa 450
           | ||||||||||| || ||||| || ||||||||||| |||||||| ||||||||||| |
Sbjct: 706 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 647

                                                                       
Query: 451 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 510
           ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || |
Sbjct: 646 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 587

                        
Query: 511 ccttcttggggtc 523
           |||||||||||||
Sbjct: 586 ccttcttggggtc 574



to top

>dbj|AK104377.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-035-G09, full
           insert sequence
          Length = 1196

 Score =  295 bits (149), Expect = 7e-77
 Identities = 226/253 (89%)
 Strand = Plus / Minus

                                                                       
Query: 271 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 330
           ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 827 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 768

                                                                       
Query: 331 ggccaccgccgatgagcgggccggcccantagatccagatgttggngaagtcgccgctgg 390
           |||| ||||||| ||| |||||| |||| |||||||||||||||| | ||||||||||||
Sbjct: 767 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 708

                                                                       
Query: 391 caacggcggggccnaatgagcgtgcagggttcatggaaccgccgganaaggggccggcaa 450
           | |||||||| || || ||||| || ||||||||||| |||||||| ||||||||||| |
Sbjct: 707 cgacggcgggaccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 648

                                                                       
Query: 451 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 510
           ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || |
Sbjct: 647 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 588

                        
Query: 511 ccttcttggggtc 523
           |||||||||||||
Sbjct: 587 ccttcttggggtc 575



to top

>dbj|AK100193.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023036J06, full
           insert sequence
          Length = 1074

 Score =  295 bits (149), Expect = 7e-77
 Identities = 226/253 (89%)
 Strand = Plus / Minus

                                                                       
Query: 271 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 330
           ||||||| ||||||| ||||| | |||||||||| | ||| |||||||||| ||||||||
Sbjct: 705 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaacggtagacgaggccggcga 646

                                                                       
Query: 331 ggccaccgccgatgagcgggccggcccantagatccagatgttggngaagtcgccgctgg 390
           |||| ||||||| ||| |||||| |||| |||||||||||||||| | ||||||||||||
Sbjct: 645 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 586

                                                                       
Query: 391 caacggcggggccnaatgagcgtgcagggttcatggaaccgccgganaaggggccggcaa 450
           | ||||||||||| || ||||| || ||||||||||| |||||||| ||||||||||| |
Sbjct: 585 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 526

                                                                       
Query: 451 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 510
           ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || |
Sbjct: 525 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 466

                        
Query: 511 ccttcttggggtc 523
           |||||||||||||
Sbjct: 465 ccttcttggggtc 453



to top

>gb|AF326502.1|AF326502 Zea mays tonoplast membrane integral protein ZmTIP2-2 mRNA,
           complete cds
          Length = 1073

 Score =  180 bits (91), Expect = 3e-42
 Identities = 182/211 (86%), Gaps = 2/211 (0%)
 Strand = Plus / Minus

                                                                       
Query: 314 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccantagatccagatgtt 373
           |||||||| ||| ||||| || |||||||||||||||||| |||| |||| |||| ||  
Sbjct: 763 gtagacgaggccagcgagtccgccgccgatgagcgggccgacccagtagacccagttgcc 704

                                                                       
Query: 374 ggngaagtcg-ccgctggcaacggcggggccnaatgagcgtgcagggttcatggaaccgc 432
           || ||||||| |||| ||| ||||||||||| || ||||| || ||||||||||| ||||
Sbjct: 703 ggcgaagtcggccgc-ggcgacggcggggccgaaggagcgggcggggttcatggagccgc 645

                                                                       
Query: 433 cgganaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatggggg 492
           ||   ||||| || ||  ||||||||||||| |||||||||||||||||||||||||| |
Sbjct: 644 cgctgaagggccccgcggcgaggatgttggcgccgacgatgaagccgatggcgatgggcg 585

                                          
Query: 493 cgatggtgccgagggatcccttcttggggtc 523
           |||||||||||||||| ||||||||||||||
Sbjct: 584 cgatggtgccgagggagcccttcttggggtc 554



to top

>gb|AF326501.1|AF326501 Zea mays tonoplast membrane integral protein ZmTIP2-1 mRNA,
           complete cds
          Length = 1110

 Score =  170 bits (86), Expect = 3e-39
 Identities = 178/210 (84%)
 Strand = Plus / Minus

                                                                       
Query: 314 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccantagatccagatgtt 373
           |||||||| ||| |||||||| ||||||| |||||||||| |||| |||| |||| |   
Sbjct: 920 gtagacgaggccagcgaggccgccgccgacgagcgggccgacccagtagacccagtttcc 861

                                                                       
Query: 374 ggngaagtcgccgctggcaacggcggggccnaatgagcgtgcagggttcatggaaccgcc 433
           || |||||||||   ||| ||||||||||| || ||||| || ||||||||||| |||||
Sbjct: 860 ggcgaagtcgcccgcggcgacggcggggccgaaggagcgggcggggttcatggagccgcc 801

                                                                       
Query: 434 gganaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggc 493
           |   ||||| || ||  ||||||||||||| |||||||||||||||||||||||||| ||
Sbjct: 800 gctgaagggccccgcggcgaggatgttggcgccgacgatgaagccgatggcgatgggcgc 741

                                         
Query: 494 gatggtgccgagggatcccttcttggggtc 523
           |||||||||||| || ||||||||||||||
Sbjct: 740 gatggtgccgagcgagcccttcttggggtc 711



to top

>gb|AY105015.1| Zea mays PCO137646 mRNA sequence
          Length = 1238

 Score =  170 bits (86), Expect = 3e-39
 Identities = 178/210 (84%)
 Strand = Plus / Minus

                                                                       
Query: 314 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccantagatccagatgtt 373
           |||||||| ||| |||||||| ||||||| |||||||||| |||| |||| |||| |   
Sbjct: 919 gtagacgaggccagcgaggccgccgccgacgagcgggccgacccagtagacccagtttcc 860

                                                                       
Query: 374 ggngaagtcgccgctggcaacggcggggccnaatgagcgtgcagggttcatggaaccgcc 433
           || |||||||||   ||| ||||||||||| || ||||| || ||||||||||| |||||
Sbjct: 859 ggcgaagtcgcccgcggcgacggcggggccgaaggagcgggcggggttcatggagccgcc 800

                                                                       
Query: 434 gganaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggc 493
           |   ||||| || ||  ||||||||||||| |||||||||||||||||||||||||| ||
Sbjct: 799 gctgaagggccccgcggcgaggatgttggcgccgacgatgaagccgatggcgatgggcgc 740

                                         
Query: 494 gatggtgccgagggatcccttcttggggtc 523
           |||||||||||| || ||||||||||||||
Sbjct: 739 gatggtgccgagcgagcccttcttggggtc 710



to top

>ref|XM_467137.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 747

 Score =  167 bits (84), Expect = 5e-38
 Identities = 170/200 (85%)
 Strand = Plus / Minus

                                                                       
Query: 324 ccggcgaggccaccgccgatgagcgggccggcccantagatccagatgttggngaagtcg 383
           ||||||||||| |||||||| ||||||||| |||| |||| |||| ||   | ||||| |
Sbjct: 683 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 624

                                                                       
Query: 384 ccgctggcaacggcggggccnaatgagcgtgcagggttcatggaaccgccgganaagggg 443
           |||  ||| ||||||||||| || ||||| || ||||||||||| ||||||   || |||
Sbjct: 623 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 564

                                                                       
Query: 444 ccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccg 503
           |||||  ||||||||||||| ||||||||||||||||| |||||||| ||||||||||||
Sbjct: 563 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 504

                               
Query: 504 agggatcccttcttggggtc 523
           || ||||||||||| |||||
Sbjct: 503 agcgatcccttcttcgggtc 484



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  167 bits (84), Expect = 5e-38
 Identities = 170/200 (85%)
 Strand = Plus / Plus

                                                                            
Query: 324      ccggcgaggccaccgccgatgagcgggccggcccantagatccagatgttggngaagtcg 383
                ||||||||||| |||||||| ||||||||| |||| |||| |||| ||   | ||||| |
Sbjct: 26627183 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 26627242

                                                                            
Query: 384      ccgctggcaacggcggggccnaatgagcgtgcagggttcatggaaccgccgganaagggg 443
                |||  ||| ||||||||||| || ||||| || ||||||||||| ||||||   || |||
Sbjct: 26627243 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 26627302

                                                                            
Query: 444      ccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccg 503
                |||||  ||||||||||||| ||||||||||||||||| |||||||| ||||||||||||
Sbjct: 26627303 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 26627362

                                    
Query: 504      agggatcccttcttggggtc 523
                || ||||||||||| |||||
Sbjct: 26627363 agcgatcccttcttcgggtc 26627382



to top

>dbj|AP005006.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0519E06
          Length = 170634

 Score =  167 bits (84), Expect = 5e-38
 Identities = 170/200 (85%)
 Strand = Plus / Plus

                                                                          
Query: 324    ccggcgaggccaccgccgatgagcgggccggcccantagatccagatgttggngaagtcg 383
              ||||||||||| |||||||| ||||||||| |||| |||| |||| ||   | ||||| |
Sbjct: 169564 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 169623

                                                                          
Query: 384    ccgctggcaacggcggggccnaatgagcgtgcagggttcatggaaccgccgganaagggg 443
              |||  ||| ||||||||||| || ||||| || ||||||||||| ||||||   || |||
Sbjct: 169624 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 169683

                                                                          
Query: 444    ccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccg 503
              |||||  ||||||||||||| ||||||||||||||||| |||||||| ||||||||||||
Sbjct: 169684 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 169743

                                  
Query: 504    agggatcccttcttggggtc 523
              || ||||||||||| |||||
Sbjct: 169744 agcgatcccttcttcgggtc 169763



to top

>dbj|AP005289.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1112_F09
          Length = 139371

 Score =  167 bits (84), Expect = 5e-38
 Identities = 170/200 (85%)
 Strand = Plus / Plus

                                                                         
Query: 324   ccggcgaggccaccgccgatgagcgggccggcccantagatccagatgttggngaagtcg 383
             ||||||||||| |||||||| ||||||||| |||| |||| |||| ||   | ||||| |
Sbjct: 61344 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 61403

                                                                         
Query: 384   ccgctggcaacggcggggccnaatgagcgtgcagggttcatggaaccgccgganaagggg 443
             |||  ||| ||||||||||| || ||||| || ||||||||||| ||||||   || |||
Sbjct: 61404 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 61463

                                                                         
Query: 444   ccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccg 503
             |||||  ||||||||||||| ||||||||||||||||| |||||||| ||||||||||||
Sbjct: 61464 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 61523

                                 
Query: 504   agggatcccttcttggggtc 523
             || ||||||||||| |||||
Sbjct: 61524 agcgatcccttcttcgggtc 61543



to top

>dbj|AB114830.1| Oryza sativa (japonica cultivar-group) OsTIP2 mRNA for tonoplast
           intrinsic protein, complete cds
          Length = 1013

 Score =  167 bits (84), Expect = 5e-38
 Identities = 170/200 (85%)
 Strand = Plus / Minus

                                                                       
Query: 324 ccggcgaggccaccgccgatgagcgggccggcccantagatccagatgttggngaagtcg 383
           ||||||||||| |||||||| ||||||||| |||| |||| |||| ||   | ||||| |
Sbjct: 756 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 697

                                                                       
Query: 384 ccgctggcaacggcggggccnaatgagcgtgcagggttcatggaaccgccgganaagggg 443
           |||  ||| ||||||||||| || ||||| || ||||||||||| ||||||   || |||
Sbjct: 696 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 637

                                                                       
Query: 444 ccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccg 503
           |||||  ||||||||||||| ||||||||||||||||| |||||||| ||||||||||||
Sbjct: 636 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 577

                               
Query: 504 agggatcccttcttggggtc 523
           || ||||||||||| |||||
Sbjct: 576 agcgatcccttcttcgggtc 557



to top

>dbj|AK064728.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-120-A10, full
           insert sequence
          Length = 873

 Score =  167 bits (84), Expect = 5e-38
 Identities = 170/200 (85%)
 Strand = Plus / Minus

                                                                       
Query: 324 ccggcgaggccaccgccgatgagcgggccggcccantagatccagatgttggngaagtcg 383
           ||||||||||| |||||||| ||||||||| |||| |||| |||| ||   | ||||| |
Sbjct: 558 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 499

                                                                       
Query: 384 ccgctggcaacggcggggccnaatgagcgtgcagggttcatggaaccgccgganaagggg 443
           |||  ||| ||||||||||| || ||||| || ||||||||||| ||||||   || |||
Sbjct: 498 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 439

                                                                       
Query: 444 ccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccg 503
           |||||  ||||||||||||| ||||||||||||||||| |||||||| ||||||||||||
Sbjct: 438 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 379

                               
Query: 504 agggatcccttcttggggtc 523
           || ||||||||||| |||||
Sbjct: 378 agcgatcccttcttcgggtc 359



to top

>emb|AJ307662.1|OSA307662 Oryza sativa genomic DNA fragment, chromosome 2
          Length = 339972

 Score =  167 bits (84), Expect = 5e-38
 Identities = 170/200 (85%)
 Strand = Plus / Minus

                                                                          
Query: 324    ccggcgaggccaccgccgatgagcgggccggcccantagatccagatgttggngaagtcg 383
              ||||||||||| |||||||| ||||||||| |||| |||| |||| ||   | ||||| |
Sbjct: 250651 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 250592

                                                                          
Query: 384    ccgctggcaacggcggggccnaatgagcgtgcagggttcatggaaccgccgganaagggg 443
              |||  ||| ||||||||||| || ||||| || ||||||||||| ||||||   || |||
Sbjct: 250591 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 250532

                                                                          
Query: 444    ccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccg 503
              |||||  ||||||||||||| ||||||||||||||||| |||||||| ||||||||||||
Sbjct: 250531 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 250472

                                  
Query: 504    agggatcccttcttggggtc 523
              || ||||||||||| |||||
Sbjct: 250471 agcgatcccttcttcgggtc 250452



 Score =  109 bits (55), Expect = 9e-21
 Identities = 76/83 (91%)
 Strand = Plus / Plus

                                                                          
Query: 441    gggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtg 500
              ||||||||  ||||||||||||| ||||||||||||||||| |||||||| |||||||||
Sbjct: 332114 gggccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtg 332173

                                     
Query: 501    ccgagggatcccttcttggggtc 523
              ||||| ||||||||||| |||||
Sbjct: 332174 ccgagcgatcccttcttcgggtc 332196



to top

>gb|AY106931.1| Zea mays PCO140073 mRNA sequence
          Length = 1069

 Score =  139 bits (70), Expect = 1e-29
 Identities = 162/194 (83%)
 Strand = Plus / Minus

                                                                       
Query: 330 aggccaccgccgatgagcgggccggcccantagatccagatgttggngaagtcgccgctg 389
           ||||||||||||| ||| |||||| |||| || | |||| ||  || ||||| ||||   
Sbjct: 757 aggccaccgccgacgagggggccgacccagtacacccagttgccggcgaagttgccggcc 698

                                                                       
Query: 390 gcaacggcggggccnaatgagcgtgcagggttcatggaaccgccgganaaggggccggca 449
           || ||||||||||| || ||||| || ||||||||||| ||||||   ||||||||||| 
Sbjct: 697 gccacggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcg 638

                                                                       
Query: 450 acgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggat 509
            | ||||||||||| |||||||||||||||||||| ||||| ||||||||||| ||||| 
Sbjct: 637 gccaggatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggac 578

                         
Query: 510 cccttcttggggtc 523
           |||||||| |||||
Sbjct: 577 cccttcttcgggtc 564



to top

>gb|AF057183.1|AF057183 Zea mays putative tonoplast aquaporin mRNA, complete cds
          Length = 1060

 Score =  139 bits (70), Expect = 1e-29
 Identities = 162/194 (83%)
 Strand = Plus / Minus

                                                                       
Query: 330 aggccaccgccgatgagcgggccggcccantagatccagatgttggngaagtcgccgctg 389
           ||||||||||||| ||| |||||| |||| || | |||| ||  || ||||| ||||   
Sbjct: 739 aggccaccgccgacgagggggccgacccagtacacccagttgccggcgaagttgccggcc 680

                                                                       
Query: 390 gcaacggcggggccnaatgagcgtgcagggttcatggaaccgccgganaaggggccggca 449
           || ||||||||||| || ||||| || ||||||||||| ||||||   ||||||||||| 
Sbjct: 679 gccacggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcg 620

                                                                       
Query: 450 acgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggat 509
            | ||||||||||| |||||||||||||||||||| ||||| ||||||||||| ||||| 
Sbjct: 619 gccaggatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggac 560

                         
Query: 510 cccttcttggggtc 523
           |||||||| |||||
Sbjct: 559 cccttcttcgggtc 546



to top

>gb|AY243804.1| Zea mays tonoplast water channel mRNA, complete cds
          Length = 968

 Score =  131 bits (66), Expect = 3e-27
 Identities = 161/194 (82%)
 Strand = Plus / Minus

                                                                       
Query: 330 aggccaccgccgatgagcgggccggcccantagatccagatgttggngaagtcgccgctg 389
           ||||||||||||| ||| |||||| |||| || | |||| ||  || |||||  |||   
Sbjct: 680 aggccaccgccgacgagggggccgacccagtacacccagttgccggcgaagttaccggcc 621

                                                                       
Query: 390 gcaacggcggggccnaatgagcgtgcagggttcatggaaccgccgganaaggggccggca 449
           || ||||||||||| || ||||| || ||||||||||| ||||||   ||||||||||| 
Sbjct: 620 gccacggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcg 561

                                                                       
Query: 450 acgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggat 509
            | ||||||||||| |||||||||||||||||||| ||||| ||||||||||| ||||| 
Sbjct: 560 gccaggatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggac 501

                         
Query: 510 cccttcttggggtc 523
           |||||||| |||||
Sbjct: 500 cccttcttcgggtc 487



to top

>gb|AF326503.1|AF326503 Zea mays tonoplast membrane integral protein ZmTIP2-3 mRNA,
           complete cds
          Length = 1042

 Score =  131 bits (66), Expect = 3e-27
 Identities = 161/194 (82%)
 Strand = Plus / Minus

                                                                       
Query: 330 aggccaccgccgatgagcgggccggcccantagatccagatgttggngaagtcgccgctg 389
           ||||||||||||| ||| |||||| |||| || | |||| ||  || |||||  |||   
Sbjct: 748 aggccaccgccgacgagggggccgacccagtacacccagttgccggcgaagttaccggcc 689

                                                                       
Query: 390 gcaacggcggggccnaatgagcgtgcagggttcatggaaccgccgganaaggggccggca 449
           || ||||||||||| || ||||| || ||||||||||| ||||||   ||||||||||| 
Sbjct: 688 gccacggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcg 629

                                                                       
Query: 450 acgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggat 509
            | ||||||||||| |||||||||||||||||||| ||||| ||||||||||| ||||| 
Sbjct: 628 gccaggatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggac 569

                         
Query: 510 cccttcttggggtc 523
           |||||||| |||||
Sbjct: 568 cccttcttcgggtc 555



to top

>ref|XM_473424.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 2307

 Score =  123 bits (62), Expect = 6e-25
 Identities = 172/210 (81%)
 Strand = Plus / Minus

                                                                       
Query: 314 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccantagatccagatgtt 373
           ||||||||  ||||| |||||||| ||||| || |||||| |||| || | |||| ||  
Sbjct: 696 gtagacgagcccggccaggccaccaccgatcagtgggccgacccagtacacccagttgcc 637

                                                                       
Query: 374 ggngaagtcgccgctggcaacggcggggccnaatgagcgtgcagggttcatggaaccgcc 433
           || ||||| ||||   || ||||| ||||| || ||||| |||||||||||||||| |||
Sbjct: 636 ggcgaagttgccggccgcgacggccgggccgaaggagcgggcagggttcatggaactgcc 577

                                                                       
Query: 434 gganaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggc 493
           |   ||||| || ||  | ||||||||||| |||||||||||||||||||| ||||| ||
Sbjct: 576 gctaaagggccccgccgccaggatgttggcaccgacgatgaagccgatggccatgggcgc 517

                                         
Query: 494 gatggtgccgagggatcccttcttggggtc 523
           || |||||||||||| |||||||| |||||
Sbjct: 516 gacggtgccgagggaacccttcttcgggtc 487



to top

>emb|AL663000.4|OSJN00201 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0034G17,
             complete sequence
          Length = 127259

 Score =  123 bits (62), Expect = 6e-25
 Identities = 172/210 (81%)
 Strand = Plus / Plus

                                                                         
Query: 314   gtagacgatgccggcgaggccaccgccgatgagcgggccggcccantagatccagatgtt 373
             ||||||||  ||||| |||||||| ||||| || |||||| |||| || | |||| ||  
Sbjct: 92483 gtagacgagcccggccaggccaccaccgatcagtgggccgacccagtacacccagttgcc 92542

                                                                         
Query: 374   ggngaagtcgccgctggcaacggcggggccnaatgagcgtgcagggttcatggaaccgcc 433
             || ||||| ||||   || ||||| ||||| || ||||| |||||||||||||||| |||
Sbjct: 92543 ggcgaagttgccggccgcgacggccgggccgaaggagcgggcagggttcatggaactgcc 92602

                                                                         
Query: 434   gganaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggc 493
             |   ||||| || ||  | ||||||||||| |||||||||||||||||||| ||||| ||
Sbjct: 92603 gctaaagggccccgccgccaggatgttggcaccgacgatgaagccgatggccatgggcgc 92662

                                           
Query: 494   gatggtgccgagggatcccttcttggggtc 523
             || |||||||||||| |||||||| |||||
Sbjct: 92663 gacggtgccgagggaacccttcttcgggtc 92692



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  123 bits (62), Expect = 6e-25
 Identities = 172/210 (81%)
 Strand = Plus / Plus

                                                                            
Query: 314      gtagacgatgccggcgaggccaccgccgatgagcgggccggcccantagatccagatgtt 373
                ||||||||  ||||| |||||||| ||||| || |||||| |||| || | |||| ||  
Sbjct: 27568507 gtagacgagcccggccaggccaccaccgatcagtgggccgacccagtacacccagttgcc 27568566

                                                                            
Query: 374      ggngaagtcgccgctggcaacggcggggccnaatgagcgtgcagggttcatggaaccgcc 433
                || ||||| ||||   || ||||| ||||| || ||||| |||||||||||||||| |||
Sbjct: 27568567 ggcgaagttgccggccgcgacggccgggccgaaggagcgggcagggttcatggaactgcc 27568626

                                                                            
Query: 434      gganaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggc 493
                |   ||||| || ||  | ||||||||||| |||||||||||||||||||| ||||| ||
Sbjct: 27568627 gctaaagggccccgccgccaggatgttggcaccgacgatgaagccgatggccatgggcgc 27568686

                                              
Query: 494      gatggtgccgagggatcccttcttggggtc 523
                || |||||||||||| |||||||| |||||
Sbjct: 27568687 gacggtgccgagggaacccttcttcgggtc 27568716



 Score = 40.1 bits (20), Expect = 7.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                       
Query: 367      agatgttggngaagtcgccgctg 389
                ||||||||| |||||||||||||
Sbjct: 25620210 agatgttggtgaagtcgccgctg 25620232



to top

>gb|AF254799.1|AF254799 Hordeum vulgare tonoplast intrinsic protein 1 (TIP1), tonoplast
             intrinsic protein 2 (TIP2), and Rar1 (Rar1) genes,
             complete cds
          Length = 65979

 Score =  121 bits (61), Expect = 2e-24
 Identities = 102/116 (87%)
 Strand = Plus / Minus

                                                                         
Query: 408   gagcgtgcagggttcatggaaccgccgganaaggggccggcaacgaggatgttggccccg 467
             ||||| || ||||||||||| ||||||   ||||| |||||  ||||||||||||| |||
Sbjct: 44828 gagcgcgccgggttcatggagccgccgctgaagggcccggcggcgaggatgttggcgccg 44769

                                                                     
Query: 468   acgatgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtc 523
             |||||||||||||| || ||||| ||||||||||||||||| ||||||||||||||
Sbjct: 44768 acgatgaagccgatcgccatgggcgcgatggtgccgagggagcccttcttggggtc 44713



to top

>emb|X80266.1|HVGTIPP H.vulgare mRNA for gamma-TIP-like protein
          Length = 1020

 Score =  119 bits (60), Expect = 1e-23
 Identities = 95/107 (88%)
 Strand = Plus / Minus

                                                                       
Query: 417 gggttcatggaaccgccgganaaggggccggcaacgaggatgttggccccgacgatgaag 476
           |||||||||||  ||||||| |||| |||| | |||||||||||||| ||||||||||||
Sbjct: 659 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaag 600

                                                          
Query: 477 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtc 523
           |||||||||||||| ||||||||||| |||   ||||||||||||||
Sbjct: 599 ccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtc 553



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 314 gtagacgatgccggcgaggccaccgccgatgagcgggccggccca 358
           ||||| || |||||||||||| ||||||||||| |||||| ||||
Sbjct: 762 gtagatgacgccggcgaggccgccgccgatgagggggccgaccca 718



to top

>ref|XM_470213.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 753

 Score =  107 bits (54), Expect = 4e-20
 Identities = 69/74 (93%)
 Strand = Plus / Minus

                                                                       
Query: 450 acgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggat 509
           ||||||||||| || ||||||||||||||||||||||||||||||||||||||||||   
Sbjct: 563 acgaggatgttcgcgccgacgatgaagccgatggcgatgggggcgatggtgccgaggctg 504

                         
Query: 510 cccttcttggggtc 523
           ||||||||||||||
Sbjct: 503 cccttcttggggtc 490



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 314 gtagacgatgccggcgaggccaccgccgatgagcgggcc 352
           ||||| || |||||||||||||||||||||||| |||||
Sbjct: 699 gtagatgacgccggcgaggccaccgccgatgagtgggcc 661



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  107 bits (54), Expect = 4e-20
 Identities = 69/74 (93%)
 Strand = Plus / Plus

                                                                           
Query: 450     acgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggat 509
               ||||||||||| || ||||||||||||||||||||||||||||||||||||||||||   
Sbjct: 2544919 acgaggatgttcgcgccgacgatgaagccgatggcgatgggggcgatggtgccgaggctg 2544978

                             
Query: 510     cccttcttggggtc 523
               ||||||||||||||
Sbjct: 2544979 cccttcttggggtc 2544992



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                      
Query: 314     gtagacgatgccggcgaggccaccgccgatgagcgggcc 352
               ||||| || |||||||||||||||||||||||| |||||
Sbjct: 2544783 gtagatgacgccggcgaggccaccgccgatgagtgggcc 2544821



 Score = 40.1 bits (20), Expect = 7.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                       
Query: 367      agatgttggngaagtcgccgctg 389
                ||||||||| |||||||||||||
Sbjct: 15990586 agatgttggtgaagtcgccgctg 15990564



to top

>gb|AC090485.3|AC090485 Genomic Sequence for Oryza sativa, Nipponbare strain, clone
              OSJNBa0067N01, from chromosome 3, complete sequence
          Length = 159636

 Score =  107 bits (54), Expect = 4e-20
 Identities = 69/74 (93%)
 Strand = Plus / Minus

                                                                          
Query: 450    acgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggat 509
              ||||||||||| || ||||||||||||||||||||||||||||||||||||||||||   
Sbjct: 125175 acgaggatgttcgcgccgacgatgaagccgatggcgatgggggcgatggtgccgaggctg 125116

                            
Query: 510    cccttcttggggtc 523
              ||||||||||||||
Sbjct: 125115 cccttcttggggtc 125102



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                     
Query: 314    gtagacgatgccggcgaggccaccgccgatgagcgggcc 352
              ||||| || |||||||||||||||||||||||| |||||
Sbjct: 125311 gtagatgacgccggcgaggccaccgccgatgagtgggcc 125273



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  107 bits (54), Expect = 4e-20
 Identities = 69/74 (93%)
 Strand = Plus / Plus

                                                                           
Query: 450     acgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggat 509
               ||||||||||| || ||||||||||||||||||||||||||||||||||||||||||   
Sbjct: 2545029 acgaggatgttcgcgccgacgatgaagccgatggcgatgggggcgatggtgccgaggctg 2545088

                             
Query: 510     cccttcttggggtc 523
               ||||||||||||||
Sbjct: 2545089 cccttcttggggtc 2545102



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                      
Query: 314     gtagacgatgccggcgaggccaccgccgatgagcgggcc 352
               ||||| || |||||||||||||||||||||||| |||||
Sbjct: 2544893 gtagatgacgccggcgaggccaccgccgatgagtgggcc 2544931



 Score = 40.1 bits (20), Expect = 7.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                       
Query: 367      agatgttggngaagtcgccgctg 389
                ||||||||| |||||||||||||
Sbjct: 15985120 agatgttggtgaagtcgccgctg 15985098



to top

>dbj|D25534.1|RICYK333 Oryza sativa yk333 mRNA for gamma-Tip, complete cds
          Length = 1080

 Score =  107 bits (54), Expect = 4e-20
 Identities = 69/74 (93%)
 Strand = Plus / Minus

                                                                       
Query: 450 acgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggat 509
           ||||||||||| || ||||||||||||||||||||||||||||||||||||||||||   
Sbjct: 641 acgaggatgttcgcgccgacgatgaagccgatggcgatgggggcgatggtgccgaggctg 582

                         
Query: 510 cccttcttggggtc 523
           ||||||||||||||
Sbjct: 581 cccttcttggggtc 568



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 314 gtagacgatgccggcgaggccaccgccgatgagcgggcc 352
           ||||| || |||||||||||||||||||||||| |||||
Sbjct: 777 gtagatgacgccggcgaggccaccgccgatgagtgggcc 739



to top

>dbj|AK110727.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-170-E06, full
           insert sequence
          Length = 1024

 Score =  107 bits (54), Expect = 4e-20
 Identities = 69/74 (93%)
 Strand = Plus / Plus

                                                                       
Query: 450 acgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggat 509
           ||||||||||| || ||||||||||||||||||||||||||||||||||||||||||   
Sbjct: 328 acgaggatgttcgcgccgacgatgaagccgatggcgatgggggcgatggtgccgaggctg 387

                         
Query: 510 cccttcttggggtc 523
           ||||||||||||||
Sbjct: 388 cccttcttggggtc 401



to top

>dbj|AK104123.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-C12, full
           insert sequence
          Length = 1034

 Score =  107 bits (54), Expect = 4e-20
 Identities = 69/74 (93%)
 Strand = Plus / Minus

                                                                       
Query: 450 acgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggat 509
           ||||||||||| || ||||||||||||||||||||||||||||||||||||||||||   
Sbjct: 650 acgaggatgttcgcgccgacgatgaagccgatggcgatgggggcgatggtgccgaggctg 591

                         
Query: 510 cccttcttggggtc 523
           ||||||||||||||
Sbjct: 590 cccttcttggggtc 577



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 314 gtagacgatgccggcgaggccaccgccgatgagcgggcc 352
           ||||| || |||||||||||||||||||||||| |||||
Sbjct: 786 gtagatgacgccggcgaggccaccgccgatgagtgggcc 748



to top

>dbj|AK068986.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023003E16, full
           insert sequence
          Length = 1082

 Score =  107 bits (54), Expect = 4e-20
 Identities = 69/74 (93%)
 Strand = Plus / Minus

                                                                       
Query: 450 acgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggat 509
           ||||||||||| || ||||||||||||||||||||||||||||||||||||||||||   
Sbjct: 652 acgaggatgttcgcgccgacgatgaagccgatggcgatgggggcgatggtgccgaggctg 593

                         
Query: 510 cccttcttggggtc 523
           ||||||||||||||
Sbjct: 592 cccttcttggggtc 579



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 314 gtagacgatgccggcgaggccaccgccgatgagcgggcc 352
           ||||| || |||||||||||||||||||||||| |||||
Sbjct: 788 gtagatgacgccggcgaggccaccgccgatgagtgggcc 750



to top

>dbj|AK059438.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-027-G11, full
           insert sequence
          Length = 551

 Score =  107 bits (54), Expect = 4e-20
 Identities = 69/74 (93%)
 Strand = Plus / Minus

                                                                       
Query: 450 acgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggat 509
           ||||||||||| || ||||||||||||||||||||||||||||||||||||||||||   
Sbjct: 176 acgaggatgttcgcgccgacgatgaagccgatggcgatgggggcgatggtgccgaggctg 117

                         
Query: 510 cccttcttggggtc 523
           ||||||||||||||
Sbjct: 116 cccttcttggggtc 103



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 314 gtagacgatgccggcgaggccaccgccgatgagcgggcc 352
           ||||| || |||||||||||||||||||||||| |||||
Sbjct: 312 gtagatgacgccggcgaggccaccgccgatgagtgggcc 274



to top

>dbj|AK058322.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B06, full
           insert sequence
          Length = 1055

 Score =  107 bits (54), Expect = 4e-20
 Identities = 69/74 (93%)
 Strand = Plus / Minus

                                                                       
Query: 450 acgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggat 509
           ||||||||||| || ||||||||||||||||||||||||||||||||||||||||||   
Sbjct: 648 acgaggatgttcgcgccgacgatgaagccgatggcgatgggggcgatggtgccgaggctg 589

                         
Query: 510 cccttcttggggtc 523
           ||||||||||||||
Sbjct: 588 cccttcttggggtc 575



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 314 gtagacgatgccggcgaggccaccgccgatgagcgggcc 352
           ||||| || |||||||||||||||||||||||| |||||
Sbjct: 784 gtagatgacgccggcgaggccaccgccgatgagtgggcc 746



to top

>emb|AJ242805.1|SST242805 Sporobolus stapfianus mRNA for putative gamma tonoplast intrinsic
           protein (TIP)
          Length = 1146

 Score =  103 bits (52), Expect = 6e-19
 Identities = 93/107 (86%)
 Strand = Plus / Minus

                                                                       
Query: 417 gggttcatggaaccgccgganaaggggccggcaacgaggatgttggccccgacgatgaag 476
           |||||||||||  |||||   |||| |||| | |||||||||||||| || |||||||||
Sbjct: 675 gggttcatggacgcgccgtcgaaggcgccgccgacgaggatgttggcgcccacgatgaag 616

                                                          
Query: 477 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtc 523
           |||||||||||||||||||||||||| |||   ||||||||||||||
Sbjct: 615 ccgatggcgatgggggcgatggtgcccaggctgcccttcttggggtc 569



to top

>emb|AJ005078.2|PAAJ5078 Picea abies mRNA for aquaporin-like protein
          Length = 1007

 Score =  103 bits (52), Expect = 6e-19
 Identities = 171/212 (80%)
 Strand = Plus / Minus

                                                                       
Query: 312 cggtagacgatgccggcgaggccaccgccgatgagcgggccggcccantagatccagatg 371
           ||||||||||| ||||| ||||| || |||||||| |||||| |||| || | |||| ||
Sbjct: 775 cggtagacgataccggcaaggccgcctccgatgagggggccgacccagtacacccagttg 716

                                                                       
Query: 372 ttggngaagtcgccgctggcaacggcggggccnaatgagcgtgcagggttcatggaaccg 431
           | || |||||| |||||  |||| || ||| | || ||||| || ||||||||||| |||
Sbjct: 715 tcggtgaagtctccgctcacaacagcagggtcgaaggagcgggcggggttcatggagccg 656

                                                                       
Query: 432 ccgganaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggg 491
           || || |||||||| ||  | | ||||||||| || ||||||||||| || || ||||| 
Sbjct: 655 ccagagaaggggcccgcggccaagatgttggcgcccacgatgaagccaatagcaatggga 596

                                           
Query: 492 gcgatggtgccgagggatcccttcttggggtc 523
           ||||||||||| |||   |||||||| |||||
Sbjct: 595 gcgatggtgcccaggtcgcccttcttcgggtc 564



to top

>gb|U86762.1|TAU86762 Triticum aestivum gamma-type tonoplast intrinsic protein mRNA,
           complete cds
          Length = 1133

 Score =  103 bits (52), Expect = 6e-19
 Identities = 93/107 (86%)
 Strand = Plus / Minus

                                                                       
Query: 417 gggttcatggaaccgccgganaaggggccggcaacgaggatgttggccccgacgatgaag 476
           |||||||||||  ||||||| |||| |||| | || ||||||||||| || |||||||||
Sbjct: 690 gggttcatggacgcgccggagaaggcgccgcccaccaggatgttggcgcccacgatgaag 631

                                                          
Query: 477 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtc 523
           |||||||||||||| ||||||||||| |||   ||||||||||||||
Sbjct: 630 ccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtc 584



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 314 gtagacgatgccggcgaggccaccgccgatgagcgggccggccca 358
           ||||| || |||||||||||| ||||||||||| |||||| ||||
Sbjct: 793 gtagatgacgccggcgaggccgccgccgatgagggggccgaccca 749



to top

>gb|AY243803.1| Zea mays tonoplast water channel (TIP1-1) mRNA, complete cds
          Length = 1039

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 92/107 (85%)
 Strand = Plus / Minus

                                                                       
Query: 417 gggttcatggaaccgccgganaaggggccggcaacgaggatgttggccccgacgatgaag 476
           |||||||||||  |||||   |||| |||| | || |||||||||||||| |||||||||
Sbjct: 597 gggttcatggacgcgccgtcgaaggcgccgcccaccaggatgttggcccccacgatgaag 538

                                                          
Query: 477 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtc 523
           |||||||||||||||||||||||||| |||   |||||||| |||||
Sbjct: 537 ccgatggcgatgggggcgatggtgcccaggctgcccttcttcgggtc 491



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 314 gtagacgatgccggcgaggccaccgccgatgagcgggccggccca 358
           ||||| || |||||||||||| ||||||||||| |||||| ||||
Sbjct: 700 gtagatgacgccggcgaggccgccgccgatgagggggccgaccca 656



to top

>gb|BT016300.1| Zea mays clone Contig133 mRNA sequence
          Length = 1112

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 91/107 (85%)
 Strand = Plus / Minus

                                                                       
Query: 417 gggttcatggaaccgccgganaaggggccggcaacgaggatgttggccccgacgatgaag 476
           |||||||||||  |||||   |||| |||| | || ||||||||||| || |||||||||
Sbjct: 693 gggttcatggacgcgccgtcgaaggcgccgcccaccaggatgttggcgcccacgatgaag 634

                                                          
Query: 477 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtc 523
           |||||||||||||||||||||||||| |||   |||||||| |||||
Sbjct: 633 ccgatggcgatgggggcgatggtgcccaggctgcccttcttcgggtc 587



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 314 gtagacgatgccggcgaggccaccgccgatgag 346
           ||||| || |||||||||||| |||||||||||
Sbjct: 796 gtagatgacgccggcgaggccgccgccgatgag 764



to top

>gb|AY104464.1| Zea mays PCO114899 mRNA sequence
          Length = 1167

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 91/107 (85%)
 Strand = Plus / Minus

                                                                       
Query: 417 gggttcatggaaccgccgganaaggggccggcaacgaggatgttggccccgacgatgaag 476
           |||||||||||  |||||   |||| |||| | || |||||||||||||| |||||||||
Sbjct: 692 gggttcatggacgcgccgtcgaaggcgccgcccaccaggatgttggcccccacgatgaag 633

                                                          
Query: 477 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtc 523
           |||||||| ||||||||||||||||| |||   |||||||| |||||
Sbjct: 632 ccgatggcaatgggggcgatggtgcccaggctgcccttcttcgggtc 586



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 314 gtagacgatgccggcgaggccaccgccgatgagcgggccggccca 358
           ||||| || |||||||||||| ||||||||||| |||||| ||||
Sbjct: 795 gtagatgacgccggcgaggccgccgccgatgagggggccgaccca 751



to top

>gb|AF037061.1|AF037061 Zea mays tonoplast intrinsic protein (ZmTIP1) mRNA, complete cds
          Length = 1097

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 91/107 (85%)
 Strand = Plus / Minus

                                                                       
Query: 417 gggttcatggaaccgccgganaaggggccggcaacgaggatgttggccccgacgatgaag 476
           |||||||||||  |||||   |||| |||| | || |||||||||||||| |||||||||
Sbjct: 689 gggttcatggacgcgccgtcgaaggcgccgcccaccaggatgttggcccccacgatgaag 630

                                                          
Query: 477 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtc 523
           |||||||| ||||||||||||||||| |||   |||||||| |||||
Sbjct: 629 ccgatggcaatgggggcgatggtgcccaggctgcccttcttcgggtc 583



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 314 gtagacgatgccggcgaggccaccgccgatgag 346
           ||||| || |||||||||||| |||||||||||
Sbjct: 792 gtagatgacgccggcgaggccgccgccgatgag 760



to top

>ref|NM_189497.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 759

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 46/47 (97%)
 Strand = Plus / Minus

                                                          
Query: 451 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatg 497
           ||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 565 cgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatg 519



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 46/47 (97%)
 Strand = Plus / Plus

                                                               
Query: 451      cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatg 497
                ||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 43108862 cgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatg 43108908



 Score = 48.1 bits (24), Expect = 0.029
 Identities = 67/82 (81%)
 Strand = Plus / Minus

                                                                           
Query: 399     gggccnaatgagcgtgcagggttcatggaaccgccgganaaggggccggcaacgaggatg 458
               ||||| || ||||| || |||||||||||  |||||||  |||| ||| |  ||||||||
Sbjct: 7297471 gggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccggcgaggatg 7297412

                                     
Query: 459     ttggccccgacgatgaagccga 480
               ||||| ||||||| || |||||
Sbjct: 7297411 ttggcgccgacgacgaggccga 7297390



to top

>gb|AF326500.1|AF326500 Zea mays tonoplast membrane integral protein ZmTIP1-2 mRNA,
           complete cds
          Length = 1021

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 64/71 (90%)
 Strand = Plus / Minus

                                                                       
Query: 453 aggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccc 512
           ||||||||||| |||||||||||||||||||||||||| ||||||  |||||||   |||
Sbjct: 577 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgatgacgccgaggtcgccc 518

                      
Query: 513 ttcttggggtc 523
           |||||||||||
Sbjct: 517 ttcttggggtc 507



to top

>dbj|AP003627.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0459B04
          Length = 142475

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 46/47 (97%)
 Strand = Plus / Plus

                                                             
Query: 451    cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatg 497
              ||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 105891 cgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatg 105937



to top

>dbj|AK111768.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023066H10, full
           insert sequence
          Length = 1346

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 46/47 (97%)
 Strand = Plus / Minus

                                                          
Query: 451 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatg 497
           ||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 589 cgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatg 543



to top

>dbj|AK111747.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023050B20, full
           insert sequence
          Length = 1149

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 46/47 (97%)
 Strand = Plus / Minus

                                                          
Query: 451 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatg 497
           ||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 638 cgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatg 592



to top

>dbj|AB114829.1| Oryza sativa (japonica cultivar-group) OsTIP1 mRNA for tonoplast
           intrinsic protein, complete cds
          Length = 970

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 46/47 (97%)
 Strand = Plus / Minus

                                                          
Query: 451 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatg 497
           ||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 575 cgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatg 529



to top

>gb|AY112388.1| Zea mays CL24208_1 mRNA sequence
          Length = 833

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 64/71 (90%)
 Strand = Plus / Plus

                                                                       
Query: 453 aggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccc 512
           ||||||||||| |||||||||||||||||||||||||| ||||||  |||||||   |||
Sbjct: 434 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgatgacgccgaggtcgccc 493

                      
Query: 513 ttcttggggtc 523
           |||||||||||
Sbjct: 494 ttcttggggtc 504



to top

>gb|AF271661.1|AF271661 Vitis berlandieri x Vitis rupestris putative aquaporin TIP1 (TIP1)
           mRNA, complete cds
          Length = 1057

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 71/84 (84%)
 Strand = Plus / Minus

                                                                       
Query: 377 gaagtcgccgctggcaacggcggggccnaatgagcgtgcagggttcatggaaccgccgga 436
           ||||||||||||| | ||||||||||| || ||||| || |||||||| || || |||||
Sbjct: 675 gaagtcgccgctgacgacggcggggccgaaggagcgggcggggttcattgatccaccgga 616

                                   
Query: 437 naaggggccggcaacgaggatgtt 460
            || ||||||||| | ||||||||
Sbjct: 615 gaatgggccggcagccaggatgtt 592



to top

>gb|U62778.1|GHU62778 Gossypium hirsutum delta-tonoplast intrinsic protein mRNA, complete
           cds
          Length = 997

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 60/69 (86%)
 Strand = Plus / Minus

                                                                       
Query: 455 gatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccctt 514
           ||||||||| || || |||||||||||||| ||||| || ||||| ||||| ||||||||
Sbjct: 592 gatgttggcaccaacaatgaagccgatggcaatgggtgcaatggtcccgagtgatccctt 533

                    
Query: 515 cttggggtc 523
           ||| |||||
Sbjct: 532 ctttgggtc 524



to top

>gb|AF009567.1|AF009567 Gossypium hirsutum delta-TIP homolog (MIP) mRNA, partial cds
          Length = 316

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 60/69 (86%)
 Strand = Plus / Minus

                                                                       
Query: 455 gatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccctt 514
           ||||||||| || || |||||||||||||| ||||| || ||||| ||||| ||||||||
Sbjct: 289 gatgttggcaccaacaatgaagccgatggcaatgggtgcaatggtcccgagtgatccctt 230

                    
Query: 515 cttggggtc 523
           ||| |||||
Sbjct: 229 ctttgggtc 221



to top

>gb|AY389618.1| Hyacinthus orientalis mitochondrial tonoplast intrinsic protein
           (TIP1) mRNA, partial cds
          Length = 662

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 453 aggatgttggccccgacgatgaagccgatggcgatgggggcgat 496
           |||||||||||||| |||||||||||||| |||||||| |||||
Sbjct: 556 aggatgttggcccccacgatgaagccgatcgcgatgggcgcgat 513



to top

>ref|NM_112495.2| Arabidopsis thaliana DELTA-TIP; water channel AT3G16240 (DELTA-TIP)
           mRNA, complete cds
          Length = 1125

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 90/110 (81%)
 Strand = Plus / Minus

                                                                       
Query: 411 cgtgcagggttcatggaaccgccgganaaggggccggcaacgaggatgttggccccgacg 470
           ||||| ||||||||||| || ||||| || || |||||  ||||||||||||| || |||
Sbjct: 709 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 650

                                                             
Query: 471 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggg 520
           || |  || |||||||  || |||||||| ||||| || |||||||||||
Sbjct: 649 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttggg 600



to top

>ref|NM_124117.2| Arabidopsis thaliana AtTIP2;3; water channel AT5G47450 (AtTIP2;3)
           mRNA, complete cds
          Length = 1051

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Minus

                                                                       
Query: 451 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 510
           ||||||||||||| || || ||||||||||||||||| || |||||||| || || ||||
Sbjct: 597 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggtccctagcgatc 538

                  
Query: 511 ccttctt 517
           | |||||
Sbjct: 537 ctttctt 531



to top

>ref|NM_112496.2| Arabidopsis thaliana electron carrier/ electron transporter/ iron ion
            binding AT3G16250 mRNA, complete cds
          Length = 1538

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 90/110 (81%)
 Strand = Plus / Plus

                                                                        
Query: 411  cgtgcagggttcatggaaccgccgganaaggggccggcaacgaggatgttggccccgacg 470
            ||||| ||||||||||| || ||||| || || |||||  ||||||||||||| || |||
Sbjct: 1166 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 1225

                                                              
Query: 471  atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggg 520
            || |  || |||||||  || |||||||| ||||| || |||||||||||
Sbjct: 1226 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttggg 1275



to top

>gb|BT011663.1| Arabidopsis thaliana At5g47450 mRNA, complete cds
          Length = 753

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Minus

                                                                       
Query: 451 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 510
           ||||||||||||| || || ||||||||||||||||| || |||||||| || || ||||
Sbjct: 559 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggtccctagcgatc 500

                  
Query: 511 ccttctt 517
           | |||||
Sbjct: 499 ctttctt 493



to top

>gb|BT011212.1| Arabidopsis thaliana At5g47450 gene, complete cds
          Length = 853

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Minus

                                                                       
Query: 451 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 510
           ||||||||||||| || || ||||||||||||||||| || |||||||| || || ||||
Sbjct: 587 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggtccctagcgatc 528

                  
Query: 511 ccttctt 517
           | |||||
Sbjct: 527 ctttctt 521



to top

>gb|AY081622.1| Arabidopsis thaliana delta tonoplast intrinsic protein (At3g16230)
           mRNA, complete cds
          Length = 853

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 90/110 (81%)
 Strand = Plus / Minus

                                                                       
Query: 411 cgtgcagggttcatggaaccgccgganaaggggccggcaacgaggatgttggccccgacg 470
           ||||| ||||||||||| || ||||| || || |||||  ||||||||||||| || |||
Sbjct: 599 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 540

                                                             
Query: 471 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggg 520
           || |  || |||||||  || |||||||| ||||| || |||||||||||
Sbjct: 539 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttggg 490



to top

>gb|AY065181.1| Arabidopsis thaliana delta tonoplast intrinsic protein (At3g16230;
           MYA6.5) mRNA, complete cds
          Length = 929

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 90/110 (81%)
 Strand = Plus / Minus

                                                                       
Query: 411 cgtgcagggttcatggaaccgccgganaaggggccggcaacgaggatgttggccccgacg 470
           ||||| ||||||||||| || ||||| || || |||||  ||||||||||||| || |||
Sbjct: 670 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 611

                                                             
Query: 471 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggg 520
           || |  || |||||||  || |||||||| ||||| || |||||||||||
Sbjct: 610 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttggg 561



to top

>emb|BX823177.1|CNS0A5ZD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB95ZE06 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 903

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 90/110 (81%)
 Strand = Plus / Minus

                                                                       
Query: 411 cgtgcagggttcatggaaccgccgganaaggggccggcaacgaggatgttggccccgacg 470
           ||||| ||||||||||| || ||||| || || |||||  ||||||||||||| || |||
Sbjct: 647 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 588

                                                             
Query: 471 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggg 520
           || |  || |||||||  || |||||||| ||||| || |||||||||||
Sbjct: 587 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttggg 538



to top

>emb|BX823081.1|CNS0A5VY Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB88ZH07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 957

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 90/110 (81%)
 Strand = Plus / Minus

                                                                       
Query: 411 cgtgcagggttcatggaaccgccgganaaggggccggcaacgaggatgttggccccgacg 470
           ||||| ||||||||||| || ||||| || || |||||  ||||||||||||| || |||
Sbjct: 652 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 593

                                                             
Query: 471 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggg 520
           || |  || |||||||  || |||||||| ||||| || |||||||||||
Sbjct: 592 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttggg 543



to top

>emb|BX823757.1|CNS0A5CX Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS72ZD10 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 945

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 90/110 (81%)
 Strand = Plus / Minus

                                                                       
Query: 411 cgtgcagggttcatggaaccgccgganaaggggccggcaacgaggatgttggccccgacg 470
           ||||| ||||||||||| || ||||| || || |||||  ||||||||||||| || |||
Sbjct: 649 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 590

                                                             
Query: 471 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggg 520
           || |  || |||||||  || |||||||| ||||| || |||||||||||
Sbjct: 589 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttggg 540



to top

>gb|AY085921.1| Arabidopsis thaliana clone 19689 mRNA, complete sequence
          Length = 978

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 90/110 (81%)
 Strand = Plus / Minus

                                                                       
Query: 411 cgtgcagggttcatggaaccgccgganaaggggccggcaacgaggatgttggccccgacg 470
           ||||| ||||||||||| || ||||| || || |||||  ||||||||||||| || |||
Sbjct: 671 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 612

                                                             
Query: 471 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggg 520
           || |  || |||||||  || |||||||| ||||| || |||||||||||
Sbjct: 611 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttggg 562



to top

>dbj|AB025628.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNJ7
          Length = 80117

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Plus

                                                                        
Query: 451  cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 510
            ||||||||||||| || || ||||||||||||||||| || |||||||| || || ||||
Sbjct: 8647 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggtccctagcgatc 8706

                   
Query: 511  ccttctt 517
            | |||||
Sbjct: 8707 ctttctt 8713



to top

>dbj|AB023046.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MYA6
          Length = 75289

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 90/110 (81%)
 Strand = Plus / Minus

                                                                         
Query: 411   cgtgcagggttcatggaaccgccgganaaggggccggcaacgaggatgttggccccgacg 470
             ||||| ||||||||||| || ||||| || || |||||  ||||||||||||| || |||
Sbjct: 19498 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 19439

                                                               
Query: 471   atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggg 520
             || |  || |||||||  || |||||||| ||||| || |||||||||||
Sbjct: 19438 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttggg 19389



to top

>gb|U39485.1|ATU39485 Arabidopsis thaliana delta tonoplast integral protein mRNA,
           complete cds
          Length = 939

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 90/110 (81%)
 Strand = Plus / Minus

                                                                       
Query: 411 cgtgcagggttcatggaaccgccgganaaggggccggcaacgaggatgttggccccgacg 470
           ||||| ||||||||||| || ||||| || || |||||  ||||||||||||| || |||
Sbjct: 616 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 557

                                                             
Query: 471 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggg 520
           || |  || |||||||  || |||||||| ||||| || |||||||||||
Sbjct: 556 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttggg 507



to top

>dbj|AB010416.1| Raphanus sativus VIP3 mRNA for delta-VM23, complete cds
          Length = 911

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 90/110 (81%)
 Strand = Plus / Minus

                                                                       
Query: 411 cgtgcagggttcatggaaccgccgganaaggggccggcaacgaggatgttggccccgacg 470
           ||||| ||||||||||| || || || || || |||||  | ||||||||||| ||||||
Sbjct: 640 cgtgctgggttcatggatccaccagagaatggaccggcggctaggatgttggcaccgacg 581

                                                             
Query: 471 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggg 520
           ||||  || ||||||| ||| |||||||| ||||| || ||||| |||||
Sbjct: 580 atgagaccaatggcgaggggagcgatggttccgagagaaccctttttggg 531



to top

>emb|AJ289866.2|VVI289866 Vitis vinifera mRNA for putative aquaporin (delta-TIP gene)
          Length = 1017

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 70/84 (83%)
 Strand = Plus / Minus

                                                                       
Query: 377 gaagtcgccgctggcaacggcggggccnaatgagcgtgcagggttcatggaaccgccgga 436
           ||||||||||||| | ||||||||||| || ||||| || |||||||| || || |||||
Sbjct: 633 gaagtcgccgctgacgacggcggggccgaaggagcgggcggggttcattgatccaccgga 574

                                   
Query: 437 naaggggccggcaacgaggatgtt 460
            || ||||| ||| | ||||||||
Sbjct: 573 gaatgggcctgcagccaggatgtt 550



to top

>dbj|AB012270.1| Aster tripolium mRNA for SAMIPD, partial cds
          Length = 321

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 455 gatgttggccccgacgatgaagccgatggcgatggg 490
           ||||||||| |||||||||||||||||||| |||||
Sbjct: 321 gatgttggcgccgacgatgaagccgatggcaatggg 286



to top

>gb|AC183494.1| Brassica oleracea Contig C, complete sequence
          Length = 285752

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 57/67 (85%)
 Strand = Plus / Minus

                                                                          
Query: 451    cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 510
              ||||||||||||| || |||||||| || || ||||| || |||||||| ||||| ||||
Sbjct: 123743 cgaggatgttggcaccaacgatgaaaccaatagcgattggtgcgatggttccgagcgatc 123684

                     
Query: 511    ccttctt 517
              | |||||
Sbjct: 123683 ctttctt 123677



to top

>dbj|AB012269.1| Aster tripolium mRNA for SAMIPC, partial cds
          Length = 321

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                      
Query: 465 ccgacgatgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtc 523
           ||||||||||||||||||||||  || || ||||| ||||  || ||||||||||||||
Sbjct: 311 ccgacgatgaagccgatggcgactggtgcaatggttccgaacgagcccttcttggggtc 253



to top

>gb|AF133532.1|AF133532 Mesembryanthemum crystallinum water channel protein MipK (MipK)
           mRNA, complete cds
          Length = 1076

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 102/128 (79%)
 Strand = Plus / Minus

                                                                       
Query: 396 gcggggccnaatgagcgtgcagggttcatggaaccgccgganaaggggccggcaacgagg 455
           ||||| || |||||||| || ||||||||||| || || || || ||||||||  | | |
Sbjct: 696 gcgggcccgaatgagcgggctgggttcatggatccaccagagaatgggccggcggccaag 637

                                                                       
Query: 456 atgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatcccttc 515
           |||||||| || || ||||| || || || |||||||| |||||||| |  || ||| ||
Sbjct: 636 atgttggctccaacaatgaacccaatagcaatgggggcaatggtgcccactgagcccctc 577

                   
Query: 516 ttggggtc 523
           ||||||||
Sbjct: 576 ttggggtc 569



to top

>gb|L12257.1|SOYNODA Glycine max nodulin-26 mRNA, complete cds
          Length = 1047

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 333 ccaccgccgatgagcgggccggcccantagatccag 368
           ||||| |||||||| ||||||||||| |||||||||
Sbjct: 788 ccacctccgatgagagggccggcccagtagatccag 753



to top

>dbj|AB012271.1| Aster tripolium mRNA for SAMIPE, partial cds
          Length = 321

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 58/69 (84%)
 Strand = Plus / Minus

                                                                       
Query: 455 gatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccctt 514
           ||||||||| |||||||| |||||||||||||| || || || ||||| |  |  |||||
Sbjct: 321 gatgttggcgccgacgataaagccgatggcgatcggtgcaattgtgcccaatgcaccctt 262

                    
Query: 515 cttggggtc 523
           |||||||||
Sbjct: 261 cttggggtc 253



to top

>dbj|AB012267.1| Aster tripolium mRNA for SAMIPA, partial cds
          Length = 321

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 459 ttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatcccttcttg 518
           ||||| |||||||| |||||||||||||| || || ||||| || || |||||||| || 
Sbjct: 317 ttggcgccgacgataaagccgatggcgattggtgcaatggttcctagtgatcccttttta 258

                
Query: 519 gggtc 523
           |||||
Sbjct: 257 gggtc 253



to top

>ref|NM_188624.1| Oryza sativa (japonica cultivar-group), Ozsa8227 predicted mRNA
          Length = 756

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 67/82 (81%)
 Strand = Plus / Minus

                                                                       
Query: 399 gggccnaatgagcgtgcagggttcatggaaccgccgganaaggggccggcaacgaggatg 458
           ||||| || ||||| || |||||||||||  |||||||  |||| ||| |  ||||||||
Sbjct: 608 gggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccggcgaggatg 549

                                 
Query: 459 ttggccccgacgatgaagccga 480
           ||||| ||||||| || |||||
Sbjct: 548 ttggcgccgacgacgaggccga 527



to top

>emb|X95650.1|TGTIP1GEN T.gesneriana mRNA for tonoplast intrinsic protein
          Length = 992

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 456 atgttggccccgacgatgaagccgatggcgatgggggcgatggt 499
           |||||||| ||||||||||| ||||| || ||||| ||||||||
Sbjct: 580 atgttggcaccgacgatgaatccgatcgcaatgggagcgatggt 537



to top

>emb|AJ314583.1|POC314583 Posidonia oceanica mRNA for putative tonoplast intrinsic protein
           (tip1 gene)
          Length = 1112

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 476 gccgatggcgatgggggcgatggtgccgagggatcccttcttggggtc 523
           ||||||||||| ||| ||||| ||||||| || ||| |||||||||||
Sbjct: 616 gccgatggcgaggggagcgatagtgccgatggctcctttcttggggtc 569



to top

>emb|AJ289696.1|POC289696 Posidonia oceanica partial mRNA for putative aquaporin (aq1 gene)
          Length = 428

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 476 gccgatggcgatgggggcgatggtgccgagggatcccttcttggggtc 523
           ||||||||||| ||| ||||| ||||||| || ||| |||||||||||
Sbjct: 304 gccgatggcgaggggagcgatagtgccgatggctcctttcttggggtc 257



to top

>dbj|AP001550.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0431F01
          Length = 143209

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 67/82 (81%)
 Strand = Plus / Minus

                                                                         
Query: 399   gggccnaatgagcgtgcagggttcatggaaccgccgganaaggggccggcaacgaggatg 458
             ||||| || ||||| || |||||||||||  |||||||  |||| ||| |  ||||||||
Sbjct: 98901 gggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccggcgaggatg 98842

                                   
Query: 459   ttggccccgacgatgaagccga 480
             ||||| ||||||| || |||||
Sbjct: 98841 ttggcgccgacgacgaggccga 98820



to top

>dbj|AK069192.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023007E01, full
           insert sequence
          Length = 1112

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 67/82 (81%)
 Strand = Plus / Minus

                                                                       
Query: 399 gggccnaatgagcgtgcagggttcatggaaccgccgganaaggggccggcaacgaggatg 458
           ||||| || ||||| || |||||||||||  |||||||  |||| ||| |  ||||||||
Sbjct: 611 gggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccggcgaggatg 552

                                 
Query: 459 ttggccccgacgatgaagccga 480
           ||||| ||||||| || |||||
Sbjct: 551 ttggcgccgacgacgaggccga 530



to top

>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome
          Length = 4751080

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                   
Query: 460     tggccccgacgatgaagccgatggcgatgggggcga 495
               |||| ||||||||||||||| || ||||||||||||
Sbjct: 3239016 tggcgccgacgatgaagccggtgacgatgggggcga 3238981



to top

>gb|AF047173.1| Vernicia fordii aquaporin mRNA, complete cds
          Length = 1049

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 57/68 (83%)
 Strand = Plus / Minus

                                                                       
Query: 456 atgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatcccttc 515
           |||||||| || || ||||| || ||||| ||||| || |||||||| || ||||| |||
Sbjct: 635 atgttggcaccaacaatgaaaccaatggcaatgggagcaatggtgcctagtgatcctttc 576

                   
Query: 516 ttggggtc 523
           ||||||||
Sbjct: 575 ttggggtc 568



to top

>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome
          Length = 5331656

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 323    gccggcgaggccaccgccgatga 345
              |||||||||||||||||||||||
Sbjct: 505313 gccggcgaggccaccgccgatga 505291



 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 323     gccggcgaggccaccgccga 342
               ||||||||||||||||||||
Sbjct: 1274146 gccggcgaggccaccgccga 1274165



to top

>dbj|AK060994.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-E02, full
           insert sequence
          Length = 870

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 314 gtagacgatgccggcgaggccaccgccgatg 344
           ||||| || ||||||||||||||||||||||
Sbjct: 622 gtagatgacgccggcgaggccaccgccgatg 592



to top

>ref|NM_117838.2| Arabidopsis thaliana DELTA-TIP2/TIP2;2; water channel AT4G17340
           (DELTA-TIP2/TIP2;2) mRNA, complete cds
          Length = 977

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                       
Query: 417 gggttcatggaaccgccgganaaggggccggcaacgaggatgttggccccgacgatgaag 476
           |||||||||||||| |||   ||||| || ||  ||||||||||||| || |||||||| 
Sbjct: 658 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 599

                
Query: 477 ccgat 481
           |||||
Sbjct: 598 ccgat 594



to top

>emb|Z97343.1|ATFCA8 Arabidopsis thaliana DNA chromosome 4, ESSA I FCA contig fragment No. 8
          Length = 207674

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                         
Query: 417   gggttcatggaaccgccgganaaggggccggcaacgaggatgttggccccgacgatgaag 476
             |||||||||||||| |||   ||||| || ||  ||||||||||||| || |||||||| 
Sbjct: 64861 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 64802

                  
Query: 477   ccgat 481
             |||||
Sbjct: 64801 ccgat 64797



to top

>emb|AL161546.2|ATCHRIV46 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 46
          Length = 198788

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                         
Query: 417   gggttcatggaaccgccgganaaggggccggcaacgaggatgttggccccgacgatgaag 476
             |||||||||||||| |||   ||||| || ||  ||||||||||||| || |||||||| 
Sbjct: 54226 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 54167

                  
Query: 477   ccgat 481
             |||||
Sbjct: 54166 ccgat 54162



to top

>gb|AY056063.1| Arabidopsis thaliana AT4g17340/dl4705w mRNA, complete cds
          Length = 753

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                       
Query: 417 gggttcatggaaccgccgganaaggggccggcaacgaggatgttggccccgacgatgaag 476
           |||||||||||||| |||   ||||| || ||  ||||||||||||| || |||||||| 
Sbjct: 593 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 534

                
Query: 477 ccgat 481
           |||||
Sbjct: 533 ccgat 529



to top

>gb|AF367283.1|AF367283 Arabidopsis thaliana AT4g17340/dl4705w mRNA, complete cds
          Length = 972

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                       
Query: 417 gggttcatggaaccgccgganaaggggccggcaacgaggatgttggccccgacgatgaag 476
           |||||||||||||| |||   ||||| || ||  ||||||||||||| || |||||||| 
Sbjct: 655 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 596

                
Query: 477 ccgat 481
           |||||
Sbjct: 595 ccgat 591



to top

>gb|AF326508.1|AF326508 Zea mays tonoplast membrane integral protein ZmTIP4-4 mRNA,
           complete cds
          Length = 955

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 62/76 (81%)
 Strand = Plus / Minus

                                                                       
Query: 396 gcggggccnaatgagcgtgcagggttcatggaaccgccgganaaggggccggcaacgagg 455
           |||||||| || ||||| || |||||||||||  ||||||| ||||| ||| |  |||| 
Sbjct: 708 gcggggccgaaggagcgcgcggggttcatggacgcgccggagaagggcccgccggcgagc 649

                           
Query: 456 atgttggccccgacga 471
           | |||||| |||||||
Sbjct: 648 acgttggcgccgacga 633



to top

>gb|AF326505.1|AF326505 Zea mays tonoplast membrane integral protein ZmTIP4-1 mRNA,
           complete cds
          Length = 1125

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 62/76 (81%)
 Strand = Plus / Minus

                                                                       
Query: 399 gggccnaatgagcgtgcagggttcatggaaccgccgganaaggggccggcaacgaggatg 458
           ||||| || |||||||| |||||||||||  ||||||  |||  |||| |  ||||| ||
Sbjct: 762 gggccgaaggagcgtgccgggttcatggacgcgccggtgaagttgccgccggcgaggctg 703

                           
Query: 459 ttggccccgacgatga 474
           ||||| ||||||||||
Sbjct: 702 ttggcgccgacgatga 687



to top

>emb|BX825196.1|CNS0A4OU Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL1ZB11 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 954

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                       
Query: 417 gggttcatggaaccgccgganaaggggccggcaacgaggatgttggccccgacgatgaag 476
           |||||||||||||| |||   ||||| || ||  ||||||||||||| || |||||||| 
Sbjct: 641 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 582

                
Query: 477 ccgat 481
           |||||
Sbjct: 581 ccgat 577



to top

>emb|BX828364.1|CNS0A340 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH80ZD07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 936

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                       
Query: 417 gggttcatggaaccgccgganaaggggccggcaacgaggatgttggccccgacgatgaag 476
           |||||||||||||| |||   ||||| || ||  ||||||||||||| || |||||||| 
Sbjct: 616 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 557

                
Query: 477 ccgat 481
           |||||
Sbjct: 556 ccgat 552



to top

>gb|AY088929.1| Arabidopsis thaliana clone 99796 mRNA, complete sequence
          Length = 969

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                       
Query: 417 gggttcatggaaccgccgganaaggggccggcaacgaggatgttggccccgacgatgaag 476
           |||||||||||||| |||   ||||| || ||  ||||||||||||| || |||||||| 
Sbjct: 659 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 600

                
Query: 477 ccgat 481
           |||||
Sbjct: 599 ccgat 595



to top

>gb|U39486.1|ATU39486 Arabidopsis thaliana delta tonoplast integral protein gene, partial
            cds
          Length = 2235

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 58/70 (82%)
 Strand = Plus / Minus

                                                                        
Query: 451  cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 510
            ||||||||||||| || ||||| |  || |||||||  || |||||||| ||||| || |
Sbjct: 2209 cgaggatgttggcaccaacgataagaccaatggcgagaggagcgatggttccgagagaac 2150

                      
Query: 511  ccttcttggg 520
            ||||||||||
Sbjct: 2149 ccttcttggg 2140



to top

>dbj|AB012272.1| Aster tripolium mRNA for SAMIPF, partial cds
          Length = 321

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 455 gatgttggccccgacgatgaagccgatggc 484
           ||||||||| |||||||| |||||||||||
Sbjct: 321 gatgttggcgccgacgataaagccgatggc 292



to top

>dbj|AB012268.1| Aster tripolium mRNA for SAMIPB, partial cds
          Length = 321

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 455 gatgttggccccgacgatgaagccgatggc 484
           ||||||||| |||||||| |||||||||||
Sbjct: 321 gatgttggcgccgacgataaagccgatggc 292



to top

>emb|BX470264.22| Zebrafish DNA sequence from clone CH211-252F13 in linkage group 7,
             complete sequence
          Length = 168673

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 63    ttcacaacatcacattatatt 83
             |||||||||||||||||||||
Sbjct: 78807 ttcacaacatcacattatatt 78827



to top

>emb|AJ243309.1|PSA243309 Pisum sativum mRNA for putative tonoplast intrinsic protein (gene
           tip1-1)
          Length = 1104

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 333 ccaccgccgatgagcgggccggcccantagatccag 368
           ||||| ||||| || ||||||||||| |||||||||
Sbjct: 755 ccaccaccgataagtgggccggcccagtagatccag 720



to top

>emb|BX824373.1|CNS0A6WG Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH44ZA10 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 887

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 60/73 (82%)
 Strand = Plus / Minus

                                                                       
Query: 451 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 510
           |||||||||| || || |||||||| || |||||||| || ||||| || ||||| |  |
Sbjct: 448 cgaggatgttcgctccaacgatgaaacctatggcgattggtgcgattgttccgagagtgc 389

                        
Query: 511 ccttcttggggtc 523
           | |||||||||||
Sbjct: 388 cgttcttggggtc 376



to top

>ref|XM_236362.3| PREDICTED: Rattus norvegicus hect (homologous to the E6-AP (UBE3A)
             carboxyl terminus) domain and RCC1 (CHC1)-like domain
             (RLD) 1 (predicted) (Herc1_predicted), mRNA
          Length = 15132

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 6     tgttcttattgaatcgcataaggaaactc 34
             ||||||||||||  |||||||||||||||
Sbjct: 10797 tgttcttattgatgcgcataaggaaactc 10825



to top

>gb|AC165149.5| Mus musculus BAC clone RP24-114C10 from chromosome 13, complete
             sequence
          Length = 191162

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 27    ggaaactcaactgaagaatt 46
             ||||||||||||||||||||
Sbjct: 13923 ggaaactcaactgaagaatt 13942



to top

>ref|NM_020416.2| Homo sapiens protein phosphatase 2 (formerly 2A), regulatory subunit
            B (PR 52), gamma isoform (PPP2R2C), transcript variant 1,
            mRNA
          Length = 4117

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 50   aaaccccaacaacttcacaa 69
            ||||||||||||||||||||
Sbjct: 3856 aaaccccaacaacttcacaa 3837



to top

>ref|NM_181876.1| Homo sapiens protein phosphatase 2 (formerly 2A), regulatory subunit
            B (PR 52), gamma isoform (PPP2R2C), transcript variant 2,
            mRNA
          Length = 4087

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 50   aaaccccaacaacttcacaa 69
            ||||||||||||||||||||
Sbjct: 3826 aaaccccaacaacttcacaa 3807



to top

>ref|XM_470886.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1812

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 367 agatgttggngaagtcgccgctg 389
           ||||||||| |||||||||||||
Sbjct: 877 agatgttggtgaagtcgccgctg 855



to top

>gb|AC121551.11| Mus musculus chromosome 1, clone RP24-144H23, complete sequence
          Length = 168683

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 27     ggaaactcaactgaagaatt 46
              ||||||||||||||||||||
Sbjct: 136133 ggaaactcaactgaagaatt 136114



to top

>gb|AC091787.6| Oryza sativa (japonica cultivar-group) chromosome 3 clone
             OSJNBa0087G11, complete sequence
          Length = 169728

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 367   agatgttggngaagtcgccgctg 389
             ||||||||| |||||||||||||
Sbjct: 59831 agatgttggtgaagtcgccgctg 59853



to top

>gb|AC147922.2| Xenopus tropicalis clone CH216-98P3, complete sequence
          Length = 171597

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 8     ttcttattgaatcgcataag 27
             ||||||||||||||||||||
Sbjct: 92152 ttcttattgaatcgcataag 92171



to top

>gb|AC006012.2| Homo sapiens PAC clone RP5-942I16 from 7, complete sequence
          Length = 121598

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 215    ggcatcatggaaaccaaaca 234
              ||||||||||||||||||||
Sbjct: 113843 ggcatcatggaaaccaaaca 113824



to top

>ref|XM_804228.1| Trypanosoma cruzi strain CL Brener hypothetical protein
            (Tc00.1047053507837.100) partial mRNA
          Length = 4953

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 476  gccgatggcgatgggggcgatggt 499
            ||||||| ||||||||||||||||
Sbjct: 4372 gccgatgacgatgggggcgatggt 4395



to top

>gb|AC117212.5| Mus musculus BAC clone RP23-302A24 from chromosome 6, complete sequence
          Length = 212735

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 50    aaaccccaacaacttcacaa 69
             ||||||||||||||||||||
Sbjct: 57462 aaaccccaacaacttcacaa 57481



to top

>emb|X70417.1|AMDIPCDNA A.majus mRNA for integral membrane protein
          Length = 848

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 77/97 (79%)
 Strand = Plus / Minus

                                                                       
Query: 334 caccgccgatgagcgggccggcccantagatccagatgttggngaagtcgccgctggcaa 393
           ||||||| || || ||||||||||| || |||||| | | || |||||| || || || |
Sbjct: 676 caccgccaatcagtgggccggcccaataaatccagttctgggagaagtctccacttgcga 617

                                                
Query: 394 cggcggggccnaatgagcgtgcagggttcatggaacc 430
           | ||||| || ||||| || || |||||||| |||||
Sbjct: 616 cagcgggtccaaatgatcgggctgggttcatcgaacc 580



to top

>emb|X54855.1|NTROOTSP N. tabacum mRNA for root-specific gene
          Length = 938

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                      
Query: 342 atgagcgggccggcccantagatccag 368
           ||||| ||||||||||| |||||||||
Sbjct: 714 atgagtgggccggcccaatagatccag 688



to top

>gb|BC021735.2| Homo sapiens protein phosphatase 2 (formerly 2A), regulatory
           subunit B (PR 52), gamma isoform, mRNA (cDNA clone
           IMAGE:4816112)
          Length = 1172

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 50  aaaccccaacaacttcacaa 69
           ||||||||||||||||||||
Sbjct: 918 aaaccccaacaacttcacaa 899



to top

>gb|BC045682.1| Homo sapiens protein phosphatase 2 (formerly 2A), regulatory subunit
            B (PR 52), gamma isoform, mRNA (cDNA clone IMAGE:5300526)
          Length = 2161

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 50   aaaccccaacaacttcacaa 69
            ||||||||||||||||||||
Sbjct: 1900 aaaccccaacaacttcacaa 1881



to top

>emb|AL606622.3|OSJN00059 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0004N05,
              complete sequence
          Length = 158601

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 367    agatgttggngaagtcgccgctg 389
              ||||||||| |||||||||||||
Sbjct: 106408 agatgttggtgaagtcgccgctg 106430



to top

>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome
          Length = 5513844

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 323     gccggcgaggccaccgccga 342
               ||||||||||||||||||||
Sbjct: 4535021 gccggcgaggccaccgccga 4535040



to top

>dbj|AK127386.1| Homo sapiens cDNA FLJ45468 fis, clone BRSTN2015788
          Length = 1737

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 50   aaaccccaacaacttcacaa 69
            ||||||||||||||||||||
Sbjct: 1499 aaaccccaacaacttcacaa 1480



to top

>gb|AC068733.12| Homo sapiens chromosome 11, clone RP11-304C12, complete sequence
          Length = 191656

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 46     tctcaaaccccaacaacttcacaa 69
              ||||||||||||||| ||||||||
Sbjct: 107696 tctcaaaccccaacaccttcacaa 107719



to top

>gb|AC073589.6| Mus musculus strain C57BL/6J chromosome 12 clone RP23-147E23, complete
              sequence
          Length = 222430

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 136    tctgaaccaaacaacatgac 155
              ||||||||||||||||||||
Sbjct: 111593 tctgaaccaaacaacatgac 111574



to top

>gb|CP000264.1| Jannaschia sp. CCS1, complete genome
          Length = 4317977

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 325     cggcgaggccaccgccgatg 344
               ||||||||||||||||||||
Sbjct: 1656225 cggcgaggccaccgccgatg 1656206



to top

>gb|S45406.1| TobRB7=root-specific gene regulator [Nicotiana tabacum=tobacco, cv
            Wisconsin 38, Genomic, 3426 nt]
          Length = 3426

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                       
Query: 342  atgagcgggccggcccantagatccag 368
            ||||| ||||||||||| |||||||||
Sbjct: 3202 atgagtgggccggcccaatagatccag 3176



to top

>gb|AF326509.1|AF326509 Zea mays tonoplast membrane integral protein ZmTIP5-1 mRNA,
           complete cds
          Length = 1021

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 43/51 (84%)
 Strand = Plus / Minus

                                                              
Query: 377 gaagtcgccgctggcaacggcggggccnaatgagcgtgcagggttcatgga 427
           ||||| ||||||| | ||||| ||||| || ||||| || |||||||||||
Sbjct: 718 gaagtggccgctgacgacggccgggccgaacgagcgggccgggttcatgga 668



to top

>gb|AC084327.5| Mus musculus strain C57BL6/J chromosome 6 clone RP23-367K14, complete
             sequence
          Length = 108667

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 50    aaaccccaacaacttcacaa 69
             ||||||||||||||||||||
Sbjct: 32732 aaaccccaacaacttcacaa 32713



to top

>gb|AC116317.4| Homo sapiens BAC clone RP11-1406H17 from 4, complete sequence
          Length = 160943

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 50    aaaccccaacaacttcacaa 69
             ||||||||||||||||||||
Sbjct: 82311 aaaccccaacaacttcacaa 82330



to top

>gb|AF497482.1| Micromonospora echinospora calicheamicin biosynthetic locus, complete
            sequence
          Length = 90348

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 336  ccgccgatgagcgggccggc 355
            ||||||||||||||||||||
Sbjct: 7090 ccgccgatgagcgggccggc 7109



to top

>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                           
Query: 468     acgatgaagccgatggcgatgggggcga 495
               |||||||||||||| |||| ||||||||
Sbjct: 4744058 acgatgaagccgatcgcgacgggggcga 4744085



to top

>dbj|AK107457.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-128-C11, full
           insert sequence
          Length = 1679

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 367 agatgttggngaagtcgccgctg 389
           ||||||||| |||||||||||||
Sbjct: 794 agatgttggtgaagtcgccgctg 816



to top

>gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, complete sequence
          Length = 3131724

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 334    caccgccgatgagcgggccg 353
              ||||||||||||||||||||
Sbjct: 557849 caccgccgatgagcgggccg 557868



to top

>emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid complete sequence
          Length = 2094509

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 467     gacgatgaagccgatggcgatggg 490
               ||||||| ||||||||||||||||
Sbjct: 1047164 gacgatgtagccgatggcgatggg 1047141



to top

>tpe|BN000872.1| TPA: TPA_exp: Mus musculus immunoglobulin heavy chain variable region
               locus, strain C57BL/6
          Length = 2500000

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 136     tctgaaccaaacaacatgac 155
               ||||||||||||||||||||
Sbjct: 1893522 tctgaaccaaacaacatgac 1893503


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,653,368
Number of Sequences: 3902068
Number of extensions: 3653368
Number of successful extensions: 68010
Number of sequences better than 10.0: 143
Number of HSP's better than 10.0 without gapping: 145
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 67036
Number of HSP's gapped (non-prelim): 968
length of query: 523
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 500
effective length of database: 17,143,297,704
effective search space: 8571648852000
effective search space used: 8571648852000
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top