ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd2o16
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AY108690.1| Zea mays PCO097961 mRNA sequence 107 5e-20
2gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 82 3e-12
3dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 82 3e-12
4gb|AC137070.2| Genomic sequence for Oryza sativa, Nipponbare str... 82 3e-12
5dbj|AK067657.1| Oryza sativa (japonica cultivar-group) cDNA clon... 82 3e-12
6dbj|AK066058.1| Oryza sativa (japonica cultivar-group) cDNA clon... 82 3e-12
7dbj|AK060759.1| Oryza sativa (japonica cultivar-group) cDNA clon... 74 7e-10
8gb|BT017575.1| Zea mays clone EL01N0427E12.c mRNA sequence 60 1e-05
9gb|AC113415.3| Homo sapiens chromosome 5 clone RP11-55N10, compl... 44 0.62
10emb|AL935261.1| Lactobacillus plantarum strain WCFS1 complete ge... 44 0.62
11gb|AC126751.2| Homo sapiens chromosome 5 clone CTD-2224K20, comp... 44 0.62
12gb|CP000150.1| Burkholderia sp. 383 chromosome 3, complete sequence 42 2.5
13gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete ... 42 2.5
14gb|AY813557.1| Schistosoma japonicum SJCHGC09409 protein mRNA, c... 42 2.5
15gb|BC097817.1| Xenopus laevis cDNA clone MGC:115537 IMAGE:337740... 42 2.5
16gb|AY508813.1| Japanese encephalitis virus strain JaOH0566/Japan... 40 9.7
17gb|AY508812.1| Japanese encephalitis virus strain ML17 (live vac... 40 9.7
18gb|AC154314.2| Mus musculus BAC clone RP23-347J22 from chromosom... 40 9.7
19gb|AC123616.11| Mus musculus chromosome 8, clone RP23-4F1, compl... 40 9.7
20gb|AY303798.1| Japanese encephalitis virus strain CC27-S8, compl... 40 9.7
21gb|AY303795.1| Japanese encephalitis virus strain CC27-L1, compl... 40 9.7
22gb|AC127551.7| Mus musculus BAC clone RP24-547H23 from chromosom... 40 9.7
23gb|AY585243.1| Japanese encephalitis virus CNU/LP2, complete genome 40 9.7
24gb|AY585242.1| Japanese encephalitis virus strain K87P39, comple... 40 9.7
25gb|AC099710.8| Mus musculus, clone RP23-366C6, complete sequence 40 9.7
26emb|AL021489.1|CEY44A6C Caenorhabditis elegans YAC Y44A6C, compl... 40 9.7
27gb|AY437479.1| Leishmania major MP63 gene, complete cds 40 9.7
28gb|AF486638.1| Japanese encephalitis virus strain YL polyprotein... 40 9.7
29emb|Y16245.1|JEVNS3 Japanese encephalitis virus NS3 gene, indian... 40 9.7
30emb|AL021127.2|MMCMX137 Mus musculus chromosome X contigA; putat... 40 9.7
31gb|AC151836.3| Mus musculus BAC clone RP23-359F5 from chromosome... 40 9.7
32gb|AY303797.1| Japanese encephalitis virus strain CC27-S6, compl... 40 9.7
33gb|AY303796.1| Japanese encephalitis virus strain CC27-L3, compl... 40 9.7
34gb|AY303794.1| Japanese encephalitis virus strain CJN-L1, comple... 40 9.7
35gb|AY303793.1| Japanese encephalitis virus strain CJN-S1, comple... 40 9.7
36gb|AY303792.1| Japanese encephalitis virus strain T1P1-L4, compl... 40 9.7
37gb|AY303791.1| Japanese encephalitis virus strain T1P1-S1, compl... 40 9.7
38dbj|AK124345.1| Homo sapiens cDNA FLJ42354 fis, clone UTERU20083... 40 9.7
39emb|CR618687.1| full-length cDNA clone CS0CAP008YE23 of Thymus o... 40 9.7
40emb|CR611820.1| full-length cDNA clone CS0DN005YJ17 of Adult bra... 40 9.7
41gb|AF254453.1| Japanese encephalitis virus strain T1P1 complete ... 40 9.7
42gb|AF254452.1| Japanese encephalitis virus strain CH1392 complet... 40 9.7
43ref|NR_002802.1| Homo sapiens trophoblast-derived noncoding RNA ... 40 9.7
44gb|AF080251.1|AF080251 Japanese encephalitis virus isolate Vello... 40 9.7
45gb|L78128.1|JEVLINGCG Japanese encephalitis virus strain Ling, c... 40 9.7
46gb|AF416457.1|AF416457 Japanese encephalitis virus attenuated st... 40 9.7
47gb|AF045593.1|AF045593 Drosophila virilis ETS DNA binding protei... 40 9.7
48gb|AC000353.27| Homo sapiens Chromosome 11q13 BAC Clone 18h3, co... 40 9.7
49ref|NM_075598.2| Caenorhabditis elegans Y44A6C.1 (Y44A6C.1) mRNA... 40 9.7
50dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 40 9.7
51gb|AF221500.1|AF221500 Japanese encephalitis virus isolate CH219... 40 9.7
52gb|AF221499.1|AF221499 Japanese encephalitis virus isolate CH219... 40 9.7
53dbj|AB196926.1| Japanese encephalitis virus genomic RNA, complet... 40 9.7
54dbj|AB196925.1| Japanese encephalitis virus genomic RNA, complet... 40 9.7
55dbj|AB196924.1| Japanese encephalitis virus genomic RNA, complet... 40 9.7
56dbj|AB196923.1| Japanese encephalitis virus genomic RNA, complet... 40 9.7
57gb|AF315119.1|AF315119 Japanese encephalitis virus strain SA14-1... 40 9.7
58gb|AC154541.2| Mus musculus BAC clone RP23-458N20 from chromosom... 40 9.7
59dbj|AP003859.2| Oryza sativa (japonica cultivar-group) genomic D... 40 9.7
60emb|BX647603.1|HSM807749 Homo sapiens mRNA; cDNA DKFZp686L01105 ... 40 9.7
61dbj|AK027191.1| Homo sapiens cDNA: FLJ23538 fis, clone LNG08010,... 40 9.7
62gb|AF069076.1|AF069076 Japanese encephalitis virus JaGAr 01 comp... 40 9.7
63gb|AF098737.1|AF098737 Japanese encephalitis virus strain TL, co... 40 9.7
64gb|AF098736.1|AF098736 Japanese encephalitis virus strain TC, co... 40 9.7
65gb|AF098735.1|AF098735 Japanese encephalitis virus strain HVI, c... 40 9.7
66dbj|AP000944.4| Homo sapiens genomic DNA, chromosome 11 clone:RP... 40 9.7
67dbj|D90195.1|JEVSAA Japanese encephalitis virus strain SA(A) gen... 40 9.7
68dbj|D90194.1|JEVSAV Japanese encephalitis virus strain SA(V) gen... 40 9.7
69gb|AC151286.4| Mus musculus BAC clone RP23-368B8 from chromosome... 40 9.7
70gb|AC139294.4| Mus musculus BAC clone RP24-239E14 from 14, compl... 40 9.7
71gb|AF001893.1|BETA2 Human MEN1 region clone epsilon/beta mRNA, 3... 40 9.7
72gb|AF014161.1|AF014161 Japanese encephalitis virus polyprotein g... 40 9.7
73gb|AF014160.1|AF014160 Japanese encephalitis virus polyprotein g... 40 9.7
74gb|M18370.1|JEVCG Japanese encephalitis virus (strain JaOArS982)... 40 9.7
75gb|L48961.1|JEVBEICG Japanese encephalitis virus (strain Beijing... 40 9.7
76gb|AY849939.1| Japanese encephalitis virus strain HW, complete g... 40 9.7
77gb|U15763.1|JEU15763 Japanese encephalitis virus C, prM, M, E, N... 40 9.7
78emb|AL671908.8| Mouse DNA sequence from clone RP23-307G22 on chr... 40 9.7
79gb|M55506.1|JEVCMNAA Japanese encephalitis SA-14 virus, complete... 40 9.7
80gb|U14163.1|JEU14163 Japanese encephalitis virus SA14 polyprotei... 40 9.7
81gb|U09482.1|JEU09482 Japanese encephalitis virus Nakayama nonstr... 40 9.7
82emb|AL671897.6| Mouse DNA sequence from clone RP23-250A14 on chr... 40 9.7
83emb|AL591222.2|HS378I6 Homo sapiens chromosome 9 BAC RP11-378I6,... 40 9.7 
>gb|AY108690.1| Zea mays PCO097961 mRNA sequence
          Length = 612

 Score =  107 bits (54), Expect = 5e-20
 Identities = 93/106 (87%)
 Strand = Plus / Minus

                                                                       
Query: 399 gaagacgagccggccttcctgaaaaccctgccaccaaagaggtccttgccgagcctcccc 458
           |||||||| ||| |||| |||||||||||||| |||||||| ||||| |||| |||  ||
Sbjct: 374 gaagacgacccgaccttgctgaaaaccctgccgccaaagagctccttcccgatcctagcc 315

                                                         
Query: 459 ttgaaggggaactgcttcttgaaacggttccggaacagcgagccgc 504
           ||||||||||||||| ||||||| ||||| ||||||| ||||||||
Sbjct: 314 ttgaaggggaactgcctcttgaagcggttgcggaacaacgagccgc 269



 Score = 42.1 bits (21), Expect = 2.5
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 616 ggttcctgcgggcggatctgagggcgacgtgaagaggctccgagaatga 664
           |||||||||| || |||| |||||| || || ||||| |||||||||||
Sbjct: 157 ggttcctgcgagcagatcggagggcaacatgcagaggttccgagaatga 109
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 107/129 (82%)
 Strand = Plus / Plus

                                                                            
Query: 412      ccttcctgaaaaccctgccaccaaagaggtccttgccgagcctccccttgaaggggaact 471
                ||||| ||||||| || ||||| ||||| || || || | |||||||||||||| |||||
Sbjct: 11876319 ccttcttgaaaactctaccaccgaagagatctttcccaaacctccccttgaaggagaact 11876378

                                                                            
Query: 472      gcttcttgaaacggttccggaacagcgagccgctgcgcgctggcgcgagcgcagactgat 531
                ||||||| |||||||| ||||||| || ||| |||||   || | | || ||||||||||
Sbjct: 11876379 gcttcttaaaacggtttcggaacatcgtgccactgcgtcttgccacaagggcagactgat 11876438

                         
Query: 532      ttctcttca 540
                |||||||||
Sbjct: 11876439 ttctcttca 11876447
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 107/129 (82%)
 Strand = Plus / Plus

                                                                            
Query: 412      ccttcctgaaaaccctgccaccaaagaggtccttgccgagcctccccttgaaggggaact 471
                ||||| ||||||| || ||||| ||||| || || || | |||||||||||||| |||||
Sbjct: 11873082 ccttcttgaaaactctaccaccgaagagatctttcccaaacctccccttgaaggagaact 11873141

                                                                            
Query: 472      gcttcttgaaacggttccggaacagcgagccgctgcgcgctggcgcgagcgcagactgat 531
                ||||||| |||||||| ||||||| || ||| |||||   || | | || ||||||||||
Sbjct: 11873142 gcttcttaaaacggtttcggaacatcgtgccactgcgtcttgccacaagggcagactgat 11873201

                         
Query: 532      ttctcttca 540
                |||||||||
Sbjct: 11873202 ttctcttca 11873210
to top
>gb|AC137070.2| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBa0035J18, from chromsome 3, complete sequence
          Length = 162711

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 107/129 (82%)
 Strand = Plus / Minus

                                                                         
Query: 412   ccttcctgaaaaccctgccaccaaagaggtccttgccgagcctccccttgaaggggaact 471
             ||||| ||||||| || ||||| ||||| || || || | |||||||||||||| |||||
Sbjct: 34334 ccttcttgaaaactctaccaccgaagagatctttcccaaacctccccttgaaggagaact 34275

                                                                         
Query: 472   gcttcttgaaacggttccggaacagcgagccgctgcgcgctggcgcgagcgcagactgat 531
             ||||||| |||||||| ||||||| || ||| |||||   || | | || ||||||||||
Sbjct: 34274 gcttcttaaaacggtttcggaacatcgtgccactgcgtcttgccacaagggcagactgat 34215

                      
Query: 532   ttctcttca 540
             |||||||||
Sbjct: 34214 ttctcttca 34206
to top
>dbj|AK067657.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013115O15, full
            insert sequence
          Length = 3802

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 107/129 (82%)
 Strand = Plus / Minus

                                                                        
Query: 412  ccttcctgaaaaccctgccaccaaagaggtccttgccgagcctccccttgaaggggaact 471
            ||||| ||||||| || ||||| ||||| || || || | |||||||||||||| |||||
Sbjct: 3482 ccttcttgaaaactctaccaccgaagagatctttcccaaacctccccttgaaggagaact 3423

                                                                        
Query: 472  gcttcttgaaacggttccggaacagcgagccgctgcgcgctggcgcgagcgcagactgat 531
            ||||||| |||||||| ||||||| || ||| |||||   || | | || ||||||||||
Sbjct: 3422 gcttcttaaaacggtttcggaacatcgtgccactgcgtcttgccacaagggcagactgat 3363

                     
Query: 532  ttctcttca 540
            |||||||||
Sbjct: 3362 ttctcttca 3354
to top
>dbj|AK066058.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013050C14, full
            insert sequence
          Length = 1988

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 107/129 (82%)
 Strand = Plus / Minus

                                                                        
Query: 412  ccttcctgaaaaccctgccaccaaagaggtccttgccgagcctccccttgaaggggaact 471
            ||||| ||||||| || ||||| ||||| || || || | |||||||||||||| |||||
Sbjct: 1617 ccttcttgaaaactctaccaccgaagagatctttcccaaacctccccttgaaggagaact 1558

                                                                        
Query: 472  gcttcttgaaacggttccggaacagcgagccgctgcgcgctggcgcgagcgcagactgat 531
            ||||||| |||||||| ||||||| || ||| |||||   || | | || ||||||||||
Sbjct: 1557 gcttcttaaaacggtttcggaacatcgtgccactgcgtcttgccacaagggcagactgat 1498

                     
Query: 532  ttctcttca 540
            |||||||||
Sbjct: 1497 ttctcttca 1489
to top
>dbj|AK060759.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-032-H11, full
            insert sequence
          Length = 2909

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 106/129 (82%)
 Strand = Plus / Minus

                                                                        
Query: 412  ccttcctgaaaaccctgccaccaaagaggtccttgccgagcctccccttgaaggggaact 471
            ||||| ||||||| || ||||| ||||| || || || | |||||||||||||| |||||
Sbjct: 2569 ccttcttgaaaactctaccaccgaagagatctttcccaaacctccccttgaaggagaact 2510

                                                                        
Query: 472  gcttcttgaaacggttccggaacagcgagccgctgcgcgctggcgcgagcgcagactgat 531
            ||||||| |||||||| ||||||| || ||| |||||   || | | || ||||||||||
Sbjct: 2509 gcttcttaaaacggtttcggaacatcgtgccactgcgtcttgccacaagggcagactgat 2450

                     
Query: 532  ttctcttca 540
            | |||||||
Sbjct: 2449 tcctcttca 2441
to top
>gb|BT017575.1| Zea mays clone EL01N0427E12.c mRNA sequence
          Length = 899

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 422 aaccctgccaccaaagaggtccttgccgagcctccccttgaaggggaactgcttcttgaa 481
           |||||| || |||||||| ||||| |||| |||| | |||||||||||||| ||||||||
Sbjct: 530 aaccctaccgccaaagagctccttcccgatcctcgctttgaaggggaactgtttcttgaa 471

                         
Query: 482 acggttccggaaca 495
            || || |||||||
Sbjct: 470 gcgattgcggaaca 457
to top
>gb|AC113415.3| Homo sapiens chromosome 5 clone RP11-55N10, complete sequence
          Length = 170798

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 414   ttcctgaaaaccctgccaccaa 435
             ||||||||||||||||||||||
Sbjct: 10299 ttcctgaaaaccctgccaccaa 10320
to top
>emb|AL935261.1| Lactobacillus plantarum strain WCFS1 complete genome; segment 10/11
          Length = 298050

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 609    atgccatggttcctgcgggcgg 630
              ||||||||||||||||||||||
Sbjct: 213688 atgccatggttcctgcgggcgg 213709
to top
>gb|AC126751.2| Homo sapiens chromosome 5 clone CTD-2224K20, complete sequence
          Length = 120658

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 414   ttcctgaaaaccctgccaccaa 435
             ||||||||||||||||||||||
Sbjct: 94411 ttcctgaaaaccctgccaccaa 94432
to top
>gb|CP000150.1| Burkholderia sp. 383 chromosome 3, complete sequence
          Length = 1395069

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 524     agactgatttctcttcagcgc 544
               |||||||||||||||||||||
Sbjct: 1138899 agactgatttctcttcagcgc 1138919
to top
>gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete genome
          Length = 2584158

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 355     ctgctggcggctgacgacggt 375
               |||||||||||||||||||||
Sbjct: 1943404 ctgctggcggctgacgacggt 1943384
to top
>gb|AY813557.1| Schistosoma japonicum SJCHGC09409 protein mRNA, complete cds
          Length = 1385

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 660  aatgatacgcatccttcactg 680
            |||||||||||||||||||||
Sbjct: 1006 aatgatacgcatccttcactg 1026
to top
>gb|BC097817.1| Xenopus laevis cDNA clone MGC:115537 IMAGE:3377408, complete cds
          Length = 892

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 568 cgctgctgctgctaccacccg 588
           |||||||||||||||||||||
Sbjct: 132 cgctgctgctgctaccacccg 112
to top
>gb|AY508813.1| Japanese encephalitis virus strain JaOH0566/Japan/1966/human,
            complete genome
          Length = 10976

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 573  ctgctgctaccacccgcgtc 592
            ||||||||||||||||||||
Sbjct: 5298 ctgctgctaccacccgcgtc 5279
to top
>gb|AY508812.1| Japanese encephalitis virus strain ML17 (live
            vaccine)/Japan/1981/human, complete genome
          Length = 10976

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 573  ctgctgctaccacccgcgtc 592
            ||||||||||||||||||||
Sbjct: 5298 ctgctgctaccacccgcgtc 5279
to top
>gb|AC154314.2| Mus musculus BAC clone RP23-347J22 from chromosome 13, complete sequence
          Length = 189556

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 422    aaccctgccaccaaagaggt 441
              ||||||||||||||||||||
Sbjct: 150653 aaccctgccaccaaagaggt 150672
to top
>gb|AC123616.11| Mus musculus chromosome 8, clone RP23-4F1, complete sequence
          Length = 228851

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 60    acacaccccaaacaaaacaa 79
             ||||||||||||||||||||
Sbjct: 28492 acacaccccaaacaaaacaa 28473
to top
>gb|AY303798.1| Japanese encephalitis virus strain CC27-S8, complete genome
          Length = 10970

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 573  ctgctgctaccacccgcgtc 592
            ||||||||||||||||||||
Sbjct: 5298 ctgctgctaccacccgcgtc 5279
to top
>gb|AY303795.1| Japanese encephalitis virus strain CC27-L1, complete genome
          Length = 10970

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 573  ctgctgctaccacccgcgtc 592
            ||||||||||||||||||||
Sbjct: 5298 ctgctgctaccacccgcgtc 5279
to top
>gb|AC127551.7| Mus musculus BAC clone RP24-547H23 from chromosome 8, complete sequence
          Length = 204342

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 60     acacaccccaaacaaaacaa 79
              ||||||||||||||||||||
Sbjct: 122532 acacaccccaaacaaaacaa 122513
to top
>gb|AY585243.1| Japanese encephalitis virus CNU/LP2, complete genome
          Length = 10968

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 573  ctgctgctaccacccgcgtc 592
            ||||||||||||||||||||
Sbjct: 5298 ctgctgctaccacccgcgtc 5279
to top
>gb|AY585242.1| Japanese encephalitis virus strain K87P39, complete genome
          Length = 10968

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 573  ctgctgctaccacccgcgtc 592
            ||||||||||||||||||||
Sbjct: 5298 ctgctgctaccacccgcgtc 5279
to top
>gb|AC099710.8| Mus musculus, clone RP23-366C6, complete sequence
          Length = 225122

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 60     acacaccccaaacaaaacaa 79
              ||||||||||||||||||||
Sbjct: 176986 acacaccccaaacaaaacaa 176967
to top
>emb|AL021489.1|CEY44A6C Caenorhabditis elegans YAC Y44A6C, complete sequence
          Length = 14347

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 238  catctactacagatttggac 257
            ||||||||||||||||||||
Sbjct: 5344 catctactacagatttggac 5363
to top
>gb|AY437479.1| Leishmania major MP63 gene, complete cds
          Length = 1872

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 494 cagcgagccgctgcgcgctg 513
           ||||||||||||||||||||
Sbjct: 41  cagcgagccgctgcgcgctg 60
to top
>gb|AF486638.1| Japanese encephalitis virus strain YL polyprotein mRNA, complete cds
          Length = 10977

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 573  ctgctgctaccacccgcgtc 592
            ||||||||||||||||||||
Sbjct: 5298 ctgctgctaccacccgcgtc 5279
to top
>emb|Y16245.1|JEVNS3 Japanese encephalitis virus NS3 gene, indian strain P20778
          Length = 1857

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 573 ctgctgctaccacccgcgtc 592
           ||||||||||||||||||||
Sbjct: 691 ctgctgctaccacccgcgtc 672
to top
>emb|AL021127.2|MMCMX137 Mus musculus chromosome X contigA; putative Magea9 gene, Caltractin,
            NAD(P) steroid dehydrogenase and Zinc finger protein 185
          Length = 195025

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 60   acacaccccaaacaaaacaa 79
            ||||||||||||||||||||
Sbjct: 1779 acacaccccaaacaaaacaa 1760
to top
>gb|AC151836.3| Mus musculus BAC clone RP23-359F5 from chromosome 14, complete sequence
          Length = 230502

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 605    cctgatgccatggttcctgc 624
              ||||||||||||||||||||
Sbjct: 139848 cctgatgccatggttcctgc 139829
to top
>gb|AY303797.1| Japanese encephalitis virus strain CC27-S6, complete genome
          Length = 10970

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 573  ctgctgctaccacccgcgtc 592
            ||||||||||||||||||||
Sbjct: 5298 ctgctgctaccacccgcgtc 5279
to top
>gb|AY303796.1| Japanese encephalitis virus strain CC27-L3, complete genome
          Length = 10970

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 573  ctgctgctaccacccgcgtc 592
            ||||||||||||||||||||
Sbjct: 5298 ctgctgctaccacccgcgtc 5279
to top
>gb|AY303794.1| Japanese encephalitis virus strain CJN-L1, complete genome
          Length = 10970

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 573  ctgctgctaccacccgcgtc 592
            ||||||||||||||||||||
Sbjct: 5298 ctgctgctaccacccgcgtc 5279
to top
>gb|AY303793.1| Japanese encephalitis virus strain CJN-S1, complete genome
          Length = 10970

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 573  ctgctgctaccacccgcgtc 592
            ||||||||||||||||||||
Sbjct: 5298 ctgctgctaccacccgcgtc 5279
to top
>gb|AY303792.1| Japanese encephalitis virus strain T1P1-L4, complete genome
          Length = 10970

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 573  ctgctgctaccacccgcgtc 592
            ||||||||||||||||||||
Sbjct: 5298 ctgctgctaccacccgcgtc 5279
to top
>gb|AY303791.1| Japanese encephalitis virus strain T1P1-S1, complete genome
          Length = 10970

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 573  ctgctgctaccacccgcgtc 592
            ||||||||||||||||||||
Sbjct: 5298 ctgctgctaccacccgcgtc 5279
to top
>dbj|AK124345.1| Homo sapiens cDNA FLJ42354 fis, clone UTERU2008347, weakly  similar
            to Chlamydomonas reinhardtii vegetative cell wall protein
            gp1 (GP1) gene
          Length = 2368

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 61   cacaccccaaacaaaacaac 80
            ||||||||||||||||||||
Sbjct: 1740 cacaccccaaacaaaacaac 1721
to top
>emb|CR618687.1| full-length cDNA clone CS0CAP008YE23 of Thymus of Homo sapiens
          (human)
          Length = 1119

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 61 cacaccccaaacaaaacaac 80
          ||||||||||||||||||||
Sbjct: 34 cacaccccaaacaaaacaac 15
to top
>emb|CR611820.1| full-length cDNA clone CS0DN005YJ17 of Adult brain of Homo sapiens
           (human)
          Length = 1656

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 61  cacaccccaaacaaaacaac 80
           ||||||||||||||||||||
Sbjct: 557 cacaccccaaacaaaacaac 538
to top
>gb|AF254453.1| Japanese encephalitis virus strain T1P1 complete genome
          Length = 10970

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 573  ctgctgctaccacccgcgtc 592
            ||||||||||||||||||||
Sbjct: 5298 ctgctgctaccacccgcgtc 5279
to top
>gb|AF254452.1| Japanese encephalitis virus strain CH1392 complete genome
          Length = 10970

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 573  ctgctgctaccacccgcgtc 592
            ||||||||||||||||||||
Sbjct: 5298 ctgctgctaccacccgcgtc 5279
to top
>ref|NR_002802.1| Homo sapiens trophoblast-derived noncoding RNA (TncRNA) on
           chromosome 11
          Length = 14709

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 61  cacaccccaaacaaaacaac 80
           ||||||||||||||||||||
Sbjct: 371 cacaccccaaacaaaacaac 352
to top
>gb|AF080251.1|AF080251 Japanese encephalitis virus isolate Vellore P20778, complete genome
          Length = 10977

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 573  ctgctgctaccacccgcgtc 592
            ||||||||||||||||||||
Sbjct: 5298 ctgctgctaccacccgcgtc 5279
to top
>gb|L78128.1|JEVLINGCG Japanese encephalitis virus strain Ling, complete genome
          Length = 10951

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 573  ctgctgctaccacccgcgtc 592
            ||||||||||||||||||||
Sbjct: 5298 ctgctgctaccacccgcgtc 5279
to top
>gb|AF416457.1|AF416457 Japanese encephalitis virus attenuated strain SA14-12-1-7, complete
            genome
          Length = 10976

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 573  ctgctgctaccacccgcgtc 592
            ||||||||||||||||||||
Sbjct: 5298 ctgctgctaccacccgcgtc 5279
to top
>gb|AF045593.1|AF045593 Drosophila virilis ETS DNA binding protein Yan (yan) gene, complete
            cds
          Length = 4866

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 565  tcgcgctgctgctgctacca 584
            ||||||||||||||||||||
Sbjct: 3665 tcgcgctgctgctgctacca 3646
to top
>gb|AC000353.27| Homo sapiens Chromosome 11q13 BAC Clone 18h3, complete sequence
          Length = 233089

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 61     cacaccccaaacaaaacaac 80
              ||||||||||||||||||||
Sbjct: 213346 cacaccccaaacaaaacaac 213327
to top
>ref|NM_075598.2| Caenorhabditis elegans Y44A6C.1 (Y44A6C.1) mRNA, complete cds
          Length = 1223

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 238 catctactacagatttggac 257
           ||||||||||||||||||||
Sbjct: 77  catctactacagatttggac 96
to top
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
               sequence
          Length = 28434780

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                           
Query: 278     cggcggcgcggcacaatataggggcggc 305
               |||||||||||||||  |||||||||||
Sbjct: 8885312 cggcggcgcggcacaggataggggcggc 8885339
to top
>gb|AF221500.1|AF221500 Japanese encephalitis virus isolate CH2195SA, complete genome
          Length = 10976

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 573  ctgctgctaccacccgcgtc 592
            ||||||||||||||||||||
Sbjct: 5298 ctgctgctaccacccgcgtc 5279
to top
>gb|AF221499.1|AF221499 Japanese encephalitis virus isolate CH2195LA, complete genome
          Length = 10976

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 573  ctgctgctaccacccgcgtc 592
            ||||||||||||||||||||
Sbjct: 5298 ctgctgctaccacccgcgtc 5279
to top
>dbj|AB196926.1| Japanese encephalitis virus genomic RNA, complete genome,
            clone:JEV-AT31
          Length = 10977

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 573  ctgctgctaccacccgcgtc 592
            ||||||||||||||||||||
Sbjct: 5298 ctgctgctaccacccgcgtc 5279
to top
>dbj|AB196925.1| Japanese encephalitis virus genomic RNA, complete genome,
            clone:JEV-rAT
          Length = 10977

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 573  ctgctgctaccacccgcgtc 592
            ||||||||||||||||||||
Sbjct: 5298 ctgctgctaccacccgcgtc 5279
to top
>dbj|AB196924.1| Japanese encephalitis virus genomic RNA, complete genome,
            clone:JEV-at222
          Length = 10977

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 573  ctgctgctaccacccgcgtc 592
            ||||||||||||||||||||
Sbjct: 5298 ctgctgctaccacccgcgtc 5279
to top
>dbj|AB196923.1| Japanese encephalitis virus genomic RNA, complete genome,
            clone:JEV-AT31
          Length = 10977

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 573  ctgctgctaccacccgcgtc 592
            ||||||||||||||||||||
Sbjct: 5298 ctgctgctaccacccgcgtc 5279
to top
>gb|AF315119.1|AF315119 Japanese encephalitis virus strain SA14-14-2, complete genome
          Length = 10976

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 573  ctgctgctaccacccgcgtc 592
            ||||||||||||||||||||
Sbjct: 5298 ctgctgctaccacccgcgtc 5279
to top
>gb|AC154541.2| Mus musculus BAC clone RP23-458N20 from chromosome 13, complete
             sequence
          Length = 174991

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 605   cctgatgccatggttcctgc 624
             ||||||||||||||||||||
Sbjct: 75250 cctgatgccatggttcctgc 75231
to top
>dbj|AP003859.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1033_B09
          Length = 120648

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 278   cggcggcgcggcacaatataggggcggc 305
             |||||||||||||||  |||||||||||
Sbjct: 68955 cggcggcgcggcacaggataggggcggc 68982
to top
>emb|BX647603.1|HSM807749 Homo sapiens mRNA; cDNA DKFZp686L01105 (from clone DKFZp686L01105)
          Length = 2037

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 61  cacaccccaaacaaaacaac 80
           ||||||||||||||||||||
Sbjct: 878 cacaccccaaacaaaacaac 859
to top
>dbj|AK027191.1| Homo sapiens cDNA: FLJ23538 fis, clone LNG08010, highly similar to
           BETA2 Human MEN1 region clone epsilon/beta mRNA
          Length = 1746

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 61  cacaccccaaacaaaacaac 80
           ||||||||||||||||||||
Sbjct: 603 cacaccccaaacaaaacaac 584
to top
>gb|AF069076.1|AF069076 Japanese encephalitis virus JaGAr 01 complete genome
          Length = 10977

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 573  ctgctgctaccacccgcgtc 592
            ||||||||||||||||||||
Sbjct: 5298 ctgctgctaccacccgcgtc 5279
to top
>gb|AF098737.1|AF098737 Japanese encephalitis virus strain TL, complete genome
          Length = 10976

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 573  ctgctgctaccacccgcgtc 592
            ||||||||||||||||||||
Sbjct: 5298 ctgctgctaccacccgcgtc 5279
to top
>gb|AF098736.1|AF098736 Japanese encephalitis virus strain TC, complete genome
          Length = 10976

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 573  ctgctgctaccacccgcgtc 592
            ||||||||||||||||||||
Sbjct: 5298 ctgctgctaccacccgcgtc 5279
to top
>gb|AF098735.1|AF098735 Japanese encephalitis virus strain HVI, complete genome
          Length = 10976

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 573  ctgctgctaccacccgcgtc 592
            ||||||||||||||||||||
Sbjct: 5298 ctgctgctaccacccgcgtc 5279
to top
>dbj|AP000944.4| Homo sapiens genomic DNA, chromosome 11 clone:RP11-867O8, complete
              sequence
          Length = 219246

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 61     cacaccccaaacaaaacaac 80
              ||||||||||||||||||||
Sbjct: 166264 cacaccccaaacaaaacaac 166245
to top
>dbj|D90195.1|JEVSAA Japanese encephalitis virus strain SA(A) genomic RNA, complete genome
          Length = 10976

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 573  ctgctgctaccacccgcgtc 592
            ||||||||||||||||||||
Sbjct: 5298 ctgctgctaccacccgcgtc 5279
to top
>dbj|D90194.1|JEVSAV Japanese encephalitis virus strain SA(V) genomic RNA, complete genome
          Length = 10976

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 573  ctgctgctaccacccgcgtc 592
            ||||||||||||||||||||
Sbjct: 5298 ctgctgctaccacccgcgtc 5279
to top
>gb|AC151286.4| Mus musculus BAC clone RP23-368B8 from chromosome 17, complete sequence
          Length = 178835

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 60     acacaccccaaacaaaacaa 79
              ||||||||||||||||||||
Sbjct: 105322 acacaccccaaacaaaacaa 105303
to top
>gb|AC139294.4| Mus musculus BAC clone RP24-239E14 from 14, complete sequence
          Length = 183363

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 605   cctgatgccatggttcctgc 624
             ||||||||||||||||||||
Sbjct: 22445 cctgatgccatggttcctgc 22426
to top
>gb|AF001893.1|BETA2 Human MEN1 region clone epsilon/beta mRNA, 3' fragment
          Length = 14709

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 61  cacaccccaaacaaaacaac 80
           ||||||||||||||||||||
Sbjct: 371 cacaccccaaacaaaacaac 352
to top
>gb|AF014161.1|AF014161 Japanese encephalitis virus polyprotein gene, complete cds
          Length = 10976

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 573  ctgctgctaccacccgcgtc 592
            ||||||||||||||||||||
Sbjct: 5298 ctgctgctaccacccgcgtc 5279
to top
>gb|AF014160.1|AF014160 Japanese encephalitis virus polyprotein gene, complete cds
          Length = 10976

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 573  ctgctgctaccacccgcgtc 592
            ||||||||||||||||||||
Sbjct: 5298 ctgctgctaccacccgcgtc 5279
to top
>gb|M18370.1|JEVCG Japanese encephalitis virus (strain JaOArS982), complete genome
          Length = 10976

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 573  ctgctgctaccacccgcgtc 592
            ||||||||||||||||||||
Sbjct: 5298 ctgctgctaccacccgcgtc 5279
to top
>gb|L48961.1|JEVBEICG Japanese encephalitis virus (strain Beijing-1), complete genome
          Length = 10976

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 573  ctgctgctaccacccgcgtc 592
            ||||||||||||||||||||
Sbjct: 5298 ctgctgctaccacccgcgtc 5279
to top
>gb|AY849939.1| Japanese encephalitis virus strain HW, complete genome
          Length = 10977

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 573  ctgctgctaccacccgcgtc 592
            ||||||||||||||||||||
Sbjct: 5298 ctgctgctaccacccgcgtc 5279
to top
>gb|U15763.1|JEU15763 Japanese encephalitis virus C, prM, M, E, NS1, NS2A, NS2B, NS3, NS4A,
            NS4B, and NS5 polyprotein mRNA, complete cds
          Length = 10969

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 573  ctgctgctaccacccgcgtc 592
            ||||||||||||||||||||
Sbjct: 5298 ctgctgctaccacccgcgtc 5279
to top
>emb|AL671908.8| Mouse DNA sequence from clone RP23-307G22 on chromosome X, complete
             sequence
          Length = 205224

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 60    acacaccccaaacaaaacaa 79
             ||||||||||||||||||||
Sbjct: 86974 acacaccccaaacaaaacaa 86955
to top
>gb|M55506.1|JEVCMNAA Japanese encephalitis SA-14 virus, complete genome
          Length = 10969

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 573  ctgctgctaccacccgcgtc 592
            ||||||||||||||||||||
Sbjct: 5298 ctgctgctaccacccgcgtc 5279
to top
>gb|U14163.1|JEU14163 Japanese encephalitis virus SA14 polyprotein mRNA, complete cds
          Length = 10976

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 573  ctgctgctaccacccgcgtc 592
            ||||||||||||||||||||
Sbjct: 5298 ctgctgctaccacccgcgtc 5279
to top
>gb|U09482.1|JEU09482 Japanese encephalitis virus Nakayama nonstructural protein NS3
           gene, partial cds
          Length = 339

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 573 ctgctgctaccacccgcgtc 592
           ||||||||||||||||||||
Sbjct: 271 ctgctgctaccacccgcgtc 252
to top
>emb|AL671897.6| Mouse DNA sequence from clone RP23-250A14 on chromosome X, complete
             sequence
          Length = 105208

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 414   ttcctgaaaaccctgccacc 433
             ||||||||||||||||||||
Sbjct: 27751 ttcctgaaaaccctgccacc 27732
to top
>emb|AL591222.2|HS378I6 Homo sapiens chromosome 9 BAC RP11-378I6, complete sequence
          Length = 147211

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 161   tcgaatcaaaacaaacaagc 180
             ||||||||||||||||||||
Sbjct: 46237 tcgaatcaaaacaaacaagc 46256


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 7,129,212
Number of Sequences: 3902068
Number of extensions: 7129212
Number of successful extensions: 116851
Number of sequences better than 10.0: 83
Number of HSP's better than 10.0 without gapping: 83
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 116546
Number of HSP's gapped (non-prelim): 300
length of query: 708
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 685
effective length of database: 17,143,297,704
effective search space: 11743158927240
effective search space used: 11743158927240
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top