ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbasd3e21 |
|---|---|
| Clone Library Name | barley_pub |
>emb|X80266.1|HVGTIPP H.vulgare mRNA for gamma-TIP-like protein Length = 1020 Score = 940 bits (474), Expect = 0.0 Identities = 486/491 (98%) Strand = Plus / Minus Query: 1 caaactgatggaccgatcgaccctgggaatgggatggattcattaattcaaagcaaactt 60 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 958 caaactgatggaccgatcgaccctgggaatgggatggattcattcattcaaagcaaactt 899 Query: 61 aaacgactcatgactggaagcaaggggagacgcgatcgaccacacggacggacgggcggg 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 898 aaacgactcatgactggaagcaaggggagacgcgatcgaccacacggacggacgggcggg 839 Query: 121 cggggggcaggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcggg 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 838 cggggggcaggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcggg 779 Query: 181 agatgaagagcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgaccc 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 778 agatgaagagcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgaccc 719 Query: 241 agtacacccactggtacccccactcccagctgacgagggcggggccgaaggagacggcgg 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 718 agtacacccactggtacccccactcccagctgacgagggcggggccgaaggagacggcgg 659 Query: 301 ggttcatggacncgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaanc 360 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| | Sbjct: 658 ggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaagc 599 Query: 361 cgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgt 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 598 cgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgt 539 Query: 421 acaccgtgtacaccagcccgaangtcatgacgatctccaggaccaccgccttccacgcgc 480 |||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||| Sbjct: 538 acaccgtgtacaccagcccgaaggtcatgacgatctccaggaccaccgcctcccacgcgc 479 Query: 481 cgatgccggtg 491 ||||||||||| Sbjct: 478 cgatgccggtg 468
>gb|U86762.1|TAU86762 Triticum aestivum gamma-type tonoplast intrinsic protein mRNA, complete cds Length = 1133 Score = 599 bits (302), Expect = e-168 Identities = 332/343 (96%) Strand = Plus / Minus Query: 145 agtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagatga 204 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 845 agtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagatga 786 Query: 205 cgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccact 264 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 785 cgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccact 726 Query: 265 cccagctgacgagggcggggccgaaggagacggcggggttcatggacncgccggagaagg 324 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 725 cccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaagg 666 Query: 325 cgccgccgacgaggatgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgc 384 ||||||| || |||||||||||||| |||||||| ||||||||||||||||||||||||| Sbjct: 665 cgccgcccaccaggatgttggcgcccacgatgaagccgatggcgatgggcgcgatggtgc 606 Query: 385 ccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaang 444 |||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| | Sbjct: 605 ccaggctgcccttcttggggtccacggccgtggcgtacaccgtgtacaccagcccgaagg 546 Query: 445 tcatgacgatctccaggaccaccgccttccacgcgccgatgcc 487 |||| ||||||||||| |||||||||| ||||||||||||||| Sbjct: 545 tcatcacgatctccagcaccaccgcctcccacgcgccgatgcc 503 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 51 aagcaaacttaaacgactcatg 72 |||||||||||||||||||||| Sbjct: 977 aagcaaacttaaacgactcatg 956
>gb|AY243803.1| Zea mays tonoplast water channel (TIP1-1) mRNA, complete cds Length = 1039 Score = 494 bits (249), Expect = e-136 Identities = 312/334 (93%) Strand = Plus / Minus Query: 143 ttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagat 202 |||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 754 ttagtagtcggtggaggggagctgctcgtgggtgtgggagatgaagagcagctcgtagat 695 Query: 203 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtaccccca 262 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 694 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtagcccca 635 Query: 263 ctcccagctgacgagggcggggccgaaggagacggcggggttcatggacncgccggagaa 322 |||||||||||||||||||||||||||||| |||||||||||||||||| ||||| ||| Sbjct: 634 ctcccagctgacgagggcggggccgaaggacacggcggggttcatggacgcgccgtcgaa 575 Query: 323 ggcgccgccgacgaggatgttggcgccgacgatgaanccgatggcgatgggcgcgatggt 382 ||||||||| || ||||||||||| || |||||||| |||||||||||||| |||||||| Sbjct: 574 ggcgccgcccaccaggatgttggcccccacgatgaagccgatggcgatgggggcgatggt 515 Query: 383 gcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaa 442 |||||||||||||||||| ||||| || || ||||||||||||||||||||||||||||| Sbjct: 514 gcccaggctgcccttcttcgggtccaccgccgtggcgtacaccgtgtacaccagcccgaa 455 Query: 443 ngtcatgacgatctccaggaccaccgccttccac 476 ||||| ||||||||||| |||| ||||| |||| Sbjct: 454 ggtcatcacgatctccagcaccagcgcctcccac 421
>gb|BT016300.1| Zea mays clone Contig133 mRNA sequence Length = 1112 Score = 486 bits (245), Expect = e-134 Identities = 311/334 (93%) Strand = Plus / Minus Query: 143 ttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagat 202 |||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 850 ttagtagtcggtggaggggagctgctcgtgggtgtgggagatgaagagcagctcgtagat 791 Query: 203 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtaccccca 262 |||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| Sbjct: 790 gacgccggcgaggccgccgccgatgaggggcccgacccagtacacccactggtagcccca 731 Query: 263 ctcccagctgacgagggcggggccgaaggagacggcggggttcatggacncgccggagaa 322 |||||||||||||||||||||||||||||| |||||||||||||||||| ||||| ||| Sbjct: 730 ctcccagctgacgagggcggggccgaaggacacggcggggttcatggacgcgccgtcgaa 671 Query: 323 ggcgccgccgacgaggatgttggcgccgacgatgaanccgatggcgatgggcgcgatggt 382 ||||||||| || |||||||||||||| |||||||| |||||||||||||| |||||||| Sbjct: 670 ggcgccgcccaccaggatgttggcgcccacgatgaagccgatggcgatgggggcgatggt 611 Query: 383 gcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaa 442 |||||||||||||||||| ||||| || || || |||||||||||||||||||||||||| Sbjct: 610 gcccaggctgcccttcttcgggtccaccgccgtcgcgtacaccgtgtacaccagcccgaa 551 Query: 443 ngtcatgacgatctccaggaccaccgccttccac 476 ||||| ||||||||||| |||| ||||| |||| Sbjct: 550 ggtcatcacgatctccagcaccagcgcctcccac 517
>gb|AY104464.1| Zea mays PCO114899 mRNA sequence Length = 1167 Score = 478 bits (241), Expect = e-132 Identities = 310/334 (92%) Strand = Plus / Minus Query: 143 ttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagat 202 |||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 849 ttagtagtcggtggaggggagctgctcgtgggtgtgggagatgaagagcagctcgtagat 790 Query: 203 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtaccccca 262 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 789 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtagcccca 730 Query: 263 ctcccagctgacgagggcggggccgaaggagacggcggggttcatggacncgccggagaa 322 |||||||||||||||||||||||||||||| |||||||||||||||||| ||||| ||| Sbjct: 729 ctcccagctgacgagggcggggccgaaggacacggcggggttcatggacgcgccgtcgaa 670 Query: 323 ggcgccgccgacgaggatgttggcgccgacgatgaanccgatggcgatgggcgcgatggt 382 ||||||||| || ||||||||||| || |||||||| |||||||| ||||| |||||||| Sbjct: 669 ggcgccgcccaccaggatgttggcccccacgatgaagccgatggcaatgggggcgatggt 610 Query: 383 gcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaa 442 |||||||||||||||||| ||||| || || || |||||||||||||||||||||||||| Sbjct: 609 gcccaggctgcccttcttcgggtccaccgccgtcgcgtacaccgtgtacaccagcccgaa 550 Query: 443 ngtcatgacgatctccaggaccaccgccttccac 476 ||||| ||||||||||| |||| ||||| |||| Sbjct: 549 ggtcatcacgatctccagcaccagcgcctcccac 516
>gb|AF037061.1|AF037061 Zea mays tonoplast intrinsic protein (ZmTIP1) mRNA, complete cds Length = 1097 Score = 478 bits (241), Expect = e-132 Identities = 310/334 (92%) Strand = Plus / Minus Query: 143 ttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagat 202 |||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 846 ttagtagtcggtggaggggagctgctcgtgggtgtgggagatgaagagcagctcgtagat 787 Query: 203 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtaccccca 262 |||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| Sbjct: 786 gacgccggcgaggccgccgccgatgaggggcccgacccagtacacccactggtagcccca 727 Query: 263 ctcccagctgacgagggcggggccgaaggagacggcggggttcatggacncgccggagaa 322 |||||||||||||||||||||||||||||| |||||||||||||||||| ||||| ||| Sbjct: 726 ctcccagctgacgagggcggggccgaaggacacggcggggttcatggacgcgccgtcgaa 667 Query: 323 ggcgccgccgacgaggatgttggcgccgacgatgaanccgatggcgatgggcgcgatggt 382 ||||||||| || ||||||||||| || |||||||| |||||||| ||||| |||||||| Sbjct: 666 ggcgccgcccaccaggatgttggcccccacgatgaagccgatggcaatgggggcgatggt 607 Query: 383 gcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaa 442 |||||||||||||||||| ||||| || || ||||||||||||||||||||||||||||| Sbjct: 606 gcccaggctgcccttcttcgggtccaccgccgtggcgtacaccgtgtacaccagcccgaa 547 Query: 443 ngtcatgacgatctccaggaccaccgccttccac 476 ||||| ||||||||||| |||| ||||| |||| Sbjct: 546 ggtcatcacgatctccagcaccagcgcctcccac 513
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 434 bits (219), Expect = e-118 Identities = 306/336 (91%) Strand = Plus / Plus Query: 130 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 189 ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 2544716 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 2544775 Query: 190 gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 249 | | |||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||| Sbjct: 2544776 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 2544835 Query: 250 actggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatgg 309 ||||| || |||| ||||||||||||||| ||||||||||||||||| |||||||||| Sbjct: 2544836 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 2544895 Query: 310 acncgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaanccgatggcga 369 | ||||| ||| |||||||||||||||||||| |||||||||||||| |||||||||| Sbjct: 2544896 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 2544955 Query: 370 tgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgt 429 |||| ||||||||||| |||||||||||||||||||| ||||||||||||||||| |||| Sbjct: 2544956 tgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcgtacacggtgt 2545015 Query: 430 acaccagcccgaangtcatgacgatctccaggacca 465 | || || ||||| ||||||||||||||||| |||| Sbjct: 2545016 agacgaggccgaaggtcatgacgatctccagcacca 2545051 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 104 acggacggacgggcgggcggg 124 ||||||||||||||||||||| Sbjct: 8319519 acggacggacgggcgggcggg 8319499
>gb|AC090485.3|AC090485 Genomic Sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0067N01, from chromosome 3, complete sequence Length = 159636 Score = 434 bits (219), Expect = e-118 Identities = 306/336 (91%) Strand = Plus / Minus Query: 130 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 189 ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 125378 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 125319 Query: 190 gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 249 | | |||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||| Sbjct: 125318 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 125259 Query: 250 actggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatgg 309 ||||| || |||| ||||||||||||||| ||||||||||||||||| |||||||||| Sbjct: 125258 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 125199 Query: 310 acncgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaanccgatggcga 369 | ||||| ||| |||||||||||||||||||| |||||||||||||| |||||||||| Sbjct: 125198 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 125139 Query: 370 tgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgt 429 |||| ||||||||||| |||||||||||||||||||| ||||||||||||||||| |||| Sbjct: 125138 tgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcgtacacggtgt 125079 Query: 430 acaccagcccgaangtcatgacgatctccaggacca 465 | || || ||||| ||||||||||||||||| |||| Sbjct: 125078 agacgaggccgaaggtcatgacgatctccagcacca 125043
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 434 bits (219), Expect = e-118 Identities = 306/336 (91%) Strand = Plus / Plus Query: 130 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 189 ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 2544826 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 2544885 Query: 190 gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 249 | | |||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||| Sbjct: 2544886 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 2544945 Query: 250 actggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatgg 309 ||||| || |||| ||||||||||||||| ||||||||||||||||| |||||||||| Sbjct: 2544946 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 2545005 Query: 310 acncgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaanccgatggcga 369 | ||||| ||| |||||||||||||||||||| |||||||||||||| |||||||||| Sbjct: 2545006 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 2545065 Query: 370 tgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgt 429 |||| ||||||||||| |||||||||||||||||||| ||||||||||||||||| |||| Sbjct: 2545066 tgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcgtacacggtgt 2545125 Query: 430 acaccagcccgaangtcatgacgatctccaggacca 465 | || || ||||| ||||||||||||||||| |||| Sbjct: 2545126 agacgaggccgaaggtcatgacgatctccagcacca 2545161 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 104 acggacggacgggcgggcggg 124 ||||||||||||||||||||| Sbjct: 8317354 acggacggacgggcgggcggg 8317334
>dbj|D25534.1|RICYK333 Oryza sativa yk333 mRNA for gamma-Tip, complete cds Length = 1080 Score = 434 bits (219), Expect = e-118 Identities = 306/336 (91%) Strand = Plus / Minus Query: 130 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 189 ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 844 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 785 Query: 190 gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 249 | | |||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||| Sbjct: 784 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 725 Query: 250 actggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatgg 309 ||||| || |||| ||||||||||||||| ||||||||||||||||| |||||||||| Sbjct: 724 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 665 Query: 310 acncgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaanccgatggcga 369 | ||||| ||| |||||||||||||||||||| |||||||||||||| |||||||||| Sbjct: 664 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 605 Query: 370 tgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgt 429 |||| ||||||||||| |||||||||||||||||||| ||||||||||||||||| |||| Sbjct: 604 tgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcgtacacggtgt 545 Query: 430 acaccagcccgaangtcatgacgatctccaggacca 465 | || || ||||| ||||||||||||||||| |||| Sbjct: 544 agacgaggccgaaggtcatgacgatctccagcacca 509
>dbj|AK104123.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-C12, full insert sequence Length = 1034 Score = 434 bits (219), Expect = e-118 Identities = 306/336 (91%) Strand = Plus / Minus Query: 130 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 189 ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 853 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 794 Query: 190 gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 249 | | |||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||| Sbjct: 793 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 734 Query: 250 actggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatgg 309 ||||| || |||| ||||||||||||||| ||||||||||||||||| |||||||||| Sbjct: 733 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 674 Query: 310 acncgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaanccgatggcga 369 | ||||| ||| |||||||||||||||||||| |||||||||||||| |||||||||| Sbjct: 673 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 614 Query: 370 tgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgt 429 |||| ||||||||||| |||||||||||||||||||| ||||||||||||||||| |||| Sbjct: 613 tgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcgtacacggtgt 554 Query: 430 acaccagcccgaangtcatgacgatctccaggacca 465 | || || ||||| ||||||||||||||||| |||| Sbjct: 553 agacgaggccgaaggtcatgacgatctccagcacca 518
>dbj|AK068986.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023003E16, full insert sequence Length = 1082 Score = 434 bits (219), Expect = e-118 Identities = 306/336 (91%) Strand = Plus / Minus Query: 130 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 189 ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 855 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 796 Query: 190 gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 249 | | |||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||| Sbjct: 795 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 736 Query: 250 actggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatgg 309 ||||| || |||| ||||||||||||||| ||||||||||||||||| |||||||||| Sbjct: 735 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 676 Query: 310 acncgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaanccgatggcga 369 | ||||| ||| |||||||||||||||||||| |||||||||||||| |||||||||| Sbjct: 675 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 616 Query: 370 tgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgt 429 |||| ||||||||||| |||||||||||||||||||| ||||||||||||||||| |||| Sbjct: 615 tgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcgtacacggtgt 556 Query: 430 acaccagcccgaangtcatgacgatctccaggacca 465 | || || ||||| ||||||||||||||||| |||| Sbjct: 555 agacgaggccgaaggtcatgacgatctccagcacca 520
>dbj|AK059438.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-027-G11, full insert sequence Length = 551 Score = 434 bits (219), Expect = e-118 Identities = 306/336 (91%) Strand = Plus / Minus Query: 130 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 189 ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 379 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 320 Query: 190 gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 249 | | |||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||| Sbjct: 319 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 260 Query: 250 actggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatgg 309 ||||| || |||| ||||||||||||||| ||||||||||||||||| |||||||||| Sbjct: 259 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 200 Query: 310 acncgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaanccgatggcga 369 | ||||| ||| |||||||||||||||||||| |||||||||||||| |||||||||| Sbjct: 199 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 140 Query: 370 tgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgt 429 |||| ||||||||||| |||||||||||||||||||| ||||||||||||||||| |||| Sbjct: 139 tgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcgtacacggtgt 80 Query: 430 acaccagcccgaangtcatgacgatctccaggacca 465 | || || ||||| ||||||||||||||||| |||| Sbjct: 79 agacgaggccgaaggtcatgacgatctccagcacca 44
>dbj|AK058322.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B06, full insert sequence Length = 1055 Score = 434 bits (219), Expect = e-118 Identities = 306/336 (91%) Strand = Plus / Minus Query: 130 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 189 ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 851 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 792 Query: 190 gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 249 | | |||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||| Sbjct: 791 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 732 Query: 250 actggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatgg 309 ||||| || |||| ||||||||||||||| ||||||||||||||||| |||||||||| Sbjct: 731 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 672 Query: 310 acncgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaanccgatggcga 369 | ||||| ||| |||||||||||||||||||| |||||||||||||| |||||||||| Sbjct: 671 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 612 Query: 370 tgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgt 429 |||| ||||||||||| |||||||||||||||||||| ||||||||||||||||| |||| Sbjct: 611 tgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcgtacacggtgt 552 Query: 430 acaccagcccgaangtcatgacgatctccaggacca 465 | || || ||||| ||||||||||||||||| |||| Sbjct: 551 agacgaggccgaaggtcatgacgatctccagcacca 516
>ref|XM_470213.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 753 Score = 416 bits (210), Expect = e-113 Identities = 294/323 (91%) Strand = Plus / Minus Query: 143 ttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagat 202 |||||||||||||||||||||||||||||||||| ||||||||||||| | ||||||||| Sbjct: 753 ttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaagaggacctcgtagat 694 Query: 203 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtaccccca 262 ||||||||||||||| ||||||||||| ||||| |||||||||||||||||| || |||| Sbjct: 693 gacgccggcgaggccaccgccgatgagtgggccaacccagtacacccactgggactccca 634 Query: 263 ctcccagctgacgagggcggggccgaaggagacggcggggttcatggacncgccggagaa 322 ||||||||||||||| ||||||||||||||||| ||||||||||| ||||| ||| Sbjct: 633 ggaccagctgacgagggccgggccgaaggagacggccgggttcatggaggcgccgtcgaa 574 Query: 323 ggcgccgccgacgaggatgttggcgccgacgatgaanccgatggcgatgggcgcgatggt 382 |||||||||||||||||||| |||||||||||||| |||||||||||||| |||||||| Sbjct: 573 cgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcgatgggggcgatggt 514 Query: 383 gcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaa 442 ||| |||||||||||||||||||| ||||||||||||||||| ||||| || || ||||| Sbjct: 513 gccgaggctgcccttcttggggtcaacggcggtggcgtacacggtgtagacgaggccgaa 454 Query: 443 ngtcatgacgatctccaggacca 465 ||||||||||||||||| |||| Sbjct: 453 ggtcatgacgatctccagcacca 431
>emb|AJ242805.1|SST242805 Sporobolus stapfianus mRNA for putative gamma tonoplast intrinsic protein (TIP) Length = 1146 Score = 313 bits (158), Expect = 3e-82 Identities = 304/353 (86%), Gaps = 3/353 (0%) Strand = Plus / Minus Query: 141 gcttagtagtcggtggtggggagctgctcgtgggtgcgggag---atgaagagcagctcg 197 |||||||||||||||||||||||||||||||||||| ||||| |||||||||| ||| Sbjct: 837 gcttagtagtcggtggtggggagctgctcgtgggtgtgggaggagatgaagagcatgtcg 778 Query: 198 tagatgacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtac 257 || || | | ||||| | | ||||||| |||||||||||||||||||| |||| Sbjct: 777 tatataagtgcagcgagtgcagcaccgatgaacgggccgacccagtacacccagtggttg 718 Query: 258 ccccactcccagctgacgagggcggggccgaaggagacggcggggttcatggacncgccg 317 ||| |||||||||||| | |||||||||||| |||||||||||||||||| ||||| Sbjct: 717 ttccaggaccagctgacgagcgaggggccgaaggacacggcggggttcatggacgcgccg 658 Query: 318 gagaaggcgccgccgacgaggatgttggcgccgacgatgaanccgatggcgatgggcgcg 377 |||||||||||||||||||||||||||||| |||||||| |||||||||||||| ||| Sbjct: 657 tcgaaggcgccgccgacgaggatgttggcgcccacgatgaagccgatggcgatgggggcg 598 Query: 378 atggtgcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagc 437 |||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 597 atggtgcccaggctgcccttcttggggtcgaccgcggtggcgtacacagtgtacaccaga 538 Query: 438 ccgaangtcatgacgatctccaggaccaccgccttccacgcgccgatgccggt 490 ||||| ||||| |||||||| || |||| |||| |||| || ||||||||| Sbjct: 537 ccgaaggtcatcacgatctcgagcaccagggcctcccacacggagatgccggt 485
>dbj|AK110727.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-170-E06, full insert sequence Length = 1024 Score = 287 bits (145), Expect = 2e-74 Identities = 217/242 (89%) Strand = Plus / Plus Query: 224 gatgagggggccgacccagtacacccactggtacccccactcccagctgacgagggcggg 283 |||||| ||||| |||||||||||||||||| || |||| ||||||||||||||| || Sbjct: 219 gatgagtgggccaacccagtacacccactgggactcccaggaccagctgacgagggccgg 278 Query: 284 gccgaaggagacggcggggttcatggacncgccggagaaggcgccgccgacgaggatgtt 343 ||||||||||||||| ||||||||||| ||||| ||| |||||||||||||||||||| Sbjct: 279 gccgaaggagacggccgggttcatggaggcgccgtcgaacgcgccgccgacgaggatgtt 338 Query: 344 ggcgccgacgatgaanccgatggcgatgggcgcgatggtgcccaggctgcccttcttggg 403 |||||||||||||| |||||||||||||| ||||||||||| ||||||||||||||||| Sbjct: 339 cgcgccgacgatgaagccgatggcgatgggggcgatggtgccgaggctgcccttcttggg 398 Query: 404 gtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcatgacgatctccaggac 463 ||| ||||||||||||||||| ||||| || || ||||| ||||||||||||||||| || Sbjct: 399 gtcaacggcggtggcgtacacggtgtagacgaggccgaaggtcatgacgatctccagcac 458 Query: 464 ca 465 || Sbjct: 459 ca 460 Score = 97.6 bits (49), Expect = 3e-17 Identities = 55/57 (96%) Strand = Plus / Plus Query: 130 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatga 186 ||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| Sbjct: 167 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatga 223
>gb|AF326500.1|AF326500 Zea mays tonoplast membrane integral protein ZmTIP1-2 mRNA, complete cds Length = 1021 Score = 228 bits (115), Expect = 1e-56 Identities = 205/236 (86%) Strand = Plus / Minus Query: 231 gggccgacccagtacacccactggtacccccactcccagctgacgagggcggggccgaag 290 |||||||||||||||||||| |||| | |||| | | | |||||| ||| ||||||||| Sbjct: 682 gggccgacccagtacacccagtggttctcccagacgccggtgacgacggccgggccgaag 623 Query: 291 gagacggcggggttcatggacncgccggagaaggcgccgccgacgaggatgttggcgccg 350 |||||||||||||||||||| ||||| ||||||||| || | ||||||||||||||| Sbjct: 622 gagacggcggggttcatggaggcgccgtcgaaggcgccccccgccaggatgttggcgccg 563 Query: 351 acgatgaanccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacg 410 |||||||| ||||||||||||||||||||| ||| ||| ||||||||||||||| ||| Sbjct: 562 acgatgaagccgatggcgatgggcgcgatgacgccgaggtcgcccttcttggggtccacg 503 Query: 411 gcggtggcgtacaccgtgtacaccagcccgaangtcatgacgatctccaggaccac 466 || |||||||||||||||||||| || ||||| |||||||| |||||||| ||||| Sbjct: 502 gccgtggcgtacaccgtgtacacgaggccgaaggtcatgaccatctccagcaccac 447
>ref|NM_189497.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 759 Score = 210 bits (106), Expect = 3e-51 Identities = 184/211 (87%) Strand = Plus / Minus Query: 271 tgacgagggcggggccgaaggagacggcggggttcatggacncgccggagaaggcgccgc 330 |||||| ||||||||||||||||||||||||||||||||| ||||| ||||||||||| Sbjct: 628 tgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgc 569 Query: 331 cgacgaggatgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgcccaggc 390 || ||||||||||||||||||||||||| |||||||||||||| |||||| || ||| Sbjct: 568 cggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggt 509 Query: 391 tgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcatga 450 |||||||||||| || || |||||||||||||| ||||| || || ||||| ||||||| Sbjct: 508 cgcccttcttgggatccaccgcggtggcgtacacggtgtagacgaggccgaaggtcatga 449 Query: 451 cgatctccaggaccaccgccttccacgcgcc 481 ||||||| | |||||||| ||||| ||||| Sbjct: 448 cgatctcgaacaccaccgcgttccaggcgcc 418
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 210 bits (106), Expect = 3e-51 Identities = 169/191 (88%) Strand = Plus / Minus Query: 269 gctgacgagggcggggccgaaggagacggcggggttcatggacncgccggagaaggcgcc 328 |||| ||| |||||||||||||||| || ||||||||||| |||||||||||| ||| Sbjct: 13251010 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 13250951 Query: 329 gccgacgaggatgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgcccag 388 | |||||||||||||||||||||||||||| |||||||||||||||||||||||||| || Sbjct: 13250950 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 13250891 Query: 389 gctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcat 448 ||||||||||||||| |||||||||||||||| ||||||||||||||||| || | Sbjct: 13250890 cgaccccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgac 13250831 Query: 449 gacgatctcca 459 || |||||||| Sbjct: 13250830 gatgatctcca 13250820 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 197 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 244 ||||| || |||||||||||||||||||| |||||||||||||||||| Sbjct: 13251082 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 13251035
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 210 bits (106), Expect = 3e-51 Identities = 184/211 (87%) Strand = Plus / Plus Query: 271 tgacgagggcggggccgaaggagacggcggggttcatggacncgccggagaaggcgccgc 330 |||||| ||||||||||||||||||||||||||||||||| ||||| ||||||||||| Sbjct: 43108799 tgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgc 43108858 Query: 331 cgacgaggatgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgcccaggc 390 || ||||||||||||||||||||||||| |||||||||||||| |||||| || ||| Sbjct: 43108859 cggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggt 43108918 Query: 391 tgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcatga 450 |||||||||||| || || |||||||||||||| ||||| || || ||||| ||||||| Sbjct: 43108919 cgcccttcttgggatccaccgcggtggcgtacacggtgtagacgaggccgaaggtcatga 43108978 Query: 451 cgatctccaggaccaccgccttccacgcgcc 481 ||||||| | |||||||| ||||| ||||| Sbjct: 43108979 cgatctcgaacaccaccgcgttccaggcgcc 43109009 Score = 83.8 bits (42), Expect = 5e-13 Identities = 71/81 (87%) Strand = Plus / Minus Query: 274 cgagggcggggccgaaggagacggcggggttcatggacncgccggagaaggcgccgccga 333 ||||||| |||||||||||| ||| ||||||||||| |||||||| ||| |||||| Sbjct: 7297479 cgagggccgggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccgg 7297420 Query: 334 cgaggatgttggcgccgacga 354 ||||||||||||||||||||| Sbjct: 7297419 cgaggatgttggcgccgacga 7297399 Score = 58.0 bits (29), Expect = 3e-05 Identities = 44/49 (89%) Strand = Plus / Plus Query: 207 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 255 |||||||||||| ||||||||| ||| |||| |||||||||||| |||| Sbjct: 6644922 ccggcgaggccggcgccgatgaagggaccgagccagtacacccagtggt 6644970 Score = 56.0 bits (28), Expect = 1e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 300 gggttcatggacncgccggagaaggcgccgccgacgaggatgttggcgccgacga 354 |||||||||||| |||||| || ||||||||| ||| | ||||||||||||||| Sbjct: 7302352 gggttcatggacgcgccggtgagcgcgccgccggcgacggtgttggcgccgacga 7302298
>dbj|AP003627.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0459B04 Length = 142475 Score = 210 bits (106), Expect = 3e-51 Identities = 184/211 (87%) Strand = Plus / Plus Query: 271 tgacgagggcggggccgaaggagacggcggggttcatggacncgccggagaaggcgccgc 330 |||||| ||||||||||||||||||||||||||||||||| ||||| ||||||||||| Sbjct: 105828 tgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgc 105887 Query: 331 cgacgaggatgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgcccaggc 390 || ||||||||||||||||||||||||| |||||||||||||| |||||| || ||| Sbjct: 105888 cggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggt 105947 Query: 391 tgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcatga 450 |||||||||||| || || |||||||||||||| ||||| || || ||||| ||||||| Sbjct: 105948 cgcccttcttgggatccaccgcggtggcgtacacggtgtagacgaggccgaaggtcatga 106007 Query: 451 cgatctccaggaccaccgccttccacgcgcc 481 ||||||| | |||||||| ||||| ||||| Sbjct: 106008 cgatctcgaacaccaccgcgttccaggcgcc 106038
>dbj|AP005449.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0427E01 Length = 146395 Score = 210 bits (106), Expect = 3e-51 Identities = 169/191 (88%) Strand = Plus / Minus Query: 269 gctgacgagggcggggccgaaggagacggcggggttcatggacncgccggagaaggcgcc 328 |||| ||| |||||||||||||||| || ||||||||||| |||||||||||| ||| Sbjct: 12820 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 12761 Query: 329 gccgacgaggatgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgcccag 388 | |||||||||||||||||||||||||||| |||||||||||||||||||||||||| || Sbjct: 12760 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 12701 Query: 389 gctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcat 448 ||||||||||||||| |||||||||||||||| ||||||||||||||||| || | Sbjct: 12700 cgaccccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgac 12641 Query: 449 gacgatctcca 459 || |||||||| Sbjct: 12640 gatgatctcca 12630 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 197 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 244 ||||| || |||||||||||||||||||| |||||||||||||||||| Sbjct: 12892 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 12845
>dbj|AP004784.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBa0012F14 Length = 168629 Score = 210 bits (106), Expect = 3e-51 Identities = 169/191 (88%) Strand = Plus / Minus Query: 269 gctgacgagggcggggccgaaggagacggcggggttcatggacncgccggagaaggcgcc 328 |||| ||| |||||||||||||||| || ||||||||||| |||||||||||| ||| Sbjct: 168198 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 168139 Query: 329 gccgacgaggatgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgcccag 388 | |||||||||||||||||||||||||||| |||||||||||||||||||||||||| || Sbjct: 168138 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 168079 Query: 389 gctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcat 448 ||||||||||||||| |||||||||||||||| ||||||||||||||||| || | Sbjct: 168078 cgaccccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgac 168019 Query: 449 gacgatctcca 459 || |||||||| Sbjct: 168018 gatgatctcca 168008 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 197 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 244 ||||| || |||||||||||||||||||| |||||||||||||||||| Sbjct: 168270 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 168223
>dbj|AK111768.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023066H10, full insert sequence Length = 1346 Score = 210 bits (106), Expect = 3e-51 Identities = 184/211 (87%) Strand = Plus / Minus Query: 271 tgacgagggcggggccgaaggagacggcggggttcatggacncgccggagaaggcgccgc 330 |||||| ||||||||||||||||||||||||||||||||| ||||| ||||||||||| Sbjct: 652 tgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgc 593 Query: 331 cgacgaggatgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgcccaggc 390 || ||||||||||||||||||||||||| |||||||||||||| |||||| || ||| Sbjct: 592 cggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggt 533 Query: 391 tgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcatga 450 |||||||||||| || || |||||||||||||| ||||| || || ||||| ||||||| Sbjct: 532 cgcccttcttgggatccaccgcggtggcgtacacggtgtagacgaggccgaaggtcatga 473 Query: 451 cgatctccaggaccaccgccttccacgcgcc 481 ||||||| | |||||||| ||||| ||||| Sbjct: 472 cgatctcgaacaccaccgcgttccaggcgcc 442
>dbj|AK111747.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023050B20, full insert sequence Length = 1149 Score = 210 bits (106), Expect = 3e-51 Identities = 184/211 (87%) Strand = Plus / Minus Query: 271 tgacgagggcggggccgaaggagacggcggggttcatggacncgccggagaaggcgccgc 330 |||||| ||||||||||||||||||||||||||||||||| ||||| ||||||||||| Sbjct: 701 tgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgc 642 Query: 331 cgacgaggatgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgcccaggc 390 || ||||||||||||||||||||||||| |||||||||||||| |||||| || ||| Sbjct: 641 cggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggt 582 Query: 391 tgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcatga 450 |||||||||||| || || |||||||||||||| ||||| || || ||||| ||||||| Sbjct: 581 cgcccttcttgggatccaccgcggtggcgtacacggtgtagacgaggccgaaggtcatga 522 Query: 451 cgatctccaggaccaccgccttccacgcgcc 481 ||||||| | |||||||| ||||| ||||| Sbjct: 521 cgatctcgaacaccaccgcgttccaggcgcc 491
>dbj|AB114829.1| Oryza sativa (japonica cultivar-group) OsTIP1 mRNA for tonoplast intrinsic protein, complete cds Length = 970 Score = 210 bits (106), Expect = 3e-51 Identities = 184/211 (87%) Strand = Plus / Minus Query: 271 tgacgagggcggggccgaaggagacggcggggttcatggacncgccggagaaggcgccgc 330 |||||| ||||||||||||||||||||||||||||||||| ||||| ||||||||||| Sbjct: 638 tgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgc 579 Query: 331 cgacgaggatgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgcccaggc 390 || ||||||||||||||||||||||||| |||||||||||||| |||||| || ||| Sbjct: 578 cggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggt 519 Query: 391 tgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcatga 450 |||||||||||| || || |||||||||||||| ||||| || || ||||| ||||||| Sbjct: 518 cgcccttcttgggatccaccgcggtggcgtacacggtgtagacgaggccgaaggtcatga 459 Query: 451 cgatctccaggaccaccgccttccacgcgcc 481 ||||||| | |||||||| ||||| ||||| Sbjct: 458 cgatctcgaacaccaccgcgttccaggcgcc 428
>dbj|AK104464.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C06, full insert sequence Length = 1194 Score = 210 bits (106), Expect = 3e-51 Identities = 169/191 (88%) Strand = Plus / Minus Query: 269 gctgacgagggcggggccgaaggagacggcggggttcatggacncgccggagaaggcgcc 328 |||| ||| |||||||||||||||| || ||||||||||| |||||||||||| ||| Sbjct: 710 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 651 Query: 329 gccgacgaggatgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgcccag 388 | |||||||||||||||||||||||||||| |||||||||||||||||||||||||| || Sbjct: 650 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 591 Query: 389 gctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcat 448 ||||||||||||||| |||||||||||||||| ||||||||||||||||| || | Sbjct: 590 cgaccccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgac 531 Query: 449 gacgatctcca 459 || |||||||| Sbjct: 530 gatgatctcca 520 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 197 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 244 ||||| || |||||||||||||||||||| |||||||||||||||||| Sbjct: 782 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 735
>dbj|AK104270.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-F03, full insert sequence Length = 1214 Score = 210 bits (106), Expect = 3e-51 Identities = 169/191 (88%) Strand = Plus / Minus Query: 269 gctgacgagggcggggccgaaggagacggcggggttcatggacncgccggagaaggcgcc 328 |||| ||| |||||||||||||||| || ||||||||||| |||||||||||| ||| Sbjct: 712 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 653 Query: 329 gccgacgaggatgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgcccag 388 | |||||||||||||||||||||||||||| |||||||||||||||||||||||||| || Sbjct: 652 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 593 Query: 389 gctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcat 448 ||||||||||||||| |||||||||||||||| ||||||||||||||||| || | Sbjct: 592 cgaccccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgac 533 Query: 449 gacgatctcca 459 || |||||||| Sbjct: 532 gatgatctcca 522 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 197 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 244 ||||| || |||||||||||||||||||| |||||||||||||||||| Sbjct: 784 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 737
>dbj|AK100193.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023036J06, full insert sequence Length = 1074 Score = 210 bits (106), Expect = 3e-51 Identities = 169/191 (88%) Strand = Plus / Minus Query: 269 gctgacgagggcggggccgaaggagacggcggggttcatggacncgccggagaaggcgcc 328 |||| ||| |||||||||||||||| || ||||||||||| |||||||||||| ||| Sbjct: 590 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 531 Query: 329 gccgacgaggatgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgcccag 388 | |||||||||||||||||||||||||||| |||||||||||||||||||||||||| || Sbjct: 530 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 471 Query: 389 gctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcat 448 ||||||||||||||| |||||||||||||||| ||||||||||||||||| || | Sbjct: 470 cgaccccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgac 411 Query: 449 gacgatctcca 459 || |||||||| Sbjct: 410 gatgatctcca 400 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 197 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 244 ||||| || |||||||||||||||||||| |||||||||||||||||| Sbjct: 662 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 615
>dbj|AK099616.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013050J20, full insert sequence Length = 1197 Score = 210 bits (106), Expect = 3e-51 Identities = 169/191 (88%) Strand = Plus / Minus Query: 269 gctgacgagggcggggccgaaggagacggcggggttcatggacncgccggagaaggcgcc 328 |||| ||| |||||||||||||||| || ||||||||||| |||||||||||| ||| Sbjct: 713 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 654 Query: 329 gccgacgaggatgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgcccag 388 | |||||||||||||||||||||||||||| |||||||||||||||||||||||||| || Sbjct: 653 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 594 Query: 389 gctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcat 448 ||||||||||||||| |||||||||||||||| ||||||||||||||||| || | Sbjct: 593 cgaccccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgac 534 Query: 449 gacgatctcca 459 || |||||||| Sbjct: 533 gatgatctcca 523 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 197 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 244 ||||| || |||||||||||||||||||| |||||||||||||||||| Sbjct: 785 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 738
>dbj|AK099141.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023055A02, full insert sequence Length = 1195 Score = 210 bits (106), Expect = 3e-51 Identities = 169/191 (88%) Strand = Plus / Minus Query: 269 gctgacgagggcggggccgaaggagacggcggggttcatggacncgccggagaaggcgcc 328 |||| ||| |||||||||||||||| || ||||||||||| |||||||||||| ||| Sbjct: 711 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 652 Query: 329 gccgacgaggatgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgcccag 388 | |||||||||||||||||||||||||||| |||||||||||||||||||||||||| || Sbjct: 651 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 592 Query: 389 gctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcat 448 ||||||||||||||| |||||||||||||||| ||||||||||||||||| || | Sbjct: 591 cgaccccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgac 532 Query: 449 gacgatctcca 459 || |||||||| Sbjct: 531 gatgatctcca 521 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 197 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 244 ||||| || |||||||||||||||||||| |||||||||||||||||| Sbjct: 783 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 736
>dbj|AK099015.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013116H02, full insert sequence Length = 1202 Score = 210 bits (106), Expect = 3e-51 Identities = 169/191 (88%) Strand = Plus / Minus Query: 269 gctgacgagggcggggccgaaggagacggcggggttcatggacncgccggagaaggcgcc 328 |||| ||| |||||||||||||||| || ||||||||||| |||||||||||| ||| Sbjct: 713 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 654 Query: 329 gccgacgaggatgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgcccag 388 | |||||||||||||||||||||||||||| |||||||||||||||||||||||||| || Sbjct: 653 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 594 Query: 389 gctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcat 448 ||||||||||||||| |||||||||||||||| ||||||||||||||||| || | Sbjct: 593 cgaccccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgac 534 Query: 449 gacgatctcca 459 || |||||||| Sbjct: 533 gatgatctcca 523 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 197 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 244 ||||| || |||||||||||||||||||| |||||||||||||||||| Sbjct: 785 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 738
>dbj|AK073531.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033044F19, full insert sequence Length = 1220 Score = 210 bits (106), Expect = 3e-51 Identities = 169/191 (88%) Strand = Plus / Minus Query: 269 gctgacgagggcggggccgaaggagacggcggggttcatggacncgccggagaaggcgcc 328 |||| ||| |||||||||||||||| || ||||||||||| |||||||||||| ||| Sbjct: 711 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 652 Query: 329 gccgacgaggatgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgcccag 388 | |||||||||||||||||||||||||||| |||||||||||||||||||||||||| || Sbjct: 651 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 592 Query: 389 gctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcat 448 ||||||||||||||| |||||||||||||||| ||||||||||||||||| || | Sbjct: 591 cgaccccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgac 532 Query: 449 gacgatctcca 459 || |||||||| Sbjct: 531 gatgatctcca 521 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 197 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 244 ||||| || |||||||||||||||||||| |||||||||||||||||| Sbjct: 783 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 736
>dbj|AK104377.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-035-G09, full insert sequence Length = 1196 Score = 202 bits (102), Expect = 8e-49 Identities = 168/191 (87%) Strand = Plus / Minus Query: 269 gctgacgagggcggggccgaaggagacggcggggttcatggacncgccggagaaggcgcc 328 |||| ||| |||||| ||||||||| || ||||||||||| |||||||||||| ||| Sbjct: 712 gctggcgacggcgggaccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 653 Query: 329 gccgacgaggatgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgcccag 388 | |||||||||||||||||||||||||||| |||||||||||||||||||||||||| || Sbjct: 652 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 593 Query: 389 gctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcat 448 ||||||||||||||| |||||||||||||||| ||||||||||||||||| || | Sbjct: 592 cgaccccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgac 533 Query: 449 gacgatctcca 459 || |||||||| Sbjct: 532 gatgatctcca 522 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 197 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 244 ||||| || |||||||||||||||||||| |||||||||||||||||| Sbjct: 784 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 737
>gb|AY112388.1| Zea mays CL24208_1 mRNA sequence Length = 833 Score = 194 bits (98), Expect = 2e-46 Identities = 199/236 (84%) Strand = Plus / Plus Query: 231 gggccgacccagtacacccactggtacccccactcccagctgacgagggcggggccgaag 290 |||||||||||||||||||| |||| | |||| | | | |||||| || ||||||||| Sbjct: 329 gggccgacccagtacacccagtggttctcccagacgccggtgacgacagccgggccgaag 388 Query: 291 gagacggcggggttcatggacncgccggagaaggcgccgccgacgaggatgttggcgccg 350 |||||||||| ||||||||| ||||| ||||||| | ||||||||||||||| Sbjct: 389 gagacggcggngttcatggaggcgccgtcgaaggcgnnnnnngccaggatgttggcgccg 448 Query: 351 acgatgaanccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacg 410 |||||||| ||||||||||||||||||||| ||| ||| ||||||||||||||| ||| Sbjct: 449 acgatgaagccgatggcgatgggcgcgatgacgccgaggtcgcccttcttggggtccacg 508 Query: 411 gcggtggcgtacaccgtgtacaccagcccgaangtcatgacgatctccaggaccac 466 || |||||||||||||||||||| || ||||| |||||||| |||||||| ||||| Sbjct: 509 gccgtggcgtacaccgtgtacacgaggccgaaggtcatgaccatctccagcaccac 564
>gb|AY525641.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;3 mRNA, complete cds Length = 829 Score = 192 bits (97), Expect = 7e-46 Identities = 160/182 (87%) Strand = Plus / Minus Query: 278 ggcggggccgaaggagacggcggggttcatggacncgccggagaaggcgccgccgacgag 337 |||||||||||||||| || |||||||||||| |||||||||||| |||| ||||||| Sbjct: 663 ggcggggccgaaggagcgtgcagggttcatggacccgccggagaaggggccggcgacgag 604 Query: 338 gatgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgcccaggctgccctt 397 ||||||||||||||||||||| ||||||||||| || ||||||||||| ||| ||||| Sbjct: 603 gatgttggcgccgacgatgaagccgatggcgattggagcgatggtgccgagggacccctt 544 Query: 398 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcatgacgatctc 457 |||||||||| |||||||||||||||| ||||| || |||||||| || | || |||||| Sbjct: 543 cttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatgatctc 484 Query: 458 ca 459 || Sbjct: 483 ca 482 Score = 63.9 bits (32), Expect = 5e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 197 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 244 ||||| ||||||||||||||| ||||||||||| |||||| ||||||| Sbjct: 744 gtagacgacgccggcgaggccaccgccgatgagcgggccggcccagta 697
>gb|AY525640.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;2 mRNA, complete cds Length = 853 Score = 192 bits (97), Expect = 7e-46 Identities = 160/182 (87%) Strand = Plus / Minus Query: 278 ggcggggccgaaggagacggcggggttcatggacncgccggagaaggcgccgccgacgag 337 |||||||||||||||| || |||||||||||| |||||||||||| |||| | ||||| Sbjct: 666 ggcggggccgaaggagcgtgcagggttcatggacccgccggagaaggggccggcaacgag 607 Query: 338 gatgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgcccaggctgccctt 397 ||||||||||||||||||||| |||||||||||||| ||||||||||| ||| ||||| Sbjct: 606 gatgttggcgccgacgatgaagccgatggcgatgggggcgatggtgccgagggaaccctt 547 Query: 398 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcatgacgatctc 457 |||||||||| |||||||||||||||| ||||| || |||||||| || | || |||||| Sbjct: 546 cttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatgatctc 487 Query: 458 ca 459 || Sbjct: 486 ca 485 Score = 63.9 bits (32), Expect = 5e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 197 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 244 ||||| ||||||||||||||| ||||||||||| |||||| ||||||| Sbjct: 747 gtagacgacgccggcgaggccaccgccgatgagcgggccggcccagta 700
>gb|AY525639.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;1 mRNA, complete cds Length = 817 Score = 192 bits (97), Expect = 7e-46 Identities = 160/182 (87%) Strand = Plus / Minus Query: 278 ggcggggccgaaggagacggcggggttcatggacncgccggagaaggcgccgccgacgag 337 |||||||||||||||| || |||||||||||| |||||||||||| |||| | ||||| Sbjct: 667 ggcggggccgaaggagcgtgcagggttcatggacccgccggagaaggggccggccacgag 608 Query: 338 gatgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgcccaggctgccctt 397 ||||||||||||||||||||| |||||||||||||| ||||||||||| ||| ||||| Sbjct: 607 gatgttggcgccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccctt 548 Query: 398 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcatgacgatctc 457 |||||||||| |||||||||||||||| ||||| || |||||||| || | || |||||| Sbjct: 547 cttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatgatctc 488 Query: 458 ca 459 || Sbjct: 487 ca 486 Score = 67.9 bits (34), Expect = 3e-08 Identities = 49/54 (90%) Strand = Plus / Minus Query: 197 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccca 250 ||||| ||||||||||||||| ||||||||||| |||||| ||||||| ||||| Sbjct: 748 gtagacgacgccggcgaggccaccgccgatgagcgggccggcccagtagaccca 695
>gb|AF326502.1|AF326502 Zea mays tonoplast membrane integral protein ZmTIP2-2 mRNA, complete cds Length = 1073 Score = 188 bits (95), Expect = 1e-44 Identities = 158/180 (87%) Strand = Plus / Minus Query: 278 ggcggggccgaaggagacggcggggttcatggacncgccggagaaggcgccgccgacgag 337 |||||||||||||||| ||||||||||||||| ||||| ||||| || || |||| Sbjct: 682 ggcggggccgaaggagcgggcggggttcatggagccgccgctgaagggccccgcggcgag 623 Query: 338 gatgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgcccaggctgccctt 397 ||||||||||||||||||||| |||||||||||||||||||||||||| ||| |||||| Sbjct: 622 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagggagccctt 563 Query: 398 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcatgacgatctc 457 |||||||||| |||||||||||||||| ||||| || ||| |||| || ||||||||||| Sbjct: 562 cttggggtcggcggcggtggcgtacacggtgtagacgagcgcgaaggtgatgacgatctc 503 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 196 cgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccca 250 |||||| || ||| ||||| |||||||||||||| |||||||||||||| ||||| Sbjct: 764 cgtagacgaggccagcgagtccgccgccgatgagcgggccgacccagtagaccca 710
>gb|AY243804.1| Zea mays tonoplast water channel mRNA, complete cds Length = 968 Score = 176 bits (89), Expect = 4e-41 Identities = 158/182 (86%) Strand = Plus / Minus Query: 278 ggcggggccgaaggagacggcggggttcatggacncgccggagaaggcgccgccgacgag 337 |||||||||||||||| ||| ||||||||||| ||||| ||||| |||| || | || Sbjct: 615 ggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcggccag 556 Query: 338 gatgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgcccaggctgccctt 397 ||||||||||||||||||||| |||||||| ||||||||||||||||||||| ||||| Sbjct: 555 gatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggacccctt 496 Query: 398 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcatgacgatctc 457 ||| |||||| | |||||||||||||| |||||||||||| |||| || || |||||||| Sbjct: 495 cttcgggtcggccgcggtggcgtacacggtgtacaccagcgcgaaggtgatcacgatctc 436 Query: 458 ca 459 || Sbjct: 435 ca 434 Score = 60.0 bits (30), Expect = 7e-06 Identities = 36/38 (94%) Strand = Plus / Minus Query: 213 aggccgccgccgatgagggggccgacccagtacaccca 250 ||||| ||||||| |||||||||||||||||||||||| Sbjct: 680 aggccaccgccgacgagggggccgacccagtacaccca 643 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Minus Query: 278 ggcggggccgaaggagacggcggggttca 306 |||| ||||||||| |||||||||||||| Sbjct: 276 ggcgaggccgaaggtgacggcggggttca 248
>gb|AF326503.1|AF326503 Zea mays tonoplast membrane integral protein ZmTIP2-3 mRNA, complete cds Length = 1042 Score = 176 bits (89), Expect = 4e-41 Identities = 158/182 (86%) Strand = Plus / Minus Query: 278 ggcggggccgaaggagacggcggggttcatggacncgccggagaaggcgccgccgacgag 337 |||||||||||||||| ||| ||||||||||| ||||| ||||| |||| || | || Sbjct: 683 ggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcggccag 624 Query: 338 gatgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgcccaggctgccctt 397 ||||||||||||||||||||| |||||||| ||||||||||||||||||||| ||||| Sbjct: 623 gatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggacccctt 564 Query: 398 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcatgacgatctc 457 ||| |||||| | |||||||||||||| |||||||||||| |||| || || |||||||| Sbjct: 563 cttcgggtcggccgcggtggcgtacacggtgtacaccagcgcgaaggtgatcacgatctc 504 Query: 458 ca 459 || Sbjct: 503 ca 502 Score = 60.0 bits (30), Expect = 7e-06 Identities = 36/38 (94%) Strand = Plus / Minus Query: 213 aggccgccgccgatgagggggccgacccagtacaccca 250 ||||| ||||||| |||||||||||||||||||||||| Sbjct: 748 aggccaccgccgacgagggggccgacccagtacaccca 711 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Minus Query: 278 ggcggggccgaaggagacggcggggttca 306 |||| ||||||||| |||||||||||||| Sbjct: 344 ggcgaggccgaaggtgacggcggggttca 316
>gb|U86763.1|TAU86763 Triticum aestivum delta-type tonoplast intrinsic protein mRNA, complete cds Length = 1067 Score = 176 bits (89), Expect = 4e-41 Identities = 158/182 (86%) Strand = Plus / Minus Query: 278 ggcggggccgaaggagacggcggggttcatggacncgccggagaaggcgccgccgacgag 337 |||||||||||||||| || |||||||||||| ||||||| |||| |||| | ||||| Sbjct: 669 ggcggggccgaaggagcgtgcagggttcatggacccgccggaaaaggggccggccacgag 610 Query: 338 gatgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgcccaggctgccctt 397 ||||||||||||||| ||||| |||||||||||||| ||||||||||| ||| ||||| Sbjct: 609 gatgttggcgccgacaatgaagccgatggcgatgggggcgatggtgccgagggatccctt 550 Query: 398 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcatgacgatctc 457 |||||||||| |||||||||||||||| ||||| || |||||||| || | || |||||| Sbjct: 549 cttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatgatctc 490 Query: 458 ca 459 || Sbjct: 489 ca 488 Score = 63.9 bits (32), Expect = 5e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 203 gacgccggcgaggccgccgccgatgagggggccgacccagtacaccca 250 ||||||||||||||| ||||||||||| |||||| ||||||| ||||| Sbjct: 744 gacgccggcgaggccaccgccgatgagcgggccggcccagtaaaccca 697
>gb|AF057183.1|AF057183 Zea mays putative tonoplast aquaporin mRNA, complete cds Length = 1060 Score = 176 bits (89), Expect = 4e-41 Identities = 158/182 (86%) Strand = Plus / Minus Query: 278 ggcggggccgaaggagacggcggggttcatggacncgccggagaaggcgccgccgacgag 337 |||||||||||||||| ||| ||||||||||| ||||| ||||| |||| || | || Sbjct: 674 ggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcggccag 615 Query: 338 gatgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgcccaggctgccctt 397 ||||||||||||||||||||| |||||||| ||||||||||||||||||||| ||||| Sbjct: 614 gatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggacccctt 555 Query: 398 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcatgacgatctc 457 ||| |||||| | |||||||||||||| |||||||||||| |||| || || |||||||| Sbjct: 554 cttcgggtcggccgcggtggcgtacacggtgtacaccagcgcgaaggtgatcacgatctc 495 Query: 458 ca 459 || Sbjct: 494 ca 493 Score = 60.0 bits (30), Expect = 7e-06 Identities = 36/38 (94%) Strand = Plus / Minus Query: 213 aggccgccgccgatgagggggccgacccagtacaccca 250 ||||| ||||||| |||||||||||||||||||||||| Sbjct: 739 aggccaccgccgacgagggggccgacccagtacaccca 702 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Minus Query: 278 ggcggggccgaaggagacggcggggttca 306 |||| ||||||||| |||||||||||||| Sbjct: 335 ggcgaggccgaaggtgacggcggggttca 307
>gb|AF326501.1|AF326501 Zea mays tonoplast membrane integral protein ZmTIP2-1 mRNA, complete cds Length = 1110 Score = 172 bits (87), Expect = 7e-40 Identities = 153/176 (86%) Strand = Plus / Minus Query: 278 ggcggggccgaaggagacggcggggttcatggacncgccggagaaggcgccgccgacgag 337 |||||||||||||||| ||||||||||||||| ||||| ||||| || || |||| Sbjct: 839 ggcggggccgaaggagcgggcggggttcatggagccgccgctgaagggccccgcggcgag 780 Query: 338 gatgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgcccaggctgccctt 397 ||||||||||||||||||||| |||||||||||||||||||||||||| || |||||| Sbjct: 779 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgagccctt 720 Query: 398 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcatgacga 453 |||||||||| |||||||||||||||| ||||| || ||| |||| || ||||||| Sbjct: 719 cttggggtcggcggcggtggcgtacacggtgtagacgagcgcgaaggtgatgacga 664 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 196 cgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccca 250 |||||| || ||| |||||||||||||||| ||| |||||||||||||| ||||| Sbjct: 921 cgtagacgaggccagcgaggccgccgccgacgagcgggccgacccagtagaccca 867
>gb|AY105015.1| Zea mays PCO137646 mRNA sequence Length = 1238 Score = 172 bits (87), Expect = 7e-40 Identities = 153/176 (86%) Strand = Plus / Minus Query: 278 ggcggggccgaaggagacggcggggttcatggacncgccggagaaggcgccgccgacgag 337 |||||||||||||||| ||||||||||||||| ||||| ||||| || || |||| Sbjct: 838 ggcggggccgaaggagcgggcggggttcatggagccgccgctgaagggccccgcggcgag 779 Query: 338 gatgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgcccaggctgccctt 397 ||||||||||||||||||||| |||||||||||||||||||||||||| || |||||| Sbjct: 778 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgagccctt 719 Query: 398 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcatgacga 453 |||||||||| |||||||||||||||| ||||| || ||| |||| || ||||||| Sbjct: 718 cttggggtcggcggcggtggcgtacacggtgtagacgagcgcgaaggtgatgacga 663 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 196 cgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccca 250 |||||| || ||| |||||||||||||||| ||| |||||||||||||| ||||| Sbjct: 920 cgtagacgaggccagcgaggccgccgccgacgagcgggccgacccagtagaccca 866
>gb|AY106931.1| Zea mays PCO140073 mRNA sequence Length = 1069 Score = 168 bits (85), Expect = 1e-38 Identities = 157/182 (86%) Strand = Plus / Minus Query: 278 ggcggggccgaaggagacggcggggttcatggacncgccggagaaggcgccgccgacgag 337 |||||||||||||||| ||| ||||||||||| ||||| ||||| |||| || | || Sbjct: 692 ggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcggccag 633 Query: 338 gatgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgcccaggctgccctt 397 ||||||||||||||||||||| |||||||| ||||||||||||||||||||| ||||| Sbjct: 632 gatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggacccctt 573 Query: 398 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcatgacgatctc 457 ||| |||||| | |||||||||||||| ||||||||||| |||| || || |||||||| Sbjct: 572 cttcgggtcggccgcggtggcgtacacggtgtacaccagagcgaaggtgatcacgatctc 513 Query: 458 ca 459 || Sbjct: 512 ca 511 Score = 60.0 bits (30), Expect = 7e-06 Identities = 36/38 (94%) Strand = Plus / Minus Query: 213 aggccgccgccgatgagggggccgacccagtacaccca 250 ||||| ||||||| |||||||||||||||||||||||| Sbjct: 757 aggccaccgccgacgagggggccgacccagtacaccca 720 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Minus Query: 278 ggcggggccgaaggagacggcggggttca 306 |||| ||||||||| |||||||||||||| Sbjct: 353 ggcgaggccgaaggtgacggcggggttca 325
>gb|AY389618.1| Hyacinthus orientalis mitochondrial tonoplast intrinsic protein (TIP1) mRNA, partial cds Length = 662 Score = 165 bits (83), Expect = 2e-37 Identities = 182/216 (84%) Strand = Plus / Minus Query: 260 ccactcccagctgacgagggcggggccgaaggagacggcggggttcatggacncgccgga 319 |||||||||||| || || | || |||||||| || || |||||||| ||| | ||| Sbjct: 632 ccactcccagctcaccagcggcggcccgaaggacaccgccgggttcatcgacgccccgtc 573 Query: 320 gaaggcgccgccgacgaggatgttggcgccgacgatgaanccgatggcgatgggcgcgat 379 |||||| |||||| | ||||||||||| || |||||||| ||||| |||||||||||||| Sbjct: 572 gaaggccccgccggccaggatgttggcccccacgatgaagccgatcgcgatgggcgcgat 513 Query: 380 ggtgcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagccc 439 || |||||||| |||||||| ||||| | ||||||||||||||| ||||| || ||||| Sbjct: 512 cgtccccaggctccccttcttcgggtcaatggcggtggcgtacacggtgtagacgagccc 453 Query: 440 gaangtcatgacgatctccaggaccaccgccttcca 475 ||| |||||||||||||| ||||||| ||| ||||| Sbjct: 452 gaaggtcatgacgatctcgaggaccagcgcgttcca 417
>dbj|AK060994.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-E02, full insert sequence Length = 870 Score = 155 bits (78), Expect = 2e-34 Identities = 93/98 (94%) Strand = Plus / Minus Query: 130 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 189 ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 689 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 630 Query: 190 gcagctcgtagatgacgccggcgaggccgccgccgatg 227 | | |||||||||||||||||||||||| ||||||||| Sbjct: 629 ggacctcgtagatgacgccggcgaggccaccgccgatg 592 Score = 99.6 bits (50), Expect = 8e-18 Identities = 70/77 (90%) Strand = Plus / Minus Query: 389 gctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcat 448 |||||||||||||||||| ||||||||||||||||| ||||| || || ||||| ||||| Sbjct: 592 gctgcccttcttggggtcaacggcggtggcgtacacggtgtagacgaggccgaaggtcat 533 Query: 449 gacgatctccaggacca 465 |||||||||||| |||| Sbjct: 532 gacgatctccagcacca 516
>ref|XM_467137.1| Oryza sativa (japonica cultivar-group), mRNA Length = 747 Score = 153 bits (77), Expect = 6e-34 Identities = 155/182 (85%) Strand = Plus / Minus Query: 278 ggcggggccgaaggagacggcggggttcatggacncgccggagaaggcgccgccgacgag 337 |||||||||||||||| || ||||||||||| ||||| ||| | |||| || |||| Sbjct: 612 ggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcgag 553 Query: 338 gatgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgcccaggctgccctt 397 ||||||||||||||||||||| ||||| |||||||||||||||||||| || ||||| Sbjct: 552 gatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccgagcgatccctt 493 Query: 398 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcatgacgatctc 457 ||| ||||| | || |||||||||||||||||||||||| |||| || ||||||||||| Sbjct: 492 cttcgggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtgatgacgatctc 433 Query: 458 ca 459 || Sbjct: 432 ca 431 Score = 63.9 bits (32), Expect = 5e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 207 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 250 |||||||||||||||||||| || |||||||||||||| ||||| Sbjct: 683 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 640
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 153 bits (77), Expect = 6e-34 Identities = 155/182 (85%) Strand = Plus / Plus Query: 278 ggcggggccgaaggagacggcggggttcatggacncgccggagaaggcgccgccgacgag 337 |||||||||||||||| || ||||||||||| ||||| ||| | |||| || |||| Sbjct: 26627254 ggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcgag 26627313 Query: 338 gatgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgcccaggctgccctt 397 ||||||||||||||||||||| ||||| |||||||||||||||||||| || ||||| Sbjct: 26627314 gatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccgagcgatccctt 26627373 Query: 398 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcatgacgatctc 457 ||| ||||| | || |||||||||||||||||||||||| |||| || ||||||||||| Sbjct: 26627374 cttcgggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtgatgacgatctc 26627433 Query: 458 ca 459 || Sbjct: 26627434 ca 26627435 Score = 63.9 bits (32), Expect = 5e-07 Identities = 41/44 (93%) Strand = Plus / Plus Query: 207 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 250 |||||||||||||||||||| || |||||||||||||| ||||| Sbjct: 26627183 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 26627226
>dbj|AP005006.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0519E06 Length = 170634 Score = 153 bits (77), Expect = 6e-34 Identities = 155/182 (85%) Strand = Plus / Plus Query: 278 ggcggggccgaaggagacggcggggttcatggacncgccggagaaggcgccgccgacgag 337 |||||||||||||||| || ||||||||||| ||||| ||| | |||| || |||| Sbjct: 169635 ggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcgag 169694 Query: 338 gatgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgcccaggctgccctt 397 ||||||||||||||||||||| ||||| |||||||||||||||||||| || ||||| Sbjct: 169695 gatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccgagcgatccctt 169754 Query: 398 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcatgacgatctc 457 ||| ||||| | || |||||||||||||||||||||||| |||| || ||||||||||| Sbjct: 169755 cttcgggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtgatgacgatctc 169814 Query: 458 ca 459 || Sbjct: 169815 ca 169816 Score = 63.9 bits (32), Expect = 5e-07 Identities = 41/44 (93%) Strand = Plus / Plus Query: 207 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 250 |||||||||||||||||||| || |||||||||||||| ||||| Sbjct: 169564 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 169607
>dbj|AP005289.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1112_F09 Length = 139371 Score = 153 bits (77), Expect = 6e-34 Identities = 155/182 (85%) Strand = Plus / Plus Query: 278 ggcggggccgaaggagacggcggggttcatggacncgccggagaaggcgccgccgacgag 337 |||||||||||||||| || ||||||||||| ||||| ||| | |||| || |||| Sbjct: 61415 ggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcgag 61474 Query: 338 gatgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgcccaggctgccctt 397 ||||||||||||||||||||| ||||| |||||||||||||||||||| || ||||| Sbjct: 61475 gatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccgagcgatccctt 61534 Query: 398 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcatgacgatctc 457 ||| ||||| | || |||||||||||||||||||||||| |||| || ||||||||||| Sbjct: 61535 cttcgggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtgatgacgatctc 61594 Query: 458 ca 459 || Sbjct: 61595 ca 61596 Score = 63.9 bits (32), Expect = 5e-07 Identities = 41/44 (93%) Strand = Plus / Plus Query: 207 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 250 |||||||||||||||||||| || |||||||||||||| ||||| Sbjct: 61344 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 61387
>dbj|AB114830.1| Oryza sativa (japonica cultivar-group) OsTIP2 mRNA for tonoplast intrinsic protein, complete cds Length = 1013 Score = 153 bits (77), Expect = 6e-34 Identities = 155/182 (85%) Strand = Plus / Minus Query: 278 ggcggggccgaaggagacggcggggttcatggacncgccggagaaggcgccgccgacgag 337 |||||||||||||||| || ||||||||||| ||||| ||| | |||| || |||| Sbjct: 685 ggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcgag 626 Query: 338 gatgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgcccaggctgccctt 397 ||||||||||||||||||||| ||||| |||||||||||||||||||| || ||||| Sbjct: 625 gatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccgagcgatccctt 566 Query: 398 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcatgacgatctc 457 ||| ||||| | || |||||||||||||||||||||||| |||| || ||||||||||| Sbjct: 565 cttcgggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtgatgacgatctc 506 Query: 458 ca 459 || Sbjct: 505 ca 504 Score = 63.9 bits (32), Expect = 5e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 207 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 250 |||||||||||||||||||| || |||||||||||||| ||||| Sbjct: 756 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 713
>dbj|AK064728.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-120-A10, full insert sequence Length = 873 Score = 153 bits (77), Expect = 6e-34 Identities = 155/182 (85%) Strand = Plus / Minus Query: 278 ggcggggccgaaggagacggcggggttcatggacncgccggagaaggcgccgccgacgag 337 |||||||||||||||| || ||||||||||| ||||| ||| | |||| || |||| Sbjct: 487 ggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcgag 428 Query: 338 gatgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgcccaggctgccctt 397 ||||||||||||||||||||| ||||| |||||||||||||||||||| || ||||| Sbjct: 427 gatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccgagcgatccctt 368 Query: 398 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcatgacgatctc 457 ||| ||||| | || |||||||||||||||||||||||| |||| || ||||||||||| Sbjct: 367 cttcgggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtgatgacgatctc 308 Query: 458 ca 459 || Sbjct: 307 ca 306 Score = 63.9 bits (32), Expect = 5e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 207 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 250 |||||||||||||||||||| || |||||||||||||| ||||| Sbjct: 558 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 515
>emb|AJ307662.1|OSA307662 Oryza sativa genomic DNA fragment, chromosome 2 Length = 339972 Score = 153 bits (77), Expect = 6e-34 Identities = 155/182 (85%) Strand = Plus / Minus Query: 278 ggcggggccgaaggagacggcggggttcatggacncgccggagaaggcgccgccgacgag 337 |||||||||||||||| || ||||||||||| ||||| ||| | |||| || |||| Sbjct: 250580 ggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcgag 250521 Query: 338 gatgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgcccaggctgccctt 397 ||||||||||||||||||||| ||||| |||||||||||||||||||| || ||||| Sbjct: 250520 gatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccgagcgatccctt 250461 Query: 398 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcatgacgatctc 457 ||| ||||| | || |||||||||||||||||||||||| |||| || ||||||||||| Sbjct: 250460 cttcgggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtgatgacgatctc 250401 Query: 458 ca 459 || Sbjct: 250400 ca 250399 Score = 135 bits (68), Expect = 2e-28 Identities = 111/126 (88%) Strand = Plus / Plus Query: 334 cgaggatgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgcccaggctgc 393 ||||||||||||||||||||||||| ||||| |||||||||||||||||||| || | Sbjct: 332124 cgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccgagcgatc 332183 Query: 394 ccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcatgacga 453 ||||||| ||||| | || |||||||||||||||||||||||| |||| || ||||||| Sbjct: 332184 ccttcttcgggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtgatgacga 332243 Query: 454 tctcca 459 |||||| Sbjct: 332244 tctcca 332249 Score = 63.9 bits (32), Expect = 5e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 207 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 250 |||||||||||||||||||| || |||||||||||||| ||||| Sbjct: 250651 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 250608
>gb|AF254799.1|AF254799 Hordeum vulgare tonoplast intrinsic protein 1 (TIP1), tonoplast intrinsic protein 2 (TIP2), and Rar1 (Rar1) genes, complete cds Length = 65979 Score = 149 bits (75), Expect = 1e-32 Identities = 138/160 (86%) Strand = Plus / Minus Query: 300 gggttcatggacncgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaan 359 ||||||||||| ||||| ||||| ||| || ||||||||||||||||||||||||| Sbjct: 44819 gggttcatggagccgccgctgaagggcccggcggcgaggatgttggcgccgacgatgaag 44760 Query: 360 ccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcg 419 ||||| || ||||||||||||||||| ||| |||||||||||||||| | || || ||| Sbjct: 44759 ccgatcgccatgggcgcgatggtgccgagggagcccttcttggggtcggccgccgtcgcg 44700 Query: 420 tacaccgtgtacaccagcccgaangtcatgacgatctcca 459 |||||||||||||||||| |||| || || |||||||||| Sbjct: 44699 tacaccgtgtacaccagcgcgaaggtgatcacgatctcca 44660 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 207 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 250 |||||||||||||| || ||||| || ||||||||||||||||| Sbjct: 44912 ccggcgaggccgccaccaatgagtggcccgacccagtacaccca 44869
>ref|XM_473424.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2307 Score = 115 bits (58), Expect = 1e-22 Identities = 107/124 (86%) Strand = Plus / Minus Query: 336 aggatgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgcccaggctgccc 395 ||||||||||| ||||||||||| |||||||| |||||||||| |||||| ||| ||| Sbjct: 557 aggatgttggcaccgacgatgaagccgatggccatgggcgcgacggtgccgagggaaccc 498 Query: 396 ttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcatgacgatc 455 ||||| |||||| | || |||||||||||||||||||||||| |||| || || || ||| Sbjct: 497 ttcttcgggtcggccgccgtggcgtacaccgtgtacaccagcgcgaacgtgatcacaatc 438 Query: 456 tcca 459 |||| Sbjct: 437 tcca 434 Score = 48.1 bits (24), Expect = 0.027 Identities = 39/44 (88%) Strand = Plus / Minus Query: 207 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 250 ||||| ||||| || ||||| || |||||||||||||||||||| Sbjct: 686 ccggccaggccaccaccgatcagtgggccgacccagtacaccca 643
>emb|AL663000.4|OSJN00201 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0034G17, complete sequence Length = 127259 Score = 115 bits (58), Expect = 1e-22 Identities = 107/124 (86%) Strand = Plus / Plus Query: 336 aggatgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgcccaggctgccc 395 ||||||||||| ||||||||||| |||||||| |||||||||| |||||| ||| ||| Sbjct: 92622 aggatgttggcaccgacgatgaagccgatggccatgggcgcgacggtgccgagggaaccc 92681 Query: 396 ttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcatgacgatc 455 ||||| |||||| | || |||||||||||||||||||||||| |||| || || || ||| Sbjct: 92682 ttcttcgggtcggccgccgtggcgtacaccgtgtacaccagcgcgaacgtgatcacaatc 92741 Query: 456 tcca 459 |||| Sbjct: 92742 tcca 92745 Score = 48.1 bits (24), Expect = 0.027 Identities = 39/44 (88%) Strand = Plus / Plus Query: 207 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 250 ||||| ||||| || ||||| || |||||||||||||||||||| Sbjct: 92493 ccggccaggccaccaccgatcagtgggccgacccagtacaccca 92536
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 115 bits (58), Expect = 1e-22 Identities = 107/124 (86%) Strand = Plus / Plus Query: 336 aggatgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgcccaggctgccc 395 ||||||||||| ||||||||||| |||||||| |||||||||| |||||| ||| ||| Sbjct: 27568646 aggatgttggcaccgacgatgaagccgatggccatgggcgcgacggtgccgagggaaccc 27568705 Query: 396 ttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcatgacgatc 455 ||||| |||||| | || |||||||||||||||||||||||| |||| || || || ||| Sbjct: 27568706 ttcttcgggtcggccgccgtggcgtacaccgtgtacaccagcgcgaacgtgatcacaatc 27568765 Query: 456 tcca 459 |||| Sbjct: 27568766 tcca 27568769 Score = 79.8 bits (40), Expect = 8e-12 Identities = 48/51 (94%) Strand = Plus / Minus Query: 403 ggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcatgacga 453 |||||||||||||||||||||| |||||||| |||||||| |||||||||| Sbjct: 26354650 ggtcgacggcggtggcgtacacggtgtacacgagcccgaacgtcatgacga 26354600 Score = 48.1 bits (24), Expect = 0.027 Identities = 39/44 (88%) Strand = Plus / Plus Query: 207 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 250 ||||| ||||| || ||||| || |||||||||||||||||||| Sbjct: 27568517 ccggccaggccaccaccgatcagtgggccgacccagtacaccca 27568560 Score = 40.1 bits (20), Expect = 6.6 Identities = 26/28 (92%) Strand = Plus / Minus Query: 203 gacgccggcgaggccgccgccgatgagg 230 ||||||| ||||||||||||||| |||| Sbjct: 19492802 gacgccgacgaggccgccgccgaggagg 19492775
>gb|U43291.1|MCU43291 Mesembryanthemum crystallinum tonoplast intrinsic protein (TIP) mRNA, complete cds Length = 1235 Score = 109 bits (55), Expect = 9e-21 Identities = 208/260 (80%) Strand = Plus / Minus Query: 198 tagatgacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtac 257 |||||||| |||||||| || || |||||||| |||||||||||||| ||||| |||| Sbjct: 752 tagatgactccggcgagccctcctccgatgagtgggccgacccagtagacccagtggttg 693 Query: 258 ccccactcccagctgacgagggcggggccgaaggagacggcggggttcatggacncgccg 317 ||| ||| ||||| ||||| || ||||| || ||||| ||||||||||| | ||| Sbjct: 692 ttccaggtccaactgactagggctggaccgaatgacacggccgggttcatggatgcaccg 633 Query: 318 gagaaggcgccgccgacgaggatgttggcgccgacgatgaanccgatggcgatgggcgcg 377 | |||||| || ||||| | ||||||||| || |||||||| || ||||| || || || Sbjct: 632 gtgaaggctcctccgaccaagatgttggctccaacgatgaaaccaatggcaattggggca 573 Query: 378 atggtgcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagc 437 ||| | || ||| |||| ||||| |||||| ||| ||||||||||| ||||| ||||| Sbjct: 572 atgattccgaggttgcctctcttgtggtcgatggccgtggcgtacacggtgtagaccagg 513 Query: 438 ccgaangtcatgacgatctc 457 ||||| ||||| || ||||| Sbjct: 512 ccgaaggtcatcacaatctc 493
>emb|AJ005078.2|PAAJ5078 Picea abies mRNA for aquaporin-like protein Length = 1007 Score = 105 bits (53), Expect = 1e-19 Identities = 143/174 (82%) Strand = Plus / Minus Query: 286 cgaaggagacggcggggttcatggacncgccggagaaggcgccgccgacgaggatgttgg 345 |||||||| ||||||||||||||| |||| ||||||| ||| || | | |||||||| Sbjct: 684 cgaaggagcgggcggggttcatggagccgccagagaaggggcccgcggccaagatgttgg 625 Query: 346 cgccgacgatgaanccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggt 405 |||| |||||||| || || || ||||| ||||||||||||||| ||||||||| |||| Sbjct: 624 cgcccacgatgaagccaatagcaatgggagcgatggtgcccaggtcgcccttcttcgggt 565 Query: 406 cgacggcggtggcgtacaccgtgtacaccagcccgaangtcatgacgatctcca 459 || | ||||||||||| || ||||| | ||| |||| || || |||||||||| Sbjct: 564 cggctgcggtggcgtagacggtgtagatgagcgcgaatgtgataacgatctcca 511 Score = 71.9 bits (36), Expect = 2e-09 Identities = 42/44 (95%) Strand = Plus / Minus Query: 207 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 250 ||||| |||||||| ||||||||||||||||||||||||||||| Sbjct: 763 ccggcaaggccgcctccgatgagggggccgacccagtacaccca 720
>emb|BX824373.1|CNS0A6WG Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH44ZA10 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 887 Score = 93.7 bits (47), Expect = 5e-16 Identities = 134/164 (81%) Strand = Plus / Minus Query: 294 acggcggggttcatggacncgccggagaaggcgccgccgacgaggatgttggcgccgacg 353 ||||| ||||||||||| ||||| ||| || || ||| |||||||||| || || ||| Sbjct: 488 acggctgggttcatggaagcgccgctgaaagctccaccggcgaggatgttcgctccaacg 429 Query: 354 atgaanccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 413 ||||| || |||||||| || ||||| || || || |||| ||||||||||| ||||| Sbjct: 428 atgaaacctatggcgattggtgcgattgttccgagagtgccgttcttggggtcaacggct 369 Query: 414 gtggcgtacaccgtgtacaccagcccgaangtcatgacgatctc 457 |||||||| || ||||| || |||||||| ||||| |||||||| Sbjct: 368 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 325
>dbj|AB206104.1| Mimosa pudica tip1;1 mRNA for tonoplast intrinsic protein 1;1, complete cds Length = 1067 Score = 89.7 bits (45), Expect = 8e-15 Identities = 96/113 (84%) Strand = Plus / Minus Query: 143 ttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagat 202 |||||| ||||||||||||||||||||||||||| |||||||||||| | || ||||| Sbjct: 826 ttagtaatcggtggtggggagctgctcgtgggtgtgggagatgaagataacttcatagat 767 Query: 203 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 255 ||| || || ||||| || || || || |||||||||||||| ||||| |||| Sbjct: 766 gaccccagcaaggccacctccaataagtgggccgacccagtagacccagtggt 714
>dbj|AB048248.1| Pyrus communis Py-gTIP mRNA for gamma tonoplast intrinsic protein, complete cds Length = 1122 Score = 89.7 bits (45), Expect = 8e-15 Identities = 100/119 (84%) Strand = Plus / Minus Query: 339 atgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgcccaggctgcccttc 398 ||||||||||| |||||||| || || |||||||||||||| || |||| ||| || ||| Sbjct: 631 atgttggcgccaacgatgaaaccaatcgcgatgggcgcgattgtccccacgctcccattc 572 Query: 399 ttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcatgacgatctc 457 || ||||| | ||| || ||||| |||||||| ||||| ||||| ||||| |||||||| Sbjct: 571 ttcgggtcaatggcagtcgcgtagaccgtgtagaccagtccgaacgtcatcacgatctc 513
>dbj|D84669.1| Raphanus sativus mRNA for VM23, complete sequence Length = 1054 Score = 87.7 bits (44), Expect = 3e-14 Identities = 134/165 (81%) Strand = Plus / Minus Query: 293 gacggcggggttcatggacncgccggagaaggcgccgccgacgaggatgttggcgccgac 352 |||||| ||||||||||| | ||| ||| || || ||| |||||||||| || || || Sbjct: 679 gacggctgggttcatggaggctccgctgaaagctccaccggcgaggatgttagctccaac 620 Query: 353 gatgaanccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggc 412 |||||| || ||||| || || ||||| || || || || || ||||||||||||||||| Sbjct: 619 gatgaaacctatggcaattggtgcgattgttccgagactaccgttcttggggtcgacggc 560 Query: 413 ggtggcgtacaccgtgtacaccagcccgaangtcatgacgatctc 457 |||||||| || ||||| || |||||||| ||||| |||||||| Sbjct: 559 tgtggcgtaaacggtgtagacgagcccgaaggtcatcacgatctc 515
>ref|NM_113559.3| Arabidopsis thaliana TIP2 (TONOPLAST INTRINSIC PROTEIN 2); water channel AT3G26520 (TIP2) mRNA, complete cds Length = 1201 Score = 85.7 bits (43), Expect = 1e-13 Identities = 133/164 (81%) Strand = Plus / Minus Query: 294 acggcggggttcatggacncgccggagaaggcgccgccgacgaggatgttggcgccgacg 353 ||||| ||||||||||| | ||| ||| || || ||| |||||||||| || || ||| Sbjct: 720 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 661 Query: 354 atgaanccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 413 ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| Sbjct: 660 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 601 Query: 414 gtggcgtacaccgtgtacaccagcccgaangtcatgacgatctc 457 |||||||| || ||||| || |||||||| ||||| |||||||| Sbjct: 600 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 557
>gb|AY079114.1| Arabidopsis thaliana AT3g26520/MFE16_3 mRNA, complete cds Length = 762 Score = 85.7 bits (43), Expect = 1e-13 Identities = 133/164 (81%) Strand = Plus / Minus Query: 294 acggcggggttcatggacncgccggagaaggcgccgccgacgaggatgttggcgccgacg 353 ||||| ||||||||||| | ||| ||| || || ||| |||||||||| || || ||| Sbjct: 608 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 549 Query: 354 atgaanccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 413 ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| Sbjct: 548 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 489 Query: 414 gtggcgtacaccgtgtacaccagcccgaangtcatgacgatctc 457 |||||||| || ||||| || |||||||| ||||| |||||||| Sbjct: 488 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 445
>gb|AF419613.1|AF419613 Arabidopsis thaliana AT3g26520/MFE16_3 mRNA, complete cds Length = 1061 Score = 85.7 bits (43), Expect = 1e-13 Identities = 133/164 (81%) Strand = Plus / Minus Query: 294 acggcggggttcatggacncgccggagaaggcgccgccgacgaggatgttggcgccgacg 353 ||||| ||||||||||| | ||| ||| || || ||| |||||||||| || || ||| Sbjct: 670 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 611 Query: 354 atgaanccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 413 ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| Sbjct: 610 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 551 Query: 414 gtggcgtacaccgtgtacaccagcccgaangtcatgacgatctc 457 |||||||| || ||||| || |||||||| ||||| |||||||| Sbjct: 550 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 507
>gb|AF428341.1|AF428341 Arabidopsis thaliana AT3g26520/MFE16_3 mRNA, complete cds Length = 1066 Score = 85.7 bits (43), Expect = 1e-13 Identities = 133/164 (81%) Strand = Plus / Minus Query: 294 acggcggggttcatggacncgccggagaaggcgccgccgacgaggatgttggcgccgacg 353 ||||| ||||||||||| | ||| ||| || || ||| |||||||||| || || ||| Sbjct: 675 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 616 Query: 354 atgaanccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 413 ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| Sbjct: 615 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 556 Query: 414 gtggcgtacaccgtgtacaccagcccgaangtcatgacgatctc 457 |||||||| || ||||| || |||||||| ||||| |||||||| Sbjct: 555 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 512
>gb|AF004393.1|AF004393 Arabidopsis thaliana salt-stress induced tonoplast intrinsic protein mRNA, complete cds Length = 1072 Score = 85.7 bits (43), Expect = 1e-13 Identities = 133/164 (81%) Strand = Plus / Minus Query: 294 acggcggggttcatggacncgccggagaaggcgccgccgacgaggatgttggcgccgacg 353 ||||| ||||||||||| | ||| ||| || || ||| |||||||||| || || ||| Sbjct: 682 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 623 Query: 354 atgaanccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 413 ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| Sbjct: 622 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 563 Query: 414 gtggcgtacaccgtgtacaccagcccgaangtcatgacgatctc 457 |||||||| || ||||| || |||||||| ||||| |||||||| Sbjct: 562 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 519
>gb|AF326508.1|AF326508 Zea mays tonoplast membrane integral protein ZmTIP4-4 mRNA, complete cds Length = 955 Score = 85.7 bits (43), Expect = 1e-13 Identities = 72/82 (87%) Strand = Plus / Minus Query: 273 acgagggcggggccgaaggagacggcggggttcatggacncgccggagaaggcgccgccg 332 ||||| ||||||||||||||| ||||||||||||||| |||||||||||| |||||| Sbjct: 714 acgagcgcggggccgaaggagcgcgcggggttcatggacgcgccggagaagggcccgccg 655 Query: 333 acgaggatgttggcgccgacga 354 |||| | |||||||||||||| Sbjct: 654 gcgagcacgttggcgccgacga 633
>emb|BX822807.1|CNS0A75T Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB65ZD08 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1010 Score = 85.7 bits (43), Expect = 1e-13 Identities = 133/164 (81%) Strand = Plus / Minus Query: 294 acggcggggttcatggacncgccggagaaggcgccgccgacgaggatgttggcgccgacg 353 ||||| ||||||||||| | ||| ||| || || ||| |||||||||| || || ||| Sbjct: 658 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 599 Query: 354 atgaanccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 413 ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| Sbjct: 598 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 539 Query: 414 gtggcgtacaccgtgtacaccagcccgaangtcatgacgatctc 457 |||||||| || ||||| || |||||||| ||||| |||||||| Sbjct: 538 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 495
>emb|BX822624.1|CNS0A742 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB53ZH08 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1020 Score = 85.7 bits (43), Expect = 1e-13 Identities = 133/164 (81%) Strand = Plus / Minus Query: 294 acggcggggttcatggacncgccggagaaggcgccgccgacgaggatgttggcgccgacg 353 ||||| ||||||||||| | ||| ||| || || ||| |||||||||| || || ||| Sbjct: 656 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 597 Query: 354 atgaanccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 413 ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| Sbjct: 596 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 537 Query: 414 gtggcgtacaccgtgtacaccagcccgaangtcatgacgatctc 457 |||||||| || ||||| || |||||||| ||||| |||||||| Sbjct: 536 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 493
>emb|BX824073.1|CNS0A6T2 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH1ZE06 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1008 Score = 85.7 bits (43), Expect = 1e-13 Identities = 133/164 (81%) Strand = Plus / Minus Query: 294 acggcggggttcatggacncgccggagaaggcgccgccgacgaggatgttggcgccgacg 353 ||||| ||||||||||| | ||| ||| || || ||| |||||||||| || || ||| Sbjct: 656 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 597 Query: 354 atgaanccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 413 ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| Sbjct: 596 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 537 Query: 414 gtggcgtacaccgtgtacaccagcccgaangtcatgacgatctc 457 |||||||| || ||||| || |||||||| ||||| |||||||| Sbjct: 536 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 493
>emb|BX822975.1|CNS0A733 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB78ZD01 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1054 Score = 85.7 bits (43), Expect = 1e-13 Identities = 133/164 (81%) Strand = Plus / Minus Query: 294 acggcggggttcatggacncgccggagaaggcgccgccgacgaggatgttggcgccgacg 353 ||||| ||||||||||| | ||| ||| || || ||| |||||||||| || || ||| Sbjct: 647 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 588 Query: 354 atgaanccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 413 ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| Sbjct: 587 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 528 Query: 414 gtggcgtacaccgtgtacaccagcccgaangtcatgacgatctc 457 |||||||| || ||||| || |||||||| ||||| |||||||| Sbjct: 527 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 484
>emb|BX824311.1|CNS0A6PE Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH38ZH05 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 995 Score = 85.7 bits (43), Expect = 1e-13 Identities = 133/164 (81%) Strand = Plus / Minus Query: 294 acggcggggttcatggacncgccggagaaggcgccgccgacgaggatgttggcgccgacg 353 ||||| ||||||||||| | ||| ||| || || ||| |||||||||| || || ||| Sbjct: 665 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 606 Query: 354 atgaanccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 413 ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| Sbjct: 605 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 546 Query: 414 gtggcgtacaccgtgtacaccagcccgaangtcatgacgatctc 457 |||||||| || ||||| || |||||||| ||||| |||||||| Sbjct: 545 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 502
>emb|BX823637.1|CNS0A6I3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS5ZE05 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 960 Score = 85.7 bits (43), Expect = 1e-13 Identities = 133/164 (81%) Strand = Plus / Minus Query: 294 acggcggggttcatggacncgccggagaaggcgccgccgacgaggatgttggcgccgacg 353 ||||| ||||||||||| | ||| ||| || || ||| |||||||||| || || ||| Sbjct: 479 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 420 Query: 354 atgaanccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 413 ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| Sbjct: 419 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 360 Query: 414 gtggcgtacaccgtgtacaccagcccgaangtcatgacgatctc 457 |||||||| || ||||| || |||||||| ||||| |||||||| Sbjct: 359 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 316
>emb|BX823607.1|CNS0A6MK Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS56ZB09 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1012 Score = 85.7 bits (43), Expect = 1e-13 Identities = 133/164 (81%) Strand = Plus / Minus Query: 294 acggcggggttcatggacncgccggagaaggcgccgccgacgaggatgttggcgccgacg 353 ||||| ||||||||||| | ||| ||| || || ||| |||||||||| || || ||| Sbjct: 656 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 597 Query: 354 atgaanccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 413 ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| Sbjct: 596 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 537 Query: 414 gtggcgtacaccgtgtacaccagcccgaangtcatgacgatctc 457 |||||||| || ||||| || |||||||| ||||| |||||||| Sbjct: 536 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 493
>dbj|AB028611.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MFE16 Length = 82646 Score = 85.7 bits (43), Expect = 1e-13 Identities = 133/164 (81%) Strand = Plus / Plus Query: 294 acggcggggttcatggacncgccggagaaggcgccgccgacgaggatgttggcgccgacg 353 ||||| ||||||||||| | ||| ||| || || ||| |||||||||| || || ||| Sbjct: 15518 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 15577 Query: 354 atgaanccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 413 ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| Sbjct: 15578 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 15637 Query: 414 gtggcgtacaccgtgtacaccagcccgaangtcatgacgatctc 457 |||||||| || ||||| || |||||||| ||||| |||||||| Sbjct: 15638 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 15681
>gb|AF118381.1|AF118381 Brassica napus tonoplast intrinsic protein (gamma-TIP2) mRNA, complete cds Length = 1020 Score = 85.7 bits (43), Expect = 1e-13 Identities = 133/164 (81%) Strand = Plus / Minus Query: 294 acggcggggttcatggacncgccggagaaggcgccgccgacgaggatgttggcgccgacg 353 ||||| ||||||||||| | ||| ||| || || ||| |||||||||| || || ||| Sbjct: 617 acggctgggttcatggaggctccgctgaaagctccaccggcgaggatgttagctccaacg 558 Query: 354 atgaanccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 413 ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| Sbjct: 557 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 498 Query: 414 gtggcgtacaccgtgtacaccagcccgaangtcatgacgatctc 457 |||||||| || ||||| || |||||||| ||||| |||||||| Sbjct: 497 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 454
>ref|NM_188624.1| Oryza sativa (japonica cultivar-group), Ozsa8227 predicted mRNA Length = 756 Score = 83.8 bits (42), Expect = 5e-13 Identities = 71/81 (87%) Strand = Plus / Minus Query: 274 cgagggcggggccgaaggagacggcggggttcatggacncgccggagaaggcgccgccga 333 ||||||| |||||||||||| ||| ||||||||||| |||||||| ||| |||||| Sbjct: 616 cgagggccgggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccgg 557 Query: 334 cgaggatgttggcgccgacga 354 ||||||||||||||||||||| Sbjct: 556 cgaggatgttggcgccgacga 536
>dbj|AP001550.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0431F01 Length = 143209 Score = 83.8 bits (42), Expect = 5e-13 Identities = 71/81 (87%) Strand = Plus / Minus Query: 274 cgagggcggggccgaaggagacggcggggttcatggacncgccggagaaggcgccgccga 333 ||||||| |||||||||||| ||| ||||||||||| |||||||| ||| |||||| Sbjct: 98909 cgagggccgggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccgg 98850 Query: 334 cgaggatgttggcgccgacga 354 ||||||||||||||||||||| Sbjct: 98849 cgaggatgttggcgccgacga 98829 Score = 56.0 bits (28), Expect = 1e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 300 gggttcatggacncgccggagaaggcgccgccgacgaggatgttggcgccgacga 354 |||||||||||| |||||| || ||||||||| ||| | ||||||||||||||| Sbjct: 103782 gggttcatggacgcgccggtgagcgcgccgccggcgacggtgttggcgccgacga 103728
>dbj|AK069192.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023007E01, full insert sequence Length = 1112 Score = 83.8 bits (42), Expect = 5e-13 Identities = 71/81 (87%) Strand = Plus / Minus Query: 274 cgagggcggggccgaaggagacggcggggttcatggacncgccggagaaggcgccgccga 333 ||||||| |||||||||||| ||| ||||||||||| |||||||| ||| |||||| Sbjct: 619 cgagggccgggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccgg 560 Query: 334 cgaggatgttggcgccgacga 354 ||||||||||||||||||||| Sbjct: 559 cgaggatgttggcgccgacga 539
>dbj|AB012272.1| Aster tripolium mRNA for SAMIPF, partial cds Length = 321 Score = 83.8 bits (42), Expect = 5e-13 Identities = 100/120 (83%) Strand = Plus / Minus Query: 338 gatgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgcccaggctgccctt 397 |||||||||||||||||| || |||||||| || || || || || ||||| || ||||| Sbjct: 321 gatgttggcgccgacgataaagccgatggcaattggtgcaattgttcccagacttccctt 262 Query: 398 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcatgacgatctc 457 ||||||||| | ||||| ||||| || |||||||| |||||||| ||||| || ||||| Sbjct: 261 cttggggtcaattgcggttgcgtagactgtgtacacaagcccgaacgtcattacaatctc 202
>emb|AJ314583.1|POC314583 Posidonia oceanica mRNA for putative tonoplast intrinsic protein (tip1 gene) Length = 1112 Score = 81.8 bits (41), Expect = 2e-12 Identities = 247/314 (78%), Gaps = 2/314 (0%) Strand = Plus / Minus Query: 145 agtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagatga 204 ||||||| ||||| |||||||| || |||||| || |||||| | ||||| ||||| || Sbjct: 830 agtagtcagtggttgggagctgttcatgggtgtggttgatgaataacagctggtagacga 771 Query: 205 cgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccact 264 |||||||| | | | |||| || |||||||||||||| | ||| |||| |||| | Sbjct: 770 tgccggcgatggctgcaccgactagtgggccgacccagtagatccagtggttaacccagt 711 Query: 265 cccagctgacgagggcggggccgaaggagacggcggggttcatggacncgccggagaagg 324 |||||| || | ||| || || |||| ||||| ||||||||||| | |||| |||| Sbjct: 710 tccagctcaccaaggcaggtccaaaggccacggcagggttcatggatgcaccggtgaaga 651 Query: 325 cgccgccgacgaggatgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgc 384 | || ||||||| ||||||||| | || || | |||||||||| ||| ||||| |||| Sbjct: 650 ctcctccgacgaagatgttggcagcaacaataaggccgatggcgaggggagcgatagtgc 591 Query: 385 cca-ggctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaan 443 | | |||| || ||||||||||||| |||||||||||| || ||||| || || ||||| Sbjct: 590 cgatggct-cctttcttggggtcgatggcggtggcgtagacggtgtagactagtccgaag 532 Query: 444 gtcatgacgatctc 457 ||||| |||||||| Sbjct: 531 gtcatcacgatctc 518
>dbj|AB126924.1| Prunus persica Pr-gTIP1 mRNA for tonoplast intrinsic protein, complete cds Length = 1143 Score = 81.8 bits (41), Expect = 2e-12 Identities = 99/119 (83%) Strand = Plus / Minus Query: 339 atgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgcccaggctgcccttc 398 ||||| ||||| || | ||| ||||| ||||| |||||||| || |||| |||||| || Sbjct: 660 atgttcgcgccaactacgaaaccgatcgcgatcggcgcgattgttcccacgctgcctctc 601 Query: 399 ttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcatgacgatctc 457 || ||||| | ||| |||||||||||||||||||||| ||| || ||||| |||||||| Sbjct: 600 ttcgggtcaatggctgtggcgtacaccgtgtacaccaacccaaacgtcatcacgatctc 542
>ref|XM_473251.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 798 Score = 79.8 bits (40), Expect = 8e-12 Identities = 48/51 (94%) Strand = Plus / Minus Query: 403 ggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcatgacga 453 |||||||||||||||||||||| |||||||| |||||||| |||||||||| Sbjct: 517 ggtcgacggcggtggcgtacacggtgtacacgagcccgaacgtcatgacga 467
>emb|AL663019.2|OSJN00221 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0038O10, complete sequence Length = 141545 Score = 79.8 bits (40), Expect = 8e-12 Identities = 48/51 (94%) Strand = Plus / Minus Query: 403 ggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcatgacga 453 |||||||||||||||||||||| |||||||| |||||||| |||||||||| Sbjct: 131227 ggtcgacggcggtggcgtacacggtgtacacgagcccgaacgtcatgacga 131177
>dbj|AK108116.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-139-C05, full insert sequence Length = 912 Score = 79.8 bits (40), Expect = 8e-12 Identities = 48/51 (94%) Strand = Plus / Minus Query: 403 ggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcatgacga 453 |||||||||||||||||||||| |||||||| |||||||| |||||||||| Sbjct: 583 ggtcgacggcggtggcgtacacggtgtacacgagcccgaacgtcatgacga 533
>emb|X95650.1|TGTIP1GEN T.gesneriana mRNA for tonoplast intrinsic protein Length = 992 Score = 77.8 bits (39), Expect = 3e-11 Identities = 132/164 (80%) Strand = Plus / Minus Query: 296 ggcggggttcatggacncgccggagaaggcgccgccgacgaggatgttggcgccgacgat 355 |||||||||||| ||| | |||| ||| || || || || || |||||||| |||||||| Sbjct: 623 ggcggggttcatcgacgcaccggtgaacgccccaccaaccagaatgttggcaccgacgat 564 Query: 356 gaanccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggt 415 ||| ||||| || ||||| |||||||| || | ||||||||||| ||||| || || Sbjct: 563 gaatccgatcgcaatgggagcgatggttccaatatcccccttcttgggatcgacagcagt 504 Query: 416 ggcgtacaccgtgtacaccagcccgaangtcatgacgatctcca 459 |||||||| ||||| || |||||| | ||||| |||||||||| Sbjct: 503 agcgtacacagtgtagacgagcccgcacgtcatcacgatctcca 460 Score = 48.1 bits (24), Expect = 0.027 Identities = 30/32 (93%) Strand = Plus / Minus Query: 219 ccgccgatgagggggccgacccagtacaccca 250 ||||||||||| ||||| |||||||||||||| Sbjct: 703 ccgccgatgagcgggccaacccagtacaccca 672
>gb|AF326505.1|AF326505 Zea mays tonoplast membrane integral protein ZmTIP4-1 mRNA, complete cds Length = 1125 Score = 77.8 bits (39), Expect = 3e-11 Identities = 71/82 (86%) Strand = Plus / Minus Query: 276 agggcggggccgaaggagacggcggggttcatggacncgccggagaaggcgccgccgacg 335 ||||| |||||||||||| || |||||||||||| |||||| |||| ||||||| || Sbjct: 768 agggccgggccgaaggagcgtgccgggttcatggacgcgccggtgaagttgccgccggcg 709 Query: 336 aggatgttggcgccgacgatga 357 ||| |||||||||||||||||| Sbjct: 708 aggctgttggcgccgacgatga 687
>gb|L12257.1|SOYNODA Glycine max nodulin-26 mRNA, complete cds Length = 1047 Score = 77.8 bits (39), Expect = 3e-11 Identities = 100/121 (82%) Strand = Plus / Minus Query: 339 atgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgcccaggctgcccttc 398 ||||| ||||| || ||||| || ||||||||||| || || | |||| |||||||| Sbjct: 665 atgttagcgccaacaatgaaaccaatggcgatgggagcaataattcccaaattgcccttc 606 Query: 399 ttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcatgacgatctcc 458 |||||||| ||||| |||||||| || |||||||||| ||||| ||||| ||||||||| Sbjct: 605 ttggggtcaacggcagtggcgtagactgtgtacaccaaaccgaaggtcatcacgatctcc 546 Query: 459 a 459 | Sbjct: 545 a 545
>gb|U92651.2|BOU92651 Brassica oleracea var. botrytis tonoplast intrinsic protein bobTIP26-1 mRNA, complete cds Length = 942 Score = 75.8 bits (38), Expect = 1e-10 Identities = 99/120 (82%) Strand = Plus / Minus Query: 338 gatgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgcccaggctgccctt 397 ||||||||| || || ||||| ||||| |||||||| || || || || || || || || Sbjct: 597 gatgttggcaccaacaatgaaaccgatagcgatgggagctattgttccaagacttccgtt 538 Query: 398 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcatgacgatctc 457 |||||| || |||||||||||||| || ||||| || |||||||| ||||| |||||||| Sbjct: 537 cttgggatcaacggcggtggcgtagactgtgtaaactagcccgaaggtcatcacgatctc 478 Score = 48.1 bits (24), Expect = 0.027 Identities = 30/32 (93%) Strand = Plus / Minus Query: 145 agtagtcggtggtggggagctgctcgtgggtg 176 ||||||||| |||||||||||| ||||||||| Sbjct: 790 agtagtcggcggtggggagctgttcgtgggtg 759
>emb|BX822304.1|CNS0A7A0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB27ZF06 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 628 Score = 75.8 bits (38), Expect = 1e-10 Identities = 102/124 (82%) Strand = Plus / Minus Query: 334 cgaggatgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgcccaggctgc 393 |||||||||| || || |||||||| || |||||||| || ||||| || || || || | Sbjct: 182 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 123 Query: 394 ccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcatgacga 453 | ||||||||||| |||| |||||||| || ||||| || |||||||| ||||| |||| Sbjct: 122 cgttcttggggtctacggttgtggcgtagacggtgtagacgagcccgaaggtcattacga 63 Query: 454 tctc 457 |||| Sbjct: 62 tctc 59
>gb|DQ226889.1| Boechera divaricarpa isolate SLW-D-E07 mRNA sequence Length = 980 Score = 71.9 bits (36), Expect = 2e-09 Identities = 243/313 (77%) Strand = Plus / Minus Query: 145 agtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagatga 204 ||||||||||||| |||||||| ||||||||| | ||||||| | ||||||||||| Sbjct: 767 agtagtcggtggttgggagctgttcgtgggtggtgttaatgaagaaaacctcgtagatga 708 Query: 205 cgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccact 264 ||||||| || ||||||| ||| || ||| ||||||| ||||| |||| |||| Sbjct: 707 gtccggcgattccaccgccgacgagaggtccggcccagtagacccagtggttggtccacg 648 Query: 265 cccagctgacgagggcggggccgaaggagacggcggggttcatggacncgccggagaagg 324 |||||| || | || || ||||| | |||||||| |||||||| | |||||||| | Sbjct: 647 tccagctcacaaccgctggtccgaaagccacggcgggattcatggaggctccggagaatg 588 Query: 325 cgccgccgacgaggatgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgc 384 | || || | | |||||||| ||||| ||||| || || ||||| || ||||| || | Sbjct: 587 ctcctccagctaatatgttggctccgactatgaaaccaatagcgattggagcgattgttc 528 Query: 385 ccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaang 444 | || || || || |||||||| | |||||||||||| || ||||| || |||||||| | Sbjct: 527 cgagactcccgtttttggggtcaatggcggtggcgtagacagtgtaaacaagcccgaatg 468 Query: 445 tcatgacgatctc 457 |||| |||||||| Sbjct: 467 tcatcacgatctc 455
>emb|AJ289696.1|POC289696 Posidonia oceanica partial mRNA for putative aquaporin (aq1 gene) Length = 428 Score = 69.9 bits (35), Expect = 7e-09 Identities = 178/224 (79%), Gaps = 2/224 (0%) Strand = Plus / Minus Query: 235 cgacccagtacacccactggtacccccactcccagctgacgagggcggggccgaaggaga 294 |||||||||| |||||||||| |||| | |||||| || | ||| || || |||| | Sbjct: 428 cgacccagtaaacccactggttaacccagttccagctcaccaaggcaggtccaaaggcca 369 Query: 295 cggcggggttcatggacncgccggagaaggcgccgccgacgaggatgttggcgccgacga 354 |||| ||||||||||| | |||| |||| | || ||| ||| ||||||||| | || | Sbjct: 368 cggcagggttcatggatgcaccggtgaagactcctccgtcgaagatgttggcagcaacaa 309 Query: 355 tgaanccgatggcgatgggcgcgatggtgccca-ggctgcccttcttggggtcgacggcg 413 | | |||||||||| ||| ||||| ||||| | |||| || ||||||||||||| |||| Sbjct: 308 taaggccgatggcgaggggagcgatagtgccgatggct-cctttcttggggtcgatggcg 250 Query: 414 gtggcgtacaccgtgtacaccagcccgaangtcatgacgatctc 457 |||||||| || ||||| || || ||||| ||||| |||||||| Sbjct: 249 gtggcgtagacggtgtagactagtccgaaggtcatcacgatctc 206
>emb|AJ133748.1|PAB133748 Picea abies mRNA for major intrinsic protein Length = 1168 Score = 69.9 bits (35), Expect = 7e-09 Identities = 140/176 (79%) Strand = Plus / Minus Query: 300 gggttcatggacncgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaan 359 ||||||||||| | ||| |||||| |||||| | || || ||||| || || ||||| Sbjct: 708 gggttcatggaagccccgtcgaaggcaccgccggccagaatattggcacccactatgaaa 649 Query: 360 ccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcg 419 ||||| || | ||| || ||||| |||||||| ||| | || | |||| ||| |||||| Sbjct: 648 ccgatcgcaaggggggctatggttcccaggctcccccttttagcatcgatggccgtggcg 589 Query: 420 tacaccgtgtacaccagcccgaangtcatgacgatctccaggaccaccgccttcca 475 || || ||||| ||||||||||| ||||| ||||||||||| ||||| || ||||| Sbjct: 588 tatacagtgtaaaccagcccgaacgtcatcacgatctccagcaccacagcgttcca 533
>emb|BX825064.1|CNS0A6TA Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH92ZF07 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 931 Score = 69.9 bits (35), Expect = 7e-09 Identities = 131/164 (79%) Strand = Plus / Minus Query: 294 acggcggggttcatggacncgccggagaaggcgccgccgacgaggatgttggcgccgacg 353 ||||| ||||||||||| |||| ||| || || ||| |||||||||| || || ||| Sbjct: 644 acggctgggttcatggaagcgcccctgaacgctccaccggcgaggatgttcgctccaacg 585 Query: 354 atgaanccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 413 ||||| | |||||||| || ||||| |||| || | || ||||||||||| ||||| Sbjct: 584 atgaaacttatggcgattggtgcgattttgccgagaataccgttcttggggtcaacggct 525 Query: 414 gtggcgtacaccgtgtacaccagcccgaangtcatgacgatctc 457 |||||||| || ||||| || |||||||| ||||| |||||||| Sbjct: 524 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 481
>emb|BX842211.1|CNS09YE1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL65ZH05 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1014 Score = 69.9 bits (35), Expect = 7e-09 Identities = 87/105 (82%) Strand = Plus / Minus Query: 353 gatgaanccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggc 412 |||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| Sbjct: 589 gatgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggc 530 Query: 413 ggtggcgtacaccgtgtacaccagcccgaangtcatgacgatctc 457 |||||||| || ||||| || |||||||| ||||| |||||||| Sbjct: 529 tgtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 485
>emb|BX842163.1|CNS09YDT Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH74ZE01 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 921 Score = 69.9 bits (35), Expect = 7e-09 Identities = 132/164 (80%), Gaps = 1/164 (0%) Strand = Plus / Minus Query: 294 acggcggggttcatggacncgccggagaaggcgccgccgacgaggatgttggcgccgacg 353 ||||| ||||||||||| | ||| ||| || || ||| |||||||||| || || ||| Sbjct: 655 acggctgggttcatggaaactccgctgaaagctccaccggcgaggatgttagctccaacg 596 Query: 354 atgaanccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 413 ||||| || |||||||| | ||||| || || || || || ||||||||||| ||||| Sbjct: 595 atgaaacctatggcgattgt-gcgattgttccgagactaccgttcttggggtcaacggct 537 Query: 414 gtggcgtacaccgtgtacaccagcccgaangtcatgacgatctc 457 |||||||| || ||||| || |||||||| ||||| |||||||| Sbjct: 536 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 493
>emb|BX842138.1|CNS09YDN Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS54ZD02 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1062 Score = 69.9 bits (35), Expect = 7e-09 Identities = 99/121 (81%) Strand = Plus / Minus Query: 337 ggatgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgcccaggctgccct 396 ||||||| || || |||||||| || |||||||| || ||||| || || || || || | Sbjct: 613 ggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactaccgt 554 Query: 397 tcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcatgacgatct 456 |||||||||| ||||| |||||||| || ||| | || |||||||| ||||| ||||||| Sbjct: 553 tcttggggtcaacggctgtggcgtagacggtgcagacgagcccgaaggtcatcacgatct 494 Query: 457 c 457 | Sbjct: 493 c 493
>dbj|AB012270.1| Aster tripolium mRNA for SAMIPD, partial cds Length = 321 Score = 69.9 bits (35), Expect = 7e-09 Identities = 82/98 (83%) Strand = Plus / Minus Query: 338 gatgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgcccaggctgccctt 397 ||||||||||||||||||||| |||||||| |||||||| || || |||| | ||||| Sbjct: 321 gatgttggcgccgacgatgaagccgatggcaatgggcgcaattgtccccacgtcaccctt 262 Query: 398 cttggggtcgacggcggtggcgtacaccgtgtacacca 435 ||| ||||| |||||| ||||||| |||||||||| Sbjct: 261 ctttgggtcacatgcggtgccgtacactgtgtacacca 224
>gb|AY821911.1| Gossypium hirsutum putative tonoplast intrinsic protein mRNA, partial cds Length = 529 Score = 63.9 bits (32), Expect = 5e-07 Identities = 86/104 (82%) Strand = Plus / Minus Query: 141 gcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtag 200 ||||| || |||||||| |||||||||||||||||| | |||||||| | ||||||| Sbjct: 417 gcttaataatcggtggttgggagctgctcgtgggtgttgctgatgaagatgaactcgtag 358 Query: 201 atgacgccggcgaggccgccgccgatgagggggccgacccagta 244 |||| || ||||| || || ||||| ||||| ||||||||||| Sbjct: 357 atgagaccagcgagcccaccaccgataaggggtccgacccagta 314 Score = 60.0 bits (30), Expect = 7e-06 Identities = 94/116 (81%) Strand = Plus / Minus Query: 339 atgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgcccaggctgcccttc 398 |||||||| || |||||||| || || || | || ||||| || |||| ||| ||||| Sbjct: 219 atgttggcccccacgatgaaaccaattgccaatggtgcgattgttcccaagcttcccttt 160 Query: 399 ttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcatgacgat 454 ||||| || ||||| ||||||||||| |||||||||| ||||| ||||| ||||| Sbjct: 159 ttgggatcaacggctgtggcgtacactgtgtacaccaatccgaaggtcatcacgat 104
>ref|NM_197137.1| Oryza sativa (japonica cultivar-group) putative beta-tonoplast intrinsic protein (OSJNBa0051D19.19), mRNA Length = 1186 Score = 61.9 bits (31), Expect = 2e-06 Identities = 70/83 (84%) Strand = Plus / Minus Query: 207 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 266 |||||||||||| |||||| || |||||||| |||||||||||| |||| || ||| | Sbjct: 855 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggtgcctccagcgc 796 Query: 267 cagctgacgagggcggggccgaa 289 |||| |||||| || |||||||| Sbjct: 795 cagccgacgagcgccgggccgaa 773 Score = 44.1 bits (22), Expect = 0.43 Identities = 42/49 (85%) Strand = Plus / Minus Query: 334 cgaggatgttggcgccgacgatgaanccgatggcgatgggcgcgatggt 382 |||| ||||||||||||| || ||| |||| ||||| ||||||||||| Sbjct: 728 cgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgatggt 680
>ref|NM_189871.1| Oryza sativa (japonica cultivar-group), mRNA Length = 576 Score = 61.9 bits (31), Expect = 2e-06 Identities = 61/71 (85%) Strand = Plus / Minus Query: 207 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 266 |||||||||||| | ||||||| |||||||| |||||||||||| |||| || ||| | | Sbjct: 512 ccggcgaggccggcaccgatgaaggggccgagccagtacacccagtggtgcctccagtgc 453 Query: 267 cagctgacgag 277 |||| |||||| Sbjct: 452 cagccgacgag 442
>gb|AC023240.9| Oryza sativa chromosome 10 BAC OSJNBa0051D19 genomic sequence, complete sequence Length = 131984 Score = 61.9 bits (31), Expect = 2e-06 Identities = 70/83 (84%) Strand = Plus / Plus Query: 207 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 266 |||||||||||| |||||| || |||||||| |||||||||||| |||| || ||| | Sbjct: 26108 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggtgcctccagcgc 26167 Query: 267 cagctgacgagggcggggccgaa 289 |||| |||||| || |||||||| Sbjct: 26168 cagccgacgagcgccgggccgaa 26190 Score = 44.1 bits (22), Expect = 0.43 Identities = 42/49 (85%) Strand = Plus / Plus Query: 334 cgaggatgttggcgccgacgatgaanccgatggcgatgggcgcgatggt 382 |||| ||||||||||||| || ||| |||| ||||| ||||||||||| Sbjct: 26235 cgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgatggt 26283
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 61.9 bits (31), Expect = 2e-06 Identities = 70/83 (84%) Strand = Plus / Minus Query: 207 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 266 |||||||||||| |||||| || |||||||| |||||||||||| |||| || ||| | Sbjct: 18187020 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggtgcctccagcgc 18186961 Query: 267 cagctgacgagggcggggccgaa 289 |||| |||||| || |||||||| Sbjct: 18186960 cagccgacgagcgccgggccgaa 18186938 Score = 44.1 bits (22), Expect = 0.43 Identities = 42/49 (85%) Strand = Plus / Minus Query: 334 cgaggatgttggcgccgacgatgaanccgatggcgatgggcgcgatggt 382 |||| ||||||||||||| || ||| |||| ||||| ||||||||||| Sbjct: 18186893 cgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgatggt 18186845
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 61.9 bits (31), Expect = 2e-06 Identities = 61/71 (85%) Strand = Plus / Plus Query: 207 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 266 |||||||||||| | ||||||| |||||||| |||||||||||| |||| || ||| | | Sbjct: 25641777 ccggcgaggccggcaccgatgaaggggccgagccagtacacccagtggtgcctccagtgc 25641836 Query: 267 cagctgacgag 277 |||| |||||| Sbjct: 25641837 cagccgacgag 25641847
>gb|AF326506.1|AF326506 Zea mays tonoplast membrane integral protein ZmTIP4-2 mRNA, complete cds Length = 1255 Score = 61.9 bits (31), Expect = 2e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 300 gggttcatggacncgccggagaaggcgccgccgacgaggatgttggcgccgacgatga 357 |||||||||||| |||||| |||| ||||||| ||||| ||||||||||||| |||| Sbjct: 743 gggttcatggacgcgccggtgaagttgccgccggcgaggctgttggcgccgactatga 686
>dbj|AP004380.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0594D10 Length = 143200 Score = 61.9 bits (31), Expect = 2e-06 Identities = 61/71 (85%) Strand = Plus / Plus Query: 207 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 266 |||||||||||| | ||||||| |||||||| |||||||||||| |||| || ||| | | Sbjct: 95750 ccggcgaggccggcaccgatgaaggggccgagccagtacacccagtggtgcctccagtgc 95809 Query: 267 cagctgacgag 277 |||| |||||| Sbjct: 95810 cagccgacgag 95820
>dbj|AK111931.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-016-C03, full insert sequence Length = 1200 Score = 61.9 bits (31), Expect = 2e-06 Identities = 70/83 (84%) Strand = Plus / Minus Query: 207 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 266 |||||||||||| |||||| || |||||||| |||||||||||| |||| || ||| | Sbjct: 864 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggtgcctccagcgc 805 Query: 267 cagctgacgagggcggggccgaa 289 |||| |||||| || |||||||| Sbjct: 804 cagccgacgagcgccgggccgaa 782 Score = 44.1 bits (22), Expect = 0.43 Identities = 42/49 (85%) Strand = Plus / Minus Query: 334 cgaggatgttggcgccgacgatgaanccgatggcgatgggcgcgatggt 382 |||| ||||||||||||| || ||| |||| ||||| ||||||||||| Sbjct: 737 cgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgatggt 689
>dbj|AB114828.1| Oryza sativa (japonica cultivar-group) OsTIP3 mRNA for tonoplast intrinsic protein, complete cds Length = 1178 Score = 61.9 bits (31), Expect = 2e-06 Identities = 70/83 (84%) Strand = Plus / Minus Query: 207 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 266 |||||||||||| |||||| || |||||||| |||||||||||| |||| || ||| | Sbjct: 847 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggtgcctccagcgc 788 Query: 267 cagctgacgagggcggggccgaa 289 |||| |||||| || |||||||| Sbjct: 787 cagccgacgagcgccgggccgaa 765 Score = 44.1 bits (22), Expect = 0.43 Identities = 42/49 (85%) Strand = Plus / Minus Query: 334 cgaggatgttggcgccgacgatgaanccgatggcgatgggcgcgatggt 382 |||| ||||||||||||| || ||| |||| ||||| ||||||||||| Sbjct: 720 cgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgatggt 672
>dbj|AK106383.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-102-E03, full insert sequence Length = 1787 Score = 61.9 bits (31), Expect = 2e-06 Identities = 70/83 (84%) Strand = Plus / Plus Query: 207 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 266 |||||||||||| |||||| || |||||||| |||||||||||| |||| || ||| | Sbjct: 139 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggtgcctccagcgc 198 Query: 267 cagctgacgagggcggggccgaa 289 |||| |||||| || |||||||| Sbjct: 199 cagccgacgagcgccgggccgaa 221 Score = 44.1 bits (22), Expect = 0.43 Identities = 42/49 (85%) Strand = Plus / Plus Query: 334 cgaggatgttggcgccgacgatgaanccgatggcgatgggcgcgatggt 382 |||| ||||||||||||| || ||| |||| ||||| ||||||||||| Sbjct: 266 cgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgatggt 314
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 61.9 bits (31), Expect = 2e-06 Identities = 70/83 (84%) Strand = Plus / Minus Query: 207 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 266 |||||||||||| |||||| || |||||||| |||||||||||| |||| || ||| | Sbjct: 18196273 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggtgcctccagcgc 18196214 Query: 267 cagctgacgagggcggggccgaa 289 |||| |||||| || |||||||| Sbjct: 18196213 cagccgacgagcgccgggccgaa 18196191 Score = 44.1 bits (22), Expect = 0.43 Identities = 42/49 (85%) Strand = Plus / Minus Query: 334 cgaggatgttggcgccgacgatgaanccgatggcgatgggcgcgatggt 382 |||| ||||||||||||| || ||| |||| ||||| ||||||||||| Sbjct: 18196146 cgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgatggt 18196098
>dbj|AB012271.1| Aster tripolium mRNA for SAMIPE, partial cds Length = 321 Score = 61.9 bits (31), Expect = 2e-06 Identities = 81/98 (82%) Strand = Plus / Minus Query: 338 gatgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgcccaggctgccctt 397 |||||||||||||||||| || ||||||||||| || || || ||||||| ||||| Sbjct: 321 gatgttggcgccgacgataaagccgatggcgatcggtgcaattgtgcccaatgcaccctt 262 Query: 398 cttggggtcgacggcggtggcgtacaccgtgtacacca 435 ||||||||| ||||||||||| || |||||||||| Sbjct: 261 cttggggtcacatgcggtggcgtaaacggtgtacacca 224
>ref|NM_188505.1| Oryza sativa (japonica cultivar-group), Ozsa8174 predicted mRNA Length = 969 Score = 58.0 bits (29), Expect = 3e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 207 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 255 |||||||||||| ||||||||| ||| |||| |||||||||||| |||| Sbjct: 881 ccggcgaggccggcgccgatgaagggaccgagccagtacacccagtggt 833
>gb|AF521135.1| Kandelia candel tonoplast intrinsic protein (TIP) mRNA, complete cds Length = 1099 Score = 58.0 bits (29), Expect = 3e-05 Identities = 35/37 (94%) Strand = Plus / Minus Query: 141 gcttagtagtcggtggtggggagctgctcgtgggtgc 177 ||||||||||| | ||||||||||||||||||||||| Sbjct: 859 gcttagtagtcagcggtggggagctgctcgtgggtgc 823 Score = 52.0 bits (26), Expect = 0.002 Identities = 85/104 (81%), Gaps = 1/104 (0%) Strand = Plus / Minus Query: 354 atgaanccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 413 ||||| ||||||||||||| |||||| ||||||| | ||||||||||| || | || Sbjct: 642 atgaaaccgatggcgatgg-cgcgattgtgcccaaatttcccttcttgggatcaatagcc 584 Query: 414 gtggcgtacaccgtgtacaccagcccgaangtcatgacgatctc 457 || ||||| || |||||||| || ||||| |||||||| ||||| Sbjct: 583 gtcgcgtagactgtgtacacgaggccgaaggtcatgactatctc 540
>emb|BX823744.1|CNS0A6NJ Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS71ZE09 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 573 Score = 58.0 bits (29), Expect = 3e-05 Identities = 133/166 (80%), Gaps = 2/166 (1%) Strand = Plus / Minus Query: 294 acggcggggttcatggacncgccggagaaggcgccgccgacgaggatgttggcgccgacg 353 ||||| ||||||||||| | ||| ||| || || ||| |||||||||| || || ||| Sbjct: 183 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 124 Query: 354 atgaanccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgac-ggc 412 ||||| || |||||||| || ||||| || || || || || ||||||||||| || ||| Sbjct: 123 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacgggc 64 Query: 413 ggtggcgtacac-cgtgtacaccagcccgaangtcatgacgatctc 457 |||||||| || ||||| || |||||||| ||||| |||||||| Sbjct: 63 tgtggcgtagacgggtgtagacgagcccgaaggtcatcacgatctc 18
>dbj|AP002094.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0483F08 Length = 148985 Score = 58.0 bits (29), Expect = 3e-05 Identities = 44/49 (89%) Strand = Plus / Plus Query: 207 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 255 |||||||||||| ||||||||| ||| |||| |||||||||||| |||| Sbjct: 125093 ccggcgaggccggcgccgatgaagggaccgagccagtacacccagtggt 125141
>ref|NM_188626.1| Oryza sativa (japonica cultivar-group), Ozsa8229 predicted mRNA Length = 756 Score = 56.0 bits (28), Expect = 1e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 300 gggttcatggacncgccggagaaggcgccgccgacgaggatgttggcgccgacga 354 |||||||||||| |||||| || ||||||||| ||| | ||||||||||||||| Sbjct: 590 gggttcatggacgcgccggtgagcgcgccgccggcgacggtgttggcgccgacga 536
>gb|AF275315.1|AF275315 Lotus japonicus water-selective transport intrinsic membrane protein 1 mRNA, complete cds Length = 1162 Score = 56.0 bits (28), Expect = 1e-04 Identities = 57/67 (85%) Strand = Plus / Minus Query: 393 cccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcatgacg 452 ||||||||||| || ||||| |||||||| || |||||||||| || || ||||| ||| Sbjct: 562 cccttcttgggatcaacggctgtggcgtaaactgtgtacaccaatccaaaggtcatcacg 503 Query: 453 atctcca 459 ||||||| Sbjct: 502 atctcca 496 Score = 42.1 bits (21), Expect = 1.7 Identities = 39/45 (86%) Strand = Plus / Minus Query: 266 ccagctgacgagggcggggccgaaggagacggcggggttcatgga 310 |||||| |||| ||| || ||||| || ||||||||||||||||| Sbjct: 689 ccagctcacgacggctggtccgaatgacacggcggggttcatgga 645
>dbj|AK099190.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023108H12, full insert sequence Length = 1055 Score = 56.0 bits (28), Expect = 1e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 300 gggttcatggacncgccggagaaggcgccgccgacgaggatgttggcgccgacga 354 |||||||||||| |||||| || ||||||||| ||| | ||||||||||||||| Sbjct: 636 gggttcatggacgcgccggtgagcgcgccgccggcgacggtgttggcgccgacga 582
>dbj|AK069592.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023019I12, full insert sequence Length = 1059 Score = 56.0 bits (28), Expect = 1e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 300 gggttcatggacncgccggagaaggcgccgccgacgaggatgttggcgccgacga 354 |||||||||||| |||||| || ||||||||| ||| | ||||||||||||||| Sbjct: 639 gggttcatggacgcgccggtgagcgcgccgccggcgacggtgttggcgccgacga 585
>dbj|AP004479.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT03H13, TM0012b, complete sequence Length = 41820 Score = 56.0 bits (28), Expect = 1e-04 Identities = 57/67 (85%) Strand = Plus / Plus Query: 393 cccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcatgacg 452 ||||||||||| || ||||| |||||||| || |||||||||| || || ||||| ||| Sbjct: 10234 cccttcttgggatcaacggctgtggcgtaaactgtgtacaccaatccaaaggtcatcacg 10293 Query: 453 atctcca 459 ||||||| Sbjct: 10294 atctcca 10300 Score = 42.1 bits (21), Expect = 1.7 Identities = 39/45 (86%) Strand = Plus / Plus Query: 266 ccagctgacgagggcggggccgaaggagacggcggggttcatgga 310 |||||| |||| ||| || ||||| || ||||||||||||||||| Sbjct: 10107 ccagctcacgacggctggtccgaatgacacggcggggttcatgga 10151
>gb|BT016509.1| Zea mays clone Contig342 mRNA sequence Length = 1237 Score = 54.0 bits (27), Expect = 4e-04 Identities = 54/63 (85%) Strand = Plus / Minus Query: 193 gctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacacccact 252 ||||||||| |||||||| ||||||| |||||| | ||| || |||||||||||||| | Sbjct: 880 gctcgtagacgacgccggagaggccggcgccgaccatgggccccacccagtacacccatt 821 Query: 253 ggt 255 ||| Sbjct: 820 ggt 818
>emb|X72581.1|ATGTIPMR A.thaliana mRNA for tonoplast intrinsic protein gamma (gamma-TIP) Length = 933 Score = 54.0 bits (27), Expect = 4e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 145 agtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagatga 204 ||||||||||||| |||||||||||||| ||| | |||||||| | |||||||||| Sbjct: 787 agtagtcggtggttgggagctgctcgtgtgtggtgttgatgaagaaaacttcgtagatga 728 Query: 205 cgccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 255 || |||| || ||||||| ||| || ||| ||||||||||||| |||| Sbjct: 727 gtccagcgattccaccgccgacgagaggtccggcccagtacacccagtggt 677
>gb|AY130971.1| Brassica oleracea var. botrytis tonoplast intrinsic protein bobTIP26-2 gene, complete cds Length = 1442 Score = 54.0 bits (27), Expect = 4e-04 Identities = 53/62 (85%) Strand = Plus / Minus Query: 396 ttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcatgacgatc 455 |||||||| || |||||||||||||| || ||||| || ||||| || ||||| |||||| Sbjct: 996 ttcttgggatcaacggcggtggcgtagactgtgtaaactagcccaaatgtcattacgatc 937 Query: 456 tc 457 || Sbjct: 936 tc 935 Score = 46.1 bits (23), Expect = 0.11 Identities = 89/111 (80%) Strand = Plus / Minus Query: 145 agtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagatga 204 |||||||||||||||||||||| || || ||| | |||||||| | ||||||||||| Sbjct: 1247 agtagtcggtggtggggagctgttcatgtgtggtgttgatgaagaaaacctcgtagatga 1188 Query: 205 cgccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 255 ||||||| || |||||||| || || || ||||||| ||||| |||| Sbjct: 1187 gtccggcgactccaccgccgataagaggtccagcccagtagacccagtggt 1137
>emb|AJ289866.2|VVI289866 Vitis vinifera mRNA for putative aquaporin (delta-TIP gene) Length = 1017 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 269 gctgacgagggcggggccgaaggagacggcggggttcat 307 |||||||| |||||||||||||||| |||||||||||| Sbjct: 624 gctgacgacggcggggccgaaggagcgggcggggttcat 586
>gb|U92652.2|BOU92652 Brassica oleracea var. botrytis tonoplast intrinsic protein bobTIP26-2 mRNA, partial cds Length = 599 Score = 54.0 bits (27), Expect = 4e-04 Identities = 53/62 (85%) Strand = Plus / Minus Query: 396 ttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcatgacgatc 455 |||||||| || |||||||||||||| || ||||| || ||||| || ||||| |||||| Sbjct: 275 ttcttgggatcaacggcggtggcgtagactgtgtaaactagcccaaatgtcattacgatc 216 Query: 456 tc 457 || Sbjct: 215 tc 214 Score = 46.1 bits (23), Expect = 0.11 Identities = 89/111 (80%) Strand = Plus / Minus Query: 145 agtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagatga 204 |||||||||||||||||||||| || || ||| | |||||||| | ||||||||||| Sbjct: 526 agtagtcggtggtggggagctgttcatgtgtggtgttgatgaagaaaacctcgtagatga 467 Query: 205 cgccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 255 ||||||| || |||||||| || || || ||||||| ||||| |||| Sbjct: 466 gtccggcgactccaccgccgataagaggtccagcccagtagacccagtggt 416
>gb|AF271661.1|AF271661 Vitis berlandieri x Vitis rupestris putative aquaporin TIP1 (TIP1) mRNA, complete cds Length = 1057 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 269 gctgacgagggcggggccgaaggagacggcggggttcat 307 |||||||| |||||||||||||||| |||||||||||| Sbjct: 666 gctgacgacggcggggccgaaggagcgggcggggttcat 628
>ref|NM_124117.2| Arabidopsis thaliana AtTIP2;3; water channel AT5G47450 (AtTIP2;3) mRNA, complete cds Length = 1051 Score = 52.0 bits (26), Expect = 0.002 Identities = 43/49 (87%) Strand = Plus / Minus Query: 334 cgaggatgttggcgccgacgatgaanccgatggcgatgggcgcgatggt 382 ||||||||||||| || || ||||| ||||||||||| || |||||||| Sbjct: 597 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggt 549
>gb|BT011663.1| Arabidopsis thaliana At5g47450 mRNA, complete cds Length = 753 Score = 52.0 bits (26), Expect = 0.002 Identities = 43/49 (87%) Strand = Plus / Minus Query: 334 cgaggatgttggcgccgacgatgaanccgatggcgatgggcgcgatggt 382 ||||||||||||| || || ||||| ||||||||||| || |||||||| Sbjct: 559 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggt 511
>gb|BT011212.1| Arabidopsis thaliana At5g47450 gene, complete cds Length = 853 Score = 52.0 bits (26), Expect = 0.002 Identities = 43/49 (87%) Strand = Plus / Minus Query: 334 cgaggatgttggcgccgacgatgaanccgatggcgatgggcgcgatggt 382 ||||||||||||| || || ||||| ||||||||||| || |||||||| Sbjct: 587 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggt 539
>emb|BX823560.1|CNS0A7QS Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS51ZB01 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 676 Score = 52.0 bits (26), Expect = 0.002 Identities = 99/124 (79%) Strand = Plus / Minus Query: 334 cgaggatgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgcccaggctgc 393 |||||||||| || || |||||||| || | |||||| || ||||| || || || | | Sbjct: 237 cgaggatgttcgctccaacgatgaaacccaaggcgattggtgcgattgttccgagacgac 178 Query: 394 ccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcatgacga 453 | ||||||||||| ||||| ||||||| || ||||| || ||||||| ||||| |||| Sbjct: 177 cgttcttggggtcaacggctgtggcgtcgacggtgtagacgagcccgagggtcatcacga 118 Query: 454 tctc 457 |||| Sbjct: 117 tctc 114
>gb|AF133531.1|AF133531 Mesembryanthemum crystallinum water channel protein MipI (MipI) mRNA, complete cds Length = 1035 Score = 52.0 bits (26), Expect = 0.002 Identities = 55/65 (84%) Strand = Plus / Minus Query: 393 cccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaangtcatgacg 452 |||||||||||||| || || |||||||| || ||||| || |||||||| ||||| || Sbjct: 576 cccttcttggggtcaacagcagtggcgtagacggtgtagacaagcccgaaggtcatcaca 517 Query: 453 atctc 457 ||||| Sbjct: 516 atctc 512
>dbj|AB025628.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNJ7 Length = 80117 Score = 52.0 bits (26), Expect = 0.002 Identities = 43/49 (87%) Strand = Plus / Plus Query: 334 cgaggatgttggcgccgacgatgaanccgatggcgatgggcgcgatggt 382 ||||||||||||| || || ||||| ||||||||||| || |||||||| Sbjct: 8647 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggt 8695
>gb|AF367456.1| Prunus persica clone gTip1 gamma-tonoplast intrinsic protein mRNA, partial cds Length = 408 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Minus Query: 266 ccagctgacgagggcggggccgaaggagacggcggggttcatgga 310 ||||||||||| ||||| ||||||||||| || ||||||||||| Sbjct: 393 ccagctgacgacagcgggtccgaaggagactgccgggttcatgga 349
>gb|AF521142.1| Kandelia candel tonoplast intrinsic protein mRNA, partial cds Length = 175 Score = 48.1 bits (24), Expect = 0.027 Identities = 41/47 (87%) Strand = Plus / Minus Query: 341 gttggcgccgacgatgaanccgatggcgatgggcgcgatggtgccca 387 |||||| || || ||||| ||||||||||| |||||||| ||||||| Sbjct: 62 gttggcacccacaatgaaaccgatggcgattggcgcgattgtgccca 16
>emb|X95952.1|HAAP H.annuus mRNA for aquaporin Length = 931 Score = 48.1 bits (24), Expect = 0.027 Identities = 39/44 (88%) Strand = Plus / Minus Query: 392 gcccttcttggggtcgacggcggtggcgtacaccgtgtacacca 435 ||||||||||||||| || ||||||||||| || ||||||||| Sbjct: 553 gcccttcttggggtcaactgcggtggcgtaaacgttgtacacca 510
>gb|AF133532.1|AF133532 Mesembryanthemum crystallinum water channel protein MipK (MipK) mRNA, complete cds Length = 1076 Score = 48.1 bits (24), Expect = 0.027 Identities = 127/162 (78%) Strand = Plus / Minus Query: 274 cgagggcggggccgaaggagacggcggggttcatggacncgccggagaaggcgccgccga 333 |||| ||||| ||||| ||| ||| ||||||||||| | || ||||| | |||| || Sbjct: 701 cgagagcgggcccgaatgagcgggctgggttcatggatccaccagagaatgggccggcgg 642 Query: 334 cgaggatgttggcgccgacgatgaanccgatggcgatgggcgcgatggtgcccaggctgc 393 | | ||||||||| || || ||||| || || || ||||| || |||||||||| || Sbjct: 641 ccaagatgttggctccaacaatgaacccaatagcaatgggggcaatggtgcccactgagc 582 Query: 394 ccttcttggggtcgacggcggtggcgtacaccgtgtacacca 435 || |||||||||| || ||||||||||| || ||||| |||| Sbjct: 581 ccctcttggggtcaactgcggtggcgtagacggtgtagacca 540
>dbj|AB010416.1| Raphanus sativus VIP3 mRNA for delta-VM23, complete cds Length = 911 Score = 48.1 bits (24), Expect = 0.027 Identities = 41/47 (87%) Strand = Plus / Minus Query: 336 aggatgttggcgccgacgatgaanccgatggcgatgggcgcgatggt 382 ||||||||||| |||||||||| || ||||||| ||| |||||||| Sbjct: 598 aggatgttggcaccgacgatgagaccaatggcgaggggagcgatggt 552
>ref|NM_112495.2| Arabidopsis thaliana DELTA-TIP; water channel AT3G16240 (DELTA-TIP) mRNA, complete cds Length = 1125 Score = 46.1 bits (23), Expect = 0.11 Identities = 125/160 (78%) Strand = Plus / Minus Query: 300 gggttcatggacncgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaan 359 ||||||||||| | |||||||| | ||| || ||||||||||||| || ||||| | Sbjct: 703 gggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacgataaga 644 Query: 360 ccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcg 419 || ||||||| || |||||||| || || ||||||||||| || ||||||||||| Sbjct: 643 ccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcggtggcg 584 Query: 420 tacaccgtgtacaccagcccgaangtcatgacgatctcca 459 || || ||||| |||| |||| || |||| |||||||| Sbjct: 583 tagacagtgtagaccaaagcgaaggtgatgatgatctcca 544
>ref|NM_112496.2| Arabidopsis thaliana electron carrier/ electron transporter/ iron ion binding AT3G16250 mRNA, complete cds Length = 1538 Score = 46.1 bits (23), Expect = 0.11 Identities = 125/160 (78%) Strand = Plus / Plus Query: 300 gggttcatggacncgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaan 359 ||||||||||| | |||||||| | ||| || ||||||||||||| || ||||| | Sbjct: 1172 gggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacgataaga 1231 Query: 360 ccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcg 419 || ||||||| || |||||||| || || ||||||||||| || ||||||||||| Sbjct: 1232 ccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcggtggcg 1291 Query: 420 tacaccgtgtacaccagcccgaangtcatgacgatctcca 459 || || ||||| |||| |||| || |||| |||||||| Sbjct: 1292 tagacagtgtagaccaaagcgaaggtgatgatgatctcca 1331
>emb|X53040.1|RNNIP26 R.norvegicus MIP-26 mRNA Length = 336 Score = 46.1 bits (23), Expect = 0.11 Identities = 38/43 (88%) Strand = Plus / Minus Query: 213 aggccgccgccgatgagggggccgacccagtacacccactggt 255 ||||| |||||||||| ||||| |||||||||||||| |||| Sbjct: 301 aggcccccgccgatgattgggcccacccagtacacccagtggt 259
>emb|X53052.1|RRMIP Rat partial mRNA for main intrinsic protein Length = 936 Score = 46.1 bits (23), Expect = 0.11 Identities = 38/43 (88%) Strand = Plus / Minus Query: 213 aggccgccgccgatgagggggccgacccagtacacccactggt 255 ||||| |||||||||| ||||| |||||||||||||| |||| Sbjct: 635 aggcccccgccgatgattgggcccacccagtacacccagtggt 593
>emb|X12514.1|RNMIP26R Rat mRNA fragment for main intrinsic protein 26 (MIP26) Length = 543 Score = 46.1 bits (23), Expect = 0.11 Identities = 38/43 (88%) Strand = Plus / Minus Query: 213 aggccgccgccgatgagggggccgacccagtacacccactggt 255 ||||| |||||||||| ||||| |||||||||||||| |||| Sbjct: 242 aggcccccgccgatgattgggcccacccagtacacccagtggt 200
>emb|AJ251652.1|MTR251652 Medicago truncatula mRNA for aquaporin (aqp1 gene) Length = 1120 Score = 46.1 bits (23), Expect = 0.11 Identities = 41/47 (87%) Strand = Plus / Minus Query: 144 tagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagag 190 |||||||| || || ||||||||||||||||||| | ||||||||| Sbjct: 837 tagtagtcagtagttgggagctgctcgtgggtgctgttgatgaagag 791
>gb|AY081622.1| Arabidopsis thaliana delta tonoplast intrinsic protein (At3g16230) mRNA, complete cds Length = 853 Score = 46.1 bits (23), Expect = 0.11 Identities = 125/160 (78%) Strand = Plus / Minus Query: 300 gggttcatggacncgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaan 359 ||||||||||| | |||||||| | ||| || ||||||||||||| || ||||| | Sbjct: 593 gggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacgataaga 534 Query: 360 ccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcg 419 || ||||||| || |||||||| || || ||||||||||| || ||||||||||| Sbjct: 533 ccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcggtggcg 474 Query: 420 tacaccgtgtacaccagcccgaangtcatgacgatctcca 459 || || ||||| |||| |||| || |||| |||||||| Sbjct: 473 tagacagtgtagaccaaagcgaaggtgatgatgatctcca 434
>gb|AY065181.1| Arabidopsis thaliana delta tonoplast intrinsic protein (At3g16230; MYA6.5) mRNA, complete cds Length = 929 Score = 46.1 bits (23), Expect = 0.11 Identities = 125/160 (78%) Strand = Plus / Minus Query: 300 gggttcatggacncgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaan 359 ||||||||||| | |||||||| | ||| || ||||||||||||| || ||||| | Sbjct: 664 gggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacgataaga 605 Query: 360 ccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcg 419 || ||||||| || |||||||| || || ||||||||||| || ||||||||||| Sbjct: 604 ccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcggtggcg 545 Query: 420 tacaccgtgtacaccagcccgaangtcatgacgatctcca 459 || || ||||| |||| |||| || |||| |||||||| Sbjct: 544 tagacagtgtagaccaaagcgaaggtgatgatgatctcca 505
>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome Length = 5331656 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 206 gccggcgaggccgccgccgatga 228 ||||||||||||||||||||||| Sbjct: 3111631 gccggcgaggccgccgccgatga 3111609 Score = 40.1 bits (20), Expect = 6.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 205 cgccggcgaggccgccgccgatga 228 ||||||||||||| |||||||||| Sbjct: 505314 cgccggcgaggccaccgccgatga 505291
>emb|BX823177.1|CNS0A5ZD Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB95ZE06 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 903 Score = 46.1 bits (23), Expect = 0.11 Identities = 125/160 (78%) Strand = Plus / Minus Query: 300 gggttcatggacncgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaan 359 ||||||||||| | |||||||| | ||| || ||||||||||||| || ||||| | Sbjct: 641 gggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacgataaga 582 Query: 360 ccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcg 419 || ||||||| || |||||||| || || ||||||||||| || ||||||||||| Sbjct: 581 ccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcggtggcg 522 Query: 420 tacaccgtgtacaccagcccgaangtcatgacgatctcca 459 || || ||||| |||| |||| || |||| |||||||| Sbjct: 521 tagacagtgtagaccaaagcgaaggtgatgatgatctcca 482
>emb|BX823081.1|CNS0A5VY Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB88ZH07 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 957 Score = 46.1 bits (23), Expect = 0.11 Identities = 125/160 (78%) Strand = Plus / Minus Query: 300 gggttcatggacncgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaan 359 ||||||||||| | |||||||| | ||| || ||||||||||||| || ||||| | Sbjct: 646 gggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacgataaga 587 Query: 360 ccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcg 419 || ||||||| || |||||||| || || ||||||||||| || ||||||||||| Sbjct: 586 ccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcggtggcg 527 Query: 420 tacaccgtgtacaccagcccgaangtcatgacgatctcca 459 || || ||||| |||| |||| || |||| |||||||| Sbjct: 526 tagacagtgtagaccaaagcgaaggtgatgatgatctcca 487
>emb|BX823757.1|CNS0A5CX Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS72ZD10 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 945 Score = 46.1 bits (23), Expect = 0.11 Identities = 125/160 (78%) Strand = Plus / Minus Query: 300 gggttcatggacncgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaan 359 ||||||||||| | |||||||| | ||| || ||||||||||||| || ||||| | Sbjct: 643 gggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacgataaga 584 Query: 360 ccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcg 419 || ||||||| || |||||||| || || ||||||||||| || ||||||||||| Sbjct: 583 ccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcggtggcg 524 Query: 420 tacaccgtgtacaccagcccgaangtcatgacgatctcca 459 || || ||||| |||| |||| || |||| |||||||| Sbjct: 523 tagacagtgtagaccaaagcgaaggtgatgatgatctcca 484
>gb|AY085921.1| Arabidopsis thaliana clone 19689 mRNA, complete sequence Length = 978 Score = 46.1 bits (23), Expect = 0.11 Identities = 125/160 (78%) Strand = Plus / Minus Query: 300 gggttcatggacncgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaan 359 ||||||||||| | |||||||| | ||| || ||||||||||||| || ||||| | Sbjct: 665 gggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacgataaga 606 Query: 360 ccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcg 419 || ||||||| || |||||||| || || ||||||||||| || ||||||||||| Sbjct: 605 ccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcggtggcg 546 Query: 420 tacaccgtgtacaccagcccgaangtcatgacgatctcca 459 || || ||||| |||| |||| || |||| |||||||| Sbjct: 545 tagacagtgtagaccaaagcgaaggtgatgatgatctcca 506
>gb|AC020922.9| Homo sapiens chromosome 19 clone CTD-2105E13, complete sequence Length = 134793 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 113 cgggcgggcggggggcaggcggc 135 ||||||||||||||||||||||| Sbjct: 78789 cgggcgggcggggggcaggcggc 78811
>ref|XM_343137.2| PREDICTED: Rattus norvegicus major intrinsic protein of eye lens fiber (Mip), mRNA Length = 2075 Score = 46.1 bits (23), Expect = 0.11 Identities = 38/43 (88%) Strand = Plus / Minus Query: 213 aggccgccgccgatgagggggccgacccagtacacccactggt 255 ||||| |||||||||| ||||| |||||||||||||| |||| Sbjct: 685 aggcccccgccgatgattgggcccacccagtacacccagtggt 643
>gb|AY207429.1| Homo sapiens interleukin 11 (IL11) gene, complete cds Length = 9803 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 113 cgggcgggcggggggcaggcggc 135 ||||||||||||||||||||||| Sbjct: 1449 cgggcgggcggggggcaggcggc 1427
>emb|AJ605573.1| Ricinus communis mRNA for aquaporin (Tip1-1 gene), clone pT4L Length = 1057 Score = 46.1 bits (23), Expect = 0.11 Identities = 32/35 (91%) Strand = Plus / Minus Query: 143 ttagtagtcggtggtggggagctgctcgtgggtgc 177 ||||||||| ||||| ||||||||||| ||||||| Sbjct: 804 ttagtagtcagtggtagggagctgctcatgggtgc 770
>dbj|AB023046.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MYA6 Length = 75289 Score = 46.1 bits (23), Expect = 0.11 Identities = 125/160 (78%) Strand = Plus / Minus Query: 300 gggttcatggacncgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaan 359 ||||||||||| | |||||||| | ||| || ||||||||||||| || ||||| | Sbjct: 19492 gggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacgataaga 19433 Query: 360 ccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcg 419 || ||||||| || |||||||| || || ||||||||||| || ||||||||||| Sbjct: 19432 ccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcggtggcg 19373 Query: 420 tacaccgtgtacaccagcccgaangtcatgacgatctcca 459 || || ||||| |||| |||| || |||| |||||||| Sbjct: 19372 tagacagtgtagaccaaagcgaaggtgatgatgatctcca 19333
>gb|AY112625.1| Zea mays CL46210_1 mRNA sequence Length = 479 Score = 46.1 bits (23), Expect = 0.11 Identities = 53/63 (84%) Strand = Plus / Plus Query: 193 gctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacacccact 252 ||||| ||| |||||||| ||||||| |||||| | ||| || |||||||||||||| | Sbjct: 279 gctcgaagacgacgccggagaggccggcgccgaccatgggccccacccagtacacccatt 338 Query: 253 ggt 255 ||| Sbjct: 339 ggt 341
>gb|U39485.1|ATU39485 Arabidopsis thaliana delta tonoplast integral protein mRNA, complete cds Length = 939 Score = 46.1 bits (23), Expect = 0.11 Identities = 125/160 (78%) Strand = Plus / Minus Query: 300 gggttcatggacncgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaan 359 ||||||||||| | |||||||| | ||| || ||||||||||||| || ||||| | Sbjct: 610 gggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacgataaga 551 Query: 360 ccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcg 419 || ||||||| || |||||||| || || ||||||||||| || ||||||||||| Sbjct: 550 ccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcggtggcg 491 Query: 420 tacaccgtgtacaccagcccgaangtcatgacgatctcca 459 || || ||||| |||| |||| || |||| |||||||| Sbjct: 490 tagacagtgtagaccaaagcgaaggtgatgatgatctcca 451
>gb|AF000143.1|HSAF000143 Human putative alternative lens membrane intrinsic protein (PALM) mRNA, partial cds Length = 789 Score = 46.1 bits (23), Expect = 0.11 Identities = 38/43 (88%) Strand = Plus / Minus Query: 213 aggccgccgccgatgagggggccgacccagtacacccactggt 255 ||||| |||||||||| ||||| |||||||||||||| |||| Sbjct: 641 aggcccccgccgatgattgggcccacccagtacacccagtggt 599
>gb|M81890.1|HUMIL11A Human interleukin 11 (IL11) gene, complete mRNA Length = 6870 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 113 cgggcgggcggggggcaggcggc 135 ||||||||||||||||||||||| Sbjct: 688 cgggcgggcggggggcaggcggc 666
>dbj|AB012268.1| Aster tripolium mRNA for SAMIPB, partial cds Length = 321 Score = 46.1 bits (23), Expect = 0.11 Identities = 28/30 (93%) Strand = Plus / Minus Query: 338 gatgttggcgccgacgatgaanccgatggc 367 |||||||||||||||||| || |||||||| Sbjct: 321 gatgttggcgccgacgataaagccgatggc 292
>emb|AL591787.1|SME591787 Sinorhizobium meliloti 1021 complete chromosome; segment 6/12 Length = 329100 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 207 ccggcgaggccgccgccgatga 228 |||||||||||||||||||||| Sbjct: 213784 ccggcgaggccgccgccgatga 213805
>ref|XM_851400.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript variant 11 (LOC479191), mRNA Length = 4681 Score = 44.1 bits (22), Expect = 0.43 Identities = 31/34 (91%) Strand = Plus / Minus Query: 104 acggacggacgggcgggcggggggcaggcggcgg 137 |||||||||||||| ||||||| || |||||||| Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91
>ref|XM_536333.2| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript variant 1 (LOC479191), mRNA Length = 4681 Score = 44.1 bits (22), Expect = 0.43 Identities = 31/34 (91%) Strand = Plus / Minus Query: 104 acggacggacgggcgggcggggggcaggcggcgg 137 |||||||||||||| ||||||| || |||||||| Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91
>ref|XM_851314.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript variant 10 (LOC479191), mRNA Length = 4663 Score = 44.1 bits (22), Expect = 0.43 Identities = 31/34 (91%) Strand = Plus / Minus Query: 104 acggacggacgggcgggcggggggcaggcggcgg 137 |||||||||||||| ||||||| || |||||||| Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91
>ref|XM_851274.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript variant 9 (LOC479191), mRNA Length = 4438 Score = 44.1 bits (22), Expect = 0.43 Identities = 31/34 (91%) Strand = Plus / Minus Query: 104 acggacggacgggcgggcggggggcaggcggcgg 137 |||||||||||||| ||||||| || |||||||| Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91
>ref|XM_851189.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript variant 7 (LOC479191), mRNA Length = 4777 Score = 44.1 bits (22), Expect = 0.43 Identities = 31/34 (91%) Strand = Plus / Minus Query: 104 acggacggacgggcgggcggggggcaggcggcgg 137 |||||||||||||| ||||||| || |||||||| Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91
>ref|XM_851152.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript variant 6 (LOC479191), mRNA Length = 4696 Score = 44.1 bits (22), Expect = 0.43 Identities = 31/34 (91%) Strand = Plus / Minus Query: 104 acggacggacgggcgggcggggggcaggcggcgg 137 |||||||||||||| ||||||| || |||||||| Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91
>ref|XM_851023.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript variant 3 (LOC479191), mRNA Length = 4681 Score = 44.1 bits (22), Expect = 0.43 Identities = 31/34 (91%) Strand = Plus / Minus Query: 104 acggacggacgggcgggcggggggcaggcggcgg 137 |||||||||||||| ||||||| || |||||||| Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91
>gb|AC183494.1| Brassica oleracea Contig C, complete sequence Length = 285752 Score = 44.1 bits (22), Expect = 0.43 Identities = 42/49 (85%) Strand = Plus / Minus Query: 334 cgaggatgttggcgccgacgatgaanccgatggcgatgggcgcgatggt 382 ||||||||||||| || |||||||| || || ||||| || |||||||| Sbjct: 123743 cgaggatgttggcaccaacgatgaaaccaatagcgattggtgcgatggt 123695
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 278 ggcggggccgaaggagacggcg 299 |||||||||||||||||||||| Sbjct: 8473737 ggcggggccgaaggagacggcg 8473716 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 278 ggcggggccgaaggagacggcg 299 |||||||||||||||||||||| Sbjct: 8461221 ggcggggccgaaggagacggcg 8461200
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 278 ggcggggccgaaggagacggcg 299 |||||||||||||||||||||| Sbjct: 8473620 ggcggggccgaaggagacggcg 8473599 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 278 ggcggggccgaaggagacggcg 299 |||||||||||||||||||||| Sbjct: 8461104 ggcggggccgaaggagacggcg 8461083
>emb|AL928775.2|CNS08CC5 Oryza sativa chromosome 12, . BAC OSJNBa0030N06 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 146444 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 278 ggcggggccgaaggagacggcg 299 |||||||||||||||||||||| Sbjct: 80400 ggcggggccgaaggagacggcg 80379 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 278 ggcggggccgaaggagacggcg 299 |||||||||||||||||||||| Sbjct: 67884 ggcggggccgaaggagacggcg 67863
>dbj|AB012269.1| Aster tripolium mRNA for SAMIPC, partial cds Length = 321 Score = 44.1 bits (22), Expect = 0.43 Identities = 24/25 (96%) Strand = Plus / Minus Query: 345 gcgccgacgatgaanccgatggcga 369 |||||||||||||| |||||||||| Sbjct: 314 gcgccgacgatgaagccgatggcga 290
>dbj|AB012267.1| Aster tripolium mRNA for SAMIPA, partial cds Length = 321 Score = 44.1 bits (22), Expect = 0.43 Identities = 27/29 (93%) Strand = Plus / Minus Query: 342 ttggcgccgacgatgaanccgatggcgat 370 |||||||||||||| || ||||||||||| Sbjct: 317 ttggcgccgacgataaagccgatggcgat 289
>gb|AE017351.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 11, complete sequence Length = 1019846 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 250 actggtacccccactcccagc 270 ||||||||||||||||||||| Sbjct: 290624 actggtacccccactcccagc 290604
>gb|AC154709.2| Mus musculus BAC clone RP24-357I4 from chromosome 12, complete sequence Length = 136354 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 104 acggacggacgggcgggcggg 124 ||||||||||||||||||||| Sbjct: 94084 acggacggacgggcgggcggg 94104
>ref|XM_593064.2| PREDICTED: Bos taurus similar to tumor protein p73 (LOC515105), mRNA Length = 2606 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 215 gccgccgccgatgagggggcc 235 ||||||||||||||||||||| Sbjct: 22 gccgccgccgatgagggggcc 42
>gb|AF183913.1| Azospirillum brasilense major outer membrane protein OmaA precursor (omaA) gene, complete cds Length = 1435 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 207 ccggcgaggccgccgccgatg 227 ||||||||||||||||||||| Sbjct: 698 ccggcgaggccgccgccgatg 678
>ref|XM_856403.1| PREDICTED: Canis familiaris similar to aquaporin 6, transcript variant 2 (LOC607978), mRNA Length = 1082 Score = 42.1 bits (21), Expect = 1.7 Identities = 30/33 (90%) Strand = Plus / Minus Query: 278 ggcggggccgaaggagacggcggggttcatgga 310 |||||||||||||||| ||| ||||||||||| Sbjct: 588 ggcggggccgaaggagcgggccgggttcatgga 556
>ref|XM_845359.1| PREDICTED: Canis familiaris similar to aquaporin 6, transcript variant 1 (LOC607978), mRNA Length = 1067 Score = 42.1 bits (21), Expect = 1.7 Identities = 30/33 (90%) Strand = Plus / Minus Query: 278 ggcggggccgaaggagacggcggggttcatgga 310 |||||||||||||||| ||| ||||||||||| Sbjct: 573 ggcggggccgaaggagcgggccgggttcatgga 541
>emb|CT025679.5| Mouse DNA sequence from clone RP24-296K22 on chromosome 14, complete sequence Length = 160805 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 104 acggacggacgggcgggcggg 124 ||||||||||||||||||||| Sbjct: 155955 acggacggacgggcgggcggg 155935
>ref|XM_567655.1| Cryptococcus neoformans var. neoformans JEC21 hypothetical protein (CNK00920) partial mRNA Length = 2340 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 250 actggtacccccactcccagc 270 ||||||||||||||||||||| Sbjct: 2133 actggtacccccactcccagc 2113
>gb|AC123532.4| Mus musculus chromosome 14 clone RP23-84B6, complete sequence Length = 166421 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 104 acggacggacgggcgggcggg 124 ||||||||||||||||||||| Sbjct: 7846 acggacggacgggcgggcggg 7826
>gb|AC098877.3| Mus musculus BAC clone RP23-2C24 from 14, complete sequence Length = 240151 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 104 acggacggacgggcgggcggg 124 ||||||||||||||||||||| Sbjct: 37973 acggacggacgggcgggcggg 37953
>gb|AC104099.5| Mus musculus BAC clone RP24-372J8 from 3, complete sequence Length = 148259 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 104 acggacggacgggcgggcggg 124 ||||||||||||||||||||| Sbjct: 37509 acggacggacgggcgggcggg 37489 Score = 40.1 bits (20), Expect = 6.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 101 cacacggacggacgggcgggcggg 124 ||||||||||||||| |||||||| Sbjct: 37516 cacacggacggacggacgggcggg 37493
>gb|BC012214.1| Mus musculus Rab geranylgeranyl transferase, a subunit, mRNA (cDNA clone MGC:19255 IMAGE:3967218), complete cds Length = 2176 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 104 acggacggacgggcgggcggg 124 ||||||||||||||||||||| Sbjct: 23 acggacggacgggcgggcggg 43
>gb|AY258323.1| Rubella virus strain BRD-II, complete genome Length = 9778 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 113 cgggcgggcggggggcaggcggcgg 137 ||||||||| ||||||||||||||| Sbjct: 2327 cgggcgggctgggggcaggcggcgg 2303
>ref|XM_503667.1| Yarrowia lipolytica CLIB122, YALI0E07557g predicted mRNA Length = 2157 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 382 tgcccaggctgcccttcttgg 402 ||||||||||||||||||||| Sbjct: 1060 tgcccaggctgcccttcttgg 1040
>ref|NM_019519.1| Mus musculus Rab geranylgeranyl transferase, a subunit (Rabggta), mRNA Length = 2547 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 104 acggacggacgggcgggcggg 124 ||||||||||||||||||||| Sbjct: 18 acggacggacgggcgggcggg 38
>ref|XM_961391.1| PREDICTED: Tribolium castaneum similar to CG31000-PC, isoform C (LOC654951), mRNA Length = 3244 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 205 cgccggcgaggccgccgccga 225 ||||||||||||||||||||| Sbjct: 1642 cgccggcgaggccgccgccga 1622
>gb|CP000089.1| Dechloromonas aromatica RCB, complete genome Length = 4501104 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 209 ggcgaggccgccgccgatgag 229 ||||||||||||||||||||| Sbjct: 1201038 ggcgaggccgccgccgatgag 1201058
>emb|AL390091.1|NCB12F1 Neurospora crassa DNA linkage group II BAC clone B12F1 Length = 68478 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 104 acggacggacgggcgggcggg 124 ||||||||||||||||||||| Sbjct: 42894 acggacggacgggcgggcggg 42914 Score = 40.1 bits (20), Expect = 6.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 101 cacacggacggacgggcgggcggg 124 ||||||||||||||| |||||||| Sbjct: 42887 cacacggacggacggacgggcggg 42910
>emb|AJ489613.1|CAR489613 Cicer arietinum partial mRNA for tonoplast intrinsic protein (tip gene) Length = 716 Score = 42.1 bits (21), Expect = 1.7 Identities = 30/33 (90%) Strand = Plus / Minus Query: 144 tagtagtcggtggtggggagctgctcgtgggtg 176 |||||||| ||||| ||||| |||||||||||| Sbjct: 428 tagtagtcagtggtagggagttgctcgtgggtg 396
>emb|BX470185.18| Zebrafish DNA sequence from clone CH211-222D3 in linkage group 3, complete sequence Length = 198900 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 104 acggacggacgggcgggcggg 124 ||||||||||||||||||||| Sbjct: 27616 acggacggacgggcgggcggg 27596
>dbj|AK146917.1| Mus musculus 17 days embryo kidney cDNA, RIKEN full-length enriched library, clone:I920074L06 product:Rab geranylgeranyl transferase, a subunit, full insert sequence Length = 2422 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 104 acggacggacgggcgggcggg 124 ||||||||||||||||||||| Sbjct: 41 acggacggacgggcgggcggg 61
>gb|AF326509.1|AF326509 Zea mays tonoplast membrane integral protein ZmTIP5-1 mRNA, complete cds Length = 1021 Score = 42.1 bits (21), Expect = 1.7 Identities = 41/48 (85%) Strand = Plus / Minus Query: 269 gctgacgagggcggggccgaaggagacggcggggttcatggacncgcc 316 |||||||| ||| |||||||| ||| ||| |||||||||||| |||| Sbjct: 709 gctgacgacggccgggccgaacgagcgggccgggttcatggacgcgcc 662
>gb|AC135495.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1664B11, complete sequence Length = 126040 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 104 acggacggacgggcgggcggg 124 ||||||||||||||||||||| Sbjct: 56775 acggacggacgggcgggcggg 56755
>ref|NM_214226.1| Sus scrofa inositol(1,3,4,5)tetrakisphosphate receptor (CENTA1), mRNA Length = 1544 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 105 cggacggacgggcgggcggggggca 129 |||||||||||||||||||| |||| Sbjct: 56 cggacggacgggcgggcgggcggca 80
>gb|AE004658.1| Pseudomonas aeruginosa PAO1, section 219 of 529 of the complete genome Length = 11864 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 205 cgccggcgaggccgccgccga 225 ||||||||||||||||||||| Sbjct: 2650 cgccggcgaggccgccgccga 2630
>gb|AF127662.1|AF127662 Mus musculus strain C57BL/6J-gm/gm RAB geranylgeranyl transferase alpha subunit (Rabggta) mRNA, complete cds, alternatively spliced Length = 2466 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 104 acggacggacgggcgggcggg 124 ||||||||||||||||||||| Sbjct: 18 acggacggacgggcgggcggg 38
>gb|AF127661.1|AF127661 Mus musculus strain C57BL/6J-gm/gm RAB geranylgeranyl transferase alpha subunit (Rabggta) pseudogene, complete sequence Length = 2435 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 104 acggacggacgggcgggcggg 124 ||||||||||||||||||||| Sbjct: 18 acggacggacgggcgggcggg 38
>gb|AF127660.1|AF127660 Mus musculus strain C57BL/6J RAB geranylgeranyl transferase alpha subunit (Rabggta) mRNA, complete cds, alternatively spliced Length = 2492 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 104 acggacggacgggcgggcggg 124 ||||||||||||||||||||| Sbjct: 18 acggacggacgggcgggcggg 38
>gb|AF127659.1|AF127659 Mus musculus strain C57BL/6J-gm/gm RAB geranylgeranyl transferase alpha subunit (Rabggta) mRNA, complete cds, alternatively spliced Length = 2547 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 104 acggacggacgggcgggcggg 124 ||||||||||||||||||||| Sbjct: 18 acggacggacgggcgggcggg 38
>gb|AF127658.1|AF127658 Mus musculus strain C57BL/6J RAB geranylgeranyl transferase alpha subunit (Rabggta) mRNA, complete cds, alternatively spliced Length = 2547 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 104 acggacggacgggcgggcggg 124 ||||||||||||||||||||| Sbjct: 18 acggacggacgggcgggcggg 38
>gb|AF127657.1|AF127657 Mus musculus strain C57BL/6J-gm/gm RAB geranylgeranyl transferase alpha subunit (Rabggta) pseudogene, complete sequence Length = 2338 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 104 acggacggacgggcgggcggg 124 ||||||||||||||||||||| Sbjct: 18 acggacggacgggcgggcggg 38
>gb|AF127656.1|AF127656 Mus musculus strain C57BL/6J RAB geranylgeranyl transferase alpha subunit (Rabggta) mRNA, complete cds, alternatively spliced Length = 2395 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 104 acggacggacgggcgggcggg 124 ||||||||||||||||||||| Sbjct: 18 acggacggacgggcgggcggg 38
>gb|AF127655.1|AF127655 Mus musculus strain C57BL/6J-gm/gm RAB geranylgeranyl transferase alpha subunit (Rabggta) gene, complete cds, alternatively spliced Length = 2685 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 104 acggacggacgggcgggcggg 124 ||||||||||||||||||||| Sbjct: 18 acggacggacgggcgggcggg 38
>gb|AF127654.1|AF127654 Mus musculus strain C57BL/6J RAB geranylgeranyl transferase alpha subunit (Rabggta) gene, complete cds, alternatively spliced Length = 2685 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 104 acggacggacgggcgggcggg 124 ||||||||||||||||||||| Sbjct: 18 acggacggacgggcgggcggg 38
>gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, complete sequence Length = 3131724 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 205 cgccggcgaggccgccgccga 225 ||||||||||||||||||||| Sbjct: 2570348 cgccggcgaggccgccgccga 2570368 Score = 40.1 bits (20), Expect = 6.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 205 cgccggcgaggccgccgccgatga 228 ||||||| |||||||||||||||| Sbjct: 2369100 cgccggccaggccgccgccgatga 2369077
>emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome complete sequence Length = 3716413 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 205 cgccggcgaggccgccgccga 225 ||||||||||||||||||||| Sbjct: 1841115 cgccggcgaggccgccgccga 1841095
>emb|AL845372.6| Zebrafish DNA sequence from clone DKEYP-113C1 in linkage group 20, complete sequence Length = 80017 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 104 acggacggacgggcgggcggg 124 ||||||||||||||||||||| Sbjct: 44968 acggacggacgggcgggcggg 44988
>emb|CR381567.9| Zebrafish DNA sequence from clone DKEY-115O4 in linkage group 23, complete sequence Length = 142417 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 104 acggacggacgggcgggcggg 124 ||||||||||||||||||||| Sbjct: 45131 acggacggacgggcgggcggg 45151
>gb|AF026470.1|AF026470 Pseudomonas aeruginosa gluconate repressor (gnuR), gluconate kinase (gnuK), and gluconate permease (gnuT) genes, complete cds Length = 3554 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 205 cgccggcgaggccgccgccga 225 ||||||||||||||||||||| Sbjct: 427 cgccggcgaggccgccgccga 407
>gb|AC159324.2| Mus musculus BAC clone RP23-9D1 from chromosome 12, complete sequence Length = 207280 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 104 acggacggacgggcgggcggg 124 ||||||||||||||||||||| Sbjct: 13760 acggacggacgggcgggcggg 13780
>gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, complete sequence Length = 2914771 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 115 ggcgggcggggggcaggcggcggtg 139 ||||||||||||||| ||||||||| Sbjct: 2074504 ggcgggcggggggcatgcggcggtg 2074480
>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome Length = 4751080 Score = 42.1 bits (21), Expect = 1.7 Identities = 32/36 (88%) Strand = Plus / Minus Query: 343 tggcgccgacgatgaanccgatggcgatgggcgcga 378 |||||||||||||||| ||| || ||||||| |||| Sbjct: 3239016 tggcgccgacgatgaagccggtgacgatgggggcga 3238981
>emb|CR974568.14| Mouse DNA sequence from clone RP23-39N20 on chromosome 12, complete sequence Length = 251037 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 104 acggacggacgggcgggcggg 124 ||||||||||||||||||||| Sbjct: 108741 acggacggacgggcgggcggg 108721
>emb|CR388420.19| Zebrafish DNA sequence from clone DKEY-37H18 in linkage group 13, complete sequence Length = 121689 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 104 acggacggacgggcgggcggg 124 ||||||||||||||||||||| Sbjct: 73151 acggacggacgggcgggcggg 73131
>emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB 122 of Yarrowia lipolytica Length = 4224103 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 382 tgcccaggctgcccttcttgg 402 ||||||||||||||||||||| Sbjct: 867021 tgcccaggctgcccttcttgg 867001
>gb|U88368.1|SSU88368 Sus scrofa inositol(1,3,4,5)tetrakisphosphate receptor mRNA, complete cds Length = 1544 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 105 cggacggacgggcgggcggggggca 129 |||||||||||||||||||| |||| Sbjct: 56 cggacggacgggcgggcgggcggca 80
>gb|L07320.1|HS5E1A Murine cytomegalovirus e1 protein gene, complete cds Length = 4536 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 104 acggacggacgggcgggcggg 124 ||||||||||||||||||||| Sbjct: 745 acggacggacgggcgggcggg 765
>ref|NM_129238.2| Arabidopsis thaliana GAMMA-TIP; water channel AT2G36830 (GAMMA-TIP) mRNA, complete cds Length = 1058 Score = 40.1 bits (20), Expect = 6.6 Identities = 26/28 (92%) Strand = Plus / Minus Query: 145 agtagtcggtggtggggagctgctcgtg 172 ||||||| ||||| |||||||||||||| Sbjct: 818 agtagtctgtggttgggagctgctcgtg 791
>ref|NM_117838.2| Arabidopsis thaliana DELTA-TIP2/TIP2;2; water channel AT4G17340 (DELTA-TIP2/TIP2;2) mRNA, complete cds Length = 977 Score = 40.1 bits (20), Expect = 6.6 Identities = 28/31 (90%) Strand = Plus / Minus Query: 334 cgaggatgttggcgccgacgatgaanccgat 364 ||||||||||||| || |||||||| ||||| Sbjct: 624 cgaggatgttggcaccaacgatgaaaccgat 594
>gb|AC164878.2| Mus musculus BAC clone RP23-364G24 from chromosome 13, complete sequence Length = 181893 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 104 acggacggacgggcgggcgg 123 |||||||||||||||||||| Sbjct: 94623 acggacggacgggcgggcgg 94642
>gb|AC162034.6| Mus musculus chromosome 7, clone RP23-285B12, complete sequence Length = 197907 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 113 cgggcgggcggggggcaggc 132 |||||||||||||||||||| Sbjct: 122681 cgggcgggcggggggcaggc 122700
>gb|CP000096.1| Pelodictyon luteolum DSM 273, complete genome Length = 2364842 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 218 gccgccgatgagggggccga 237 |||||||||||||||||||| Sbjct: 1305526 gccgccgatgagggggccga 1305507
>gb|DQ215783.1| Taeniopygia guttata clone 0058P0012B09 proteasome alpha 1 subunit variant 1-like mRNA, complete sequence Length = 1190 Score = 40.1 bits (20), Expect = 6.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 113 cgggcgggcggggggcaggcggcg 136 ||||||||||| |||||||||||| Sbjct: 38 cgggcgggcggcgggcaggcggcg 15
>gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence Length = 3587082 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 206 gccggcgaggccgccgccga 225 |||||||||||||||||||| Sbjct: 412353 gccggcgaggccgccgccga 412372
>ref|XM_472326.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 618 Score = 40.1 bits (20), Expect = 6.6 Identities = 26/28 (92%) Strand = Plus / Plus Query: 203 gacgccggcgaggccgccgccgatgagg 230 ||||||| ||||||||||||||| |||| Sbjct: 133 gacgccgacgaggccgccgccgaggagg 160
>gb|AF474373.1| Hordeum vulgare subsp. vulgare BAC 259I16, complete sequence Length = 124050 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 104 acggacggacgggcgggcgg 123 |||||||||||||||||||| Sbjct: 72221 acggacggacgggcgggcgg 72202
>ref|NM_001025266.1| Homo sapiens hypothetical gene supported by AK091454 (LOC285382), mRNA Length = 5901 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 203 gacgccggcgaggccgccgc 222 |||||||||||||||||||| Sbjct: 217 gacgccggcgaggccgccgc 198
>gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, complete genome Length = 3188609 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 208 cggcgaggccgccgccgatg 227 |||||||||||||||||||| Sbjct: 622954 cggcgaggccgccgccgatg 622973
>gb|AC145321.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0094P07, complete sequence Length = 162311 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 205 cgccggcgaggccgccgccg 224 |||||||||||||||||||| Sbjct: 15954 cgccggcgaggccgccgccg 15935
>gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, complete sequence Length = 3510148 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 206 gccggcgaggccgccgccga 225 |||||||||||||||||||| Sbjct: 1776040 gccggcgaggccgccgccga 1776021
>ref|XM_414866.1| PREDICTED: Gallus gallus similar to Aquaporin 8 (LOC416566), mRNA Length = 1761 Score = 40.1 bits (20), Expect = 6.6 Identities = 32/36 (88%) Strand = Plus / Minus Query: 221 gccgatgagggggccgacccagtacacccactggta 256 |||||| || || ||||||||||||||||| ||||| Sbjct: 1371 gccgatcagaggcccgacccagtacacccagtggta 1336
>ref|XM_426181.1| PREDICTED: Gallus gallus similar to Brix domain containing protein 1 (LOC428624), mRNA Length = 1530 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 205 cgccggcgaggccgccgccg 224 |||||||||||||||||||| Sbjct: 1364 cgccggcgaggccgccgccg 1345
>gb|CP000285.1| Chromohalobacter salexigens DSM 3043, complete genome Length = 3696649 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 208 cggcgaggccgccgccgatg 227 |||||||||||||||||||| Sbjct: 49687 cggcgaggccgccgccgatg 49668
>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence Length = 4126292 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 206 gccggcgaggccgccgccga 225 |||||||||||||||||||| Sbjct: 3021559 gccggcgaggccgccgccga 3021540
>gb|DQ356948.1| Crocodilepox virus, complete genome Length = 190054 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 205 cgccggcgaggccgccgccg 224 |||||||||||||||||||| Sbjct: 101116 cgccggcgaggccgccgccg 101135
>gb|AY502065.1| Streptomyces mobaraensis transglutaminase gene, complete cds Length = 1224 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 206 gccggcgaggccgccgccga 225 |||||||||||||||||||| Sbjct: 76 gccggcgaggccgccgccga 95
>gb|AF531437.1| Streptomyces mobaraensis IFO13819 transglutaminase precursor, gene, complete cds Length = 1809 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 206 gccggcgaggccgccgccga 225 |||||||||||||||||||| Sbjct: 653 gccggcgaggccgccgccga 672
>gb|AY225468.1| Mus musculus interleukin 11 gene, promoter region and partial 5'UTR Length = 3811 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 113 cgggcgggcggggggcaggc 132 |||||||||||||||||||| Sbjct: 3619 cgggcgggcggggggcaggc 3600
>gb|AC123518.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0088N01, complete sequence Length = 123954 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 205 cgccggcgaggccgccgccg 224 |||||||||||||||||||| Sbjct: 68770 cgccggcgaggccgccgccg 68751
>emb|Z97343.1|ATFCA8 Arabidopsis thaliana DNA chromosome 4, ESSA I FCA contig fragment No. 8 Length = 207674 Score = 40.1 bits (20), Expect = 6.6 Identities = 28/31 (90%) Strand = Plus / Minus Query: 334 cgaggatgttggcgccgacgatgaanccgat 364 ||||||||||||| || |||||||| ||||| Sbjct: 64827 cgaggatgttggcaccaacgatgaaaccgat 64797
>emb|X63552.1|ATGTIPARA A.thaliana gene for tonoplast intrinsic protein gamma-TIP(Ara) Length = 1398 Score = 40.1 bits (20), Expect = 6.6 Identities = 26/28 (92%) Strand = Plus / Minus Query: 145 agtagtcggtggtggggagctgctcgtg 172 ||||||| ||||| |||||||||||||| Sbjct: 1203 agtagtctgtggttgggagctgctcgtg 1176 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,822,337 Number of Sequences: 3902068 Number of extensions: 3822337 Number of successful extensions: 94000 Number of sequences better than 10.0: 320 Number of HSP's better than 10.0 without gapping: 324 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 90164 Number of HSP's gapped (non-prelim): 3783 length of query: 491 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 469 effective length of database: 17,147,199,772 effective search space: 8042036693068 effective search space used: 8042036693068 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
