Clone Name | rbasd2o13 |
---|---|
Clone Library Name | barley_pub |
>gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds Length = 1044 Score = 392 bits (198), Expect = e-106 Identities = 332/373 (89%), Gaps = 3/373 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| |||||||| |||||||| |||||||||||||||||||||||||| |||||||||| Sbjct: 517 ggctggggttgccgaggtagtcgaggccgccctcgctgaagatctgggagccggccttga 458 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| || ||||| |||||||| |||||||| ||||| |||| ||||||||||||||||| Sbjct: 457 accacacggcctcgccgaacttgacgccgttgcgggcgagcagctcggggaagacgcagc 398 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 ||||||| || ||||||||||| ||||||||||||||||||||||| ||||||||||||| Sbjct: 397 cgagcgcgcccagcatggcccaccggcagtggatcacctccagctcccggttcttggcga 338 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 ||||||||||||| || |||| ||| || ||||||| ||||||||||||| |||||||| Sbjct: 337 aggtctcggggtcggccgacagccccgcggtgtccc-acccgtagtcgccggggaactcg 279 Query: 456 ccggtcaggtagctcgggggctcaccagaaagcgggcccgaggtagagcacacggtcagn 515 ||||| |||||||||||||| || || || |||||| |||||||||||||| ||||| | Sbjct: 278 ccggtgaggtagctcggggggtcgccggagagcggg-ccgaggtagagcacgcggtc-gg 221 Query: 516 agccgtaccacgggctgccggaggcaacctgcttggcctttgccgccgttttgcgcatgg 575 | |||||||||||||||||||| | ||| |||||||||| ||||| || |||||||||| Sbjct: 220 acccgtaccacgggctgccggacgacaccggcttggccttggccgcggtcttgcgcatgg 161 Query: 576 tgacgcgagcctc 588 ||||||| ||||| Sbjct: 160 tgacgcgcgcctc 148 Score = 145 bits (73), Expect = 2e-31 Identities = 100/109 (91%) Strand = Plus / Minus Query: 110 cttacttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcgg 169 ||||||||||||| ||||||||||||||||| ||||| || ||||||||||||||||||| Sbjct: 865 cttacttgccgggcacgaagttggtggcgaaggcccaggcgttgttgttgacggggtcgg 806 Query: 170 cgagatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 ||| ||||| |||||||||||||| || |||||||||||||||||||| Sbjct: 805 agaggtggtcggcgaggttctcgagggggcccttgccggtgacgatggc 757
>gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding protein WCAB precursor (Wcab) mRNA, complete cds Length = 918 Score = 361 bits (182), Expect = 2e-96 Identities = 328/373 (87%), Gaps = 3/373 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| |||||||| |||||||| || || ||||| || ||||||||||| |||||||||| Sbjct: 463 ggctggggttgccgaggtagtcgagaccaccctcactaaagatctgggagccggccttga 404 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 ||||||| ||||| || ||||| |||||||| ||||| |||||||| |||||||| || | Sbjct: 403 accaaacggcctcgccaaacttgacgccgttgcgggcgagcaactcagggaagacacaac 344 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 | || || |||||||||||||| || |||||||||||||||||||| |||||||||| || Sbjct: 343 caagtgccccaagcatggcccagcgacagtggatcacctccagctcccggttcttggaga 284 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 ||||||| |||||||| || | ||||||||||||| |||| |||||||||||||||||| Sbjct: 283 aggtctccgggtcagccgaaagtccagcagtgtccc-acccatagtcgccagggaactca 225 Query: 456 ccggtcaggtagctcgggggctcaccagaaagcgggcccgaggtagagcacacggtcagn 515 ||||||||||||||||| |||||||| || || ||| |||||||||||||||||||||| Sbjct: 224 ccggtcaggtagctcggaggctcaccggagagtggg-ccgaggtagagcacacggtcagc 166 Query: 516 agccgtaccacgggctgccggaggcaacctgcttggcctttgccgccgttttgcgcatgg 575 | |||||||| ||||||||||||| ||||||||| |||||||| || || |||||||||| Sbjct: 165 a-ccgtaccatgggctgccggaggaaacctgctttgcctttgctgcggtcttgcgcatgg 107 Query: 576 tgacgcgagcctc 588 ||||||| ||||| Sbjct: 106 tgacgcgggcctc 94 Score = 161 bits (81), Expect = 4e-36 Identities = 105/113 (92%) Strand = Plus / Minus Query: 110 cttacttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcgg 169 ||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 811 cttacttgccggggacaaagttggtggcgaatgcccatgcattgttgttgacggggtcgg 752 Query: 170 cgagatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttgg 222 ||| ||||||||||||||||| ||||| |||||||| |||||||| |||||| Sbjct: 751 cgatgtggtcagcgaggttctcaagtgggcccttgcccgtgacgatagcttgg 699
>emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein Length = 934 Score = 319 bits (161), Expect = 7e-84 Identities = 325/376 (86%), Gaps = 3/376 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 ||||||||||||| |||||||| ||||| |||||||||||||| || || |||||||||| Sbjct: 472 ggcttgggttgccgaggtagtcgaggccaccctcgctgaagatttgcgagccggccttga 413 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| |||||||| |||||||||||||| || ||||| |||||||| ||||| ||||| | Sbjct: 412 accagacagcctcgccgaacttcacgccattgcgggcaagcaactcagggaacacgcaac 353 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 | || || |||||||| ||||| |||||||| |||||||||| |||||||||||| | || Sbjct: 352 ccagtgcaccaagcatagcccagcggcagtgtatcacctccaactcgcggttcttcgaga 293 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 ||||||||||||||||||| | ||||| ||||||| |||||||||| || ||||| ||| Sbjct: 292 aggtctcggggtcagcagagagtccagccgtgtccc-acccgtagtcaccggggaaatca 234 Query: 456 ccggtcaggtagctcgggggctcaccagaaagcgggcccgaggtagagcacacggtcagn 515 ||||| |||||||| |||||||| | ||| || ||| ||||||||||||||||| |||| Sbjct: 233 ccggtgaggtagcttgggggctcgcgagagagtggg-ccgaggtagagcacacgatcagc 175 Query: 516 agccgtaccacgggctgccggaggcaacctgcttggcctttgccgccgttttgcgcatgg 575 |||||||| ||||||| ||||| ||| ||||| || || ||||| || |||||||||| Sbjct: 174 -tccgtaccatgggctgctggaggaaacttgcttagctttcgccgcggtcttgcgcatgg 116 Query: 576 tgacgcgagcctcacc 591 |||||||||||||||| Sbjct: 115 tgacgcgagcctcacc 100 Score = 121 bits (61), Expect = 3e-24 Identities = 97/109 (88%) Strand = Plus / Minus Query: 110 cttacttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcgg 169 |||| |||||||| |||||||| ||||| |||||||| || ||||||||||||||||||| Sbjct: 820 cttatttgccggggacgaagtttgtggcaaatgcccaagcgttgttgttgacggggtcgg 761 Query: 170 cgagatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 ||| ||||||||||||||||| || || |||||||||||||| ||||| Sbjct: 760 cgatgtggtcagcgaggttctcaagagggcccttgccggtgactatggc 712
>gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein gene, complete cds Length = 1191 Score = 309 bits (156), Expect = 7e-81 Identities = 361/424 (85%), Gaps = 4/424 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| ||||||||||||||||| ||||| || |||||||||||||| || || ||||||| Sbjct: 654 ggctggggttgccaaggtagtcgaggccaccatcgctgaagatctgagagccagccttga 595 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 ||||| | ||||| ||||||||||| || || ||||| ||||||||||| ||||| || | Sbjct: 594 accaaccggcctcgccgaacttcacaccattgcgggcaagcaactcgggaaagacacaac 535 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 | ||||| || ||||||||||| ||||||||||||||||| ||||| ||||||||||||| Sbjct: 534 caagcgcaccgagcatggcccatcggcagtggatcacctcgagctcccggttcttggcga 475 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 ||||||| |||||||| || | ||| || ||||||| |||| ||||| || ||||||||| Sbjct: 474 aggtctcagggtcagccgagagcccggcggtgtccc-acccatagtcaccggggaactca 416 Query: 456 ccggtcaggtagctcgggggctcaccagaaagcgggcccgaggtagagcacacggtcagn 515 || |||| |||||| |||||||| || ||||||||| |||||||||||||||||||||| Sbjct: 415 ccagtcaagtagctggggggctcgccggaaagcggg-ccgaggtagagcacacggtcag- 358 Query: 516 agccgtaccacgggctgccggaggcaacctgcttggcctttgccgccgttttgcgcatgg 575 |||||||||||||||||| || | ||| || |||||||| ||||| || ||||||||| Sbjct: 357 agccgtaccacgggctgctcgacgaaacttgtttggccttcgccgcagtcttgcgcatgt 298 Query: 576 tgacgcgagcctcaccaaaaacagacgatgatgggcaagttcttcactgccttgccggca 635 | || || || ||||||| | || ||| || |||||||||||| || ||||||||||| Sbjct: 297 tcacacgtgcgtcaccaatgagagccgacga-gggcaagttcttgacggccttgccggcg 239 Query: 636 aagg 639 |||| Sbjct: 238 aagg 235 Score = 52.0 bits (26), Expect = 0.003 Identities = 85/102 (83%), Gaps = 2/102 (1%) Strand = Plus / Minus Query: 118 ccgggaacgaagttggtggcgaatgc-ccatgcattgttgttgacggggtcggcgagatg 176 ||||| |||||||||||||| |||| ||| || ||||||||||| |||||||| | || Sbjct: 994 ccgggcacgaagttggtggc-aatgagccacgcgttgttgttgacagggtcggcaatgtg 936 Query: 177 gtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 ||| || |||| ||| | ||| |||||||||||||| ||||| Sbjct: 935 gtcggcaaggtcctccaatgggcccttgccggtgacaatggc 894
>emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding protein Length = 2100 Score = 299 bits (151), Expect = 7e-78 Identities = 236/263 (89%), Gaps = 1/263 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| |||||||| ||||||||||| ||||||||||||||||||||||| |||||||||| Sbjct: 1333 ggctggggttgccgaggtagtccagcccgccctcgctgaagatctgggagccggccttga 1274 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| || ||||| |||||||| |||||||| |||| |||| ||||||||||||||||| Sbjct: 1273 accagacggcctcgccgaacttgacgccgttgcgggagagcagctcggggaagacgcagc 1214 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 ||||||| || ||||||||||| ||| ||||||||||||||||||||||||||||||||| Sbjct: 1213 cgagcgcgccgagcatggcccagcgggagtggatcacctccagctcgcggttcttggcga 1154 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 | ||||||||||| || |||| ||| || ||||||| | ||||||||||| |||||||| Sbjct: 1153 atgtctcggggtcggcggacagcccggcggtgtccc-agccgtagtcgccggggaactcg 1095 Query: 456 ccggtcaggtagctcgggggctc 478 ||||| ||||||||||||||||| Sbjct: 1094 ccggtgaggtagctcgggggctc 1072 Score = 129 bits (65), Expect = 1e-26 Identities = 98/109 (89%) Strand = Plus / Minus Query: 110 cttacttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcgg 169 |||| |||||||| ||||||||||||||| | |||||||| ||||||||||| ||||| | Sbjct: 1681 cttagttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgactgggtcag 1622 Query: 170 cgagatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 ||| |||||||||||||||||||| || |||||||||||||||||||| Sbjct: 1621 cgatgtggtcagcgaggttctcgagcgggcccttgccggtgacgatggc 1573
>emb|AJ635207.1| Triticum durum ssp. durum partial mRNA for putative chlorophyll a/b binding protein (cab gene) Length = 760 Score = 285 bits (144), Expect = 1e-73 Identities = 358/424 (84%), Gaps = 4/424 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| ||||||||||||||||| ||||| ||||||||||| ||||| || || ||| ||| Sbjct: 449 ggctggggttgccaaggtagtcgaggccaccctcgctgaaaatctgagagccagccatga 390 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| || ||||| ||||||||||| || || ||||| ||||||||||| ||||| || | Sbjct: 389 accagacggcctcgccgaacttcacaccattgcgggcaagcaactcgggaaagacacaac 330 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 | ||||| || ||||||||||| ||||||||||||||||| ||||| ||||||||||||| Sbjct: 329 caagcgcaccgagcatggcccatcggcagtggatcacctcgagctcccggttcttggcga 270 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 ||||||| |||||||| || | ||| || ||||||| |||| ||||| || ||||||||| Sbjct: 269 aggtctcagggtcagccgagagcccggcggtgtccc-acccatagtcaccggggaactca 211 Query: 456 ccggtcaggtagctcgggggctcaccagaaagcgggcccgaggtagagcacacggtcagn 515 || |||| |||||| ||||| || || ||||||| | |||||||||||||||||||||| Sbjct: 210 ccagtcaagtagctggggggttcgccggaaagcgag-ccgaggtagagcacacggtcag- 153 Query: 516 agccgtaccacgggctgccggaggcaacctgcttggcctttgccgccgttttgcgcatgg 575 |||||||||||||||||| || | ||| || |||||||| ||||| || ||||||||| Sbjct: 152 agccgtaccacgggctgctcgacgaaacttgtttggccttcgccgcagtcttgcgcatgt 93 Query: 576 tgacgcgagcctcaccaaaaacagacgatgatgggcaagttcttcactgccttgccggca 635 | || || || ||||||| | || ||| || |||||||||||| || ||||||||||| Sbjct: 92 tcacacgtgcgtcaccaatgagagccgacga-gggcaagttcttgacggccttgccggcg 34 Query: 636 aagg 639 |||| Sbjct: 33 aagg 30 Score = 56.0 bits (28), Expect = 2e-04 Identities = 58/68 (85%) Strand = Plus / Minus Query: 151 ttgttgttgacggggtcggcgagatggtcagcgaggttctcgagtggacccttgccggtg 210 ||||||||||| |||||||| | ||||| || |||||||| | ||| |||||||||||| Sbjct: 756 ttgttgttgacagggtcggcaatgtggtcggcaaggttctccaatgggcccttgccggtg 697 Query: 211 acgatggc 218 || ||||| Sbjct: 696 acaatggc 689
>emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll a/b binding protein LHCP Length = 967 Score = 283 bits (143), Expect = 4e-73 Identities = 321/376 (85%), Gaps = 6/376 (1%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| ||||| || ||||||||||| ||||||||||||||||||||||| |||||||||| Sbjct: 515 ggctcgggttcccgaggtagtccagcccgccctcgctgaagatctgggagccggccttga 456 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| || ||||| |||||||| |||||||| ||||| || | ||| ||||||||||| | Sbjct: 455 accacacggcctcgccgaacttgacgccgttgcgggcgagaagctccgggaagacgcaac 396 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 ||||||| || ||||||||||| ||||||||||||||||||||||| ||||||||||||| Sbjct: 395 cgagcgcgcccagcatggcccagcggcagtggatcacctccagctcccggttcttggcga 336 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 | ||||| ||||| || |||| ||| || ||||||| | ||||||||||| |||||||| Sbjct: 335 acgtctccgggtccgccgacagccccgcggtgtccc-agccgtagtcgcccgggaactcg 277 Query: 456 ccggtcaggtagctcgggggctcaccagaaagcgggcccgaggtagagcacacggtcagn 515 || |||||||||||||| ||||| || || || |||||| ||||| ||||| ||||| | Sbjct: 276 cccgtcaggtagctcggcggctcgccggacagtgggccc-aggtacagcacgcggtc-gg 219 Query: 516 agccgtaccacgggctgccggaggcaacc---tgcttggcctttgccgccgttttgcgca 572 ||||||||||||||| ||||| || || |||||||||| |||||||| ||||||| Sbjct: 218 ggccgtaccacgggctcccggacgccgccgctggcttggccttcgccgccgtcttgcgca 159 Query: 573 tggtgacgcgagcctc 588 | || ||||| ||||| Sbjct: 158 tcgtcacgcgggcctc 143 Score = 123 bits (62), Expect = 9e-25 Identities = 95/106 (89%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||||||||| ||||||||||||||| | ||||| || |||||||||||||||||||| | Sbjct: 860 acttgccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcggcaa 801 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 |||||||||||||||||||| || ||||| |||||||||||||| Sbjct: 800 tgtggtcagcgaggttctcgagcgggcccttcccggtgacgatggc 755
>emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chlorophyll a/b binding protein Length = 2261 Score = 276 bits (139), Expect = 1e-70 Identities = 320/376 (85%), Gaps = 6/376 (1%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| ||||| || ||||||||||| || |||||||||||||||||||| |||||||||| Sbjct: 1463 ggctcgggttcccgaggtagtccagtccaccctcgctgaagatctgggagccggccttga 1404 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 ||| ||| ||||| |||||||| |||||||| ||||| |||| ||| ||||||||||| | Sbjct: 1403 acccaacggcctcgccgaacttgacgccgttgcgggcgagcagctccgggaagacgcaac 1344 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 ||||||| || ||||||||||| ||| ||||||||||||||||||| ||||||||||||| Sbjct: 1343 cgagcgcgcccagcatggcccagcgggagtggatcacctccagctcccggttcttggcga 1284 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 | ||||| ||||| || |||| ||| || ||||||| | ||||||||||| |||||||| Sbjct: 1283 acgtctccgggtccgccgacagccccgcggtgtccc-agccgtagtcgcccgggaactcg 1225 Query: 456 ccggtcaggtagctcgggggctcaccagaaagcgggcccgaggtagagcacacggtcagn 515 || |||||||||||||| ||||| || || || |||||| ||||| ||||| ||||| | Sbjct: 1224 cccgtcaggtagctcggcggctcgccggacagtgggccc-aggtacagcacgcggtc-gg 1167 Query: 516 agccgtaccacgggctgccggaggcaacc---tgcttggcctttgccgccgttttgcgca 572 ||||||||||||||| ||||| || || |||||||||| |||||||| ||||||| Sbjct: 1166 ggccgtaccacgggctcccggacgccgccgctggcttggccttcgccgccgtcttgcgca 1107 Query: 573 tggtgacgcgagcctc 588 | || ||||| ||||| Sbjct: 1106 tcgtcacgcgggcctc 1091 Score = 123 bits (62), Expect = 9e-25 Identities = 95/106 (89%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||||||||| ||||||||||||||| | ||||| || |||||||||||||||||||| | Sbjct: 1808 acttgccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcggcaa 1749 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 |||||||||||||||||||| || ||||| |||||||||||||| Sbjct: 1748 tgtggtcagcgaggttctcgagcgggcccttcccggtgacgatggc 1703
>emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlorophyll a/b binding protein Length = 869 Score = 276 bits (139), Expect = 1e-70 Identities = 320/376 (85%), Gaps = 6/376 (1%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| |||||||| ||||||||||| || ||||||||||||||||| || |||||||||| Sbjct: 463 ggctcgggttgccgaggtagtccagcccaccctcgctgaagatctgcgacccggccttga 404 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| || ||||| |||||||| |||||||| ||||| |||| ||| ||||| ||||||| Sbjct: 403 accacacggcctcgccgaacttgacgccgttgcgggcgagcagctccgggaacacgcagc 344 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 | | ||| || ||||||||||| ||| ||||||| ||||||||||| ||||||||||||| Sbjct: 343 ccaacgcgcccagcatggcccagcgggagtggatgacctccagctcccggttcttggcga 284 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 | ||||| ||||| || |||| ||| || ||||||| | ||||||||||| |||||||| Sbjct: 283 acgtctccgggtccgccgacagccccgcggtgtccc-agccgtagtcgcccgggaactcg 225 Query: 456 ccggtcaggtagctcgggggctcaccagaaagcgggcccgaggtagagcacacggtcagn 515 || |||||||||||||||||||| || || || |||||| ||||||||||| ||||| | Sbjct: 224 cccgtcaggtagctcgggggctcgccggacagtgggccc-aggtagagcacgcggtc-gg 167 Query: 516 agccgtaccacgggctgccggag---gcaacctgcttggcctttgccgccgttttgcgca 572 |||||||||||||||||||||| || || |||| ||||| |||||||| ||||||| Sbjct: 166 ggccgtaccacgggctgccggagctcgccgccggctttgccttcgccgccgtcttgcgca 107 Query: 573 tggtgacgcgagcctc 588 | || ||||| ||||| Sbjct: 106 tcgtcacgcgggcctc 91 Score = 131 bits (66), Expect = 4e-27 Identities = 96/106 (90%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||||||||| || ||||||||||| | |||||||| |||||||||||||||||||||| Sbjct: 808 acttgccgggcacaaagttggtggcataggcccatgcgttgttgttgacggggtcggcga 749 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 | ||||| |||||||||||||| || |||||||||||||||||||| Sbjct: 748 ggtggtcggcgaggttctcgagcgggcccttgccggtgacgatggc 703
>ref|NM_191799.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 798 Score = 272 bits (137), Expect = 2e-69 Identities = 274/316 (86%), Gaps = 3/316 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| |||||||| |||||||| || || |||||||||||||||||||| || ||||||| Sbjct: 451 ggctggggttgccgaggtagtcgagccccccctcgctgaagatctgggaccccgccttga 392 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| || ||||| ||||||||||||||||| ||||| || | ||| ||||||||||||| Sbjct: 391 accacacggcctcgccgaacttcacgccgttgcgggcgaggagctccgggaagacgcagc 332 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 ||||||| || ||||||||||| ||||||||||||||||||||||| ||||||||||||| Sbjct: 331 cgagcgcgcccagcatggcccaccggcagtggatcacctccagctcccggttcttggcga 272 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 | ||||| ||||| || |||| ||| || ||||||| | ||||||||||| |||||||| Sbjct: 271 acgtctccgggtcggccgacagcccggcggtgtccc-agccgtagtcgccggggaactcg 213 Query: 456 ccggtcaggtagctcgggggctcaccagaaagcgggcccgaggtagagcacacggtcagn 515 ||||| |||||| ||| ||||| || || |||||| |||||||||||||| ||||| | Sbjct: 212 ccggtgaggtaggacggcggctcgccggagagcggg-ccgaggtagagcacgcggtc-gg 155 Query: 516 agccgtaccacgggct 531 ||||||||||||||| Sbjct: 154 cgccgtaccacgggct 139 Score = 139 bits (70), Expect = 1e-29 Identities = 97/106 (91%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||||||||| ||||||||||||||| | |||||||| |||||||||||||||||||||| Sbjct: 796 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 737 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 | ||||| || |||||||| ||||| |||||||||||||||||||| Sbjct: 736 ggtggtcggccaggttctccagtggccccttgccggtgacgatggc 691
>gb|AY100470.1| Oryza sativa (indica cultivar-group) putative soluble starch synthase IV-1 gene, complete cds Length = 15000 Score = 272 bits (137), Expect = 2e-69 Identities = 274/316 (86%), Gaps = 3/316 (0%) Strand = Plus / Plus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| |||||||| |||||||| || || |||||||||||||||||||| || ||||||| Sbjct: 14223 ggctggggttgccgaggtagtcgagccccccctcgctgaagatctgggaccccgccttga 14282 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| || ||||| ||||||||||||||||| ||||| || | ||| ||||||||||||| Sbjct: 14283 accacacggcctcgccgaacttcacgccgttgcgggcgaggagctccgggaagacgcagc 14342 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 ||||||| || ||||||||||| ||||||||||||||||||||||| ||||||||||||| Sbjct: 14343 cgagcgcgcccagcatggcccaccggcagtggatcacctccagctcccggttcttggcga 14402 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 | ||||| ||||| || |||| ||| || ||||||| | ||||||||||| |||||||| Sbjct: 14403 acgtctccgggtcggccgacagcccggcggtgtccc-agccgtagtcgccggggaactcg 14461 Query: 456 ccggtcaggtagctcgggggctcaccagaaagcgggcccgaggtagagcacacggtcagn 515 ||||| |||||| ||| ||||| || || |||||| |||||||||||||| ||||| | Sbjct: 14462 ccggtgaggtaggacggcggctcgccggagagcggg-ccgaggtagagcacgcggtc-gg 14519 Query: 516 agccgtaccacgggct 531 ||||||||||||||| Sbjct: 14520 cgccgtaccacgggct 14535 Score = 139 bits (70), Expect = 1e-29 Identities = 97/106 (91%) Strand = Plus / Plus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||||||||| ||||||||||||||| | |||||||| |||||||||||||||||||||| Sbjct: 13878 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 13937 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 | ||||| || |||||||| ||||| |||||||||||||||||||| Sbjct: 13938 ggtggtcggccaggttctccagtggccccttgccggtgacgatggc 13983
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 272 bits (137), Expect = 2e-69 Identities = 274/316 (86%), Gaps = 3/316 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| |||||||| |||||||| || || |||||||||||||||||||| || ||||||| Sbjct: 30024788 ggctggggttgccgaggtagtcgagccccccctcgctgaagatctgggaccccgccttga 30024729 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| || ||||| ||||||||||||||||| ||||| || | ||| ||||||||||||| Sbjct: 30024728 accacacggcctcgccgaacttcacgccgttgcgggcgaggagctccgggaagacgcagc 30024669 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 ||||||| || ||||||||||| ||||||||||||||||||||||| ||||||||||||| Sbjct: 30024668 cgagcgcgcccagcatggcccaccggcagtggatcacctccagctcccggttcttggcga 30024609 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 | ||||| ||||| || |||| ||| || ||||||| | ||||||||||| |||||||| Sbjct: 30024608 acgtctccgggtcggccgacagcccggcggtgtccc-agccgtagtcgccggggaactcg 30024550 Query: 456 ccggtcaggtagctcgggggctcaccagaaagcgggcccgaggtagagcacacggtcagn 515 ||||| |||||| ||| ||||| || || |||||| |||||||||||||| ||||| | Sbjct: 30024549 ccggtgaggtaggacggcggctcgccggagagcggg-ccgaggtagagcacgcggtc-gg 30024492 Query: 516 agccgtaccacgggct 531 ||||||||||||||| Sbjct: 30024491 cgccgtaccacgggct 30024476 Score = 254 bits (128), Expect = 4e-64 Identities = 307/363 (84%), Gaps = 3/363 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| |||||||| |||||||| || |||||||||||||||||||| || || ||||||| Sbjct: 23603982 ggctcgggttgccgaggtagtcgagcccgccctcgctgaagatctgcgaccccgccttga 23603923 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| || ||||| |||||||| |||||||| ||||| || | ||| ||||| ||||||| Sbjct: 23603922 accacaccgcctcgccgaacttgacgccgttgcgggcgaggagctccgggaacacgcagc 23603863 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 | ||||| || ||||| ||||| | | ||||||||||||||||||| ||||||||||||| Sbjct: 23603862 ccagcgcgccgagcatcgcccacctggagtggatcacctccagctcccggttcttggcga 23603803 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 | ||||| ||||| || || | ||| || ||||||| ||||||||||||| |||||||| Sbjct: 23603802 acgtctccgggtcggcggagagccccgcggtgtccc-acccgtagtcgccggggaactcg 23603744 Query: 456 ccggtcaggtagctcgggggctcaccagaaagcgggcccgaggtagagcacacggtcagn 515 ||||||||||||||||| ||||| || || |||||| |||||||||||||| ||||| | Sbjct: 23603743 ccggtcaggtagctcggcggctcgccggagagcggg-ccgaggtagagcacgcggtc-gg 23603686 Query: 516 agccgtaccacgggctgccggaggcaacctgcttggcctttgccgccgttttgcgcatgg 575 ||||||||||||||| || || || | |||||| ||| ||||||| |||||||||| Sbjct: 23603685 cgccgtaccacgggctccccgacgcggcgggcttgggcttcgccgccgacttgcgcatgg 23603626 Query: 576 tga 578 ||| Sbjct: 23603625 tga 23603623 Score = 139 bits (70), Expect = 1e-29 Identities = 97/106 (91%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||||||||| ||||||||||||||| | |||||||| |||||||||||||||||||||| Sbjct: 30025133 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 30025074 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 | ||||| || |||||||| ||||| |||||||||||||||||||| Sbjct: 30025073 ggtggtcggccaggttctccagtggccccttgccggtgacgatggc 30025028 Score = 139 bits (70), Expect = 1e-29 Identities = 97/106 (91%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||||||||| ||||||||||||||| | ||||| || |||||||||||||||||||||| Sbjct: 23604327 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 23604268 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 | ||||| |||||||||||||| || |||||||||||||||||||| Sbjct: 23604267 ggtggtcggcgaggttctcgagggggcccttgccggtgacgatggc 23604222
>dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0690B02 Length = 153116 Score = 272 bits (137), Expect = 2e-69 Identities = 274/316 (86%), Gaps = 3/316 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| |||||||| |||||||| || || |||||||||||||||||||| || ||||||| Sbjct: 20778 ggctggggttgccgaggtagtcgagccccccctcgctgaagatctgggaccccgccttga 20719 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| || ||||| ||||||||||||||||| ||||| || | ||| ||||||||||||| Sbjct: 20718 accacacggcctcgccgaacttcacgccgttgcgggcgaggagctccgggaagacgcagc 20659 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 ||||||| || ||||||||||| ||||||||||||||||||||||| ||||||||||||| Sbjct: 20658 cgagcgcgcccagcatggcccaccggcagtggatcacctccagctcccggttcttggcga 20599 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 | ||||| ||||| || |||| ||| || ||||||| | ||||||||||| |||||||| Sbjct: 20598 acgtctccgggtcggccgacagcccggcggtgtccc-agccgtagtcgccggggaactcg 20540 Query: 456 ccggtcaggtagctcgggggctcaccagaaagcgggcccgaggtagagcacacggtcagn 515 ||||| |||||| ||| ||||| || || |||||| |||||||||||||| ||||| | Sbjct: 20539 ccggtgaggtaggacggcggctcgccggagagcggg-ccgaggtagagcacgcggtc-gg 20482 Query: 516 agccgtaccacgggct 531 ||||||||||||||| Sbjct: 20481 cgccgtaccacgggct 20466 Score = 139 bits (70), Expect = 1e-29 Identities = 97/106 (91%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||||||||| ||||||||||||||| | |||||||| |||||||||||||||||||||| Sbjct: 21123 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 21064 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 | ||||| || |||||||| ||||| |||||||||||||||||||| Sbjct: 21063 ggtggtcggccaggttctccagtggccccttgccggtgacgatggc 21018
>dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C12, full insert sequence Length = 1055 Score = 272 bits (137), Expect = 2e-69 Identities = 274/316 (86%), Gaps = 3/316 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| |||||||| |||||||| || || |||||||||||||||||||| || ||||||| Sbjct: 532 ggctggggttgccgaggtagtcgagccccccctcgctgaagatctgggaccccgccttga 473 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| || ||||| ||||||||||||||||| ||||| || | ||| ||||||||||||| Sbjct: 472 accacacggcctcgccgaacttcacgccgttgcgggcgaggagctccgggaagacgcagc 413 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 ||||||| || ||||||||||| ||||||||||||||||||||||| ||||||||||||| Sbjct: 412 cgagcgcgcccagcatggcccaccggcagtggatcacctccagctcccggttcttggcga 353 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 | ||||| ||||| || |||| ||| || ||||||| | ||||||||||| |||||||| Sbjct: 352 acgtctccgggtcggccgacagcccggcggtgtccc-agccgtagtcgccggggaactcg 294 Query: 456 ccggtcaggtagctcgggggctcaccagaaagcgggcccgaggtagagcacacggtcagn 515 ||||| |||||| ||| ||||| || || |||||| |||||||||||||| ||||| | Sbjct: 293 ccggtgaggtaggacggcggctcgccggagagcggg-ccgaggtagagcacgcggtc-gg 236 Query: 516 agccgtaccacgggct 531 ||||||||||||||| Sbjct: 235 cgccgtaccacgggct 220 Score = 139 bits (70), Expect = 1e-29 Identities = 97/106 (91%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||||||||| ||||||||||||||| | |||||||| |||||||||||||||||||||| Sbjct: 877 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 818 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 | ||||| || |||||||| ||||| |||||||||||||||||||| Sbjct: 817 ggtggtcggccaggttctccagtggccccttgccggtgacgatggc 772
>dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B02, full insert sequence Length = 1055 Score = 272 bits (137), Expect = 2e-69 Identities = 274/316 (86%), Gaps = 3/316 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| |||||||| |||||||| || || |||||||||||||||||||| || ||||||| Sbjct: 532 ggctggggttgccgaggtagtcgagccccccctcgctgaagatctgggaccccgccttga 473 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| || ||||| ||||||||||||||||| ||||| || | ||| ||||||||||||| Sbjct: 472 accacacggcctcgccgaacttcacgccgttgcgggcgaggagctccgggaagacgcagc 413 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 ||||||| || ||||||||||| ||||||||||||||||||||||| ||||||||||||| Sbjct: 412 cgagcgcgcccagcatggcccaccggcagtggatcacctccagctcccggttcttggcga 353 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 | ||||| ||||| || |||| ||| || ||||||| | ||||||||||| |||||||| Sbjct: 352 acgtctccgggtcggccgacagcccggcggtgtccc-agccgtagtcgccggggaactcg 294 Query: 456 ccggtcaggtagctcgggggctcaccagaaagcgggcccgaggtagagcacacggtcagn 515 ||||| |||||| ||| ||||| || || |||||| |||||||||||||| ||||| | Sbjct: 293 ccggtgaggtaggacggcggctcgccggagagcggg-ccgaggtagagcacgcggtc-gg 236 Query: 516 agccgtaccacgggct 531 ||||||||||||||| Sbjct: 235 cgccgtaccacgggct 220 Score = 139 bits (70), Expect = 1e-29 Identities = 97/106 (91%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||||||||| ||||||||||||||| | |||||||| |||||||||||||||||||||| Sbjct: 877 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 818 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 | ||||| || |||||||| ||||| |||||||||||||||||||| Sbjct: 817 ggtggtcggccaggttctccagtggccccttgccggtgacgatggc 772
>dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-D08, full insert sequence Length = 1057 Score = 272 bits (137), Expect = 2e-69 Identities = 274/316 (86%), Gaps = 3/316 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| |||||||| |||||||| || || |||||||||||||||||||| || ||||||| Sbjct: 534 ggctggggttgccgaggtagtcgagccccccctcgctgaagatctgggaccccgccttga 475 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| || ||||| ||||||||||||||||| ||||| || | ||| ||||||||||||| Sbjct: 474 accacacggcctcgccgaacttcacgccgttgcgggcgaggagctccgggaagacgcagc 415 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 ||||||| || ||||||||||| ||||||||||||||||||||||| ||||||||||||| Sbjct: 414 cgagcgcgcccagcatggcccaccggcagtggatcacctccagctcccggttcttggcga 355 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 | ||||| ||||| || |||| ||| || ||||||| | ||||||||||| |||||||| Sbjct: 354 acgtctccgggtcggccgacagcccggcggtgtccc-agccgtagtcgccggggaactcg 296 Query: 456 ccggtcaggtagctcgggggctcaccagaaagcgggcccgaggtagagcacacggtcagn 515 ||||| |||||| ||| ||||| || || |||||| |||||||||||||| ||||| | Sbjct: 295 ccggtgaggtaggacggcggctcgccggagagcggg-ccgaggtagagcacgcggtc-gg 238 Query: 516 agccgtaccacgggct 531 ||||||||||||||| Sbjct: 237 cgccgtaccacgggct 222 Score = 139 bits (70), Expect = 1e-29 Identities = 97/106 (91%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||||||||| ||||||||||||||| | |||||||| |||||||||||||||||||||| Sbjct: 879 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 820 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 | ||||| || |||||||| ||||| |||||||||||||||||||| Sbjct: 819 ggtggtcggccaggttctccagtggccccttgccggtgacgatggc 774
>dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-E06, full insert sequence Length = 1057 Score = 272 bits (137), Expect = 2e-69 Identities = 274/316 (86%), Gaps = 3/316 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| |||||||| |||||||| || || |||||||||||||||||||| || ||||||| Sbjct: 534 ggctggggttgccgaggtagtcgagccccccctcgctgaagatctgggaccccgccttga 475 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| || ||||| ||||||||||||||||| ||||| || | ||| ||||||||||||| Sbjct: 474 accacacggcctcgccgaacttcacgccgttgcgggcgaggagctccgggaagacgcagc 415 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 ||||||| || ||||||||||| ||||||||||||||||||||||| ||||||||||||| Sbjct: 414 cgagcgcgcccagcatggcccaccggcagtggatcacctccagctcccggttcttggcga 355 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 | ||||| ||||| || |||| ||| || ||||||| | ||||||||||| |||||||| Sbjct: 354 acgtctccgggtcggccgacagcccggcggtgtccc-agccgtagtcgccggggaactcg 296 Query: 456 ccggtcaggtagctcgggggctcaccagaaagcgggcccgaggtagagcacacggtcagn 515 ||||| |||||| ||| ||||| || || |||||| |||||||||||||| ||||| | Sbjct: 295 ccggtgaggtaggacggcggctcgccggagagcggg-ccgaggtagagcacgcggtc-gg 238 Query: 516 agccgtaccacgggct 531 ||||||||||||||| Sbjct: 237 cgccgtaccacgggct 222 Score = 139 bits (70), Expect = 1e-29 Identities = 97/106 (91%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||||||||| ||||||||||||||| | |||||||| |||||||||||||||||||||| Sbjct: 879 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 820 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 | ||||| || |||||||| ||||| |||||||||||||||||||| Sbjct: 819 ggtggtcggccaggttctccagtggccccttgccggtgacgatggc 774
>gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protein (kcdl895) mRNA, complete cds Length = 1022 Score = 264 bits (133), Expect = 4e-67 Identities = 273/316 (86%), Gaps = 3/316 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| |||||||| |||||||| || || |||||||||||||||||||| || ||||||| Sbjct: 493 ggctggggttgccgaggtagtcgagccccccctcgctgaagatctgggaccccgccttga 434 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| || ||||| ||||||||||||||||| ||||| || | ||| ||||||||||||| Sbjct: 433 accacacggcctcgccgaacttcacgccgttgcgggcgaggagctccgggaagacgcagc 374 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 ||||||| || ||||||||||| ||||||||||||||||||||||| ||||||||||||| Sbjct: 373 cgagcgcgcccagcatggcccaccggcagtggatcacctccagctcccggttcttggcga 314 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 | ||||| ||||| || |||| ||| || ||||||| | ||||||||||| | |||||| Sbjct: 313 acgtctccgggtcggccgacagcccggcggtgtccc-agccgtagtcgccggagaactcg 255 Query: 456 ccggtcaggtagctcgggggctcaccagaaagcgggcccgaggtagagcacacggtcagn 515 ||||| |||||| ||| ||||| || || |||||| |||||||||||||| ||||| | Sbjct: 254 ccggtgaggtaggacggcggctcgccggagagcggg-ccgaggtagagcacgcggtc-gg 197 Query: 516 agccgtaccacgggct 531 ||||||||||||||| Sbjct: 196 cgccgtaccacgggct 181 Score = 123 bits (62), Expect = 9e-25 Identities = 95/106 (89%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||||||||| || |||||||||||| | |||||||| |||||||||||||||||||||| Sbjct: 838 acttgccggggacaaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 779 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 | ||||| | || |||||| ||||| |||||||||||||||||||| Sbjct: 778 ggtggtctgtgatgttctccagtggccccttgccggtgacgatggc 733
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 256 bits (129), Expect = 9e-65 Identities = 272/316 (86%), Gaps = 3/316 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| |||||||| |||||||| || |||||||||||||||||||| || || ||||||| Sbjct: 10793435 ggctcgggttgccgaggtagtcgagcccgccctcgctgaagatctgcgagcccgccttga 10793376 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| || ||||| |||||||| |||||||| ||||| || | ||| ||||||||||||| Sbjct: 10793375 accacacggcctcgccgaacttgacgccgttccgggcgaggagctccgggaagacgcagc 10793316 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 ||||||| || ||||| ||||| ||| ||||||||||||||||||| ||||||||||||| Sbjct: 10793315 cgagcgcgcccagcatcgcccaccgggagtggatcacctccagctcccggttcttggcga 10793256 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 | ||||| ||||| || || | ||| || ||||||| ||||||||||||| |||||||| Sbjct: 10793255 acgtctccgggtcggcggagagccccgcggtgtccc-acccgtagtcgcccgggaactcg 10793197 Query: 456 ccggtcaggtagctcgggggctcaccagaaagcgggcccgaggtagagcacacggtcagn 515 ||||| ||||||||||| ||||| || || |||||| ||||||||||| || ||||| | Sbjct: 10793196 ccggtgaggtagctcggcggctcgccggagagcggg-ccgaggtagaggacgcggtc-gg 10793139 Query: 516 agccgtaccacgggct 531 ||||||||||||||| Sbjct: 10793138 cgccgtaccacgggct 10793123 Score = 139 bits (70), Expect = 1e-29 Identities = 97/106 (91%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||||||||| ||||||||||||||| | ||||| || |||||||||||||||||||||| Sbjct: 10793780 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 10793721 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 | ||||| |||||||||||||| || |||||||||||||||||||| Sbjct: 10793720 ggtggtcggcgaggttctcgagggggcccttgccggtgacgatggc 10793675
>dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0512H04 Length = 151049 Score = 256 bits (129), Expect = 9e-65 Identities = 272/316 (86%), Gaps = 3/316 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| |||||||| |||||||| || |||||||||||||||||||| || || ||||||| Sbjct: 17158 ggctcgggttgccgaggtagtcgagcccgccctcgctgaagatctgcgagcccgccttga 17099 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| || ||||| |||||||| |||||||| ||||| || | ||| ||||||||||||| Sbjct: 17098 accacacggcctcgccgaacttgacgccgttccgggcgaggagctccgggaagacgcagc 17039 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 ||||||| || ||||| ||||| ||| ||||||||||||||||||| ||||||||||||| Sbjct: 17038 cgagcgcgcccagcatcgcccaccgggagtggatcacctccagctcccggttcttggcga 16979 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 | ||||| ||||| || || | ||| || ||||||| ||||||||||||| |||||||| Sbjct: 16978 acgtctccgggtcggcggagagccccgcggtgtccc-acccgtagtcgcccgggaactcg 16920 Query: 456 ccggtcaggtagctcgggggctcaccagaaagcgggcccgaggtagagcacacggtcagn 515 ||||| ||||||||||| ||||| || || |||||| ||||||||||| || ||||| | Sbjct: 16919 ccggtgaggtagctcggcggctcgccggagagcggg-ccgaggtagaggacgcggtc-gg 16862 Query: 516 agccgtaccacgggct 531 ||||||||||||||| Sbjct: 16861 cgccgtaccacgggct 16846 Score = 139 bits (70), Expect = 1e-29 Identities = 97/106 (91%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||||||||| ||||||||||||||| | ||||| || |||||||||||||||||||||| Sbjct: 17503 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 17444 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 | ||||| |||||||||||||| || |||||||||||||||||||| Sbjct: 17443 ggtggtcggcgaggttctcgagggggcccttgccggtgacgatggc 17398
>dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJNBb0085I16 Length = 141701 Score = 256 bits (129), Expect = 9e-65 Identities = 272/316 (86%), Gaps = 3/316 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| |||||||| |||||||| || |||||||||||||||||||| || || ||||||| Sbjct: 130053 ggctcgggttgccgaggtagtcgagcccgccctcgctgaagatctgcgagcccgccttga 129994 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| || ||||| |||||||| |||||||| ||||| || | ||| ||||||||||||| Sbjct: 129993 accacacggcctcgccgaacttgacgccgttccgggcgaggagctccgggaagacgcagc 129934 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 ||||||| || ||||| ||||| ||| ||||||||||||||||||| ||||||||||||| Sbjct: 129933 cgagcgcgcccagcatcgcccaccgggagtggatcacctccagctcccggttcttggcga 129874 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 | ||||| ||||| || || | ||| || ||||||| ||||||||||||| |||||||| Sbjct: 129873 acgtctccgggtcggcggagagccccgcggtgtccc-acccgtagtcgcccgggaactcg 129815 Query: 456 ccggtcaggtagctcgggggctcaccagaaagcgggcccgaggtagagcacacggtcagn 515 ||||| ||||||||||| ||||| || || |||||| ||||||||||| || ||||| | Sbjct: 129814 ccggtgaggtagctcggcggctcgccggagagcggg-ccgaggtagaggacgcggtc-gg 129757 Query: 516 agccgtaccacgggct 531 ||||||||||||||| Sbjct: 129756 cgccgtaccacgggct 129741 Score = 139 bits (70), Expect = 1e-29 Identities = 97/106 (91%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||||||||| ||||||||||||||| | ||||| || |||||||||||||||||||||| Sbjct: 130398 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 130339 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 | ||||| |||||||||||||| || |||||||||||||||||||| Sbjct: 130338 ggtggtcggcgaggttctcgagggggcccttgccggtgacgatggc 130293
>dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-G02, full insert sequence Length = 1013 Score = 256 bits (129), Expect = 9e-65 Identities = 272/316 (86%), Gaps = 3/316 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| |||||||| |||||||| || |||||||||||||||||||| || || ||||||| Sbjct: 503 ggctcgggttgccgaggtagtcgagcccgccctcgctgaagatctgcgagcccgccttga 444 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| || ||||| |||||||| |||||||| ||||| || | ||| ||||||||||||| Sbjct: 443 accacacggcctcgccgaacttgacgccgttccgggcgaggagctccgggaagacgcagc 384 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 ||||||| || ||||| ||||| ||| ||||||||||||||||||| ||||||||||||| Sbjct: 383 cgagcgcgcccagcatcgcccaccgggagtggatcacctccagctcccggttcttggcga 324 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 | ||||| ||||| || || | ||| || ||||||| ||||||||||||| |||||||| Sbjct: 323 acgtctccgggtcggcggagagccccgcggtgtccc-acccgtagtcgcccgggaactcg 265 Query: 456 ccggtcaggtagctcgggggctcaccagaaagcgggcccgaggtagagcacacggtcagn 515 ||||| ||||||||||| ||||| || || |||||| ||||||||||| || ||||| | Sbjct: 264 ccggtgaggtagctcggcggctcgccggagagcggg-ccgaggtagaggacgcggtc-gg 207 Query: 516 agccgtaccacgggct 531 ||||||||||||||| Sbjct: 206 cgccgtaccacgggct 191 Score = 139 bits (70), Expect = 1e-29 Identities = 97/106 (91%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||||||||| ||||||||||||||| | ||||| || |||||||||||||||||||||| Sbjct: 848 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 789 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 | ||||| |||||||||||||| || |||||||||||||||||||| Sbjct: 788 ggtggtcggcgaggttctcgagggggcccttgccggtgacgatggc 743
>dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-E05, full insert sequence Length = 1021 Score = 256 bits (129), Expect = 9e-65 Identities = 272/316 (86%), Gaps = 3/316 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| |||||||| |||||||| || |||||||||||||||||||| || || ||||||| Sbjct: 508 ggctcgggttgccgaggtagtcgagcccgccctcgctgaagatctgcgagcccgccttga 449 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| || ||||| |||||||| |||||||| ||||| || | ||| ||||||||||||| Sbjct: 448 accacacggcctcgccgaacttgacgccgttccgggcgaggagctccgggaagacgcagc 389 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 ||||||| || ||||| ||||| ||| ||||||||||||||||||| ||||||||||||| Sbjct: 388 cgagcgcgcccagcatcgcccaccgggagtggatcacctccagctcccggttcttggcga 329 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 | ||||| ||||| || || | ||| || ||||||| ||||||||||||| |||||||| Sbjct: 328 acgtctccgggtcggcggagagccccgcggtgtccc-acccgtagtcgcccgggaactcg 270 Query: 456 ccggtcaggtagctcgggggctcaccagaaagcgggcccgaggtagagcacacggtcagn 515 ||||| ||||||||||| ||||| || || |||||| ||||||||||| || ||||| | Sbjct: 269 ccggtgaggtagctcggcggctcgccggagagcggg-ccgaggtagaggacgcggtc-gg 212 Query: 516 agccgtaccacgggct 531 ||||||||||||||| Sbjct: 211 cgccgtaccacgggct 196 Score = 139 bits (70), Expect = 1e-29 Identities = 97/106 (91%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||||||||| ||||||||||||||| | ||||| || |||||||||||||||||||||| Sbjct: 853 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 794 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 | ||||| |||||||||||||| || |||||||||||||||||||| Sbjct: 793 ggtggtcggcgaggttctcgagggggcccttgccggtgacgatggc 748
>dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-006-D01, full insert sequence Length = 1056 Score = 256 bits (129), Expect = 9e-65 Identities = 272/316 (86%), Gaps = 3/316 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| |||||||| |||||||| || |||||||||||||||||||| || || ||||||| Sbjct: 510 ggctcgggttgccgaggtagtcgagcccgccctcgctgaagatctgcgagcccgccttga 451 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| || ||||| |||||||| |||||||| ||||| || | ||| ||||||||||||| Sbjct: 450 accacacggcctcgccgaacttgacgccgttccgggcgaggagctccgggaagacgcagc 391 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 ||||||| || ||||| ||||| ||| ||||||||||||||||||| ||||||||||||| Sbjct: 390 cgagcgcgcccagcatcgcccaccgggagtggatcacctccagctcccggttcttggcga 331 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 | ||||| ||||| || || | ||| || ||||||| ||||||||||||| |||||||| Sbjct: 330 acgtctccgggtcggcggagagccccgcggtgtccc-acccgtagtcgcccgggaactcg 272 Query: 456 ccggtcaggtagctcgggggctcaccagaaagcgggcccgaggtagagcacacggtcagn 515 ||||| ||||||||||| ||||| || || |||||| ||||||||||| || ||||| | Sbjct: 271 ccggtgaggtagctcggcggctcgccggagagcggg-ccgaggtagaggacgcggtc-gg 214 Query: 516 agccgtaccacgggct 531 ||||||||||||||| Sbjct: 213 cgccgtaccacgggct 198 Score = 139 bits (70), Expect = 1e-29 Identities = 97/106 (91%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||||||||| ||||||||||||||| | ||||| || |||||||||||||||||||||| Sbjct: 855 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 796 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 | ||||| |||||||||||||| || |||||||||||||||||||| Sbjct: 795 ggtggtcggcgaggttctcgagggggcccttgccggtgacgatggc 750
>dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-E08, full insert sequence Length = 1235 Score = 256 bits (129), Expect = 9e-65 Identities = 272/316 (86%), Gaps = 3/316 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| |||||||| |||||||| || |||||||||||||||||||| || || ||||||| Sbjct: 508 ggctcgggttgccgaggtagtcgagcccgccctcgctgaagatctgcgagcccgccttga 449 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| || ||||| |||||||| |||||||| ||||| || | ||| ||||||||||||| Sbjct: 448 accacacggcctcgccgaacttgacgccgttccgggcgaggagctccgggaagacgcagc 389 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 ||||||| || ||||| ||||| ||| ||||||||||||||||||| ||||||||||||| Sbjct: 388 cgagcgcgcccagcatcgcccaccgggagtggatcacctccagctcccggttcttggcga 329 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 | ||||| ||||| || || | ||| || ||||||| ||||||||||||| |||||||| Sbjct: 328 acgtctccgggtcggcggagagccccgcggtgtccc-acccgtagtcgcccgggaactcg 270 Query: 456 ccggtcaggtagctcgggggctcaccagaaagcgggcccgaggtagagcacacggtcagn 515 ||||| ||||||||||| ||||| || || |||||| ||||||||||| || ||||| | Sbjct: 269 ccggtgaggtagctcggcggctcgccggagagcggg-ccgaggtagaggacgcggtc-gg 212 Query: 516 agccgtaccacgggct 531 ||||||||||||||| Sbjct: 211 cgccgtaccacgggct 196 Score = 139 bits (70), Expect = 1e-29 Identities = 97/106 (91%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||||||||| ||||||||||||||| | ||||| || |||||||||||||||||||||| Sbjct: 853 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 794 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 | ||||| |||||||||||||| || |||||||||||||||||||| Sbjct: 793 ggtggtcggcgaggttctcgagggggcccttgccggtgacgatggc 748
>ref|NM_192636.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 789 Score = 254 bits (128), Expect = 4e-64 Identities = 307/363 (84%), Gaps = 3/363 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| |||||||| |||||||| || |||||||||||||||||||| || || ||||||| Sbjct: 439 ggctcgggttgccgaggtagtcgagcccgccctcgctgaagatctgcgaccccgccttga 380 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| || ||||| |||||||| |||||||| ||||| || | ||| ||||| ||||||| Sbjct: 379 accacaccgcctcgccgaacttgacgccgttgcgggcgaggagctccgggaacacgcagc 320 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 | ||||| || ||||| ||||| | | ||||||||||||||||||| ||||||||||||| Sbjct: 319 ccagcgcgccgagcatcgcccacctggagtggatcacctccagctcccggttcttggcga 260 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 | ||||| ||||| || || | ||| || ||||||| ||||||||||||| |||||||| Sbjct: 259 acgtctccgggtcggcggagagccccgcggtgtccc-acccgtagtcgccggggaactcg 201 Query: 456 ccggtcaggtagctcgggggctcaccagaaagcgggcccgaggtagagcacacggtcagn 515 ||||||||||||||||| ||||| || || |||||| |||||||||||||| ||||| | Sbjct: 200 ccggtcaggtagctcggcggctcgccggagagcggg-ccgaggtagagcacgcggtc-gg 143 Query: 516 agccgtaccacgggctgccggaggcaacctgcttggcctttgccgccgttttgcgcatgg 575 ||||||||||||||| || || || | |||||| ||| ||||||| |||||||||| Sbjct: 142 cgccgtaccacgggctccccgacgcggcgggcttgggcttcgccgccgacttgcgcatgg 83 Query: 576 tga 578 ||| Sbjct: 82 tga 80 Score = 139 bits (70), Expect = 1e-29 Identities = 97/106 (91%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||||||||| ||||||||||||||| | ||||| || |||||||||||||||||||||| Sbjct: 784 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 725 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 | ||||| |||||||||||||| || |||||||||||||||||||| Sbjct: 724 ggtggtcggcgaggttctcgagggggcccttgccggtgacgatggc 679
>dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0518F01 Length = 154541 Score = 254 bits (128), Expect = 4e-64 Identities = 307/363 (84%), Gaps = 3/363 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| |||||||| |||||||| || |||||||||||||||||||| || || ||||||| Sbjct: 66681 ggctcgggttgccgaggtagtcgagcccgccctcgctgaagatctgcgaccccgccttga 66622 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| || ||||| |||||||| |||||||| ||||| || | ||| ||||| ||||||| Sbjct: 66621 accacaccgcctcgccgaacttgacgccgttgcgggcgaggagctccgggaacacgcagc 66562 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 | ||||| || ||||| ||||| | | ||||||||||||||||||| ||||||||||||| Sbjct: 66561 ccagcgcgccgagcatcgcccacctggagtggatcacctccagctcccggttcttggcga 66502 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 | ||||| ||||| || || | ||| || ||||||| ||||||||||||| |||||||| Sbjct: 66501 acgtctccgggtcggcggagagccccgcggtgtccc-acccgtagtcgccggggaactcg 66443 Query: 456 ccggtcaggtagctcgggggctcaccagaaagcgggcccgaggtagagcacacggtcagn 515 ||||||||||||||||| ||||| || || |||||| |||||||||||||| ||||| | Sbjct: 66442 ccggtcaggtagctcggcggctcgccggagagcggg-ccgaggtagagcacgcggtc-gg 66385 Query: 516 agccgtaccacgggctgccggaggcaacctgcttggcctttgccgccgttttgcgcatgg 575 ||||||||||||||| || || || | |||||| ||| ||||||| |||||||||| Sbjct: 66384 cgccgtaccacgggctccccgacgcggcgggcttgggcttcgccgccgacttgcgcatgg 66325 Query: 576 tga 578 ||| Sbjct: 66324 tga 66322 Score = 139 bits (70), Expect = 1e-29 Identities = 97/106 (91%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||||||||| ||||||||||||||| | ||||| || |||||||||||||||||||||| Sbjct: 67026 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 66967 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 | ||||| |||||||||||||| || |||||||||||||||||||| Sbjct: 66966 ggtggtcggcgaggttctcgagggggcccttgccggtgacgatggc 66921
>dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033034J10, full insert sequence Length = 1180 Score = 254 bits (128), Expect = 4e-64 Identities = 307/363 (84%), Gaps = 3/363 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| |||||||| |||||||| || |||||||||||||||||||| || || ||||||| Sbjct: 510 ggctcgggttgccgaggtagtcgagcccgccctcgctgaagatctgcgaccccgccttga 451 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| || ||||| |||||||| |||||||| ||||| || | ||| ||||| ||||||| Sbjct: 450 accacaccgcctcgccgaacttgacgccgttgcgggcgaggagctccgggaacacgcagc 391 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 | ||||| || ||||| ||||| | | ||||||||||||||||||| ||||||||||||| Sbjct: 390 ccagcgcgccgagcatcgcccacctggagtggatcacctccagctcccggttcttggcga 331 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 | ||||| ||||| || || | ||| || ||||||| ||||||||||||| |||||||| Sbjct: 330 acgtctccgggtcggcggagagccccgcggtgtccc-acccgtagtcgccggggaactcg 272 Query: 456 ccggtcaggtagctcgggggctcaccagaaagcgggcccgaggtagagcacacggtcagn 515 ||||||||||||||||| ||||| || || |||||| |||||||||||||| ||||| | Sbjct: 271 ccggtcaggtagctcggcggctcgccggagagcggg-ccgaggtagagcacgcggtc-gg 214 Query: 516 agccgtaccacgggctgccggaggcaacctgcttggcctttgccgccgttttgcgcatgg 575 ||||||||||||||| || || || | |||||| ||| ||||||| |||||||||| Sbjct: 213 cgccgtaccacgggctccccgacgcggcgggcttgggcttcgccgccgacttgcgcatgg 154 Query: 576 tga 578 ||| Sbjct: 153 tga 151 Score = 139 bits (70), Expect = 1e-29 Identities = 97/106 (91%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||||||||| ||||||||||||||| | ||||| || |||||||||||||||||||||| Sbjct: 855 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 796 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 | ||||| |||||||||||||| || |||||||||||||||||||| Sbjct: 795 ggtggtcggcgaggttctcgagggggcccttgccggtgacgatggc 750
>dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-B06, full insert sequence Length = 1126 Score = 254 bits (128), Expect = 4e-64 Identities = 307/363 (84%), Gaps = 3/363 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| |||||||| |||||||| || |||||||||||||||||||| || || ||||||| Sbjct: 509 ggctcgggttgccgaggtagtcgagcccgccctcgctgaagatctgcgaccccgccttga 450 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| || ||||| |||||||| |||||||| ||||| || | ||| ||||| ||||||| Sbjct: 449 accacaccgcctcgccgaacttgacgccgttgcgggcgaggagctccgggaacacgcagc 390 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 | ||||| || ||||| ||||| | | ||||||||||||||||||| ||||||||||||| Sbjct: 389 ccagcgcgccgagcatcgcccacctggagtggatcacctccagctcccggttcttggcga 330 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 | ||||| ||||| || || | ||| || ||||||| ||||||||||||| |||||||| Sbjct: 329 acgtctccgggtcggcggagagccccgcggtgtccc-acccgtagtcgccggggaactcg 271 Query: 456 ccggtcaggtagctcgggggctcaccagaaagcgggcccgaggtagagcacacggtcagn 515 ||||||||||||||||| ||||| || || |||||| |||||||||||||| ||||| | Sbjct: 270 ccggtcaggtagctcggcggctcgccggagagcggg-ccgaggtagagcacgcggtc-gg 213 Query: 516 agccgtaccacgggctgccggaggcaacctgcttggcctttgccgccgttttgcgcatgg 575 ||||||||||||||| || || || | |||||| ||| ||||||| |||||||||| Sbjct: 212 cgccgtaccacgggctccccgacgcggcgggcttgggcttcgccgccgacttgcgcatgg 153 Query: 576 tga 578 ||| Sbjct: 152 tga 150 Score = 139 bits (70), Expect = 1e-29 Identities = 97/106 (91%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||||||||| ||||||||||||||| | ||||| || |||||||||||||||||||||| Sbjct: 854 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 795 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 | ||||| |||||||||||||| || |||||||||||||||||||| Sbjct: 794 ggtggtcggcgaggttctcgagggggcccttgccggtgacgatggc 749
>gb|AY389606.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein 40 mRNA, complete cds Length = 859 Score = 252 bits (127), Expect = 1e-63 Identities = 221/251 (88%), Gaps = 1/251 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| |||||||| |||||||||| |||||||||||||||||||||| ||||||||||| Sbjct: 508 ggctggggttgcccaggtagtccaatccgccctcgctgaagatctgggctccggccttga 449 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| || ||||| ||||||||||||||||| ||||| || | ||||||||||||||||| Sbjct: 448 accagaccgcctcgccgaacttcacgccgttgcgggcgaggagctcggggaagacgcagc 389 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 |||| || || ||||||||||| ||||||||||||||||| ||||| |||||||||| || Sbjct: 388 cgagagcacccagcatggcccaccggcagtggatcacctcgagctcccggttcttggaga 329 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 ||||||||||||| || || | ||| || ||||||| ||||||||||||| ||||| || Sbjct: 328 aggtctcggggtcggcggagagcccggcggtgtccc-acccgtagtcgccggggaattcg 270 Query: 456 ccggtcaggta 466 ||||| ||||| Sbjct: 269 ccggtgaggta 259
>dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H02, full insert sequence Length = 1045 Score = 248 bits (125), Expect = 2e-62 Identities = 271/316 (85%), Gaps = 3/316 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| |||||||| |||||||| || |||||||||||||||||||| || || ||||||| Sbjct: 508 ggctcgggttgccgaggtagtcgagcccgccctcgctgaagatctgcgagcccgccttga 449 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| || ||||| |||||||| |||||||| ||||| || | ||| ||||||||||||| Sbjct: 448 accacacggcctcgccgaacttgacgccgttccgggcgaggagctccgggaagacgcagc 389 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 ||||||| || ||||| ||||| ||| ||||||||||||||||||| ||||||||||||| Sbjct: 388 cgagcgcgcccagcatcgcccaccgggagtggatcacctccagctcccggttcttggcga 329 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 ||||| ||||| || || | ||| || ||||||| ||||||||||||| |||||||| Sbjct: 328 gcgtctccgggtcggcggagagccccgcggtgtccc-acccgtagtcgcccgggaactcg 270 Query: 456 ccggtcaggtagctcgggggctcaccagaaagcgggcccgaggtagagcacacggtcagn 515 ||||| ||||||||||| ||||| || || |||||| ||||||||||| || ||||| | Sbjct: 269 ccggtgaggtagctcggcggctcgccggagagcggg-ccgaggtagaggacgcggtc-gg 212 Query: 516 agccgtaccacgggct 531 ||||||||||||||| Sbjct: 211 cgccgtaccacgggct 196 Score = 139 bits (70), Expect = 1e-29 Identities = 97/106 (91%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||||||||| ||||||||||||||| | ||||| || |||||||||||||||||||||| Sbjct: 853 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 794 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 | ||||| |||||||||||||| || |||||||||||||||||||| Sbjct: 793 ggtggtcggcgaggttctcgagggggcccttgccggtgacgatggc 748
>dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRNA for type I light-harvesting chlorophyll a/b binding protein of photosystem II (LHCPII), complete cds Length = 1022 Score = 248 bits (125), Expect = 2e-62 Identities = 271/316 (85%), Gaps = 3/316 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| |||||||| |||||||| || |||||||||||||||||||| || || ||||||| Sbjct: 489 ggctcgggttgccgaggtagtcgagcccgccctcgctgaagatctgcgagcccgccttga 430 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| || ||||| |||||||| |||||||| ||||| || | ||| ||||||||||||| Sbjct: 429 accacacggcctcgccgaacttgacgccgttccgggcgaggagctccgggaagacgcagc 370 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 ||||||| || ||||| ||||| ||| ||||||||| ||||||||| ||||||||||||| Sbjct: 369 cgagcgcgcccagcatcgcccatcgggagtggatcagctccagctcccggttcttggcga 310 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 | ||||| ||||| || || | ||| || ||||||| ||||||||||||| |||||||| Sbjct: 309 acgtctccgggtcggcggagagccccgcggtgtccc-acccgtagtcgcccgggaactcg 251 Query: 456 ccggtcaggtagctcgggggctcaccagaaagcgggcccgaggtagagcacacggtcagn 515 ||||| ||||||||||| ||||| || || |||||| ||||||||||| || ||||| | Sbjct: 250 ccggtgaggtagctcggcggctcgccggagagcggg-ccgaggtagaggacgcggtc-gg 193 Query: 516 agccgtaccacgggct 531 ||||||||||||||| Sbjct: 192 cgccgtaccacgggct 177 Score = 139 bits (70), Expect = 1e-29 Identities = 97/106 (91%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||||||||| ||||||||||||||| | ||||| || |||||||||||||||||||||| Sbjct: 834 acttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 775 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 | ||||| |||||||||||||| || |||||||||||||||||||| Sbjct: 774 ggtggtcggcgaggttctcgagggggcccttgccggtgacgatggc 729
>gb|AY389573.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein 40 (LHCP) mRNA, partial cds Length = 712 Score = 236 bits (119), Expect = 8e-59 Identities = 219/251 (87%), Gaps = 1/251 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| ||||| || ||||||||||| |||||||||||||||||||| ||||||||||||| Sbjct: 412 ggctagggtttcccaggtagtccagcccgccctcgctgaagatctgagatccggccttga 353 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| || ||||| ||||||||||| ||||| ||||| || | ||||||||||||||||| Sbjct: 352 accataccgcctcgccgaacttcacaccgttgcgggcaaggagctcggggaagacgcagc 293 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 |||| || || ||||| ||||| ||||||||||||||||| ||||| ||||||||||| | Sbjct: 292 cgagagcacccagcattgcccaccggcagtggatcacctcgagctcccggttcttggcaa 233 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 | ||||||||||| || || | ||| || ||||||| | ||||||||||| ||||||||| Sbjct: 232 atgtctcggggtccgcggagagcccggcggtgtccc-agccgtagtcgccggggaactca 174 Query: 456 ccggtcaggta 466 ||||| ||||| Sbjct: 173 ccggtgaggta 163
>gb|AY389553.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein (CAB) mRNA, partial cds Length = 720 Score = 236 bits (119), Expect = 8e-59 Identities = 219/251 (87%), Gaps = 1/251 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| |||||||| |||||||||| |||||||||||||||||||||| |||||||||| Sbjct: 492 ggctagggttgcccaggtagtccaatccgccctcgctgaagatctgggcgccggccttga 433 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| || ||||| ||||||||||||||||| ||||| || | ||||||||||||||||| Sbjct: 432 accagaccgcctcgccgaacttcacgccgttgcgggcgaggagctcggggaagacgcagc 373 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 |||| || || ||||| ||||| | ||||||||||||||| ||||| ||||||||||||| Sbjct: 372 cgagagcgcccagcattgcccacctgcagtggatcacctcgagctcccggttcttggcga 313 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 | ||||||||||| || || | ||| || ||||||| | ||||||||||| ||||||||| Sbjct: 312 atgtctcggggtccgctgagagcccggcggtgtccc-agccgtagtcgccggggaactca 254 Query: 456 ccggtcaggta 466 ||||| ||||| Sbjct: 253 ccggtgaggta 243 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 517 gccgtaccacgggctgccgga 537 ||||||||||||||||||||| Sbjct: 194 gccgtaccacgggctgccgga 174
>gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein 3C (LHCP) mRNA, partial cds Length = 661 Score = 236 bits (119), Expect = 8e-59 Identities = 219/251 (87%), Gaps = 1/251 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| |||||||| |||||||||| |||||||||||||||||||||| |||||||||| Sbjct: 327 ggctagggttgcccaggtagtccaatccgccctcgctgaagatctgggcgccggccttga 268 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| || ||||| ||||||||||||||||| ||||| || | ||||||||||||||||| Sbjct: 267 accagaccgcctcgccgaacttcacgccgttgcgggcgaggagctcggggaagacgcagc 208 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 |||| || || ||||| ||||| | ||||||||||||||| ||||| ||||||||||||| Sbjct: 207 cgagagcgcccagcattgcccacctgcagtggatcacctcgagctcccggttcttggcga 148 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 | ||||||||||| || || | ||| || ||||||| | ||||||||||| ||||||||| Sbjct: 147 atgtctcggggtccgctgagagcccggcggtgtccc-agccgtagtcgccggggaactca 89 Query: 456 ccggtcaggta 466 ||||| ||||| Sbjct: 88 ccggtgaggta 78 Score = 71.9 bits (36), Expect = 3e-09 Identities = 78/92 (84%) Strand = Plus / Minus Query: 124 acgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcgagatggtcagcg 183 |||||||||||||| || ||||| ||||||||||||||||| ||||| || || || || Sbjct: 661 acgaagttggtggcaaacgcccaggcattgttgttgacgggatcggcaaggtgatcggcc 602 Query: 184 aggttctcgagtggacccttgccggtgacgat 215 | |||||| ||||| |||||||| || ||||| Sbjct: 601 aagttctccagtggccccttgcccgtcacgat 570 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 517 gccgtaccacgggctgccgga 537 ||||||||||||||||||||| Sbjct: 29 gccgtaccacgggctgccgga 9
>emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chlorophyll a/b-binding protein Length = 1664 Score = 236 bits (119), Expect = 8e-59 Identities = 228/263 (86%), Gaps = 1/263 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| |||||||| |||||||| || |||||||||||||||||||| || || ||||||| Sbjct: 900 ggctcgggttgccgaggtagtcgagcccgccctcgctgaagatctgcgagcccgccttga 841 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| || ||||| |||||||| |||||||| ||||| || | ||| ||||||||||||| Sbjct: 840 accacacggcctcgccgaacttgacgccgttccgggcgaggagctccgggaagacgcagc 781 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 ||||||| || ||||| ||||| ||| ||||||||||||||||||| ||||||||||||| Sbjct: 780 cgagcgcgcccagcatcgcccaccgggagtggatcacctccagctcccggttcttggcga 721 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 | ||||| ||||| || || | ||| || ||||||| ||||||||||||| |||||||| Sbjct: 720 acgtctccgggtcggcggagagccccgcggtgtccc-acccgtagtcgccggggaactcg 662 Query: 456 ccggtcaggtagctcgggggctc 478 ||||| ||||||||||| ||||| Sbjct: 661 ccggtgaggtagctcggcggctc 639 Score = 139 bits (70), Expect = 1e-29 Identities = 97/106 (91%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||||||||| ||||||||||||||| | ||||| || |||||||||||||||||||||| Sbjct: 1245 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 1186 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 | ||||| |||||||||||||| || |||||||||||||||||||| Sbjct: 1185 ggtggtcggcgaggttctcgagggggcccttgccggtgacgatggc 1140
>dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue1, partial cds Length = 695 Score = 236 bits (119), Expect = 8e-59 Identities = 219/251 (87%), Gaps = 1/251 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| ||||| || |||||||| || ||||||||||||||||||||||| |||||||||| Sbjct: 362 ggctggggttcccgaggtagtcgagcccgccctcgctgaagatctgggagccggccttga 303 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| || ||||| |||||||| |||||||| ||||| |||| ||||||||||||||||| Sbjct: 302 accagacggcctcgccgaacttgacgccgttgcgggcgagcagctcggggaagacgcagc 243 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 ||||||| || ||||||||||| | |||||||||||||||||||||||||||||||| Sbjct: 242 cgagcgcgccgagcatggcccacctcgcgtggatcacctccagctcgcggttcttggcga 183 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 ||||||||||||| || || | ||| || ||||||| | ||||||||||| | |||||| Sbjct: 182 aggtctcggggtcggcggagagcccggcggtgtccc-agccgtagtcgccggcgaactcg 124 Query: 456 ccggtcaggta 466 ||||| ||||| Sbjct: 123 ccggtgaggta 113 Score = 99.6 bits (50), Expect = 1e-17 Identities = 83/94 (88%) Strand = Plus / Minus Query: 125 cgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcgagatggtcagcga 184 |||||||||||||||| ||||| || ||||||||||||||||| ||||| ||||| || | Sbjct: 695 cgaagttggtggcgaaggcccaggcgttgttgttgacggggtcagcgaggtggtcggcca 636 Query: 185 ggttctcgagtggacccttgccggtgacgatggc 218 ||||||||| || ||||||||||| |||||||| Sbjct: 635 agttctcgaggggtcccttgccggtcacgatggc 602 Score = 40.1 bits (20), Expect = 9.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 517 gccgtaccacgggctgccggaggc 540 ||||||||| |||||||||||||| Sbjct: 64 gccgtaccaggggctgccggaggc 41
>emb|AJ843976.1| Plantago major partial mRNA for light harvesting protein 1 (lhc1 gene) Length = 688 Score = 232 bits (117), Expect = 1e-57 Identities = 229/265 (86%), Gaps = 1/265 (0%) Strand = Plus / Minus Query: 217 gcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaa 276 ||||||||| || | |||||||| || |||||||| |||||||| ||||| |||||||| Sbjct: 342 gcttgggtttcccaagtagtccaaaccaccctcgctaaagatctgtgatccagccttgaa 283 Query: 277 ccaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagcc 336 |||||||||||| |||||||| || ||||| ||||||| | ||||||||| ||||| || Sbjct: 282 ccaaacagcctcgccgaacttgacaccgttacgggccaagagctcggggaatacgcatcc 223 Query: 337 gagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaa 396 ||| ||||||||||||||||| | ||||||||||||| ||||| |||||||||||||| Sbjct: 222 gagtgctccaagcatggcccatcttgagtggatcacctcaagctcacggttcttggcgaa 163 Query: 397 ggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcac 456 |||||| |||||||| || | ||||||||||||| | |||||||| || |||||||||| Sbjct: 162 ggtctctgggtcagctgagagtccagcagtgtccc-agccgtagtcaccggggaactcac 104 Query: 457 cggtcaggtagctcgggggctcacc 481 |||||| ||||||||||| |||||| Sbjct: 103 cggtcaagtagctcggggactcacc 79 Score = 61.9 bits (31), Expect = 3e-06 Identities = 83/99 (83%), Gaps = 1/99 (1%) Strand = Plus / Minus Query: 118 ccgggaacgaagttggtggcgaatg-cccatgcattgttgttgacggggtcggcgagatg 176 |||||||||||||| ||||| || | |||| || |||||||| |||||||| || || || Sbjct: 684 ccgggaacgaagtttgtggcaaaaggcccaagcgttgttgttaacggggtctgctaggtg 625 Query: 177 gtcagcgaggttctcgagtggacccttgccggtgacgat 215 |||||| |||||||| | || ||||| ||||||||||| Sbjct: 624 gtcagcaaggttctccaacgggccctttccggtgacgat 586
>gb|AY109324.1| Zea mays CL187_1 mRNA sequence Length = 2262 Score = 226 bits (114), Expect = 8e-56 Identities = 274/323 (84%), Gaps = 6/323 (1%) Strand = Plus / Minus Query: 269 gccttgaaccaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaag 328 |||||||||| ||| ||||| |||||||| |||||||| ||||| |||| ||| |||||| Sbjct: 1410 gccttgaacccaacggcctcgccgaacttgacgccgttgcgggcgagcagctccgggaag 1351 Query: 329 acgcagccgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttc 388 |||||||||||||| || ||||||||||| ||| ||||||||||||||||||| |||||| Sbjct: 1350 acgcagccgagcgcgcccagcatggcccagcgggagtggatcacctccagctcccggttc 1291 Query: 389 ttggcgaaggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagg 448 |||||||| ||||| ||||| || |||| ||| || ||||||| | ||||||||||| || Sbjct: 1290 ttggcgaacgtctccgggtccgccgacagccccgcggtgtccc-agccgtagtcgcccgg 1232 Query: 449 gaactcaccggtcaggtagctcgggggctcaccagaaagcgggcccgaggtagagcacac 508 |||||| || |||||||||||||| ||||| || || || |||||| ||||| ||||| | Sbjct: 1231 gaactcgcccgtcaggtagctcggcggctcgccggacagtgggccc-aggtacagcacgc 1173 Query: 509 ggtcagnagccgtaccacgggctgccggaggcaacc---tgcttggcctttgccgccgtt 565 |||| | ||||||||||||||| ||||| || || |||||||||| |||||||| Sbjct: 1172 ggtc-ggggccgtaccacgggctcccggacgccgccgctggcttggccttcgccgccgtc 1114 Query: 566 ttgcgcatggtgacgcgagcctc 588 |||||||| || ||||| ||||| Sbjct: 1113 ttgcgcatcgtcacgcgggcctc 1091 Score = 123 bits (62), Expect = 9e-25 Identities = 95/106 (89%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||||||||| ||||||||||||||| | ||||| || |||||||||||||||||||| | Sbjct: 1808 acttgccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcggcaa 1749 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 |||||||||||||||||||| || ||||| |||||||||||||| Sbjct: 1748 tgtggtcagcgaggttctcgagcgggcccttcccggtgacgatggc 1703
>emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll a/b binding protein Length = 1361 Score = 224 bits (113), Expect = 3e-55 Identities = 231/269 (85%), Gaps = 1/269 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 ||||||||||||| | |||||| || || |||||||||||||||||||| |||||||||| Sbjct: 695 ggcttgggttgcccaagtagtcgagcccaccctcgctgaagatctgggacccggccttga 636 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| || || || ||||||||||| ||||| |||| ||||||||| ||||||||||||| Sbjct: 635 accacacggcttctccgaacttcaccccgttgcgggacagcaactccgggaagacgcagc 576 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 | | ||||| ||||||||||| | | |||||||||| || || || ||||||||||||| Sbjct: 575 ccaaggctccgagcatggcccacctggagtggatcacttcgagttcacggttcttggcga 516 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 |||| || ||||| || || | |||||||||||||| | ||||||||||| ||||||||| Sbjct: 515 aggtttctgggtctgcggaaagcccagcagtgtccc-agccgtagtcgcctgggaactca 457 Query: 456 ccggtcaggtagctcgggggctcaccaga 484 ||||| |||||| ||||||||| ||||| Sbjct: 456 ccggttaggtaggacgggggctcgccaga 428 Score = 60.0 bits (30), Expect = 1e-05 Identities = 87/106 (82%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| ||||| |||||||||||||| | ||||| || ||||||||||| || | || | Sbjct: 1040 actttccggggacgaagttggtggcataggcccaggcgttgttgttgacaggtccagcaa 981 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 | || || ||||||||||| | ||||||||| |||||||| ||||| Sbjct: 980 ggtgatcggcgaggttctccaatggaccctttccggtgacaatggc 935
>emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chlorophyll a/b-binding protein Length = 1442 Score = 218 bits (110), Expect = 2e-53 Identities = 270/319 (84%), Gaps = 6/319 (1%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| |||||||| |||||||| || |||||||||||||||||||| || || ||||||| Sbjct: 939 ggctcgggttgccgaggtagtcgagcccgccctcgctgaagatctgcgaccccgccttga 880 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| || ||||| |||||||| |||||||| ||||| || | ||| ||||| ||||||| Sbjct: 879 accacaccgcctccccgaacttgacgccgttgcgggcgaggagctccgggaacacgcagc 820 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 | ||| | || ||||| ||||| | | ||||||||||||||||||| ||||||||||||| Sbjct: 819 ccagcccgccgagcatcgcccacctggagtggatcacctccagctcccggttcttggcga 760 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 | ||||| ||||| || || | ||| || ||||||| ||||||||||||| |||||||| Sbjct: 759 acgtctccgggtcggcggagagccccgcggtgtccc-acccgtagtcgccggggaactcg 701 Query: 456 ccggtcaggtagctcgggggctc---accagaaagcgggcccgaggtagagcacacggtc 512 ||||||||||||||||| ||||| || || |||||| |||||||||||||| ||||| Sbjct: 700 ccggtcaggtagctcggcggctcgcggccggagagcggg-ccgaggtagagcacgcggtc 642 Query: 513 agnagccgtaccacgggct 531 | ||||||||||||||| Sbjct: 641 -ggcgccgtaccacgggct 624 Score = 139 bits (70), Expect = 1e-29 Identities = 97/106 (91%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||||||||| ||||||||||||||| | ||||| || |||||||||||||||||||||| Sbjct: 1284 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 1225 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 | ||||| |||||||||||||| || |||||||||||||||||||| Sbjct: 1224 ggtggtcggcgaggttctcgagggggcccttgccggtgacgatggc 1179
>gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b protein gene, complete cds Length = 1633 Score = 214 bits (108), Expect = 3e-52 Identities = 217/252 (86%), Gaps = 1/252 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| |||||||| ||||||||||| || ||||||||||||||||| || || ||||||| Sbjct: 848 ggctggggttgcccaggtagtccagccccccctcgctgaagatctgcgaacccgccttga 789 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| || ||||| || |||||||||||||| || ||||||| ||| ||||| ||||||| Sbjct: 788 accacacggcctcgccaaacttcacgccgttgcgcgccagcagctccgggaacacgcagc 729 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 | ||||| || ||||||||||| || |||||||||||||||||| ||||||||||||| Sbjct: 728 ccagcgcgccgagcatggcccaccgcgcgtggatcacctccagctcccggttcttggcga 669 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 ||||||||||||| || || | ||| || ||||||| | ||||||||||| | |||||| Sbjct: 668 aggtctcggggtcggccgagagcccggcggtgtccc-agccgtagtcgccggcgaactcg 610 Query: 456 ccggtcaggtag 467 |||||||||||| Sbjct: 609 ccggtcaggtag 598 Score = 131 bits (66), Expect = 4e-27 Identities = 96/106 (90%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||||||||| ||||||||||||||||| ||||| || |||||||||||||||||||||| Sbjct: 1193 acttgccggggacgaagttggtggcgaaggcccaggcgttgttgttgacggggtcggcga 1134 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 ||||||| || | ||||||||| || ||||| |||||||||||||| Sbjct: 1133 gatggtccgccaagttctcgagggggcccttcccggtgacgatggc 1088
>emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b binding protein precursor Length = 2780 Score = 212 bits (107), Expect = 1e-51 Identities = 201/231 (87%), Gaps = 1/231 (0%) Strand = Plus / Minus Query: 242 ccgccctcgctgaagatctgggatccggccttgaaccaaacagcctcaccgaacttcacg 301 ||||||||||||||||||||||| || ||||||||||| || |||| |||||||| ||| Sbjct: 2348 ccgccctcgctgaagatctgggagcccgccttgaaccacaccccctcgccgaacttgacg 2289 Query: 302 ccgtttcgggccagcaactcggggaagacgcagccgagcgctccaagcatggcccaacgg 361 ||||| ||||| |||| ||| ||||| ||||| |||||| || | |||||||| ||| Sbjct: 2288 ccgttgcgggcgagcagctccgggaacacgcacccgagccctaccgcgatggcccagcgg 2229 Query: 362 cagtggatcacctccagctcgcggttcttggcgaaggtctcggggtcagcagacaaccca 421 ||||||||||||||||||||||||||||||||||||||||| ||||| || |||| ||| Sbjct: 2228 cagtggatcacctccagctcgcggttcttggcgaaggtctccgggtccgccgacagcccc 2169 Query: 422 gcagtgtcccaacccgtagtcgccagggaactcaccggtcaggtagctcgg 472 | ||||||| ||||||||||||| |||||||| ||||||||||||||||| Sbjct: 2168 tcggtgtccc-acccgtagtcgccggggaactcgccggtcaggtagctcgg 2119 Score = 117 bits (59), Expect = 5e-23 Identities = 92/103 (89%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||||||||| ||||||||||||||| | ||||| || ||||||||||||||||||| || Sbjct: 2719 acttgccggggacgaagttggtggcgtaagcccaggcgttgttgttgacggggtcggtga 2660 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgat 215 | ||||| ||||||||||||| || ||||||||||||||||| Sbjct: 2659 ggtggtcggcgaggttctcgatggggcccttgccggtgacgat 2617
>gb|U21111.1|STU21111 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-1) gene, nuclear gene encoding chloroplast protein, complete cds Length = 798 Score = 198 bits (100), Expect = 2e-47 Identities = 227/268 (84%), Gaps = 1/268 (0%) Strand = Plus / Minus Query: 217 gcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaa 276 |||||||||||| | |||||| || || |||||||||||||||||||||||||||||||| Sbjct: 450 gcttgggttgcccaagtagtcaagtcctccctcgctgaagatctgggatccggccttgaa 391 Query: 277 ccaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagcc 336 ||| ||||||||||||||||| || ||||| |||| || | ||| |||||||| || || Sbjct: 390 ccacacagcctcaccgaacttgacaccgttacgggacaatagctcagggaagacacatcc 331 Query: 337 gagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaa 396 || || |||||||| ||||| | ||||||||||||||| || || ||||||||||| || Sbjct: 330 aagagcaccaagcattgcccatctgcagtggatcacctcgagttcacggttcttggcaaa 271 Query: 397 ggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcac 456 ||| || ||||| || || | ||||| || |||| |||||||||| |||||||| |||| Sbjct: 270 ggtttcagggtctgctgaaagtccagcggtatccc-acccgtagtcaccagggaattcac 212 Query: 457 cggtcaggtagctcgggggctcaccaga 484 |||||| |||||| |||| ||||||||| Sbjct: 211 cggtcaagtagcttggggactcaccaga 184
>gb|AY198376.1| Citrus limon chlorophyll a/b-binding protein precursor, gene, partial cds; nuclear gene for chloroplast product Length = 647 Score = 190 bits (96), Expect = 4e-45 Identities = 226/268 (84%), Gaps = 1/268 (0%) Strand = Plus / Minus Query: 217 gcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaa 276 ||||||||| || | |||||| || |||||||||||||||||||| | ||| |||||||| Sbjct: 447 gcttgggtttcccaagtagtcaagcccgccctcgctgaagatctgagctcccgccttgaa 388 Query: 277 ccaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagcc 336 ||| || |||||||||||||| || ||||| ||||||| | ||| ||||||||||| || Sbjct: 387 ccacacggcctcaccgaacttgactccgttgcgggccaagagctccgggaagacgcatcc 328 Query: 337 gagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaa 396 || ||||| | ||||||||| | ||||||||| || || || || || |||||||| || Sbjct: 327 aagagctcccaacatggcccatctgcagtggatgacttcgagttcacgattcttggcaaa 268 Query: 397 ggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcac 456 ||| || |||||||| || | ||| || ||||||||| |||||||||||||||||||||| Sbjct: 267 ggtttctgggtcagctgaaagcccggctgtgtcccaa-ccgtagtcgccagggaactcac 209 Query: 457 cggtcaggtagctcgggggctcaccaga 484 |||||| |||||| |||||||| ||||| Sbjct: 208 cggtcaagtagcttgggggctcgccaga 181
>gb|U21114.1|STU21114 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-5) gene, nuclear gene encoding chloroplast protein, complete cds Length = 798 Score = 190 bits (96), Expect = 4e-45 Identities = 226/268 (84%), Gaps = 1/268 (0%) Strand = Plus / Minus Query: 217 gcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaa 276 |||||||||||| | |||||| || || |||||||||||||||||||||||||||||||| Sbjct: 450 gcttgggttgcccaagtagtcaagtccaccctcgctgaagatctgggatccggccttgaa 391 Query: 277 ccaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagcc 336 ||| || ||||||||||||| || ||||| ||||||| | ||| |||||||| || || Sbjct: 390 ccacacgacctcaccgaacttgacaccgttacgggccaatagctcagggaagacacatcc 331 Query: 337 gagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaa 396 || || |||||||| ||||| | ||||||||||||||| || || ||||||||||| || Sbjct: 330 aagagcaccaagcattgcccatctgcagtggatcacctcgagttcacggttcttggcaaa 271 Query: 397 ggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcac 456 ||| || ||||| || || | ||||| || |||| |||||||||| |||||||| |||| Sbjct: 270 ggtttcagggtctgctgaaagtccagcggtatccc-acccgtagtcaccagggaattcac 212 Query: 457 cggtcaggtagctcgggggctcaccaga 484 |||||| |||||| |||| ||||||||| Sbjct: 211 cggtcaagtagcttggggactcaccaga 184
>dbj|AP004473.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT10J15, TM0007, complete sequence Length = 92741 Score = 186 bits (94), Expect = 7e-44 Identities = 224/266 (84%), Gaps = 1/266 (0%) Strand = Plus / Plus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| |||||||| | |||||| || || |||||||||||||| || || || ||||||| Sbjct: 65906 ggctcgggttgcccaagtagtcaagcccaccctcgctgaagatttgtgacccagccttga 65965 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| |||||||||||||| || || ||||| ||||||| | ||| ||||| || |||| Sbjct: 65966 accacacagcctcaccgaatttaaccccgttgcgggccaagagctctgggaaaacacagc 66025 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 | | ||||| | ||||||||| | ||||||||||||| ||||| ||||||||||||| Sbjct: 66026 ccaaagctcccaacatggcccacctagagtggatcacctcaagctcacggttcttggcga 66085 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 | ||||||||||||||||| | |||||||||||||| | |||||||| || ||||||||| Sbjct: 66086 atgtctcggggtcagcagaaagcccagcagtgtccc-agccgtagtcaccggggaactca 66144 Query: 456 ccggtcaggtagctcgggggctcacc 481 ||||||| |||| |||||||||||| Sbjct: 66145 ccggtcaagtaggacgggggctcacc 66170
>gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene, complete cds Length = 1913 Score = 186 bits (94), Expect = 7e-44 Identities = 209/246 (84%), Gaps = 1/246 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 |||||||| |||||||| |||||||||||| ||||||||||| || ||||||||||| Sbjct: 1182 gggttgcccaggtagtcgaggccgccctcggagaagatctgggcgcccgccttgaaccag 1123 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || ||||| ||||||| ||| ||||| || |||| ||| ||||||| |||||||||| Sbjct: 1122 acggcctccccgaactgcaccccgttcttggagagcagctccgggaagatgcagccgagc 1063 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 || || ||||||||||| |||| |||||| |||||||||||||||||||||||||||||| Sbjct: 1062 gcgccgagcatggcccaccggctgtggatgacctccagctcgcggttcttggcgaaggtc 1003 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || ||||| || || | || || ||||||| ||||||||||||| |||||||| || || Sbjct: 1002 tccgggtcggcggagaggccggccgtgtccc-acccgtagtcgccggggaactcgcccgt 944 Query: 461 caggta 466 |||||| Sbjct: 943 caggta 938 Score = 107 bits (54), Expect = 5e-20 Identities = 93/106 (87%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||||||||| ||||||||||||||||| ||||| || |||||| |||||||||||||| Sbjct: 1532 acttgccggggacgaagttggtggcgaaggcccaggcgttgttggcgacggggtcggcga 1473 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 ||||| || |||||||||| || |||||||||||||||||||| Sbjct: 1472 tgtggtcggccaggttctcgatggggcccttgccggtgacgatggc 1427
>gb|U20983.1|STU20983 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-2) gene, nuclear gene encoding chloroplast protein, complete cds Length = 798 Score = 182 bits (92), Expect = 1e-42 Identities = 225/268 (83%), Gaps = 1/268 (0%) Strand = Plus / Minus Query: 217 gcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaa 276 |||||||||||| | |||||| || || |||||||||||||||||||||||||||||||| Sbjct: 450 gcttgggttgcccaagtagtcaagtccaccctcgctgaagatctgggatccggccttgaa 391 Query: 277 ccaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagcc 336 ||| ||||||||||||||||| || ||||| ||||||| | ||| |||||||| || || Sbjct: 390 ccacacagcctcaccgaacttgacaccgttacgggccaagagctcagggaagacacatcc 331 Query: 337 gagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaa 396 || || |||||||| ||||| | ||||||||||||||| || || ||||||||||| || Sbjct: 330 aagagcaccaagcatagcccatctgcagtggatcacctcaagttcacggttcttggcaaa 271 Query: 397 ggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcac 456 |||||| ||||| || || | ||||| || |||| | || ||||| |||||||| |||| Sbjct: 270 ggtctcagggtctgctgaaagtccagcggtatccc-atccatagtcaccagggaattcac 212 Query: 457 cggtcaggtagctcgggggctcaccaga 484 | |||| ||| || |||| ||||||||| Sbjct: 211 cagtcaagtaacttggggactcaccaga 184 Score = 79.8 bits (40), Expect = 1e-11 Identities = 88/104 (84%) Strand = Plus / Minus Query: 118 ccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcgagatgg 177 |||||||| ||||| ||||| || |||||||||||||||||||| || || || || ||| Sbjct: 791 ccgggaacaaagtttgtggcaaaggcccatgcattgttgttgactggatctgcaaggtgg 732 Query: 178 tcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 ||||| || ||||| | ||||||||| ||||| || |||||||| Sbjct: 731 tcagcaagattctccaatggaccctttccggtaacaatggcttg 688
>gb|M16058.1|CUSLHCPB Cucumber LHCP mRNA encoding chlorophyll a/b-binding protein, partial cds Length = 748 Score = 182 bits (92), Expect = 1e-42 Identities = 222/264 (84%), Gaps = 1/264 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 |||||||| | |||||| || |||||||||||||||||||| ||||| |||||||||||| Sbjct: 271 gggttgcccaagtagtcaagcccgccctcgctgaagatctgagatccagccttgaaccaa 212 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 ||||||||||| |||||||| || || || | || | ||| ||||| || || || | Sbjct: 211 acagcctcaccaaacttcacaccattgcgagacaaaagctcagggaaaacacaccccaaa 152 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 ||||||||||||||||| | |||||||||| |||| ||| |||||||||||||||||| Sbjct: 151 gctccaagcatggcccatgtggagtggatcacttccaactctcggttcttggcgaaggtc 92 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 ||||| ||||| || | ||||||||||||||| |||||||| ||||||||||| ||||| Sbjct: 91 tcgggatcagctgaaagtccagcagtgtcccaa-ccgtagtcaccagggaactctccggt 33 Query: 461 caggtagctcgggggctcaccaga 484 |||||| || ||||||||||| Sbjct: 32 aaggtaggatggtggctcaccaga 9 Score = 54.0 bits (27), Expect = 7e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtc 167 |||| |||||||| ||||| ||||| ||||||| |||||||||||||| ||||| Sbjct: 621 actttccgggaacaaagtttgtggcatatgcccaagcattgttgttgactgggtc 567
>gb|AF034631.1|AF034631 Panax ginseng chlorophyll a/b binding protein of LHCII type I precursor (CAB) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1015 Score = 180 bits (91), Expect = 4e-42 Identities = 187/219 (85%) Strand = Plus / Minus Query: 217 gcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaa 276 |||||||||||| | |||||| || || || ||||||||||| ||||||||||||||||| Sbjct: 476 gcttgggttgcccaagtagtcaagcccaccttcgctgaagatttgggatccggccttgaa 417 Query: 277 ccaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagcc 336 ||| || ||||||||||| || || ||||| || |||| | |||||||||||| || || Sbjct: 416 ccacacggcctcaccgaatttgacaccgttacgagccaagagctcggggaagacacatcc 357 Query: 337 gagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaa 396 || ||||||||||||||||| | || ||| |||||||| ||||| |||||||||||||| Sbjct: 356 aagggctccaagcatggcccatctgctgtgaatcacctcaagctcacggttcttggcgaa 297 Query: 397 ggtctcggggtcagcagacaacccagcagtgtcccaacc 435 |||||||| |||||||| | ||||||||||||||||| Sbjct: 296 tgtctcgggatcagcagaaaggccagcagtgtcccaacc 258 Score = 48.1 bits (24), Expect = 0.041 Identities = 42/48 (87%) Strand = Plus / Minus Query: 111 ttacttgccgggaacgaagttggtggcgaatgcccatgcattgttgtt 158 |||||| ||||| || ||||||||||| | ||||||||||||||||| Sbjct: 824 ttactttccggggacaaagttggtggcataggcccatgcattgttgtt 777
>gb|L23107.1|GBICABBP Ginkgo biloba nuclear-encoded chloroplast chlorophyll a/b binding protein mRNA, complete cds Length = 997 Score = 180 bits (91), Expect = 4e-42 Identities = 194/227 (85%), Gaps = 1/227 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 ||||||||||||| |||||||| |||||||| |||||||||||||| || || ||||||| Sbjct: 524 ggcttgggttgcccaggtagtcgaggccgccgtcgctgaagatctgagagcccgccttga 465 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| |||||||| |||||||| |||||||| |||| |||| ||| ||||||||||||| Sbjct: 464 accagacagcctcgccgaacttgacgccgttgcgggagagcagctccgggaagacgcagc 405 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 | || ||||| | ||| ||||| || ||||||||||||||||||| | |||||| |||| Sbjct: 404 ccagggctcccaacatcgcccaccgcgagtggatcacctccagctctctgttcttcgcga 345 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtc 442 | ||||| ||||| || |||| ||| || ||||||| |||||||||| Sbjct: 344 acgtctccgggtccgccgacagccccgccgtgtccc-acccgtagtc 299 Score = 127 bits (64), Expect = 5e-26 Identities = 94/104 (90%) Strand = Plus / Minus Query: 115 ttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcgaga 174 |||||||| ||||||||||||||||| ||||| || ||||||||||||||||||||||| Sbjct: 867 ttgccggggacgaagttggtggcgaaggcccaggcgttgttgttgacggggtcggcgagg 808 Query: 175 tggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 ||||| ||||||||||||| || || ||||||||||||||||| Sbjct: 807 tggtcggcgaggttctcgatggggcctttgccggtgacgatggc 764
>emb|X02356.1|PECAB91R Petunia gene for chlorophyll a/b binding protein cab 91R Length = 1173 Score = 176 bits (89), Expect = 7e-41 Identities = 216/257 (84%), Gaps = 1/257 (0%) Strand = Plus / Minus Query: 218 cttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaac 277 ||||||||||| | |||||| || || ||||||||||| || |||||||| ||||| ||| Sbjct: 685 cttgggttgcccaagtagtcaagtccaccctcgctgaatatttgggatccagccttaaac 626 Query: 278 caaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccg 337 || ||||||||||||||||| || || || ||||| || | || |||||||| || || Sbjct: 625 catacagcctcaccgaacttgacaccattacgggcaaggagttcagggaagacacaacca 566 Query: 338 agcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaag 397 || ||||||||||||||||| | ||||||||||||||||| ||| |||||||||||||| Sbjct: 565 agagctccaagcatggcccatctgcagtggatcacctccaactcacggttcttggcgaat 506 Query: 398 gtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcacc 457 || ||||| ||||| || | |||| ||||||||| || ||||| |||||||||||||| Sbjct: 505 gtttcgggatcagctgaaagttcagcggtgtcccaa-ccatagtcaccagggaactcacc 447 Query: 458 ggtcaggtagctcgggg 474 ||||| |||||| |||| Sbjct: 446 ggtcaagtagcttgggg 430
>gb|U21113.1|STU21113 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-4) gene, nuclear gene encoding chloroplast protein, complete cds Length = 798 Score = 174 bits (88), Expect = 3e-40 Identities = 224/268 (83%), Gaps = 1/268 (0%) Strand = Plus / Minus Query: 217 gcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaa 276 ||||||||| || | |||||| || || |||||||||||||||||||||||||||||||| Sbjct: 450 gcttgggttccccaagtagtcaagtccaccctcgctgaagatctgggatccggccttgaa 391 Query: 277 ccaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagcc 336 ||| ||||||||||| ||||| || ||||| ||||||| | ||| |||||||| || || Sbjct: 390 ccacacagcctcaccaaacttgacaccgttacgggccaagagctcagggaagacacatcc 331 Query: 337 gagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaa 396 || || |||||||| ||||| | ||||||||||||||| || || ||||||||||| || Sbjct: 330 aagagcaccaagcatagcccacctgcagtggatcacctctagttcacggttcttggcaaa 271 Query: 397 ggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcac 456 ||| || ||||| || || | |||||||| |||| | || ||||| |||||||| |||| Sbjct: 270 ggtttcagggtctgctgaaagtccagcagtatccc-agccatagtcaccagggaattcac 212 Query: 457 cggtcaggtagctcgggggctcaccaga 484 |||||| ||| || |||| ||||||||| Sbjct: 211 cggtcaagtaacttggggactcaccaga 184 Score = 75.8 bits (38), Expect = 2e-10 Identities = 83/98 (84%) Strand = Plus / Minus Query: 121 ggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcgagatggtca 180 ||||| ||||| |||||| | ||||| ||||||||||| |||||||| || || |||||| Sbjct: 788 ggaacaaagtttgtggcgtaggcccaggcattgttgttaacggggtctgcaaggtggtca 729 Query: 181 gcgaggttctcgagtggacccttgccggtgacgatggc 218 || |||||||| | ||||||||| ||||| || ||||| Sbjct: 728 gcaaggttctccaatggaccctttccggtaacaatggc 691
>emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting chlorophyll a/b- binding protein ( LHCP ) Length = 1030 Score = 172 bits (87), Expect = 1e-39 Identities = 208/247 (84%), Gaps = 1/247 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 ||||| || ||||| | ||| ||||||||||| ||||||||||| || ||||||||| Sbjct: 623 gggttccccaggtactgcagcccgccctcgctaaagatctgggaacccttcttgaaccac 564 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || ||||| || ||||| |||||||| ||||| || | ||| ||||||||||| |||||| Sbjct: 563 acggcctcgccaaacttgacgccgttccgggcgaggagctccgggaagacgcacccgagc 504 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 || || ||||| ||||| || | ||||||||||||||||||||||||||||||||||||| Sbjct: 503 gcccccagcatcgcccagcgcccgtggatcacctccagctcgcggttcttggcgaaggtc 444 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 |||||||| || | ||| || ||||||| |||||||||| || |||||||| ||||| Sbjct: 443 tcggggtcggcgctgagcccggccgtgtccc-acccgtagtctccggggaactcgccggt 385 Query: 461 caggtag 467 ||||||| Sbjct: 384 caggtag 378 Score = 135 bits (68), Expect = 2e-28 Identities = 98/108 (90%) Strand = Plus / Minus Query: 111 ttacttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggc 170 |||||||||||| ||||||||||||||||| ||||| ||||||||||| ||||||||||| Sbjct: 975 ttacttgccggggacgaagttggtggcgaaggcccaggcattgttgtttacggggtcggc 916 Query: 171 gagatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 ||||||||| || | ||||||||| || ||||| |||||||||||||| Sbjct: 915 gagatggtccgccaagttctcgaggggccccttcccggtgacgatggc 868
>gb|M16057.1|CUSLHCPA Cucumber LHCP mRNA encoding chlorophyll a/b-binding protein, partial cds Length = 878 Score = 167 bits (84), Expect = 6e-38 Identities = 220/264 (83%), Gaps = 1/264 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 |||||||| | |||||| || |||||||||||||||||||| || || ||||||||||| Sbjct: 416 gggttgcccaagtagtcaagcccgccctcgctgaagatctgcgaaccagccttgaaccac 357 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 ||||| ||||| |||||||| || || || | || | ||| ||||| || || || | Sbjct: 356 acagcttcaccaaacttcacaccattacgagacaaaagctcagggaaaacacaccccaaa 297 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 ||||||||||||||||| | | |||||||||| |||| ||| |||||||||||||||||| Sbjct: 296 gctccaagcatggcccatctggagtggatcacttccaactcacggttcttggcgaaggtc 237 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 ||||| ||||| || | ||||||||||||||| |||||||| ||||||||||| ||||| Sbjct: 236 tcgggatcagctgaaagtccagcagtgtcccaa-ccgtagtcaccagggaactctccggt 178 Query: 461 caggtagctcgggggctcaccaga 484 |||||| || ||||||||||| Sbjct: 177 aaggtaggatggtggctcaccaga 154 Score = 52.0 bits (26), Expect = 0.003 Identities = 62/74 (83%) Strand = Plus / Minus Query: 142 gcccatgcattgttgttgacggggtcggcgagatggtcagcgaggttctcgagtggaccc 201 ||||| |||||||||||||| ||||| || ||||| ||||| | ||||| | ||||||| Sbjct: 737 gcccaagcattgttgttgactgggtcagcaagatgatcagccaaattctccaatggaccc 678 Query: 202 ttgccggtgacgat 215 || ||||| ||||| Sbjct: 677 tttccggtaacgat 664
>dbj|D14002.1|LAUCAB Lettuce mRNA for light-harvesting chlorophyll a/b-binding protein (LHCP), complete cds Length = 905 Score = 167 bits (84), Expect = 6e-38 Identities = 184/216 (85%), Gaps = 1/216 (0%) Strand = Plus / Minus Query: 251 ctgaagatctgggatccggccttgaaccaaacagcctcaccgaacttcacgccgtttcgg 310 ||||||||||||||||| ||||||||||| |||||||||||||||||||| || || ||| Sbjct: 463 ctgaagatctgggatccagccttgaaccatacagcctcaccgaacttcacaccattacgg 404 Query: 311 gccagcaactcggggaagacgcagccgagcgctccaagcatggcccaacggcagtggatc 370 |||| | ||| |||||||||||||| || ||||||||||| ||||| | ||||||||| Sbjct: 403 gccaagagctcagggaagacgcagccaagagctccaagcattgcccatctgcagtggatg 344 Query: 371 acctccagctcgcggttcttggcgaaggtctcggggtcagcagacaacccagcagtgtcc 430 ||||| ||||| |||||||||| || ||||| || |||||||| | || || |||||| Sbjct: 343 acctcaagctcacggttcttggaaaatgtctctggatcagcagaaagtccggcggtgtcc 284 Query: 431 caacccgtagtcgccagggaactcaccggtcaggta 466 | | |||||||| || ||||| |||||||||||||| Sbjct: 283 c-agccgtagtcacctgggaattcaccggtcaggta 249
>gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/b binding protein (CipLhcb1) mRNA, complete cds; nuclear gene for chloroplast product Length = 975 Score = 165 bits (83), Expect = 3e-37 Identities = 219/263 (83%), Gaps = 1/263 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 ||||||||||||| | |||||| || || |||||||||||||||||||| ||||| |||| Sbjct: 503 ggcttgggttgcccaagtagtcgagcccaccctcgctgaagatctgggaaccggctttga 444 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| || ||||| ||||| ||||| ||||| |||| || |||||||||||| || Sbjct: 443 accagacggcctcgccgaatttcacaccgttgcgggacaagggttcggggaagacgatgc 384 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 | | ||||| ||||||||||| | | ||||||| || |||| ||| |||||| |||||| Sbjct: 383 ccaaggctcccagcatggcccacctggagtggatgacttccaactcacggttcctggcga 324 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 ||||||| |||||||| || | |||||||||||||||| |||||||| || |||||||| Sbjct: 323 aggtctctgggtcagcggaaagcccagcagtgtcccaa-ccgtagtcacctgggaactcg 265 Query: 456 ccggtcaggtagctcgggggctc 478 ||||| |||||| ||||||||| Sbjct: 264 ccggtgaggtaggacgggggctc 242 Score = 83.8 bits (42), Expect = 7e-13 Identities = 90/106 (84%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| ||||| ||||||||||||||| | ||||| || ||||||||||| ||||| || | Sbjct: 848 actttccggggacgaagttggtggcgtaggcccaggcgttgttgttgactgggtcagcaa 789 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 | ||||| ||||||||||| | ||| ||||| |||||||| ||||| Sbjct: 788 ggtggtcggcgaggttctccaatggtccctttccggtgacaatggc 743
>emb|X02359.1|PECAB22L Petunia gene for chlorophyll a/b binding protein cab 22L Length = 1187 Score = 165 bits (83), Expect = 3e-37 Identities = 222/267 (83%), Gaps = 1/267 (0%) Strand = Plus / Minus Query: 218 cttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaac 277 ||||||||||| | |||||| || || ||||| ||||| || || ||||| ||||||| | Sbjct: 685 cttgggttgcccaagtagtcaagtccaccctcactgaaaatttgtgatccagccttgagc 626 Query: 278 caaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccg 337 || ||||||||||| ||||| || ||||| ||||| | | ||| ||||||||||| || Sbjct: 625 catacagcctcaccaaacttgacaccgttacgggcaaaaagctcagggaagacgcaacca 566 Query: 338 agcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaag 397 || ||||||||||||||||| | ||||||||||||||||| ||| || ||||||||||| Sbjct: 565 agagctccaagcatggcccatctgcagtggatcacctccaactcacgattcttggcgaaa 506 Query: 398 gtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcacc 457 || || || ||||| || | ||||||||||||| |||| || || |||||||||||||| Sbjct: 505 gtttctggatcagctgaaagtccagcagtgtccc-acccataatcaccagggaactcacc 447 Query: 458 ggtcaggtagctcgggggctcaccaga 484 |||| |||||| |||| ||||||||| Sbjct: 446 agtcaagtagcttggggcctcaccaga 420
>emb|X52741.1|NTCAB16 Tabacco Cab16 mRNA for major chlorophyll a/b binding protein Length = 1025 Score = 165 bits (83), Expect = 3e-37 Identities = 222/267 (83%), Gaps = 1/267 (0%) Strand = Plus / Minus Query: 218 cttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaac 277 ||||||||||| | |||||| || || |||||||| || || |||||||| ||||||||| Sbjct: 510 cttgggttgcccaagtagtcaagtccaccctcgctaaaaatttgggatccagccttgaac 451 Query: 278 caaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccg 337 || ||||| ||||||||||| || || || || |||| | ||||||||||| || || Sbjct: 450 catacagcttcaccgaacttgacaccattacgtgccaagagttcggggaagacacaacca 391 Query: 338 agcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaag 397 || ||||||||||||||||| | ||||||||||||||||| ||| |||||||||||||| Sbjct: 390 agagctccaagcatggcccatctgcagtggatcacctccaactcacggttcttggcgaat 331 Query: 398 gtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcacc 457 || || || ||||| || | ||||||||||||| ||||||| || ||||| |||||||| Sbjct: 330 gtttctggatcagctgaaagtccagcagtgtccc-acccgtaatcaccaggaaactcacc 272 Query: 458 ggtcaggtagctcgggggctcaccaga 484 |||| |||||| || | ||||||||| Sbjct: 271 agtcaagtagcttggagactcaccaga 245 Score = 61.9 bits (31), Expect = 3e-06 Identities = 85/103 (82%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| |||||||| ||||| ||||| | | ||| || |||||||| || ||||| || | Sbjct: 857 actttccgggaacaaagttagtggcataagaccaggcgttgttgttaaccgggtcagcaa 798 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgat 215 | |||||||| |||||||| | ||||||||| ||||||||||| Sbjct: 797 ggtggtcagcaaggttctccaatggaccctttccggtgacgat 755
>dbj|AB012641.1| Nicotiana sylvestris Lhcb1*9 gene for light harvesting chlorophyll a/b-binding protein, complete cds Length = 3386 Score = 165 bits (83), Expect = 3e-37 Identities = 222/267 (83%), Gaps = 1/267 (0%) Strand = Plus / Minus Query: 218 cttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaac 277 ||||||||||| | |||||| || || || |||||||| ||||||||||| ||||||||| Sbjct: 1905 cttgggttgcccaagtagtcaagtccaccttcgctgaaaatctgggatccagccttgaac 1846 Query: 278 caaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccg 337 || ||||||||||||||||| || ||||| || |||| | ||||||||||| || || Sbjct: 1845 catacagcctcaccgaacttgactccgttacgagccaagagttcggggaagacacaacca 1786 Query: 338 agcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaag 397 || ||||||||||||||||| | ||| ||||||||||||| ||| |||||||| || || Sbjct: 1785 agagctccaagcatggcccatctgcaatggatcacctccaactcacggttcttagcaaaa 1726 Query: 398 gtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcacc 457 || || || ||||| || | ||||||||||||| | || || || |||||||||||||| Sbjct: 1725 gtttctggatcagctgaaagtccagcagtgtccc-atccataatcaccagggaactcacc 1667 Query: 458 ggtcaggtagctcgggggctcaccaga 484 |||| |||||| |||| ||||||||| Sbjct: 1666 cgtcaagtagcttggggactcaccaga 1640
>ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant AT2G34410.3 mRNA, complete cds Length = 3299 Score = 163 bits (82), Expect = 1e-36 Identities = 215/258 (83%), Gaps = 1/258 (0%) Strand = Plus / Plus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 |||||||| | |||||||| || || |||||||||||||| || ||||||||||||||| Sbjct: 2801 gggttgcccaagtagtccaatcctccgtcgctgaagatctgtgaaccggccttgaaccaa 2860 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || || || ||||||||||| ||||| | |||| | ||| ||||| |||||||| || Sbjct: 2861 accgcttctccgaacttcactccgttcctagccaatagctcagggaaaacgcagcctagg 2920 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 ||||| ||||||||||| | || |||||| || || ||||| |||||| ||||||||||| Sbjct: 2921 gctccgagcatggcccatctgctgtggataacttctagctcacggttcctggcgaaggtc 2980 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || ||||| || || | ||||| ||||||| | |||||||| || |||||||||||||| Sbjct: 2981 tctgggtcggcggatagaccagcggtgtccc-atccgtagtcaccggggaactcaccggt 3039 Query: 461 caggtagctcgggggctc 478 ||||||||||||||||| Sbjct: 3040 aaggtagctcgggggctc 3057 Score = 105 bits (53), Expect = 2e-19 Identities = 95/109 (87%) Strand = Plus / Plus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| ||||| ||||||||||||||||| ||||| || ||||||||||| |||||||| | Sbjct: 2487 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 2546 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 |||||| ||||||||||| | || ||||| ||||||||||||||||| Sbjct: 2547 aatggtcggcgaggttctccaaaggtccctttccggtgacgatggcttg 2595
>ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant AT2G34410.2 mRNA, complete cds Length = 3338 Score = 163 bits (82), Expect = 1e-36 Identities = 215/258 (83%), Gaps = 1/258 (0%) Strand = Plus / Plus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 |||||||| | |||||||| || || |||||||||||||| || ||||||||||||||| Sbjct: 2840 gggttgcccaagtagtccaatcctccgtcgctgaagatctgtgaaccggccttgaaccaa 2899 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || || || ||||||||||| ||||| | |||| | ||| ||||| |||||||| || Sbjct: 2900 accgcttctccgaacttcactccgttcctagccaatagctcagggaaaacgcagcctagg 2959 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 ||||| ||||||||||| | || |||||| || || ||||| |||||| ||||||||||| Sbjct: 2960 gctccgagcatggcccatctgctgtggataacttctagctcacggttcctggcgaaggtc 3019 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || ||||| || || | ||||| ||||||| | |||||||| || |||||||||||||| Sbjct: 3020 tctgggtcggcggatagaccagcggtgtccc-atccgtagtcaccggggaactcaccggt 3078 Query: 461 caggtagctcgggggctc 478 ||||||||||||||||| Sbjct: 3079 aaggtagctcgggggctc 3096 Score = 105 bits (53), Expect = 2e-19 Identities = 95/109 (87%) Strand = Plus / Plus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| ||||| ||||||||||||||||| ||||| || ||||||||||| |||||||| | Sbjct: 2487 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 2546 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 |||||| ||||||||||| | || ||||| ||||||||||||||||| Sbjct: 2547 aatggtcggcgaggttctccaaaggtccctttccggtgacgatggcttg 2595
>ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll binding AT2G34420 (LHB1B2) transcript variant AT2G34420.1 mRNA, complete cds Length = 1354 Score = 163 bits (82), Expect = 1e-36 Identities = 215/258 (83%), Gaps = 1/258 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 |||||||| | |||||||| || || |||||||||||||| || ||||||||||||||| Sbjct: 498 gggttgcccaagtagtccaatcctccgtcgctgaagatctgtgaaccggccttgaaccaa 439 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || || || ||||||||||| ||||| | |||| | ||| ||||| |||||||| || Sbjct: 438 accgcttctccgaacttcactccgttcctagccaatagctcagggaaaacgcagcctagg 379 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 ||||| ||||||||||| | || |||||| || || ||||| |||||| ||||||||||| Sbjct: 378 gctccgagcatggcccatctgctgtggataacttctagctcacggttcctggcgaaggtc 319 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || ||||| || || | ||||| ||||||| | |||||||| || |||||||||||||| Sbjct: 318 tctgggtcggcggatagaccagcggtgtccc-atccgtagtcaccggggaactcaccggt 260 Query: 461 caggtagctcgggggctc 478 ||||||||||||||||| Sbjct: 259 aaggtagctcgggggctc 242 Score = 105 bits (53), Expect = 2e-19 Identities = 95/109 (87%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| ||||| ||||||||||||||||| ||||| || ||||||||||| |||||||| | Sbjct: 851 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 792 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 |||||| ||||||||||| | || ||||| ||||||||||||||||| Sbjct: 791 aatggtcggcgaggttctccaaaggtccctttccggtgacgatggcttg 743
>ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) transcript variant AT2G34420.2 mRNA, complete cds Length = 1312 Score = 163 bits (82), Expect = 1e-36 Identities = 215/258 (83%), Gaps = 1/258 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 |||||||| | |||||||| || || |||||||||||||| || ||||||||||||||| Sbjct: 498 gggttgcccaagtagtccaatcctccgtcgctgaagatctgtgaaccggccttgaaccaa 439 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || || || ||||||||||| ||||| | |||| | ||| ||||| |||||||| || Sbjct: 438 accgcttctccgaacttcactccgttcctagccaatagctcagggaaaacgcagcctagg 379 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 ||||| ||||||||||| | || |||||| || || ||||| |||||| ||||||||||| Sbjct: 378 gctccgagcatggcccatctgctgtggataacttctagctcacggttcctggcgaaggtc 319 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || ||||| || || | ||||| ||||||| | |||||||| || |||||||||||||| Sbjct: 318 tctgggtcggcggatagaccagcggtgtccc-atccgtagtcaccggggaactcaccggt 260 Query: 461 caggtagctcgggggctc 478 ||||||||||||||||| Sbjct: 259 aaggtagctcgggggctc 242 Score = 105 bits (53), Expect = 2e-19 Identities = 95/109 (87%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| ||||| ||||||||||||||||| ||||| || ||||||||||| |||||||| | Sbjct: 809 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 750 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 |||||| ||||||||||| | || ||||| ||||||||||||||||| Sbjct: 749 aatggtcggcgaggttctccaaaggtccctttccggtgacgatggcttg 701
>gb|AY142513.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At2g34420) mRNA, complete cds Length = 829 Score = 163 bits (82), Expect = 1e-36 Identities = 215/258 (83%), Gaps = 1/258 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 |||||||| | |||||||| || || |||||||||||||| || ||||||||||||||| Sbjct: 443 gggttgcccaagtagtccaatcctccgtcgctgaagatctgtgaaccggccttgaaccaa 384 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || || || ||||||||||| ||||| | |||| | ||| ||||| |||||||| || Sbjct: 383 accgcttctccgaacttcactccgttcctagccaatagctcagggaaaacgcagcctagg 324 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 ||||| ||||||||||| | || |||||| || || ||||| |||||| ||||||||||| Sbjct: 323 gctccgagcatggcccatctgctgtggataacttctagctcacggttcctggcgaaggtc 264 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || ||||| || || | ||||| ||||||| | |||||||| || |||||||||||||| Sbjct: 263 tctgggtcggcggatagaccagcggtgtccc-atccgtagtcaccggggaactcaccggt 205 Query: 461 caggtagctcgggggctc 478 ||||||||||||||||| Sbjct: 204 aaggtagctcgggggctc 187 Score = 105 bits (53), Expect = 2e-19 Identities = 95/109 (87%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| ||||| ||||||||||||||||| ||||| || ||||||||||| |||||||| | Sbjct: 796 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 737 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 |||||| ||||||||||| | || ||||| ||||||||||||||||| Sbjct: 736 aatggtcggcgaggttctccaaaggtccctttccggtgacgatggcttg 688
>gb|AY045806.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At2g34420) mRNA, complete cds Length = 1015 Score = 163 bits (82), Expect = 1e-36 Identities = 215/258 (83%), Gaps = 1/258 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 |||||||| | |||||||| || || |||||||||||||| || ||||||||||||||| Sbjct: 498 gggttgcccaagtagtccaatcctccgtcgctgaagatctgtgaaccggccttgaaccaa 439 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || || || ||||||||||| ||||| | |||| | ||| ||||| |||||||| || Sbjct: 438 accgcttctccgaacttcactccgttcctagccaatagctcagggaaaacgcagcctagg 379 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 ||||| ||||||||||| | || |||||| || || ||||| |||||| ||||||||||| Sbjct: 378 gctccgagcatggcccatctgctgtggataacttctagctcacggttcctggcgaaggtc 319 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || ||||| || || | ||||| ||||||| | |||||||| || |||||||||||||| Sbjct: 318 tctgggtcggcggatagaccagcggtgtccc-atccgtagtcaccggggaactcaccggt 260 Query: 461 caggtagctcgggggctc 478 ||||||||||||||||| Sbjct: 259 aaggtagctcgggggctc 242 Score = 105 bits (53), Expect = 2e-19 Identities = 95/109 (87%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| ||||| ||||||||||||||||| ||||| || ||||||||||| |||||||| | Sbjct: 851 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 792 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 |||||| ||||||||||| | || ||||| ||||||||||||||||| Sbjct: 791 aatggtcggcgaggttctccaaaggtccctttccggtgacgatggcttg 743
>gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 map ve016, complete sequence Length = 112763 Score = 163 bits (82), Expect = 1e-36 Identities = 215/258 (83%), Gaps = 1/258 (0%) Strand = Plus / Plus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 |||||||| | |||||||| || || |||||||||||||| || ||||||||||||||| Sbjct: 93558 gggttgcccaagtagtccaatcctccgtcgctgaagatctgtgaaccggccttgaaccaa 93617 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || || || ||||||||||| ||||| | |||| | ||| ||||| |||||||| || Sbjct: 93618 accgcttctccgaacttcactccgttcctagccaatagctcagggaaaacgcagcctagg 93677 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 ||||| ||||||||||| | || |||||| || || ||||| |||||| ||||||||||| Sbjct: 93678 gctccgagcatggcccatctgctgtggataacttctagctcacggttcctggcgaaggtc 93737 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || ||||| || || | ||||| ||||||| | |||||||| || |||||||||||||| Sbjct: 93738 tctgggtcggcggatagaccagcggtgtccc-atccgtagtcaccggggaactcaccggt 93796 Query: 461 caggtagctcgggggctc 478 ||||||||||||||||| Sbjct: 93797 aaggtagctcgggggctc 93814 Score = 129 bits (65), Expect = 1e-26 Identities = 213/261 (81%), Gaps = 1/261 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 |||||||| | |||||||| || || |||||||||||||| || || |||||||||||| Sbjct: 95750 gggttgcccaagtagtccaatcctccgtcgctgaagatctgtgaaccagccttgaaccaa 95691 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || || || ||||||||||| ||||| | |||| | ||| ||||| |||||||| || Sbjct: 95690 accgcttctccgaacttcactccgttcctagccaatagctcagggaaaacgcagcctagg 95631 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 ||||| ||||||||||| | || |||||| || || ||||| |||||| | ||||||||| Sbjct: 95630 gctccgagcatggcccatctgctgtggataacttctagctcacggttcctagcgaaggtc 95571 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 ||||| || || || | || |||||||||| ||||||| || || |||||||| || || Sbjct: 95570 tcgggatcggcggatagaccggcagtgtccc-acccgtaatcaccggggaactctccagt 95512 Query: 461 caggtagctcgggggctcacc 481 ||||||||||| |||||||| Sbjct: 95511 gaggtagctcggaggctcacc 95491 Score = 105 bits (53), Expect = 2e-19 Identities = 95/109 (87%) Strand = Plus / Plus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| ||||| ||||||||||||||||| ||||| || ||||||||||| |||||||| | Sbjct: 93205 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 93264 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 |||||| ||||||||||| | || ||||| ||||||||||||||||| Sbjct: 93265 aatggtcggcgaggttctccaaaggtccctttccggtgacgatggcttg 93313 Score = 75.8 bits (38), Expect = 2e-10 Identities = 89/106 (83%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| ||||| ||||||||||| ||||| |||||||||||||||||||| || || || | Sbjct: 96103 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagcca 96044 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 ||||| ||||||||||| | || ||||| |||||||| ||||| Sbjct: 96043 agtggtccgcgaggttctccaacggtccctttccggtgacaatggc 95998
>gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 map ve016, complete sequence Length = 93060 Score = 163 bits (82), Expect = 1e-36 Identities = 215/258 (83%), Gaps = 1/258 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 |||||||| | |||||||| || || |||||||||||||| || ||||||||||||||| Sbjct: 80644 gggttgcccaagtagtccaatcctccgtcgctgaagatctgtgaaccggccttgaaccaa 80585 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || || || ||||||||||| ||||| | |||| | ||| ||||| |||||||| || Sbjct: 80584 accgcttctccgaacttcactccgttcctagccaatagctcagggaaaacgcagcctagg 80525 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 ||||| ||||||||||| | || |||||| || || ||||| |||||| ||||||||||| Sbjct: 80524 gctccgagcatggcccatctgctgtggataacttctagctcacggttcctggcgaaggtc 80465 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || ||||| || || | ||||| ||||||| | |||||||| || |||||||||||||| Sbjct: 80464 tctgggtcggcggatagaccagcggtgtccc-atccgtagtcaccggggaactcaccggt 80406 Query: 461 caggtagctcgggggctc 478 ||||||||||||||||| Sbjct: 80405 aaggtagctcgggggctc 80388 Score = 129 bits (65), Expect = 1e-26 Identities = 213/261 (81%), Gaps = 1/261 (0%) Strand = Plus / Plus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 |||||||| | |||||||| || || |||||||||||||| || || |||||||||||| Sbjct: 78452 gggttgcccaagtagtccaatcctccgtcgctgaagatctgtgaaccagccttgaaccaa 78511 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || || || ||||||||||| ||||| | |||| | ||| ||||| |||||||| || Sbjct: 78512 accgcttctccgaacttcactccgttcctagccaatagctcagggaaaacgcagcctagg 78571 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 ||||| ||||||||||| | || |||||| || || ||||| |||||| | ||||||||| Sbjct: 78572 gctccgagcatggcccatctgctgtggataacttctagctcacggttcctagcgaaggtc 78631 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 ||||| || || || | || |||||||||| ||||||| || || |||||||| || || Sbjct: 78632 tcgggatcggcggatagaccggcagtgtccc-acccgtaatcaccggggaactctccagt 78690 Query: 461 caggtagctcgggggctcacc 481 ||||||||||| |||||||| Sbjct: 78691 gaggtagctcggaggctcacc 78711 Score = 105 bits (53), Expect = 2e-19 Identities = 95/109 (87%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| ||||| ||||||||||||||||| ||||| || ||||||||||| |||||||| | Sbjct: 80997 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 80938 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 |||||| ||||||||||| | || ||||| ||||||||||||||||| Sbjct: 80937 aatggtcggcgaggttctccaaaggtccctttccggtgacgatggcttg 80889 Score = 75.8 bits (38), Expect = 2e-10 Identities = 89/106 (83%) Strand = Plus / Plus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| ||||| ||||||||||| ||||| |||||||||||||||||||| || || || | Sbjct: 78099 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagcca 78158 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 ||||| ||||||||||| | || ||||| |||||||| ||||| Sbjct: 78159 agtggtccgcgaggttctccaacggtccctttccggtgacaatggc 78204
>gb|AY081587.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding protein (At2g34420) mRNA, complete cds Length = 883 Score = 163 bits (82), Expect = 1e-36 Identities = 215/258 (83%), Gaps = 1/258 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 |||||||| | |||||||| || || |||||||||||||| || ||||||||||||||| Sbjct: 443 gggttgcccaagtagtccaatcctccgtcgctgaagatctgtgaaccggccttgaaccaa 384 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || || || ||||||||||| ||||| | |||| | ||| ||||| |||||||| || Sbjct: 383 accgcttctccgaacttcactccgttcctagccaatagctcagggaaaacgcagcctagg 324 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 ||||| ||||||||||| | || |||||| || || ||||| |||||| ||||||||||| Sbjct: 323 gctccgagcatggcccatctgctgtggataacttctagctcacggttcctggcgaaggtc 264 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || ||||| || || | ||||| ||||||| | |||||||| || |||||||||||||| Sbjct: 263 tctgggtcggcggatagaccagcggtgtccc-atccgtagtcaccggggaactcaccggt 205 Query: 461 caggtagctcgggggctc 478 ||||||||||||||||| Sbjct: 204 aaggtagctcgggggctc 187 Score = 105 bits (53), Expect = 2e-19 Identities = 95/109 (87%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| ||||| ||||||||||||||||| ||||| || ||||||||||| |||||||| | Sbjct: 796 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 737 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 |||||| ||||||||||| | || ||||| ||||||||||||||||| Sbjct: 736 aatggtcggcgaggttctccaaaggtccctttccggtgacgatggcttg 688
>gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 798 Score = 163 bits (82), Expect = 1e-36 Identities = 215/258 (83%), Gaps = 1/258 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 |||||||| | |||||||| || || |||||||||||||| || ||||||||||||||| Sbjct: 443 gggttgcccaagtagtccaatcctccgtcgctgaagatctgtgaaccggccttgaaccaa 384 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || || || ||||||||||| ||||| | |||| | ||| ||||| |||||||| || Sbjct: 383 accgcttctccgaacttcactccgttcctagccaatagctcagggaaaacgcagcctagg 324 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 ||||| ||||||||||| | || |||||| || || ||||| |||||| ||||||||||| Sbjct: 323 gctccgagcatggcccatctgctgtggataacttctagctcacggttcctggcgaaggtc 264 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || ||||| || || | ||||| ||||||| | |||||||| || |||||||||||||| Sbjct: 263 tctgggtcggcggatagaccagcggtgtccc-atccgtagtcaccggggaactcaccggt 205 Query: 461 caggtagctcgggggctc 478 ||||||||||||||||| Sbjct: 204 aaggtagctcgggggctc 187 Score = 105 bits (53), Expect = 2e-19 Identities = 95/109 (87%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| ||||| ||||||||||||||||| ||||| || ||||||||||| |||||||| | Sbjct: 796 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 737 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 |||||| ||||||||||| | || ||||| ||||||||||||||||| Sbjct: 736 aatggtcggcgaggttctccaaaggtccctttccggtgacgatggcttg 688
>gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 798 Score = 163 bits (82), Expect = 1e-36 Identities = 215/258 (83%), Gaps = 1/258 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 |||||||| | |||||||| || || |||||||||||||| || ||||||||||||||| Sbjct: 443 gggttgcccaagtagtccaatcctccgtcgctgaagatctgtgaaccggccttgaaccaa 384 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || || || ||||||||||| ||||| | |||| | ||| ||||| |||||||| || Sbjct: 383 accgcttctccgaacttcactccgttcctagccaatagctcagggaaaacgcagcctagg 324 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 ||||| ||||||||||| | || |||||| || || ||||| |||||| ||||||||||| Sbjct: 323 gctccgagcatggcccatctgctgtggataacttctagctcacggttcctggcgaaggtc 264 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || ||||| || || | ||||| ||||||| | |||||||| || |||||||||||||| Sbjct: 263 tctgggtcggcggatagaccagcggtgtccc-atccgtagtcaccggggaactcaccggt 205 Query: 461 caggtagctcgggggctc 478 ||||||||||||||||| Sbjct: 204 aaggtagctcgggggctc 187 Score = 105 bits (53), Expect = 2e-19 Identities = 95/109 (87%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| ||||| ||||||||||||||||| ||||| || ||||||||||| |||||||| | Sbjct: 796 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 737 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 |||||| ||||||||||| | || ||||| ||||||||||||||||| Sbjct: 736 aatggtcggcgaggttctccaaaggtccctttccggtgacgatggcttg 688
>gb|AY065125.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding protein (At2g34420; T31E10.24) mRNA, complete cds Length = 969 Score = 163 bits (82), Expect = 1e-36 Identities = 215/258 (83%), Gaps = 1/258 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 |||||||| | |||||||| || || |||||||||||||| || ||||||||||||||| Sbjct: 494 gggttgcccaagtagtccaatcctccgtcgctgaagatctgtgaaccggccttgaaccaa 435 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || || || ||||||||||| ||||| | |||| | ||| ||||| |||||||| || Sbjct: 434 accgcttctccgaacttcactccgttcctagccaatagctcagggaaaacgcagcctagg 375 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 ||||| ||||||||||| | || |||||| || || ||||| |||||| ||||||||||| Sbjct: 374 gctccgagcatggcccatctgctgtggataacttctagctcacggttcctggcgaaggtc 315 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || ||||| || || | ||||| ||||||| | |||||||| || |||||||||||||| Sbjct: 314 tctgggtcggcggatagaccagcggtgtccc-atccgtagtcaccggggaactcaccggt 256 Query: 461 caggtagctcgggggctc 478 ||||||||||||||||| Sbjct: 255 aaggtagctcgggggctc 238 Score = 105 bits (53), Expect = 2e-19 Identities = 95/109 (87%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| ||||| ||||||||||||||||| ||||| || ||||||||||| |||||||| | Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 788 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 |||||| ||||||||||| | || ||||| ||||||||||||||||| Sbjct: 787 aatggtcggcgaggttctccaaaggtccctttccggtgacgatggcttg 739
>gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 969 Score = 163 bits (82), Expect = 1e-36 Identities = 215/258 (83%), Gaps = 1/258 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 |||||||| | |||||||| || || |||||||||||||| || ||||||||||||||| Sbjct: 494 gggttgcccaagtagtccaatcctccgtcgctgaagatctgtgaaccggccttgaaccaa 435 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || || || ||||||||||| ||||| | |||| | ||| ||||| |||||||| || Sbjct: 434 accgcttctccgaacttcactccgttcctagccaatagctcagggaaaacgcagcctagg 375 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 ||||| ||||||||||| | || |||||| || || ||||| |||||| ||||||||||| Sbjct: 374 gctccgagcatggcccatctgctgtggataacttctagctcacggttcctggcgaaggtc 315 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || ||||| || || | ||||| ||||||| | |||||||| || |||||||||||||| Sbjct: 314 tctgggtcggcggatagaccagcggtgtccc-atccgtagtcaccggggaactcaccggt 256 Query: 461 caggtagctcgggggctc 478 ||||||||||||||||| Sbjct: 255 aaggtagctcgggggctc 238 Score = 105 bits (53), Expect = 2e-19 Identities = 95/109 (87%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| ||||| ||||||||||||||||| ||||| || ||||||||||| |||||||| | Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 788 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 |||||| ||||||||||| | || ||||| ||||||||||||||||| Sbjct: 787 aatggtcggcgaggttctccaaaggtccctttccggtgacgatggcttg 739
>gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 969 Score = 163 bits (82), Expect = 1e-36 Identities = 215/258 (83%), Gaps = 1/258 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 |||||||| | |||||||| || || |||||||||||||| || ||||||||||||||| Sbjct: 494 gggttgcccaagtagtccaatcctccgtcgctgaagatctgtgaaccggccttgaaccaa 435 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || || || ||||||||||| ||||| | |||| | ||| ||||| |||||||| || Sbjct: 434 accgcttctccgaacttcactccgttcctagccaatagctcagggaaaacgcagcctagg 375 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 ||||| ||||||||||| | || |||||| || || ||||| |||||| ||||||||||| Sbjct: 374 gctccgagcatggcccatctgctgtggataacttctagctcacggttcctggcgaaggtc 315 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || ||||| || || | ||||| ||||||| | |||||||| || |||||||||||||| Sbjct: 314 tctgggtcggcggatagaccagcggtgtccc-atccgtagtcaccggggaactcaccggt 256 Query: 461 caggtagctcgggggctc 478 ||||||||||||||||| Sbjct: 255 aaggtagctcgggggctc 238 Score = 105 bits (53), Expect = 2e-19 Identities = 95/109 (87%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| ||||| ||||||||||||||||| ||||| || ||||||||||| |||||||| | Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 788 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 |||||| ||||||||||| | || ||||| ||||||||||||||||| Sbjct: 787 aatggtcggcgaggttctccaaaggtccctttccggtgacgatggcttg 739
>gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 1024 Score = 163 bits (82), Expect = 1e-36 Identities = 215/258 (83%), Gaps = 1/258 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 |||||||| | |||||||| || || |||||||||||||| || ||||||||||||||| Sbjct: 494 gggttgcccaagtagtccaatcctccgtcgctgaagatctgtgaaccggccttgaaccaa 435 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || || || ||||||||||| ||||| | |||| | ||| ||||| |||||||| || Sbjct: 434 accgcttctccgaacttcactccgttcctagccaatagctcagggaaaacgcagcctagg 375 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 ||||| ||||||||||| | || |||||| || || ||||| |||||| ||||||||||| Sbjct: 374 gctccgagcatggcccatctgctgtggataacttctagctcacggttcctggcgaaggtc 315 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || ||||| || || | ||||| ||||||| | |||||||| || |||||||||||||| Sbjct: 314 tctgggtcggcggatagaccagcggtgtccc-atccgtagtcaccggggaactcaccggt 256 Query: 461 caggtagctcgggggctc 478 ||||||||||||||||| Sbjct: 255 aaggtagctcgggggctc 238 Score = 105 bits (53), Expect = 2e-19 Identities = 95/109 (87%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| ||||| ||||||||||||||||| ||||| || ||||||||||| |||||||| | Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 788 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 |||||| ||||||||||| | || ||||| ||||||||||||||||| Sbjct: 787 aatggtcggcgaggttctccaaaggtccctttccggtgacgatggcttg 739
>gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 995 Score = 163 bits (82), Expect = 1e-36 Identities = 215/258 (83%), Gaps = 1/258 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 |||||||| | |||||||| || || |||||||||||||| || ||||||||||||||| Sbjct: 494 gggttgcccaagtagtccaatcctccgtcgctgaagatctgtgaaccggccttgaaccaa 435 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || || || ||||||||||| ||||| | |||| | ||| ||||| |||||||| || Sbjct: 434 accgcttctccgaacttcactccgttcctagccaatagctcagggaaaacgcagcctagg 375 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 ||||| ||||||||||| | || |||||| || || ||||| |||||| ||||||||||| Sbjct: 374 gctccgagcatggcccatctgctgtggataacttctagctcacggttcctggcgaaggtc 315 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || ||||| || || | ||||| ||||||| | |||||||| || |||||||||||||| Sbjct: 314 tctgggtcggcggatagaccagcggtgtccc-atccgtagtcaccggggaactcaccggt 256 Query: 461 caggtagctcgggggctc 478 ||||||||||||||||| Sbjct: 255 aaggtagctcgggggctc 238 Score = 105 bits (53), Expect = 2e-19 Identities = 95/109 (87%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| ||||| ||||||||||||||||| ||||| || ||||||||||| |||||||| | Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 788 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 |||||| ||||||||||| | || ||||| ||||||||||||||||| Sbjct: 787 aatggtcggcgaggttctccaaaggtccctttccggtgacgatggcttg 739
>gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 969 Score = 163 bits (82), Expect = 1e-36 Identities = 215/258 (83%), Gaps = 1/258 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 |||||||| | |||||||| || || |||||||||||||| || ||||||||||||||| Sbjct: 494 gggttgcccaagtagtccaatcctccgtcgctgaagatctgtgaaccggccttgaaccaa 435 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || || || ||||||||||| ||||| | |||| | ||| ||||| |||||||| || Sbjct: 434 accgcttctccgaacttcactccgttcctagccaatagctcagggaaaacgcagcctagg 375 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 ||||| ||||||||||| | || |||||| || || ||||| |||||| ||||||||||| Sbjct: 374 gctccgagcatggcccatctgctgtggataacttctagctcacggttcctggcgaaggtc 315 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || ||||| || || | ||||| ||||||| | |||||||| || |||||||||||||| Sbjct: 314 tctgggtcggcggatagaccagcggtgtccc-atccgtagtcaccggggaactcaccggt 256 Query: 461 caggtagctcgggggctc 478 ||||||||||||||||| Sbjct: 255 aaggtagctcgggggctc 238 Score = 105 bits (53), Expect = 2e-19 Identities = 95/109 (87%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| ||||| ||||||||||||||||| ||||| || ||||||||||| |||||||| | Sbjct: 847 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 788 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 |||||| ||||||||||| | || ||||| ||||||||||||||||| Sbjct: 787 aatggtcggcgaggttctccaaaggtccctttccggtgacgatggcttg 739
>emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS62ZC05 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 903 Score = 163 bits (82), Expect = 1e-36 Identities = 215/258 (83%), Gaps = 1/258 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 |||||||| | |||||||| || || |||||||||||||| || ||||||||||||||| Sbjct: 475 gggttgcccaagtagtccaatcctccgtcgctgaagatctgtgaaccggccttgaaccaa 416 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || || || ||||||||||| ||||| | |||| | ||| ||||| |||||||| || Sbjct: 415 accgcttctccgaacttcactccgttcctagccaatagctcagggaaaacgcagcctagg 356 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 ||||| ||||||||||| | || |||||| || || ||||| |||||| ||||||||||| Sbjct: 355 gctccgagcatggcccatctgctgtggataacttctagctcacggttcctggcgaaggtc 296 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || ||||| || || | ||||| ||||||| | |||||||| || |||||||||||||| Sbjct: 295 tctgggtcggcggatagaccagcggtgtccc-atccgtagtcaccggggaactcaccggt 237 Query: 461 caggtagctcgggggctc 478 ||||||||||||||||| Sbjct: 236 aaggtagctcgggggctc 219 Score = 105 bits (53), Expect = 2e-19 Identities = 95/109 (87%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| ||||| ||||||||||||||||| ||||| || ||||||||||| |||||||| | Sbjct: 828 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 769 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 |||||| ||||||||||| | || ||||| ||||||||||||||||| Sbjct: 768 aatggtcggcgaggttctccaaaggtccctttccggtgacgatggcttg 720
>emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS5ZF09 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 885 Score = 163 bits (82), Expect = 1e-36 Identities = 215/258 (83%), Gaps = 1/258 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 |||||||| | |||||||| || || |||||||||||||| || ||||||||||||||| Sbjct: 478 gggttgcccaagtagtccaatcctccgtcgctgaagatctgtgaaccggccttgaaccaa 419 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || || || ||||||||||| ||||| | |||| | ||| ||||| |||||||| || Sbjct: 418 accgcttctccgaacttcactccgttcctagccaatagctcagggaaaacgcagcctagg 359 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 ||||| ||||||||||| | || |||||| || || ||||| |||||| ||||||||||| Sbjct: 358 gctccgagcatggcccatctgctgtggataacttctagctcacggttcctggcgaaggtc 299 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || ||||| || || | ||||| ||||||| | |||||||| || |||||||||||||| Sbjct: 298 tctgggtcggcggatagaccagcggtgtccc-atccgtagtcaccggggaactcaccggt 240 Query: 461 caggtagctcgggggctc 478 ||||||||||||||||| Sbjct: 239 aaggtagctcgggggctc 222 Score = 105 bits (53), Expect = 2e-19 Identities = 95/109 (87%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| ||||| ||||||||||||||||| ||||| || ||||||||||| |||||||| | Sbjct: 831 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 772 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 |||||| ||||||||||| | || ||||| ||||||||||||||||| Sbjct: 771 aatggtcggcgaggttctccaaaggtccctttccggtgacgatggcttg 723
>emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II chlorophyll a/b binding protein Length = 1405 Score = 163 bits (82), Expect = 1e-36 Identities = 215/258 (83%), Gaps = 1/258 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 |||||||| | |||||||| || || |||||||||||||| || ||||||||||||||| Sbjct: 743 gggttgcccaagtagtccaatcctccgtcgctgaagatctgtgaaccggccttgaaccaa 684 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || || || ||||||||||| ||||| | |||| | ||| ||||| |||||||| || Sbjct: 683 accgcttctccgaacttcactccgttcctagccaatagctcagggaaaacgcagcctagg 624 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 ||||| ||||||||||| | || |||||| || || ||||| |||||| ||||||||||| Sbjct: 623 gctccgagcatggcccatctgctgtggataacttctagctcacggttcctggcgaaggtc 564 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || ||||| || || | ||||| ||||||| | |||||||| || |||||||||||||| Sbjct: 563 tctgggtcggcggatagaccagcggtgtccc-atccgtagtcaccggggaactcaccggt 505 Query: 461 caggtagctcgggggctc 478 ||||||||||||||||| Sbjct: 504 aaggtagctcgggggctc 487 Score = 105 bits (53), Expect = 2e-19 Identities = 95/109 (87%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| ||||| ||||||||||||||||| ||||| || ||||||||||| |||||||| | Sbjct: 1096 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 1037 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 |||||| ||||||||||| | || ||||| ||||||||||||||||| Sbjct: 1036 aatggtcggcgaggttctccaaaggtccctttccggtgacgatggcttg 988
>emb|X02358.1|PECAB25 Petunia gene for chlorophyll a/b binding protein cab 25 Length = 1184 Score = 161 bits (81), Expect = 4e-36 Identities = 223/269 (82%), Gaps = 1/269 (0%) Strand = Plus / Minus Query: 218 cttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaac 277 ||||||||||| | |||||| || || || || ||||| || || ||||| ||||||||| Sbjct: 682 cttgggttgcccaagtagtcaagtccaccttcactgaaaatttgagatccagccttgaac 623 Query: 278 caaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccg 337 || ||||| ||||||||||| || || || ||||| | | ||| ||||||||||| || Sbjct: 622 catacagcttcaccgaacttgacaccattacgggcaaagagctcagggaagacgcaacca 563 Query: 338 agcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaag 397 || ||||||||||||||||| | ||||||||||||||||| ||| |||||||||||||| Sbjct: 562 agagctccaagcatggcccatctgcagtggatcacctccaactcccggttcttggcgaaa 503 Query: 398 gtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcacc 457 || || ||||| || || | |||||||| |||| |||| ||||| ||||| |||||||| Sbjct: 502 gtttctgggtctgctgaaagtccagcagtatccc-acccatagtcaccaggaaactcacc 444 Query: 458 ggtcaggtagctcgggggctcaccagaaa 486 |||| |||||| |||| ||||||||||| Sbjct: 443 agtcaagtagcttggggcctcaccagaaa 415 Score = 73.8 bits (37), Expect = 7e-10 Identities = 91/109 (83%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| |||||||| ||||| ||||| || ||||| ||||||||||| |||||||| || | Sbjct: 1029 actttccgggaacaaagtttgtggcaaaggcccacgcattgttgttaacggggtcagcaa 970 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 | || |||||||||||||| | |||||| || || ||||| || ||||| Sbjct: 969 ggtgatcagcgaggttctccaatggaccttttccagtgacaatagcttg 921
>gb|AF162200.1|AF162200 Lactuca sativa light-harvesting chlorophyll a/b binding protein mRNA, complete sequence; nuclear gene for chloroplast product Length = 643 Score = 161 bits (81), Expect = 4e-36 Identities = 181/213 (84%), Gaps = 1/213 (0%) Strand = Plus / Minus Query: 254 aagatctgggatccggccttgaaccaaacagcctcaccgaacttcacgccgtttcgggcc 313 |||||||||||||| ||||||||||| ||||||||||| ||||| || || || || ||| Sbjct: 244 aagatctgggatccagccttgaaccatacagcctcaccaaacttgacaccattacgcgcc 185 Query: 314 agcaactcggggaagacgcagccgagcgctccaagcatggcccaacggcagtggatcacc 373 | | |||||||||||||| || || ||||| ||||||||||| | || |||||| ||| Sbjct: 184 aagagttcggggaagacgcacccaagagctccgagcatggcccatctgctgtggatgacc 125 Query: 374 tccagctcgcggttcttggcgaaggtctcggggtcagcagacaacccagcagtgtcccaa 433 || ||||| |||||||||||||| || || || |||||||| | |||||||||||||||| Sbjct: 124 tcaagctcacggttcttggcgaatgtttcaggatcagcagagagcccagcagtgtcccaa 65 Query: 434 cccgtagtcgccagggaactcaccggtcaggta 466 |||||||| || |||||| ||||||||||||| Sbjct: 64 -ccgtagtcaccggggaacccaccggtcaggta 33 Score = 46.1 bits (23), Expect = 0.16 Identities = 41/47 (87%) Strand = Plus / Minus Query: 175 tggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 ||||||||||||||||| | ||| ||||| ||||| || |||||||| Sbjct: 566 tggtcagcgaggttctccaatggtccctttccggtaacaatggcttg 520
>gb|AF003129.1|AF003129 Mesembryanthemum crystallinum chlorophyll a/b-binding protein (CAB3) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1011 Score = 161 bits (81), Expect = 4e-36 Identities = 208/249 (83%), Gaps = 1/249 (0%) Strand = Plus / Minus Query: 218 cttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaac 277 ||||||||||| | |||||| || || ||||| || ||||| |||| ||| ||||||||| Sbjct: 511 cttgggttgcccaagtagtcgagtccaccctcactaaagatttgggctccagccttgaac 452 Query: 278 caaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccg 337 ||||||||||||||||| || || ||||| ||||||| | ||| |||||||| || || Sbjct: 451 caaacagcctcaccgaatttgacaccgttgcgggccaagagctctgggaagacacatcct 392 Query: 338 agcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaag 397 || ||||| | ||||||||| | |||||||||||||| ||||| |||||||| || || Sbjct: 391 agagctcctaacatggcccacctacagtggatcacctcaagctcacggttcttagcaaaa 332 Query: 398 gtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcacc 457 |||||||||||||| || | |||||||||||||||| || ||||| |||||||| ||||| Sbjct: 331 gtctcggggtcagctgagagcccagcagtgtcccaa-ccatagtcaccagggaattcacc 273 Query: 458 ggtcaggta 466 || ||||| Sbjct: 272 agtgaggta 264 Score = 91.7 bits (46), Expect = 3e-15 Identities = 94/110 (85%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 ||||||||||| | ||||| || ||||| ||||| ||||||||||| || ||||| || | Sbjct: 858 acttgccgggagcaaagtttgtagcgaaggcccaagcattgttgttaactgggtctgcaa 799 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttgg 222 |||| |||||||||||||| | ||||||||| ||||| || ||||||||| Sbjct: 798 gatgatcagcgaggttctccaatggaccctttccggtcacaatggcttgg 749
>gb|BT014208.1| Lycopersicon esculentum clone 133385R, mRNA sequence Length = 958 Score = 159 bits (80), Expect = 2e-35 Identities = 222/268 (82%), Gaps = 1/268 (0%) Strand = Plus / Minus Query: 217 gcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaa 276 |||||||||||| | |||||| || || || || |||||||||||||||||||||||||| Sbjct: 494 gcttgggttgcccaagtagtcaagtccaccttcactgaagatctgggatccggccttgaa 435 Query: 277 ccaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagcc 336 ||| ||||||||||||||||| || || || ||||||| | ||| |||||||| || || Sbjct: 434 ccacacagcctcaccgaacttgacaccattacgggccaagagctcagggaagacacatcc 375 Query: 337 gagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaa 396 || || |||||||| ||||| | ||||||||||||||| || || ||||||||||| || Sbjct: 374 aagagcaccaagcatagcccatctgcagtggatcacctcaagttcacggttcttggcaaa 315 Query: 397 ggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcac 456 || || ||||| || || | ||||| || |||| ||||||| || ||||| || |||| Sbjct: 314 agtttcagggtctgctgaaagtccagcggtatccc-acccgtaatcaccaggaaattcac 256 Query: 457 cggtcaggtagctcgggggctcaccaga 484 |||||| |||||| |||| ||||||||| Sbjct: 255 cggtcaagtagcttggggactcaccaga 228 Score = 87.7 bits (44), Expect = 5e-14 Identities = 89/104 (85%) Strand = Plus / Minus Query: 118 ccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcgagatgg 177 ||||| || ||||| |||||||| ||||| ||||||||||| |||||||| || || ||| Sbjct: 835 ccggggacaaagtttgtggcgaaagcccaggcattgttgtttacggggtctgcaaggtgg 776 Query: 178 tcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 ||||| |||||||| | ||||||||| |||||||| || ||||| Sbjct: 775 tcagcaaggttctccaatggaccctttccggtgacaatagcttg 732
>emb|AJ318069.1|STU318069 Solanum tuberosum mRNA for ferredoxin-thioredoxin-reductase catalytic subunit B (ftrbpot gene) Length = 701 Score = 159 bits (80), Expect = 2e-35 Identities = 224/268 (83%), Gaps = 3/268 (1%) Strand = Plus / Plus Query: 217 gcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaa 276 |||||||||||| | |||||| || || |||||||||||||| ||||||||||||||||| Sbjct: 345 gcttgggttgcccaagtagtcaagtccaccctcgctgaagatgtgggatccggccttgaa 404 Query: 277 ccaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagcc 336 ||| ||||||||||||||||| || || || ||||||| | ||| |||||||| || | Sbjct: 405 ccacacagcctcaccgaacttgacaccattacgggccaatagctcagggaagacaca-tc 463 Query: 337 gagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaa 396 || || |||||||| | ||| | ||||||||||||||| || || ||||||||||| || Sbjct: 464 aagagcaccaagcatag-ccatctgcagtggatcacctcgagttcacggttcttggcaaa 522 Query: 397 ggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcac 456 ||| || ||||| || || | ||||| || |||| |||||||||| |||||||| |||| Sbjct: 523 ggtttcagggtctgctgaaagtccagcggtatccc-acccgtagtcaccagggaattcac 581 Query: 457 cggtcaggtagctcgggggctcaccaga 484 |||||| |||||| |||| ||||||||| Sbjct: 582 cggtcaagtagcttggggactcaccaga 609
>emb|BX814757.1|CNS0AEAM Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB92ZG04 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 409 Score = 157 bits (79), Expect = 6e-35 Identities = 194/231 (83%), Gaps = 1/231 (0%) Strand = Plus / Plus Query: 248 tcgctgaagatctgggatccggccttgaaccaaacagcctcaccgaacttcacgccgttt 307 |||||||||||||| || ||||||||||||||||| || || ||||||||||| ||||| Sbjct: 2 tcgctgaagatctgtgaaccggccttgaaccaaaccgcttctccgaacttcactccgttc 61 Query: 308 cgggccagcaactcggggaagacgcagccgagcgctccaagcatggcccaacggcagtgg 367 | |||| | ||| ||||| |||||||| || ||||| ||||||||||| | || |||| Sbjct: 62 ctagccaatagctcagggaaaacgcagcctagggctccgagcatggcccatctgctgtgg 121 Query: 368 atcacctccagctcgcggttcttggcgaaggtctcggggtcagcagacaacccagcagtg 427 || || || ||||| |||||| ||||||||||||| ||||| || || | ||||| ||| Sbjct: 122 ataacttctagctcacggttcctggcgaaggtctctgggtcggcggatagaccagcggtg 181 Query: 428 tcccaacccgtagtcgccagggaactcaccggtcaggtagctcgggggctc 478 |||| | |||||||| || |||||||||||||| ||||||||||||||||| Sbjct: 182 tccc-atccgtagtcaccggggaactcaccggtaaggtagctcgggggctc 231
>emb|X52744.1|NTCAB40 Tabacco Cab40 mRNA for major chlorophyll a/b binding protein Length = 1080 Score = 157 bits (79), Expect = 6e-35 Identities = 221/267 (82%), Gaps = 1/267 (0%) Strand = Plus / Minus Query: 218 cttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaac 277 ||||||||||| | ||||| || || |||||||| || || || ||||| ||||||||| Sbjct: 518 cttgggttgcccaaatagtcaagtccaccctcgctaaaaatttgagatccagccttgaac 459 Query: 278 caaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccg 337 || |||||||| || ||||| || ||||| || |||| | ||| |||||||| || || Sbjct: 458 catacagcctcgccaaacttgacaccgttacgtgccaagagctcagggaagacacaacca 399 Query: 338 agcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaag 397 || ||||||||||||||||| | ||||||||||||||||| ||| || |||||||| || Sbjct: 398 agagctccaagcatggcccatctgcagtggatcacctccaactcacgattcttggcaaaa 339 Query: 398 gtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcacc 457 || || || ||||| || | ||||||||||||| |||||||||| |||||||||||||| Sbjct: 338 gtttctggatcagctgaaagtccagcagtgtccc-acccgtagtcaccagggaactcacc 280 Query: 458 ggtcaggtagctcgggggctcaccaga 484 |||| |||||| |||| ||||||||| Sbjct: 279 agtcaagtagcttggggactcaccaga 253 Score = 61.9 bits (31), Expect = 3e-06 Identities = 85/103 (82%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| |||||||| ||||| ||||| | ||||| ||||||||||| || ||||| || | Sbjct: 865 actttccgggaacaaagtttgtggcataggcccaggcattgttgttaactgggtctgcaa 806 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgat 215 | ||||| || |||||||| | ||||||||| || |||||||| Sbjct: 805 ggtggtcggcaaggttctccaatggaccctttccagtgacgat 763
>gb|AF003127.1|AF003127 Mesembryanthemum crystallinum chlorophyll a/b-binding protein (CAB) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1042 Score = 157 bits (79), Expect = 6e-35 Identities = 209/251 (83%), Gaps = 1/251 (0%) Strand = Plus / Minus Query: 217 gcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaa 276 |||||||||||| | |||||| ||||| ||||| |||||||| || | ||||||||||| Sbjct: 480 gcttgggttgcccaagtagtcaaggccaccctcactgaagatttgtgcaccggccttgaa 421 Query: 277 ccaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagcc 336 ||| || |||||||||||||| || ||||| || |||| | ||| |||||||| || || Sbjct: 420 ccatacggcctcaccgaacttgacaccgttgcgagccaagagctctgggaagacacatcc 361 Query: 337 gagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaa 396 || || || | ||| ||||| | ||||||||||||||| || ||||||||||| || || Sbjct: 360 cagagcacccaacatagcccatctgcagtggatcacctcaagttcgcggttcttagcaaa 301 Query: 397 ggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcac 456 |||||| ||||||||||| | ||||||||||||| |||||||||| |||||||| |||| Sbjct: 300 ggtctctgggtcagcagagagtccagcagtgtccc-acccgtagtcaccagggaattcac 242 Query: 457 cggtcaggtag 467 | || |||||| Sbjct: 241 cagtgaggtag 231 Score = 107 bits (54), Expect = 5e-20 Identities = 96/110 (87%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||||||||||||||||||||||||||| ||||| |||||||||||||| ||||| || | Sbjct: 826 acttgccgggaacgaagttggtggcgaaggcccaagcattgttgttgactgggtcagcaa 767 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttgg 222 | ||||| ||||||||||| | ||| ||||| || || || ||||||||| Sbjct: 766 ggtggtctgcgaggttctccaatgggccctttccagtcacaatggcttgg 717
>gb|DQ252493.1| Solanum tuberosum clone 062G02 chlorophyll a-b binding protein 3C-like mRNA, complete cds Length = 1055 Score = 157 bits (79), Expect = 6e-35 Identities = 221/267 (82%), Gaps = 1/267 (0%) Strand = Plus / Minus Query: 218 cttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaac 277 ||||||||||| | |||||| || || ||||||||||| || |||||||| ||||||||| Sbjct: 490 cttgggttgcccaagtagtcaagtccaccctcgctgaaaatttgggatccagccttgaac 431 Query: 278 caaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccg 337 || ||||| || || ||||| || || || ||||||| | ||| |||||||| || || Sbjct: 430 catacagcttcgccaaacttgacaccattacgggccaaaagctcagggaagacacatcca 371 Query: 338 agcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaag 397 || || |||||||||||||| | ||||||||||||||| ||||| |||||||| ||||| Sbjct: 370 agagcaccaagcatggcccatctgcagtggatcacctcaagctcacggttcttagcgaat 311 Query: 398 gtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcacc 457 || || |||||||| || | ||||||||||||| | |||||||| ||||| |||||||| Sbjct: 310 gtttcagggtcagctgaaagtccagcagtgtccc-atccgtagtcaccaggaaactcacc 252 Query: 458 ggtcaggtagctcgggggctcaccaga 484 |||| |||||| |||| |||||||| Sbjct: 251 agtcaagtagcttggggcttcaccaga 225
>gb|M21398.1|TOBCABB Tobacco chlorophyll a/b-binding protein (Cab-E) gene, complete cds Length = 1815 Score = 157 bits (79), Expect = 6e-35 Identities = 221/267 (82%), Gaps = 1/267 (0%) Strand = Plus / Minus Query: 218 cttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaac 277 ||||||||||| | |||||| || || |||||||| || || |||||||| ||||||||| Sbjct: 1430 cttgggttgcccaagtagtcaagtccaccctcgctaaaaatttgggatccagccttgaac 1371 Query: 278 caaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccg 337 || ||||| ||||||||||| || || || || |||| | ||||||||||| || || Sbjct: 1370 catacagcttcaccgaacttgacaccattacgtgccaagagttcggggaagacacaacca 1311 Query: 338 agcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaag 397 || ||||||||||||||||| | ||||||||||||||||| ||| |||||||||||||| Sbjct: 1310 agagctccaagcatggcccatctgcagtggatcacctccaactcacggttcttggcgaat 1251 Query: 398 gtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcacc 457 || || || ||||| || | || |||||||||| ||||||| || ||||| |||||||| Sbjct: 1250 gtttctggatcagctgaaagtccggcagtgtccc-acccgtaatcaccaggaaactcacc 1192 Query: 458 ggtcaggtagctcgggggctcaccaga 484 |||| |||||| || | ||||||||| Sbjct: 1191 agtcaagtagcttggagactcaccaga 1165
>dbj|AB012638.1| Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b-binding protein, complete cds Length = 7299 Score = 157 bits (79), Expect = 6e-35 Identities = 221/267 (82%), Gaps = 1/267 (0%) Strand = Plus / Plus Query: 218 cttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaac 277 ||||||||||| | |||||| || || ||||||||||| |||||||| || ||||||||| Sbjct: 2219 cttgggttgcccaagtagtcaagaccaccctcgctgaaaatctgggaaccagccttgaac 2278 Query: 278 caaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccg 337 || ||||| || |||||||| || ||||| || |||| | |||||||||||| || || Sbjct: 2279 catacagcttctccgaacttgacaccgttacgtgccaagagctcggggaagacacaacca 2338 Query: 338 agcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaag 397 || ||||||||||||||||| | ||||||||||||||||| ||| ||||||||||| || Sbjct: 2339 agagctccaagcatggcccatctgcagtggatcacctccaactcacggttcttggcaaaa 2398 Query: 398 gtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcacc 457 || || || ||||| || | ||||||||||||| | || ||||| || || |||||||| Sbjct: 2399 gtttctggatcagctgaaagtccagcagtgtccc-atccatagtcacctggaaactcacc 2457 Query: 458 ggtcaggtagctcgggggctcaccaga 484 |||| |||||| || | ||||||||| Sbjct: 2458 agtcaagtagcttggagactcaccaga 2484 Score = 133 bits (67), Expect = 9e-28 Identities = 218/267 (81%), Gaps = 1/267 (0%) Strand = Plus / Minus Query: 218 cttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaac 277 ||||||||||| | |||||| || || || || ||||| || || ||||| ||||||||| Sbjct: 4814 cttgggttgcccaagtagtcaagtccaccttcactgaaaatttgagatccagccttgaac 4755 Query: 278 caaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccg 337 || || ||||| || ||||| || || || ||||||| | |||||||||||| || || Sbjct: 4754 catacggcctcgccaaacttaacaccattacgggccaagagctcggggaagacacaacca 4695 Query: 338 agcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaag 397 || ||||||||||| ||||| | ||||||||||||||||| ||| |||||||| || || Sbjct: 4694 agagctccaagcattgcccatctgcagtggatcacctccaactcacggttcttagcaaaa 4635 Query: 398 gtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcacc 457 || || || ||||| || | ||||||||||||| |||||||||| |||||||| ||||| Sbjct: 4634 gtttctggatcagctgaaagtccagcagtgtccc-acccgtagtcaccagggaattcacc 4576 Query: 458 ggtcaggtagctcgggggctcaccaga 484 |||| |||||| || | ||||||||| Sbjct: 4575 agtcaagtagcttggagactcaccaga 4549 Score = 73.8 bits (37), Expect = 7e-10 Identities = 91/109 (83%) Strand = Plus / Plus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| |||||||| ||||| ||||| | ||||| || |||||||| || ||||| || | Sbjct: 1872 actttccgggaacaaagtttgtggcataggcccaagcgttgttgttaactgggtcagcaa 1931 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 ||||||| || |||||||| | ||||||||| ||||||||||| ||||| Sbjct: 1932 gatggtcggcaaggttctccaatggaccctttccggtgacgatagcttg 1980 Score = 69.9 bits (35), Expect = 1e-08 Identities = 86/103 (83%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| |||||||| ||||| ||||| ||||||| ||||||||||| || ||||| || | Sbjct: 5161 actttccgggaacaaagttagtggcatatgcccaggcattgttgttaactgggtcagcaa 5102 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgat 215 | ||||| || |||||||| | |||||| || ||||||||||| Sbjct: 5101 ggtggtcggcaaggttctccaatggaccttttccggtgacgat 5059
>gb|AY617096.1| Picea sitchensis chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 763 Score = 155 bits (78), Expect = 2e-34 Identities = 202/242 (83%), Gaps = 1/242 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 ||||| || |||||||| ||||| ||||||||||||||||| | ||| ||||||||||| Sbjct: 466 gggtttcccaggtagtcaaggcctccctcgctgaagatctgagctcccgccttgaaccac 407 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || ||||| |||||||| || ||||||| |||||| | ||| ||||| |||||||| || Sbjct: 406 accgcctccccgaacttgactccgtttctggccaggagctccgggaaaacgcagcccaga 347 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 || || ||||| ||||| |||| ||||||||| |||||||| | ||||||||| || ||| Sbjct: 346 gcgcccagcattgcccaccggctgtggatcacttccagctctctgttcttggcaaacgtc 287 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || || || || || | ||| || ||||||| |||||||||| || |||||||||||||| Sbjct: 286 tccggatctgccgaaagccccgccgtgtccc-acccgtagtcacccgggaactcaccggt 228 Query: 461 ca 462 || Sbjct: 227 ca 226
>emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB71ZG07 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 919 Score = 155 bits (78), Expect = 2e-34 Identities = 214/258 (82%), Gaps = 1/258 (0%) Strand = Plus / Plus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 |||||||| | |||||||| || || |||||||||||||| || ||||||||||||||| Sbjct: 441 gggttgcccaagtagtccaatcctccgtcgctgaagatctgtgaaccggccttgaaccaa 500 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || || || ||||||||||| ||||| | |||| | ||| ||||| |||||||| || Sbjct: 501 accgcttctccgaacttcactccgttcctagccaatagctcagggaaaacgcagcctagg 560 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 ||||| ||||||||||| | || |||||| || || ||||| |||| | ||||||||||| Sbjct: 561 gctccgagcatggcccatctgctgtggataacttctagctcacggtccctggcgaaggtc 620 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || ||||| || || | ||||| ||||||| | |||||||| || |||||||||||||| Sbjct: 621 tctgggtcggcggatagaccagcggtgtccc-atccgtagtcaccggggaactcaccggt 679 Query: 461 caggtagctcgggggctc 478 ||||||||||||||||| Sbjct: 680 aaggtagctcgggggctc 697 Score = 105 bits (53), Expect = 2e-19 Identities = 95/109 (87%) Strand = Plus / Plus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| ||||| ||||||||||||||||| ||||| || ||||||||||| |||||||| | Sbjct: 88 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 147 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 |||||| ||||||||||| | || ||||| ||||||||||||||||| Sbjct: 148 aatggtcggcgaggttctccaaaggtccctttccggtgacgatggcttg 196
>emb|X81810.1|PALHCB122 P.abies (L.)Karst. Lhcb1*2-2 mRNA for light-harvesting chlorophyll a/b-binding protein Length = 1050 Score = 155 bits (78), Expect = 2e-34 Identities = 202/242 (83%), Gaps = 1/242 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 ||||| || |||||||| ||||| ||||||||||||||||| | ||| ||||||||||| Sbjct: 500 gggtttcccaggtagtcaaggcctccctcgctgaagatctgagctcccgccttgaaccac 441 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || ||||| |||||||| || ||||||| |||||| | ||| ||||| |||||||| || Sbjct: 440 accgcctccccgaacttgactccgtttctggccaggagctccgggaaaacgcagcccaga 381 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 || || ||||| ||||| |||| ||||||||| |||||||| | ||||||||| || ||| Sbjct: 380 gcgcccagcattgcccaccggctgtggatcacttccagctctctgttcttggcaaacgtc 321 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || || || || || | ||| || ||||||| |||||||||| || |||||||||||||| Sbjct: 320 tccggatctgccgaaagccccgccgtgtccc-acccgtagtcacccgggaactcaccggt 262 Query: 461 ca 462 || Sbjct: 261 ca 260 Score = 48.1 bits (24), Expect = 0.041 Identities = 84/104 (80%) Strand = Plus / Minus Query: 115 ttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcgaga 174 ||||| || |||||||| || ||| | ||||| || |||||| | || |||||||| || Sbjct: 848 ttgcctgggacgaagttagtagcgtaggcccaggcgttgttggtaaccgggtcggccagg 789 Query: 175 tggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 || |||||||| ||||||| || || || |||||||||||||| Sbjct: 788 tgatcagcgagattctcgatgggtcctttaccggtgacgatggc 745
>emb|X81809.1|PALHCB12 P.abies (L.)Karst. Lhcb1*2-1 mRNA for light-harvesting chlorophyll a/b-binding protein Length = 1062 Score = 155 bits (78), Expect = 2e-34 Identities = 202/242 (83%), Gaps = 1/242 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 ||||| || |||||||| ||||| ||||||||||||||||| | ||| ||||||||||| Sbjct: 497 gggtttcccaggtagtcaaggcctccctcgctgaagatctgagctcccgccttgaaccac 438 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || ||||| |||||||| || ||||||| |||||| | ||| ||||| |||||||| || Sbjct: 437 accgcctccccgaacttgactccgtttctggccaggagctccgggaaaacgcagcccaga 378 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 || || ||||| ||||| |||| ||||||||| |||||||| | ||||||||| || ||| Sbjct: 377 gcgcccagcattgcccaccggctgtggatcacttccagctctctgttcttggcaaacgtc 318 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || || || || || | ||| || ||||||| |||||||||| || |||||||||||||| Sbjct: 317 tccggatctgccgaaagccccgccgtgtccc-acccgtagtcacccgggaactcaccggt 259 Query: 461 ca 462 || Sbjct: 258 ca 257 Score = 48.1 bits (24), Expect = 0.041 Identities = 84/104 (80%) Strand = Plus / Minus Query: 115 ttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcgaga 174 ||||| || |||||||| || ||| | ||||| || |||||| | || |||||||| || Sbjct: 845 ttgcctgggacgaagttagtagcgtaggcccaggcgttgttggtaaccgggtcggccagg 786 Query: 175 tggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 || |||||||| ||||||| || || || |||||||||||||| Sbjct: 785 tgatcagcgagattctcgatgggtcctttaccggtgacgatggc 742
>emb|X52743.1|NTCAB21 Tabacco Cab21 mRNA for major chlorophyll a/b binding protein Length = 953 Score = 153 bits (77), Expect = 1e-33 Identities = 219/265 (82%), Gaps = 1/265 (0%) Strand = Plus / Minus Query: 217 gcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaa 276 |||||||||||| | |||||| || || |||||||| ||||| |||||||| |||||||| Sbjct: 512 gcttgggttgcccaagtagtcaagtccaccctcgctaaagatttgggatccagccttgaa 453 Query: 277 ccaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagcc 336 ||| |||||||| || ||||| || || || ||||||| | |||||||||||| || || Sbjct: 452 ccacacagcctcgccaaacttgacaccattacgggccaagagctcggggaagacacatcc 393 Query: 337 gagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaa 396 || || |||||||| ||||| | ||||||||||||||| || || ||||||||||| || Sbjct: 392 aagagcaccaagcatagcccatctgcagtggatcacctcgagttcacggttcttggcaaa 333 Query: 397 ggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcac 456 ||| || ||||| || || | |||||||| |||| ||||||| || || ||||| |||| Sbjct: 332 ggtttctgggtctgctgaaagtccagcagtatccc-acccgtaatcaccggggaattcac 274 Query: 457 cggtcaggtagctcgggggctcacc 481 |||||| |||||| |||| |||||| Sbjct: 273 cggtcaagtagcttggggactcacc 249 Score = 71.9 bits (36), Expect = 3e-09 Identities = 75/88 (85%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| ||||| || ||||| |||||| ||||||| ||||||||||| || ||||| || | Sbjct: 858 actttccggggacaaagtttgtggcgtatgcccaagcattgttgttaactgggtctgcaa 799 Query: 173 gatggtcagcgaggttctcgagtggacc 200 |||||||||| |||||||| | |||||| Sbjct: 798 gatggtcagcaaggttctccaatggacc 771
>gb|U39475.1|GMU39475 Glycine max chlorophyll a/b-binding protein (cab3) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 977 Score = 153 bits (77), Expect = 1e-33 Identities = 222/269 (82%), Gaps = 1/269 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 ||||||||||||| | ||||||||| || |||||||||||||||||||| |||||||||| Sbjct: 476 ggcttgggttgcccaagtagtccagcccaccctcgctgaagatctgggacccggccttga 417 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| ||||| || || ||||| || ||||| |||| || | |||||||||||||||| Sbjct: 416 accacacagcttctccaaacttgaccccgttgcgggacaatagttcggggaagacgcagc 357 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 | | || || ||||||||||| | | |||||||||| || ||||| |||| |||||| Sbjct: 356 ccaaggccccgagcatggcccacctggagtggatcacttcgagctcagggtttctggcga 297 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 |||| || ||||| || || | |||||||||||||| | |||||||| || |||||||| Sbjct: 296 aggtttctgggtcggccgaaagcccagcagtgtccc-agccgtagtcacctgggaactcg 238 Query: 456 ccggtcaggtagctcgggggctcaccaga 484 || || |||||| ||||||||| ||||| Sbjct: 237 ccagtgaggtaggacgggggctcgccaga 209 Score = 99.6 bits (50), Expect = 1e-17 Identities = 92/106 (86%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||||||||| ||||||||||||||| | ||||| |||||||||||||| ||||| || | Sbjct: 821 acttgccggggacgaagttggtggcgtaggcccaggcattgttgttgactgggtccgcaa 762 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 | || ||||| |||||||| | ||||||||| |||||||| ||||| Sbjct: 761 ggtgatcagcaaggttctccaatggacccttaccggtgacaatggc 716
>dbj|AB012637.1| Nicotiana sylvestris Lhcb1*2, Lhcb1*3, Lhcb1*4 genes for light harvesting chlorophyll a/b-binding protein, complete cds Length = 7965 Score = 153 bits (77), Expect = 1e-33 Identities = 219/265 (82%), Gaps = 1/265 (0%) Strand = Plus / Minus Query: 217 gcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaa 276 |||||||||||| | ||||| || || || ||||||||||| ||||||||||||||||| Sbjct: 4784 gcttgggttgcccaaatagtcaagtccaccatcgctgaagatttgggatccggccttgaa 4725 Query: 277 ccaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagcc 336 ||| |||||||| || ||||| || ||||| ||||||| | |||||||||||| || || Sbjct: 4724 ccacacagcctcgccaaacttaacaccgttacgggccaagagctcggggaagacacatcc 4665 Query: 337 gagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaa 396 || || |||||||| ||||| | ||||||||||||||| ||||| ||||||||||| || Sbjct: 4664 aagagcaccaagcatagcccatctgcagtggatcacctcgagctcacggttcttggcaaa 4605 Query: 397 ggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcac 456 ||| || || || || || | |||||||| |||| |||| ||||| || || || |||| Sbjct: 4604 ggtttctggatctgctgaaagtccagcagtatccc-acccatagtcaccgggaaattcac 4546 Query: 457 cggtcaggtagctcgggggctcacc 481 |||||| |||||| |||| |||||| Sbjct: 4545 cggtcaagtagcttggggactcacc 4521 Score = 129 bits (65), Expect = 1e-26 Identities = 216/265 (81%), Gaps = 1/265 (0%) Strand = Plus / Minus Query: 217 gcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaa 276 |||||||||||| | |||||| || || |||||||| ||||| |||||||| |||||||| Sbjct: 7324 gcttgggttgcccaagtagtcaagtccaccctcgctaaagatttgggatccagccttgaa 7265 Query: 277 ccaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagcc 336 ||| ||||| || || ||||| || ||||| || |||| | ||| |||||||| || || Sbjct: 7264 ccagacagcttcgccaaacttgacaccgttacgagccaagagctcagggaagacacatcc 7205 Query: 337 gagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaa 396 || || |||||||| ||||| | ||||||||||||||| || || ||||||||||| || Sbjct: 7204 aagagcaccaagcatagcccatctgcagtggatcacctcgagttcacggttcttggcaaa 7145 Query: 397 ggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcac 456 ||| || || || || || | |||||||| |||| ||||||| || || ||||| |||| Sbjct: 7144 ggtttctggatccgctgaaagtccagcagtatccc-acccgtaatcacctgggaattcac 7086 Query: 457 cggtcaggtagctcgggggctcacc 481 |||||| |||||| |||| |||||| Sbjct: 7085 cggtcaagtagcttggggcctcacc 7061 Score = 123 bits (62), Expect = 9e-25 Identities = 219/270 (81%), Gaps = 1/270 (0%) Strand = Plus / Minus Query: 217 gcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaa 276 |||||| ||||| | |||||| || || |||||||| ||||| || ||||| |||||||| Sbjct: 2331 gcttggattgcccaagtagtcaagtccaccctcgctaaagatttgtgatccagccttgaa 2272 Query: 277 ccaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagcc 336 ||| ||||||||||| ||||| ||||| || ||||||| | ||||||||| || || || Sbjct: 2271 ccatacagcctcaccaaacttgacgccattacgggccaagagctcggggaaaacacatcc 2212 Query: 337 gagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaa 396 || || |||||||| ||||| | |||||| |||||||| || || ||||||||||| || Sbjct: 2211 aagagcaccaagcatagcccatctgcagtgaatcacctcgagttcacggttcttggcaaa 2152 Query: 397 ggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcac 456 || || ||||| || || | |||||||| |||| |||| ||||| |||||||| |||| Sbjct: 2151 agtttctgggtcggctgaaagtccagcagtatccc-acccatagtcaccagggaattcac 2093 Query: 457 cggtcaggtagctcgggggctcaccagaaa 486 | |||| ||||| || | ||||||||||| Sbjct: 2092 cagtcaaatagcttggagactcaccagaaa 2063 Score = 56.0 bits (28), Expect = 2e-04 Identities = 85/104 (81%) Strand = Plus / Minus Query: 118 ccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcgagatgg 177 ||||| || ||||| |||||| | ||||| ||||||||||| || ||||| || || ||| Sbjct: 7665 ccggggacaaagtttgtggcgtaggcccaagcattgttgttaactgggtctgcaaggtgg 7606 Query: 178 tcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 ||||| |||||||| | ||| ||||| || || || |||||||| Sbjct: 7605 tcagcaaggttctctaatgggccctttccagtaacaatggcttg 7562 Score = 44.1 bits (22), Expect = 0.63 Identities = 43/50 (86%) Strand = Plus / Minus Query: 151 ttgttgttgacggggtcggcgagatggtcagcgaggttctcgagtggacc 200 |||||||| || ||||| || ||||||||||| |||||||| | |||||| Sbjct: 2639 ttgttgttaactgggtcagcaagatggtcagcaaggttctccaatggacc 2590
>gb|AY389597.1| Hyacinthus orientalis chloroplast chlorophyll a/b-binding protein mRNA, partial cds Length = 575 Score = 151 bits (76), Expect = 4e-33 Identities = 112/124 (90%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| |||||||| |||||||||| |||||||||||||||||||||| ||||||||||| Sbjct: 125 ggctggggttgcccaggtagtccaatccgccctcgctgaagatctgggctccggccttga 66 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| || ||||| ||||||||||||||||| ||||| || | ||||||||||||||||| Sbjct: 65 accagaccgcctcgccgaacttcacgccgttgcgggcgaggagctcggggaagacgcagc 6 Query: 336 cgag 339 |||| Sbjct: 5 cgag 2 Score = 93.7 bits (47), Expect = 8e-16 Identities = 89/103 (86%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||||||||| || ||||||||||| || ||||| ||||||||||||||||||||||||| Sbjct: 470 acttgccggggacaaagttggtggcaaaagcccaggcattgttgttgacggggtcggcga 411 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgat 215 | || || || | |||||| | ||| ||||||||||| ||||| Sbjct: 410 ggtgatcggccaagttctccaatggccccttgccggtcacgat 368
>emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-harvesting chlorophyll a/b-binding protein Length = 1078 Score = 151 bits (76), Expect = 4e-33 Identities = 206/248 (83%), Gaps = 1/248 (0%) Strand = Plus / Minus Query: 219 ttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaacc 278 ||||| |||| |||||||| || || ||||||||||||||||| | ||| |||||||||| Sbjct: 488 ttgggctgcccaggtagtcaagccctccctcgctgaagatctgagctcccgccttgaacc 429 Query: 279 aaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccga 338 | || |||||||||||||| || ||||||| ||| || | ||| ||||| |||||||| | Sbjct: 428 acaccgcctcaccgaactttactccgtttctggcaaggagctctgggaatacgcagccca 369 Query: 339 gcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaagg 398 | || || | ||||||||| |||| ||||||||| |||||||| | |||||| ||||| | Sbjct: 368 gagcacccaacatggcccatcggccgtggatcacttccagctctctgttcttcgcgaacg 309 Query: 399 tctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccg 458 |||| || || || |||| ||| || ||||||| |||||||||| || ||||| |||||| Sbjct: 308 tctccggatctgccgacagccccgccgtgtccc-acccgtagtcacccgggaattcaccg 250 Query: 459 gtcaggta 466 || ||||| Sbjct: 249 gttaggta 242 Score = 63.9 bits (32), Expect = 7e-07 Identities = 77/92 (83%) Strand = Plus / Minus Query: 127 aagttggtggcgaatgcccatgcattgttgttgacggggtcggcgagatggtcagcgagg 186 |||||||||||| | ||||| || ||||||||||| ||||| ||||| || || |||||| Sbjct: 822 aagttggtggcgtaggcccaggcgttgttgttgacagggtcagcgaggtgatcggcgagg 763 Query: 187 ttctcgagtggacccttgccggtgacgatggc 218 ||||| || || || ||||| || |||||||| Sbjct: 762 ttctctaggggtcctttgcctgtcacgatggc 731
>gb|M14443.1|TOMCBPA Tomato chlorophyll a/b-binding protein gene Cab-1B, complete cds Length = 1253 Score = 151 bits (76), Expect = 4e-33 Identities = 221/268 (82%), Gaps = 1/268 (0%) Strand = Plus / Minus Query: 217 gcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaa 276 |||||||||||| | |||||| || || || || |||||||||||||||||||||||||| Sbjct: 640 gcttgggttgcccaagtagtcaagtccaccttcactgaagatctgggatccggccttgaa 581 Query: 277 ccaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagcc 336 ||| ||||||||||||||||| || || || ||||||| | ||| |||||||| || || Sbjct: 580 ccacacagcctcaccgaacttgacaccattacgggccaagagctcagggaagacacatcc 521 Query: 337 gagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaa 396 || || |||||||| ||||| | |||||||||||| || || || ||||||||||| || Sbjct: 520 aagagcaccaagcatagcccatctgcagtggatcacttcaagttcacggttcttggcaaa 461 Query: 397 ggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcac 456 || || ||||| || || | ||||| || |||| ||||||| || ||||| || |||| Sbjct: 460 agtttcagggtctgctgaaagtccagcggtatccc-acccgtaatcaccaggaaattcac 402 Query: 457 cggtcaggtagctcgggggctcaccaga 484 |||||| |||||| |||| ||||||||| Sbjct: 401 cggtcaagtagcttggggactcaccaga 374 Score = 79.8 bits (40), Expect = 1e-11 Identities = 88/104 (84%) Strand = Plus / Minus Query: 118 ccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcgagatgg 177 ||||| || ||||| |||||||| ||||| ||||||||||| |||||||| || || || Sbjct: 981 ccggggacaaagtttgtggcgaaagcccaggcattgttgtttacggggtctgcaaggtga 922 Query: 178 tcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 ||||| |||||||| | ||||||||| |||||||| || ||||| Sbjct: 921 tcagcaaggttctccaatggaccctttccggtgacaatagcttg 878
>gb|U21112.1|STU21112 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-3 gene, nuclear gene encoding chloroplast protein, complete cds Length = 798 Score = 149 bits (75), Expect = 1e-32 Identities = 220/267 (82%), Gaps = 1/267 (0%) Strand = Plus / Minus Query: 218 cttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaac 277 |||||||| || | |||||| || || ||||| | |||||| |||||||| || |||||| Sbjct: 449 cttgggtttcccaagtagtcaagtccaccctcacggaagatttgggatccagctttgaac 390 Query: 278 caaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccg 337 || ||||||||||||||||| || ||||| ||||||| | ||| |||||||| || || Sbjct: 389 cacacagcctcaccgaacttgacaccgttacgggccaagagctcagggaagacacatcca 330 Query: 338 agcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaag 397 || || |||||||| ||||| | ||||||||||||||| || || ||||||||||| ||| Sbjct: 329 agagcaccaagcatagcccatctgcagtggatcacctcgagttcacggttcttggcaaag 270 Query: 398 gtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcacc 457 || || ||||| || || | ||||| || |||| |||||||||| |||||||| ||||| Sbjct: 269 gtttcagggtctgctgaaagtccagcggtatccc-acccgtagtcaccagggaattcacc 211 Query: 458 ggtcaggtagctcgggggctcaccaga 484 |||| |||||| |||| ||||||||| Sbjct: 210 agtcaagtagcttggggactcaccaga 184
>gb|M21397.1|TOBCABA Tobacco chlorophyll a/b-binding protein (Cab-C) gene, complete cds Length = 1240 Score = 149 bits (75), Expect = 1e-32 Identities = 220/267 (82%), Gaps = 1/267 (0%) Strand = Plus / Minus Query: 218 cttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaac 277 ||||||||||| | |||||| || || |||| |||||| || |||||||| |||||||| Sbjct: 891 cttgggttgcccaagtagtcaagtccaccctggctgaaaatttgggatccacccttgaac 832 Query: 278 caaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccg 337 || ||||||||||||||||| || || || ||||||| | |||||| ||||| || || Sbjct: 831 catacagcctcaccgaacttaacaccattacgggccaagagctcgggaaagacacaacca 772 Query: 338 agcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaag 397 || ||||||||||||||||| | |||||||||||||||| ||| ||||||||||| || Sbjct: 771 agagctccaagcatggcccatctacagtggatcacctccaactcacggttcttggcaaaa 712 Query: 398 gtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcacc 457 || || || ||||| || | |||||||| |||| | || ||||| |||||||||||||| Sbjct: 711 gtttcaggatcagctgaaagtccagcagtatccc-atccatagtcaccagggaactcacc 653 Query: 458 ggtcaggtagctcgggggctcaccaga 484 |||| |||||| || | ||||||||| Sbjct: 652 agtcaagtagcttggagactcaccaga 626 Score = 50.1 bits (25), Expect = 0.010 Identities = 73/89 (82%) Strand = Plus / Minus Query: 127 aagttggtggcgaatgcccatgcattgttgttgacggggtcggcgagatggtcagcgagg 186 ||||| |||||| | |||||||| ||||| || || ||||| || ||||| || || ||| Sbjct: 1224 aagtttgtggcgtaggcccatgcgttgttattaactgggtctgcaagatgatcggcaagg 1165 Query: 187 ttctcgagtggacccttgccggtgacgat 215 || || | ||||||||| ||||||||||| Sbjct: 1164 ttttccaatggaccctttccggtgacgat 1136
>emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL5ZG08 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 911 Score = 147 bits (74), Expect = 6e-32 Identities = 213/258 (82%), Gaps = 1/258 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 |||||||| | |||||||| || || |||||||||||||| || ||||||||||||||| Sbjct: 478 gggttgcccaagtagtccaatcctccgtcgctgaagatctgtgaaccggccttgaaccaa 419 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || || || ||||||||||| ||||| | |||| | ||| ||||| |||||||| || Sbjct: 418 accgcttctccgaacttcactccgttcctagccaatagctcagggaaaacgcagcctagg 359 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 ||||| ||||||||||| | || |||||| || || |||| |||||| |||||||||| Sbjct: 358 gctccgagcatggcccatctgctgtggataacttctcgctcacggttcctggcgaaggtt 299 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || ||||| || || | ||||| ||||||| | |||||||| || |||||||||||||| Sbjct: 298 tctgggtcggcggatagaccagcggtgtccc-atccgtagtcaccggggaactcaccggt 240 Query: 461 caggtagctcgggggctc 478 ||||||||||||||||| Sbjct: 239 aaggtagctcgggggctc 222 Score = 89.7 bits (45), Expect = 1e-14 Identities = 94/109 (86%), Gaps = 1/109 (0%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| ||||| ||||| ||||||||||| ||||| || ||||||||||| |||||||| | Sbjct: 830 actttccggggacgaa-ttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 772 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 |||||| ||||||||||| | || ||||| ||||||||||||||||| Sbjct: 771 aatggtcggcgaggttctccaaaggtccctttccggtgacgatggcttg 723
>emb|X03907.1|ATLHCP1 A.thaliana gene (LHCP AB 165) for chlorophyll a/b binding protein Length = 999 Score = 147 bits (74), Expect = 6e-32 Identities = 186/222 (83%), Gaps = 1/222 (0%) Strand = Plus / Minus Query: 248 tcgctgaagatctgggatccggccttgaaccaaacagcctcaccgaacttcacgccgttt 307 |||||||||||||| || || |||||||||||||||||||| || ||||| || ||||| Sbjct: 567 tcgctgaagatctgtgaaccagccttgaaccaaacagcctctccaaacttgactccgttc 508 Query: 308 cgggccagcaactcggggaagacgcagccgagcgctccaagcatggcccaacggcagtgg 367 | ||||| | ||| |||||||||||||| || ||||| ||||||||||| | || |||| Sbjct: 507 ctggccaaaagctcagggaagacgcagcctagggctccgagcatggcccacctgctgtgg 448 Query: 368 atcacctccagctcgcggttcttggcgaaggtctcggggtcagcagacaacccagcagtg 427 || || || ||||| |||||| | ||||| |||||||||||||| || | ||||| ||| Sbjct: 447 ataacttctagctcacggttccttgcgaatgtctcggggtcagcggatagaccagctgtg 388 Query: 428 tcccaacccgtagtcgccagggaactcaccggtcaggtagct 469 |||| | |||||||| ||||||||||| ||||| |||||||| Sbjct: 387 tccc-atccgtagtctccagggaactctccggtaaggtagct 347 Score = 81.8 bits (41), Expect = 3e-12 Identities = 92/109 (84%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| |||||||| ||||||||||| || ||||| || ||||||||||| || ||||| | Sbjct: 947 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggcca 888 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 ||||||||| |||||||| | || ||||| || |||||||||||||| Sbjct: 887 aatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttg 839
>gb|AF165529.1|AF165529 Rumex palustris chlorophyll a/b binding protein (CAB1) mRNA, complete cds Length = 986 Score = 147 bits (74), Expect = 6e-32 Identities = 180/214 (84%), Gaps = 1/214 (0%) Strand = Plus / Minus Query: 253 gaagatctgggatccggccttgaaccaaacagcctcaccgaacttcacgccgtttcgggc 312 |||||||||||| |||||||||||||| || ||||| ||||||| || ||||| | Sbjct: 465 gaagatctgggacccggccttgaaccacaccgcctccccgaactggaccccgttcttcga 406 Query: 313 cagcaactcggggaagacgcagccgagcgctccaagcatggcccaacggcagtggatcac 372 ||| | ||| ||||||||||| ||||| || || ||||||||||| | |||||||||| Sbjct: 405 caggagctccgggaagacgcaaccgagagcgccgagcatggcccacctcgagtggatcac 346 Query: 373 ctccagctcgcggttcttggcgaaggtctcggggtcagcagacaacccagcagtgtccca 432 ||||||||| |||||| ||||||| ||||| ||||| || |||| |||||||||||||| Sbjct: 345 ctccagctcacggttcctggcgaaagtctctgggtccgccgacagcccagcagtgtccc- 287 Query: 433 acccgtagtcgccagggaactcaccggtcaggta 466 | ||||||||||| |||||||| ||||||||||| Sbjct: 286 atccgtagtcgccggggaactctccggtcaggta 253 Score = 52.0 bits (26), Expect = 0.003 Identities = 86/106 (81%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 ||||||||||||||||||| |||||| | ||||| || |||||| || || || || | Sbjct: 847 acttgccgggaacgaagttagtggcgtaagcccaagcgttgttggcaacaggatcagcaa 788 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 ||||| | |||||||| | ||| |||||||||||||||||||| Sbjct: 787 tgtggtcgactaggttctcaactgggcccttgccggtgacgatggc 742
>gb|DQ124219.1| Fagus sylvatica putative chlorophyll a/b-binding protein mRNA, partial cds Length = 780 Score = 143 bits (72), Expect = 9e-31 Identities = 220/268 (82%), Gaps = 1/268 (0%) Strand = Plus / Minus Query: 217 gcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaa 276 ||||||||| || | |||||| || || || || ||||| || |||| ||| |||||||| Sbjct: 438 gcttgggttacccaagtagtcaagcccaccttcactgaaaatttgggctccagccttgaa 379 Query: 277 ccaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagcc 336 |||||| |||||||| ||||| || ||||| ||||||| | ||| |||||||| || || Sbjct: 378 ccaaacggcctcaccaaacttaaccccgttacgggccaagagctcagggaagacacaccc 319 Query: 337 gagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaa 396 || ||||||||||||||||| | | |||||||||| || ||||| ||||||||||| || Sbjct: 318 aagagctccaagcatggcccatctggagtggatcacttcaagctcacggttcttggcaaa 259 Query: 397 ggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcac 456 ||| || |||||||| || | |||||||||||||| | || ||||| |||||||| |||| Sbjct: 258 ggtttctgggtcagctgaaagcccagcagtgtccc-agccatagtcaccagggaattcac 200 Query: 457 cggtcaggtagctcgggggctcaccaga 484 | || ||||| |||||||||||||| Sbjct: 199 cagtaaggtaagatgggggctcaccaga 172 Score = 40.1 bits (20), Expect = 9.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 617 cttcactgccttgccggcaa 636 |||||||||||||||||||| Sbjct: 48 cttcactgccttgccggcaa 29
>dbj|AB236867.1| Panax ginseng cab mRNA for chlorophyll a/b binding protein, complete cds Length = 935 Score = 143 bits (72), Expect = 9e-31 Identities = 205/248 (82%), Gaps = 1/248 (0%) Strand = Plus / Minus Query: 219 ttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaacc 278 ||||||||||||| ||||| ||||| || ||| |||||| |||| |||||||||||||| Sbjct: 470 ttgggttgccaagatagtcaaggccaccttcggagaagatttgggctccggccttgaacc 411 Query: 279 aaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccga 338 |||| ||||| ||||| || || || || | || || | || |||||||| ||||| | Sbjct: 410 aaactgcctcgccgaatttgacaccattccttgcaagaatttcagggaagacacagccta 351 Query: 339 gcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaagg 398 | || |||||||||||||| | || ||||||||| || ||||| ||||||||||| || | Sbjct: 350 gtgcaccaagcatggcccatctgctgtggatcacttcgagctcacggttcttggcaaatg 291 Query: 399 tctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccg 458 |||| |||||||| || | ||||||||||||| |||| ||||| |||||||| |||||| Sbjct: 290 tctctgggtcagctgaaagtccagcagtgtccc-acccatagtctccagggaattcaccg 232 Query: 459 gtcaggta 466 |||||||| Sbjct: 231 gtcaggta 224
>emb|X16536.1|GMCAB5 G.max DNA for Cab5 Length = 1467 Score = 143 bits (72), Expect = 9e-31 Identities = 183/220 (83%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 ||||||||||||| | |||||| || || ||||| ||||| ||||| || |||||||||| Sbjct: 775 ggcttgggttgcccaagtagtcaagcccaccctcactgaatatctgagacccggccttga 716 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| || || ||||||||||| || ||||| ||||||| | |||||||| || |||| Sbjct: 715 accacacggcttcaccgaacttgacaccgttgcgggccaagagttcggggaaaacacagc 656 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 | || ||||| | ||||||||| | | ||||||| || || || || ||||||||||| | Sbjct: 655 ccagggctcccaacatggcccatctggagtggatgacttcaagttcacggttcttggcaa 596 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacc 435 ||||||| ||||||||||| | |||||||||||||||||| Sbjct: 595 aggtctctgggtcagcagaaagcccagcagtgtcccaacc 556
>gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding protein (CAB1) mRNA, complete cds Length = 980 Score = 141 bits (71), Expect = 4e-30 Identities = 192/231 (83%), Gaps = 1/231 (0%) Strand = Plus / Minus Query: 248 tcgctgaagatctgggatccggccttgaaccaaacagcctcaccgaacttcacgccgttt 307 |||||||||||||| || || ||||||||||||||||| || ||||||||||| ||||| Sbjct: 461 tcgctgaagatctgtgaaccagccttgaaccaaacagcttctccgaacttcactccgttc 402 Query: 308 cgggccagcaactcggggaagacgcagccgagcgctccaagcatggcccaacggcagtgg 367 | |||| | || ||||| || ||||| || ||||||||||||||||| | ||||||| Sbjct: 401 ctagccaaaagttcagggaaaacacagcctagggctccaagcatggcccatctgcagtgg 342 Query: 368 atcacctccagctcgcggttcttggcgaaggtctcggggtcagcagacaacccagcagtg 427 || || || ||||| |||||| |||||||||||||||||||||| || | || || ||| Sbjct: 341 ataacttctagctcacggttcctggcgaaggtctcggggtcagcggaaagaccggcggtg 282 Query: 428 tcccaacccgtagtcgccagggaactcaccggtcaggtagctcgggggctc 478 |||| | |||||||| || |||||||| || || |||||||| |||||||| Sbjct: 281 tccc-atccgtagtcaccggggaactctcctgtgaggtagcttgggggctc 232 Score = 77.8 bits (39), Expect = 5e-11 Identities = 87/103 (84%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| ||||| |||||||||||||| || |||||||||||||||||||| || || || | Sbjct: 841 actttccggggacgaagttggtggcaaaggcccatgcattgttgttgactggatcagcca 782 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgat 215 ||||||||| || ||||| | || ||||| ||||||||||| Sbjct: 781 aatggtcagcaagattctccaacggtccctttccggtgacgat 739
>ref|NM_102732.2| Arabidopsis thaliana CAB2; chlorophyll binding AT1G29920 (CAB2) mRNA, complete cds Length = 1176 Score = 139 bits (70), Expect = 1e-29 Identities = 185/222 (83%), Gaps = 1/222 (0%) Strand = Plus / Minus Query: 248 tcgctgaagatctgggatccggccttgaaccaaacagcctcaccgaacttcacgccgttt 307 |||||||||||||| || || |||||||||||||| ||||| || ||||| || ||||| Sbjct: 489 tcgctgaagatctgtgaaccagccttgaaccaaactgcctctccaaacttgactccgttc 430 Query: 308 cgggccagcaactcggggaagacgcagccgagcgctccaagcatggcccaacggcagtgg 367 | ||||| | ||| |||||||||||||| || ||||| ||||||||||| | || |||| Sbjct: 429 ctggccaaaagctcagggaagacgcagcctagggctccgagcatggcccacctgctgtgg 370 Query: 368 atcacctccagctcgcggttcttggcgaaggtctcggggtcagcagacaacccagcagtg 427 || || || ||||| |||||| | ||||| |||||||||||||| || | ||||| ||| Sbjct: 369 ataacttctagctcacggttccttgcgaatgtctcggggtcagcggatagaccagctgtg 310 Query: 428 tcccaacccgtagtcgccagggaactcaccggtcaggtagct 469 |||| | |||||||| ||||||||||| ||||| |||||||| Sbjct: 309 tccc-atccgtagtctccagggaactctccggtaaggtagct 269 Score = 81.8 bits (41), Expect = 3e-12 Identities = 92/109 (84%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| |||||||| ||||||||||| || ||||| || ||||||||||| || ||||| | Sbjct: 869 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggcca 810 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 ||||||||| |||||||| | || ||||| || |||||||||||||| Sbjct: 809 aatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttg 761
>gb|BT000726.1| Arabidopsis thaliana clone RAFL06-67-G16 (R11472) putative photosystem II type I chlorophyll a /b binding protein (At1g29920) mRNA, complete cds Length = 1044 Score = 139 bits (70), Expect = 1e-29 Identities = 185/222 (83%), Gaps = 1/222 (0%) Strand = Plus / Minus Query: 248 tcgctgaagatctgggatccggccttgaaccaaacagcctcaccgaacttcacgccgttt 307 |||||||||||||| || || |||||||||||||| ||||| || ||||| || ||||| Sbjct: 475 tcgctgaagatctgtgaaccagccttgaaccaaactgcctctccaaacttgactccgttc 416 Query: 308 cgggccagcaactcggggaagacgcagccgagcgctccaagcatggcccaacggcagtgg 367 | ||||| | ||| |||||||||||||| || ||||| ||||||||||| | || |||| Sbjct: 415 ctggccaaaagctcagggaagacgcagcctagggctccgagcatggcccacctgctgtgg 356 Query: 368 atcacctccagctcgcggttcttggcgaaggtctcggggtcagcagacaacccagcagtg 427 || || || ||||| |||||| | ||||| |||||||||||||| || | ||||| ||| Sbjct: 355 ataacttctagctcacggttccttgcgaatgtctcggggtcagcggatagaccagctgtg 296 Query: 428 tcccaacccgtagtcgccagggaactcaccggtcaggtagct 469 |||| | |||||||| ||||||||||| ||||| |||||||| Sbjct: 295 tccc-atccgtagtctccagggaactctccggtaaggtagct 255 Score = 81.8 bits (41), Expect = 3e-12 Identities = 92/109 (84%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| |||||||| ||||||||||| || ||||| || ||||||||||| || ||||| | Sbjct: 855 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggcca 796 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 ||||||||| |||||||| | || ||||| || |||||||||||||| Sbjct: 795 aatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttg 747
>gb|AY128345.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding protein, putative (At1g29920) mRNA, complete cds Length = 994 Score = 139 bits (70), Expect = 1e-29 Identities = 185/222 (83%), Gaps = 1/222 (0%) Strand = Plus / Minus Query: 248 tcgctgaagatctgggatccggccttgaaccaaacagcctcaccgaacttcacgccgttt 307 |||||||||||||| || || |||||||||||||| ||||| || ||||| || ||||| Sbjct: 475 tcgctgaagatctgtgaaccagccttgaaccaaactgcctctccaaacttgactccgttc 416 Query: 308 cgggccagcaactcggggaagacgcagccgagcgctccaagcatggcccaacggcagtgg 367 | ||||| | ||| |||||||||||||| || ||||| ||||||||||| | || |||| Sbjct: 415 ctggccaaaagctcagggaagacgcagcctagggctccgagcatggcccacctgctgtgg 356 Query: 368 atcacctccagctcgcggttcttggcgaaggtctcggggtcagcagacaacccagcagtg 427 || || || ||||| |||||| | ||||| |||||||||||||| || | ||||| ||| Sbjct: 355 ataacttctagctcacggttccttgcgaatgtctcggggtcagcggatagaccagctgtg 296 Query: 428 tcccaacccgtagtcgccagggaactcaccggtcaggtagct 469 |||| | |||||||| ||||||||||| ||||| |||||||| Sbjct: 295 tccc-atccgtagtctccagggaactctccggtaaggtagct 255 Score = 81.8 bits (41), Expect = 3e-12 Identities = 92/109 (84%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| |||||||| ||||||||||| || ||||| || ||||||||||| || ||||| | Sbjct: 855 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggcca 796 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 ||||||||| |||||||| | || ||||| || |||||||||||||| Sbjct: 795 aatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttg 747
>gb|AY081572.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920) mRNA, complete cds Length = 898 Score = 139 bits (70), Expect = 1e-29 Identities = 185/222 (83%), Gaps = 1/222 (0%) Strand = Plus / Minus Query: 248 tcgctgaagatctgggatccggccttgaaccaaacagcctcaccgaacttcacgccgttt 307 |||||||||||||| || || |||||||||||||| ||||| || ||||| || ||||| Sbjct: 422 tcgctgaagatctgtgaaccagccttgaaccaaactgcctctccaaacttgactccgttc 363 Query: 308 cgggccagcaactcggggaagacgcagccgagcgctccaagcatggcccaacggcagtgg 367 | ||||| | ||| |||||||||||||| || ||||| ||||||||||| | || |||| Sbjct: 362 ctggccaaaagctcagggaagacgcagcctagggctccgagcatggcccacctgctgtgg 303 Query: 368 atcacctccagctcgcggttcttggcgaaggtctcggggtcagcagacaacccagcagtg 427 || || || ||||| |||||| | ||||| |||||||||||||| || | ||||| ||| Sbjct: 302 ataacttctagctcacggttccttgcgaatgtctcggggtcagcggatagaccagctgtg 243 Query: 428 tcccaacccgtagtcgccagggaactcaccggtcaggtagct 469 |||| | |||||||| ||||||||||| ||||| |||||||| Sbjct: 242 tccc-atccgtagtctccagggaactctccggtaaggtagct 202 Score = 81.8 bits (41), Expect = 3e-12 Identities = 92/109 (84%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| |||||||| ||||||||||| || ||||| || ||||||||||| || ||||| | Sbjct: 802 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggcca 743 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 ||||||||| |||||||| | || ||||| || |||||||||||||| Sbjct: 742 aatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttg 694
>gb|AY062814.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920; F1N18.4) mRNA, complete cds Length = 1007 Score = 139 bits (70), Expect = 1e-29 Identities = 185/222 (83%), Gaps = 1/222 (0%) Strand = Plus / Minus Query: 248 tcgctgaagatctgggatccggccttgaaccaaacagcctcaccgaacttcacgccgttt 307 |||||||||||||| || || |||||||||||||| ||||| || ||||| || ||||| Sbjct: 474 tcgctgaagatctgtgaaccagccttgaaccaaactgcctctccaaacttgactccgttc 415 Query: 308 cgggccagcaactcggggaagacgcagccgagcgctccaagcatggcccaacggcagtgg 367 | ||||| | ||| |||||||||||||| || ||||| ||||||||||| | || |||| Sbjct: 414 ctggccaaaagctcagggaagacgcagcctagggctccgagcatggcccacctgctgtgg 355 Query: 368 atcacctccagctcgcggttcttggcgaaggtctcggggtcagcagacaacccagcagtg 427 || || || ||||| |||||| | ||||| |||||||||||||| || | ||||| ||| Sbjct: 354 ataacttctagctcacggttccttgcgaatgtctcggggtcagcggatagaccagctgtg 295 Query: 428 tcccaacccgtagtcgccagggaactcaccggtcaggtagct 469 |||| | |||||||| ||||||||||| ||||| |||||||| Sbjct: 294 tccc-atccgtagtctccagggaactctccggtaaggtagct 254 Score = 81.8 bits (41), Expect = 3e-12 Identities = 92/109 (84%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| |||||||| ||||||||||| || ||||| || ||||||||||| || ||||| | Sbjct: 854 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggcca 795 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 ||||||||| |||||||| | || ||||| || |||||||||||||| Sbjct: 794 aatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttg 746
>gb|AY060500.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds Length = 804 Score = 139 bits (70), Expect = 1e-29 Identities = 185/222 (83%), Gaps = 1/222 (0%) Strand = Plus / Minus Query: 248 tcgctgaagatctgggatccggccttgaaccaaacagcctcaccgaacttcacgccgttt 307 |||||||||||||| || || |||||||||||||| ||||| || ||||| || ||||| Sbjct: 422 tcgctgaagatctgtgaaccagccttgaaccaaactgcctctccaaacttgactccgttc 363 Query: 308 cgggccagcaactcggggaagacgcagccgagcgctccaagcatggcccaacggcagtgg 367 | ||||| | ||| |||||||||||||| || ||||| ||||||||||| | || |||| Sbjct: 362 ctggccaaaagctcagggaagacgcagcctagggctccgagcatggcccacctgctgtgg 303 Query: 368 atcacctccagctcgcggttcttggcgaaggtctcggggtcagcagacaacccagcagtg 427 || || || ||||| |||||| | ||||| |||||||||||||| || | ||||| ||| Sbjct: 302 ataacttctagctcacggttccttgcgaatgtctcggggtcagcggatagaccagctgtg 243 Query: 428 tcccaacccgtagtcgccagggaactcaccggtcaggtagct 469 |||| | |||||||| ||||||||||| ||||| |||||||| Sbjct: 242 tccc-atccgtagtctccagggaactctccggtaaggtagct 202 Score = 81.8 bits (41), Expect = 3e-12 Identities = 92/109 (84%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| |||||||| ||||||||||| || ||||| || ||||||||||| || ||||| | Sbjct: 802 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggcca 743 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 ||||||||| |||||||| | || ||||| || |||||||||||||| Sbjct: 742 aatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttg 694
>gb|AY054198.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds Length = 1027 Score = 139 bits (70), Expect = 1e-29 Identities = 185/222 (83%), Gaps = 1/222 (0%) Strand = Plus / Minus Query: 248 tcgctgaagatctgggatccggccttgaaccaaacagcctcaccgaacttcacgccgttt 307 |||||||||||||| || || |||||||||||||| ||||| || ||||| || ||||| Sbjct: 468 tcgctgaagatctgtgaaccagccttgaaccaaactgcctctccaaacttgactccgttc 409 Query: 308 cgggccagcaactcggggaagacgcagccgagcgctccaagcatggcccaacggcagtgg 367 | ||||| | ||| |||||||||||||| || ||||| ||||||||||| | || |||| Sbjct: 408 ctggccaaaagctcagggaagacgcagcctagggctccgagcatggcccacctgctgtgg 349 Query: 368 atcacctccagctcgcggttcttggcgaaggtctcggggtcagcagacaacccagcagtg 427 || || || ||||| |||||| | ||||| |||||||||||||| || | ||||| ||| Sbjct: 348 ataacttctagctcacggttccttgcgaatgtctcggggtcagcggatagaccagctgtg 289 Query: 428 tcccaacccgtagtcgccagggaactcaccggtcaggtagct 469 |||| | |||||||| ||||||||||| ||||| |||||||| Sbjct: 288 tccc-atccgtagtctccagggaactctccggtaaggtagct 248 Score = 81.8 bits (41), Expect = 3e-12 Identities = 92/109 (84%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| |||||||| ||||||||||| || ||||| || ||||||||||| || ||||| | Sbjct: 848 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggcca 789 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 ||||||||| |||||||| | || ||||| || |||||||||||||| Sbjct: 788 aatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttg 740
>gb|AY052237.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds Length = 1027 Score = 139 bits (70), Expect = 1e-29 Identities = 185/222 (83%), Gaps = 1/222 (0%) Strand = Plus / Minus Query: 248 tcgctgaagatctgggatccggccttgaaccaaacagcctcaccgaacttcacgccgttt 307 |||||||||||||| || || |||||||||||||| ||||| || ||||| || ||||| Sbjct: 474 tcgctgaagatctgtgaaccagccttgaaccaaactgcctctccaaacttgactccgttc 415 Query: 308 cgggccagcaactcggggaagacgcagccgagcgctccaagcatggcccaacggcagtgg 367 | ||||| | ||| |||||||||||||| || ||||| ||||||||||| | || |||| Sbjct: 414 ctggccaaaagctcagggaagacgcagcctagggctccgagcatggcccacctgctgtgg 355 Query: 368 atcacctccagctcgcggttcttggcgaaggtctcggggtcagcagacaacccagcagtg 427 || || || ||||| |||||| | ||||| |||||||||||||| || | ||||| ||| Sbjct: 354 ataacttctagctcacggttccttgcgaatgtctcggggtcagcggatagaccagctgtg 295 Query: 428 tcccaacccgtagtcgccagggaactcaccggtcaggtagct 469 |||| | |||||||| ||||||||||| ||||| |||||||| Sbjct: 294 tccc-atccgtagtctccagggaactctccggtaaggtagct 254 Score = 81.8 bits (41), Expect = 3e-12 Identities = 92/109 (84%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| |||||||| ||||||||||| || ||||| || ||||||||||| || ||||| | Sbjct: 854 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggcca 795 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 ||||||||| |||||||| | || ||||| || |||||||||||||| Sbjct: 794 aatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttg 746
>gb|DQ355993.1| Brassica napus chlorophyll a/b binding protein (LHB1B2) mRNA, partial cds Length = 226 Score = 139 bits (70), Expect = 1e-29 Identities = 176/210 (83%), Gaps = 1/210 (0%) Strand = Plus / Minus Query: 269 gccttgaaccaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaag 328 |||||||||||||| || || ||||||||||| ||||| | |||| | ||| ||||| Sbjct: 215 gccttgaaccaaaccgcttctccgaacttcactccgttcctagccaaaagctcagggaaa 156 Query: 329 acgcagccgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttc 388 |||||||| || ||||| ||||||||||| | ||||||||| || || ||||| |||||| Sbjct: 155 acgcagcctagggctccgagcatggcccatctgcagtggataacttctagctcacggttc 96 Query: 389 ttggcgaaggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagg 448 |||||||||||||||||||||| || | || || ||||||| | |||||||| || || Sbjct: 95 ctggcgaaggtctcggggtcagcggagagaccggcggtgtccc-atccgtagtctccggg 37 Query: 449 gaactcaccggtcaggtagctcgggggctc 478 |||||| ||||| ||||||||||||||||| Sbjct: 36 gaactctccggtgaggtagctcgggggctc 7
>emb|BX815776.1|CNS0AE4K Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS93ZB12 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 972 Score = 139 bits (70), Expect = 1e-29 Identities = 185/222 (83%), Gaps = 1/222 (0%) Strand = Plus / Minus Query: 248 tcgctgaagatctgggatccggccttgaaccaaacagcctcaccgaacttcacgccgttt 307 |||||||||||||| || || |||||||||||||| ||||| || ||||| || ||||| Sbjct: 460 tcgctgaagatctgtgaaccagccttgaaccaaactgcctctccaaacttgactccgttc 401 Query: 308 cgggccagcaactcggggaagacgcagccgagcgctccaagcatggcccaacggcagtgg 367 | ||||| | ||| |||||||||||||| || ||||| ||||||||||| | || |||| Sbjct: 400 ctggccaaaagctcagggaagacgcagcctagggctccgagcatggcccacctgctgtgg 341 Query: 368 atcacctccagctcgcggttcttggcgaaggtctcggggtcagcagacaacccagcagtg 427 || || || ||||| |||||| | ||||| |||||||||||||| || | ||||| ||| Sbjct: 340 ataacttctagctcacggttccttgcgaatgtctcggggtcagcggatagaccagctgtg 281 Query: 428 tcccaacccgtagtcgccagggaactcaccggtcaggtagct 469 |||| | |||||||| ||||||||||| ||||| |||||||| Sbjct: 280 tccc-atccgtagtctccagggaactctccggtaaggtagct 240 Score = 73.8 bits (37), Expect = 7e-10 Identities = 92/109 (84%), Gaps = 1/109 (0%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| |||||||| ||||||||||| || ||||| || ||||||||||| || ||||| | Sbjct: 839 actttccgggaacaaagttggtggc-aaggcccaagcgttgttgttgactggatcggcca 781 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 ||||||||| |||||||| | || ||||| || |||||||||||||| Sbjct: 780 aatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttg 732
>gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N18 genomic sequence, complete sequence Length = 101075 Score = 139 bits (70), Expect = 1e-29 Identities = 185/222 (83%), Gaps = 1/222 (0%) Strand = Plus / Minus Query: 248 tcgctgaagatctgggatccggccttgaaccaaacagcctcaccgaacttcacgccgttt 307 |||||||||||||| || || |||||||||||||| ||||| || ||||| || ||||| Sbjct: 19514 tcgctgaagatctgtgaaccagccttgaaccaaactgcctctccaaacttgactccgttc 19455 Query: 308 cgggccagcaactcggggaagacgcagccgagcgctccaagcatggcccaacggcagtgg 367 | ||||| | ||| |||||||||||||| || ||||| ||||||||||| | || |||| Sbjct: 19454 ctggccaaaagctcagggaagacgcagcctagggctccgagcatggcccacctgctgtgg 19395 Query: 368 atcacctccagctcgcggttcttggcgaaggtctcggggtcagcagacaacccagcagtg 427 || || || ||||| |||||| | ||||| |||||||||||||| || | ||||| ||| Sbjct: 19394 ataacttctagctcacggttccttgcgaatgtctcggggtcagcggatagaccagctgtg 19335 Query: 428 tcccaacccgtagtcgccagggaactcaccggtcaggtagct 469 |||| | |||||||| ||||||||||| ||||| |||||||| Sbjct: 19334 tccc-atccgtagtctccagggaactctccggtaaggtagct 19294 Score = 137 bits (69), Expect = 6e-29 Identities = 187/225 (83%), Gaps = 1/225 (0%) Strand = Plus / Plus Query: 248 tcgctgaagatctgggatccggccttgaaccaaacagcctcaccgaacttcacgccgttt 307 |||||||||||||| || ||||||||||||||||| ||||| |||||||| || |||||| Sbjct: 16493 tcgctgaagatctgtgaaccggccttgaaccaaaccgcctctccgaacttgactccgttt 16552 Query: 308 cgggccagcaactcggggaagacgcagccgagcgctccaagcatggcccaacggcagtgg 367 | |||| | ||| |||||||||||||| || ||||| ||||||||||| | || |||| Sbjct: 16553 ctagccaaaagctcagggaagacgcagcctagggctccgagcatggcccacctgctgtgg 16612 Query: 368 atcacctccagctcgcggttcttggcgaaggtctcggggtcagcagacaacccagcagtg 427 || || || || || |||||| | ||||| |||||||||||||| || | || || ||| Sbjct: 16613 ataacttctagttcacggttccttgcgaatgtctcggggtcagctgaaagtccggcggtg 16672 Query: 428 tcccaacccgtagtcgccagggaactcaccggtcaggtagctcgg 472 |||| | |||||||| || |||||||| ||||| ||||||||||| Sbjct: 16673 tccc-atccgtagtctccggggaactctccggtaaggtagctcgg 16716 Score = 121 bits (61), Expect = 3e-24 Identities = 185/225 (82%), Gaps = 1/225 (0%) Strand = Plus / Minus Query: 248 tcgctgaagatctgggatccggccttgaaccaaacagcctcaccgaacttcacgccgttt 307 ||||| |||||||| || ||||||||||||||||| ||||| |||||||| || ||||| Sbjct: 22160 tcgctaaagatctgtgaaccggccttgaaccaaaccgcctctccgaacttgactccgttc 22101 Query: 308 cgggccagcaactcggggaagacgcagccgagcgctccaagcatggcccaacggcagtgg 367 | |||| | ||| |||||||||||||| || ||||| ||||| ||||| | || |||| Sbjct: 22100 ctagccaaaagctcagggaagacgcagcctagggctccgagcatagcccacctgctgtgg 22041 Query: 368 atcacctccagctcgcggttcttggcgaaggtctcggggtcagcagacaacccagcagtg 427 || || || ||||| |||||| | ||||| |||||||| ||||| || | ||||| ||| Sbjct: 22040 ataacttctagctcacggttccttgcgaatgtctcgggatcagctgaaagtccagcggtg 21981 Query: 428 tcccaacccgtagtcgccagggaactcaccggtcaggtagctcgg 472 |||| | |||||||| || |||||||| ||||| ||||||||||| Sbjct: 21980 tccc-atccgtagtctccggggaactctccggtaaggtagctcgg 21937 Score = 89.7 bits (45), Expect = 1e-14 Identities = 93/109 (85%) Strand = Plus / Plus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| |||||||| |||||||||||||| |||||||| |||||||| || || ||||| | Sbjct: 16113 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 16172 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 ||||||||| |||||||| | || ||||| || |||||||||||||| Sbjct: 16173 aatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttg 16221 Score = 81.8 bits (41), Expect = 3e-12 Identities = 92/109 (84%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| |||||||| |||||||| ||||| |||||||| ||||||||||| || ||||| | Sbjct: 22540 actttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcggcca 22481 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 ||||||||| |||||||| | || ||||| || ||||| |||||||| Sbjct: 22480 aatggtcagcaaggttctctatcggtcccttaccagtgacaatggcttg 22432 Score = 81.8 bits (41), Expect = 3e-12 Identities = 92/109 (84%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| |||||||| ||||||||||| || ||||| || ||||||||||| || ||||| | Sbjct: 19894 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggcca 19835 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 ||||||||| |||||||| | || ||||| || |||||||||||||| Sbjct: 19834 aatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttg 19786
>dbj|AK061619.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-033-E02, full insert sequence Length = 650 Score = 139 bits (70), Expect = 1e-29 Identities = 97/106 (91%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||||||||| ||||||||||||||| | ||||| || |||||||||||||||||||||| Sbjct: 384 acttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 325 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 | ||||| |||||||||||||| || |||||||||||||||||||| Sbjct: 324 ggtggtcggcgaggttctcgagggggcccttgccggtgacgatggc 279 Score = 46.1 bits (23), Expect = 0.16 Identities = 35/39 (89%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctga 254 |||| |||||||| |||||||| || ||||||||||||| Sbjct: 39 ggctcgggttgccgaggtagtcgagcccgccctcgctga 1
>emb|X68333.1|HHLHC H.helix mRNA for light harvesting chlorophyll a/b binding protein Length = 686 Score = 139 bits (70), Expect = 1e-29 Identities = 166/198 (83%) Strand = Plus / Minus Query: 217 gcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaa 276 |||||||||||| | |||||| || || ||||| ||||| || || | ||| |||||||| Sbjct: 234 gcttgggttgcccaagtagtcaagcccaccctcactgaaaatttgagctccagccttgaa 175 Query: 277 ccaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagcc 336 ||| |||||||||||||| || || ||||| ||||||| | |||||| ||||| ||||| Sbjct: 174 ccacacagcctcaccgaatttgacaccgttacgggccaagagctcgggaaagacacagcc 115 Query: 337 gagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaa 396 || ||||||||||| ||||| | | |||||||||||| ||||| |||||||||||||| Sbjct: 114 aagggctccaagcatagcccatctactgtggatcacctcgagctcacggttcttggcgaa 55 Query: 397 ggtctcggggtcagcaga 414 |||||||| |||||||| Sbjct: 54 agtctcgggatcagcaga 37 Score = 61.9 bits (31), Expect = 3e-06 Identities = 76/91 (83%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| ||||| || ||||||||||| | ||||||||||||||||| || || || || | Sbjct: 580 actttccggggacaaagttggtggcataggcccatgcattgttgtttactggatcagcaa 521 Query: 173 gatggtcagcgaggttctcgagtggaccctt 203 ||||||| || |||||||| | ||||||||| Sbjct: 520 gatggtcggctaggttctccaatggaccctt 490
>ref|NM_102733.2| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BINDING PROTEIN 1); chlorophyll binding AT1G29930 (CAB1) mRNA, complete cds Length = 1044 Score = 137 bits (69), Expect = 6e-29 Identities = 187/225 (83%), Gaps = 1/225 (0%) Strand = Plus / Minus Query: 248 tcgctgaagatctgggatccggccttgaaccaaacagcctcaccgaacttcacgccgttt 307 |||||||||||||| || ||||||||||||||||| ||||| |||||||| || |||||| Sbjct: 488 tcgctgaagatctgtgaaccggccttgaaccaaaccgcctctccgaacttgactccgttt 429 Query: 308 cgggccagcaactcggggaagacgcagccgagcgctccaagcatggcccaacggcagtgg 367 | |||| | ||| |||||||||||||| || ||||| ||||||||||| | || |||| Sbjct: 428 ctagccaaaagctcagggaagacgcagcctagggctccgagcatggcccacctgctgtgg 369 Query: 368 atcacctccagctcgcggttcttggcgaaggtctcggggtcagcagacaacccagcagtg 427 || || || || || |||||| | ||||| |||||||||||||| || | || || ||| Sbjct: 368 ataacttctagttcacggttccttgcgaatgtctcggggtcagctgaaagtccggcggtg 309 Query: 428 tcccaacccgtagtcgccagggaactcaccggtcaggtagctcgg 472 |||| | |||||||| || |||||||| ||||| ||||||||||| Sbjct: 308 tccc-atccgtagtctccggggaactctccggtaaggtagctcgg 265 Score = 89.7 bits (45), Expect = 1e-14 Identities = 93/109 (85%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| |||||||| |||||||||||||| |||||||| |||||||| || || ||||| | Sbjct: 868 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 809 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 ||||||||| |||||||| | || ||||| || |||||||||||||| Sbjct: 808 aatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttg 760
>gb|AY091169.1| Arabidopsis thaliana putative chlorophyll a/b-binding protein (At1g29930) mRNA, complete cds Length = 835 Score = 137 bits (69), Expect = 6e-29 Identities = 187/225 (83%), Gaps = 1/225 (0%) Strand = Plus / Minus Query: 248 tcgctgaagatctgggatccggccttgaaccaaacagcctcaccgaacttcacgccgttt 307 |||||||||||||| || ||||||||||||||||| ||||| |||||||| || |||||| Sbjct: 422 tcgctgaagatctgtgaaccggccttgaaccaaaccgcctctccgaacttgactccgttt 363 Query: 308 cgggccagcaactcggggaagacgcagccgagcgctccaagcatggcccaacggcagtgg 367 | |||| | ||| |||||||||||||| || ||||| ||||||||||| | || |||| Sbjct: 362 ctagccaaaagctcagggaagacgcagcctagggctccgagcatggcccacctgctgtgg 303 Query: 368 atcacctccagctcgcggttcttggcgaaggtctcggggtcagcagacaacccagcagtg 427 || || || || || |||||| | ||||| |||||||||||||| || | || || ||| Sbjct: 302 ataacttctagttcacggttccttgcgaatgtctcggggtcagctgaaagtccggcggtg 243 Query: 428 tcccaacccgtagtcgccagggaactcaccggtcaggtagctcgg 472 |||| | |||||||| || |||||||| ||||| ||||||||||| Sbjct: 242 tccc-atccgtagtctccggggaactctccggtaaggtagctcgg 199 Score = 89.7 bits (45), Expect = 1e-14 Identities = 93/109 (85%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| |||||||| |||||||||||||| |||||||| |||||||| || || ||||| | Sbjct: 802 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 743 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 ||||||||| |||||||| | || ||||| || |||||||||||||| Sbjct: 742 aatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttg 694
>gb|AY050935.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At1g29930) mRNA, complete cds Length = 1014 Score = 137 bits (69), Expect = 6e-29 Identities = 187/225 (83%), Gaps = 1/225 (0%) Strand = Plus / Minus Query: 248 tcgctgaagatctgggatccggccttgaaccaaacagcctcaccgaacttcacgccgttt 307 |||||||||||||| || ||||||||||||||||| ||||| |||||||| || |||||| Sbjct: 488 tcgctgaagatctgtgaaccggccttgaaccaaaccgcctctccgaacttgactccgttt 429 Query: 308 cgggccagcaactcggggaagacgcagccgagcgctccaagcatggcccaacggcagtgg 367 | |||| | ||| |||||||||||||| || ||||| ||||||||||| | || |||| Sbjct: 428 ctagccaaaagctcagggaagacgcagcctagggctccgagcatggcccacctgctgtgg 369 Query: 368 atcacctccagctcgcggttcttggcgaaggtctcggggtcagcagacaacccagcagtg 427 || || || || || |||||| | ||||| |||||||||||||| || | || || ||| Sbjct: 368 ataacttctagttcacggttccttgcgaatgtctcggggtcagctgaaagtccggcggtg 309 Query: 428 tcccaacccgtagtcgccagggaactcaccggtcaggtagctcgg 472 |||| | |||||||| || |||||||| ||||| ||||||||||| Sbjct: 308 tccc-atccgtagtctccggggaactctccggtaaggtagctcgg 265 Score = 89.7 bits (45), Expect = 1e-14 Identities = 93/109 (85%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| |||||||| |||||||||||||| |||||||| |||||||| || || ||||| | Sbjct: 868 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 809 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 ||||||||| |||||||| | || ||||| || |||||||||||||| Sbjct: 808 aatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttg 760
>gb|AY058180.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds Length = 1019 Score = 137 bits (69), Expect = 6e-29 Identities = 187/225 (83%), Gaps = 1/225 (0%) Strand = Plus / Minus Query: 248 tcgctgaagatctgggatccggccttgaaccaaacagcctcaccgaacttcacgccgttt 307 |||||||||||||| || ||||||||||||||||| ||||| |||||||| || |||||| Sbjct: 488 tcgctgaagatctgtgaaccggccttgaaccaaaccgcctctccgaacttgactccgttt 429 Query: 308 cgggccagcaactcggggaagacgcagccgagcgctccaagcatggcccaacggcagtgg 367 | |||| | ||| |||||||||||||| || ||||| ||||||||||| | || |||| Sbjct: 428 ctagccaaaagctcagggaagacgcagcctagggctccgagcatggcccacctgctgtgg 369 Query: 368 atcacctccagctcgcggttcttggcgaaggtctcggggtcagcagacaacccagcagtg 427 || || || || || |||||| | ||||| |||||||||||||| || | || || ||| Sbjct: 368 ataacttctagttcacggttccttgcgaatgtctcggggtcagctgaaagtccggcggtg 309 Query: 428 tcccaacccgtagtcgccagggaactcaccggtcaggtagctcgg 472 |||| | |||||||| || |||||||| ||||| ||||||||||| Sbjct: 308 tccc-atccgtagtctccggggaactctccggtaaggtagctcgg 265 Score = 89.7 bits (45), Expect = 1e-14 Identities = 93/109 (85%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| |||||||| |||||||||||||| |||||||| |||||||| || || ||||| | Sbjct: 868 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 809 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 ||||||||| |||||||| | || ||||| || |||||||||||||| Sbjct: 808 aatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttg 760
>gb|AF428359.1|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds Length = 1045 Score = 137 bits (69), Expect = 6e-29 Identities = 187/225 (83%), Gaps = 1/225 (0%) Strand = Plus / Minus Query: 248 tcgctgaagatctgggatccggccttgaaccaaacagcctcaccgaacttcacgccgttt 307 |||||||||||||| || ||||||||||||||||| ||||| |||||||| || |||||| Sbjct: 488 tcgctgaagatctgtgaaccggccttgaaccaaaccgcctctccgaacttgactccgttt 429 Query: 308 cgggccagcaactcggggaagacgcagccgagcgctccaagcatggcccaacggcagtgg 367 | |||| | ||| |||||||||||||| || ||||| ||||||||||| | || |||| Sbjct: 428 ctagccaaaagctcagggaagacgcagcctagggctccgagcatggcccacctgctgtgg 369 Query: 368 atcacctccagctcgcggttcttggcgaaggtctcggggtcagcagacaacccagcagtg 427 || || || || || |||||| | ||||| |||||||||||||| || | || || ||| Sbjct: 368 ataacttctagttcacggttccttgcgaatgtctcggggtcagctgaaagtccggcggtg 309 Query: 428 tcccaacccgtagtcgccagggaactcaccggtcaggtagctcgg 472 |||| | |||||||| || |||||||| ||||| ||||||||||| Sbjct: 308 tccc-atccgtagtctccggggaactctccggtaaggtagctcgg 265 Score = 89.7 bits (45), Expect = 1e-14 Identities = 93/109 (85%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| |||||||| |||||||||||||| |||||||| |||||||| || || ||||| | Sbjct: 868 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 809 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 ||||||||| |||||||| | || ||||| || |||||||||||||| Sbjct: 808 aatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttg 760
>gb|AY045673.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds Length = 999 Score = 137 bits (69), Expect = 6e-29 Identities = 187/225 (83%), Gaps = 1/225 (0%) Strand = Plus / Minus Query: 248 tcgctgaagatctgggatccggccttgaaccaaacagcctcaccgaacttcacgccgttt 307 |||||||||||||| || ||||||||||||||||| ||||| |||||||| || |||||| Sbjct: 488 tcgctgaagatctgtgaaccggccttgaaccaaaccgcctctccgaacttgactccgttt 429 Query: 308 cgggccagcaactcggggaagacgcagccgagcgctccaagcatggcccaacggcagtgg 367 | |||| | ||| |||||||||||||| || ||||| ||||||||||| | || |||| Sbjct: 428 ctagccaaaagctcagggaagacgcagcctagggctccgagcatggcccacctgctgtgg 369 Query: 368 atcacctccagctcgcggttcttggcgaaggtctcggggtcagcagacaacccagcagtg 427 || || || || || |||||| | ||||| |||||||||||||| || | || || ||| Sbjct: 368 ataacttctagttcacggttccttgcgaatgtctcggggtcagctgaaagtccggcggtg 309 Query: 428 tcccaacccgtagtcgccagggaactcaccggtcaggtagctcgg 472 |||| | |||||||| || |||||||| ||||| ||||||||||| Sbjct: 308 tccc-atccgtagtctccggggaactctccggtaaggtagctcgg 265 Score = 89.7 bits (45), Expect = 1e-14 Identities = 93/109 (85%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| |||||||| |||||||||||||| |||||||| |||||||| || || ||||| | Sbjct: 868 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 809 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 ||||||||| |||||||| | || ||||| || |||||||||||||| Sbjct: 808 aatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttg 760
>emb|BX815726.1|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS89ZA03 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 930 Score = 137 bits (69), Expect = 6e-29 Identities = 187/225 (83%), Gaps = 1/225 (0%) Strand = Plus / Minus Query: 248 tcgctgaagatctgggatccggccttgaaccaaacagcctcaccgaacttcacgccgttt 307 |||||||||||||| || ||||||||||||||||| ||||| |||||||| || |||||| Sbjct: 457 tcgctgaagatctgtgaaccggccttgaaccaaaccgcctctccgaacttgactccgttt 398 Query: 308 cgggccagcaactcggggaagacgcagccgagcgctccaagcatggcccaacggcagtgg 367 | |||| | ||| |||||||||||||| || ||||| ||||||||||| | || |||| Sbjct: 397 ctagccaaaagctcagggaagacgcagcctagggctccgagcatggcccacctgctgtgg 338 Query: 368 atcacctccagctcgcggttcttggcgaaggtctcggggtcagcagacaacccagcagtg 427 || || || || || |||||| | ||||| |||||||||||||| || | || || ||| Sbjct: 337 ataacttctagttcacggttccttgcgaatgtctcggggtcagctgaaagtccggcggtg 278 Query: 428 tcccaacccgtagtcgccagggaactcaccggtcaggtagctcgg 472 |||| | |||||||| || |||||||| ||||| ||||||||||| Sbjct: 277 tccc-atccgtagtctccggggaactctccggtaaggtagctcgg 234 Score = 89.7 bits (45), Expect = 1e-14 Identities = 93/109 (85%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| |||||||| |||||||||||||| |||||||| |||||||| || || ||||| | Sbjct: 837 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 778 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 ||||||||| |||||||| | || ||||| || |||||||||||||| Sbjct: 777 aatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttg 729
>gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P2 genomic sequence, complete sequence Length = 82053 Score = 137 bits (69), Expect = 6e-29 Identities = 187/225 (83%), Gaps = 1/225 (0%) Strand = Plus / Minus Query: 248 tcgctgaagatctgggatccggccttgaaccaaacagcctcaccgaacttcacgccgttt 307 |||||||||||||| || ||||||||||||||||| ||||| |||||||| || |||||| Sbjct: 368 tcgctgaagatctgtgaaccggccttgaaccaaaccgcctctccgaacttgactccgttt 309 Query: 308 cgggccagcaactcggggaagacgcagccgagcgctccaagcatggcccaacggcagtgg 367 | |||| | ||| |||||||||||||| || ||||| ||||||||||| | || |||| Sbjct: 308 ctagccaaaagctcagggaagacgcagcctagggctccgagcatggcccacctgctgtgg 249 Query: 368 atcacctccagctcgcggttcttggcgaaggtctcggggtcagcagacaacccagcagtg 427 || || || || || |||||| | ||||| |||||||||||||| || | || || ||| Sbjct: 248 ataacttctagttcacggttccttgcgaatgtctcggggtcagctgaaagtccggcggtg 189 Query: 428 tcccaacccgtagtcgccagggaactcaccggtcaggtagctcgg 472 |||| | |||||||| || |||||||| ||||| ||||||||||| Sbjct: 188 tccc-atccgtagtctccggggaactctccggtaaggtagctcgg 145 Score = 89.7 bits (45), Expect = 1e-14 Identities = 93/109 (85%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| |||||||| |||||||||||||| |||||||| |||||||| || || ||||| | Sbjct: 748 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 689 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 ||||||||| |||||||| | || ||||| || |||||||||||||| Sbjct: 688 aatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttg 640
>emb|X16535.1|GMCAB4 G.max DNA for Cab4 Length = 1470 Score = 137 bits (69), Expect = 6e-29 Identities = 220/269 (81%), Gaps = 1/269 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 ||||||||||||| | |||||| || |||||||| ||||| ||||| || |||||||||| Sbjct: 778 ggcttgggttgcccaagtagtcaagcccgccctcactgaatatctgagacccggccttga 719 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| || |||||||| ||||| || ||||| |||| || | || ||||| || |||| Sbjct: 718 accacacggcctcaccaaacttgactccgttgcgggacaagagttcagggaaaacacagc 659 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 | | ||||| | ||||||||| | | ||||||| || ||||| || ||||| ||||| | Sbjct: 658 ccaaggctcccaacatggcccatctggagtggatgacttccagttcacggtttttggcaa 599 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 ||||||| ||||||||||| | |||||||||||||||| || ||||| || ||||| ||| Sbjct: 598 aggtctctgggtcagcagaaagcccagcagtgtcccaa-ccatagtcacctgggaattca 540 Query: 456 ccggtcaggtagctcgggggctcaccaga 484 || || |||||| |||||||||||||| Sbjct: 539 ccagtgaggtaggatgggggctcaccaga 511
>emb|X14505.1|PSCABIIA Pinus sylvestris cab II/1A mRNA for chlorophyll a/b-binding protein Length = 1083 Score = 137 bits (69), Expect = 6e-29 Identities = 196/237 (82%), Gaps = 1/237 (0%) Strand = Plus / Minus Query: 230 aggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaaacagcctca 289 |||||||| || || ||||||||||||||||| | ||| ||||||||||| || |||||| Sbjct: 531 aggtagtcaagccctccctcgctgaagatctgagctcccgccttgaaccacaccgcctca 472 Query: 290 ccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagcgctccaagc 349 |||||||| || ||||| | || || | ||| ||||| ||||| ||||| || || ||| Sbjct: 471 ccgaactttactccgttcctcgcaagaagctccgggaatacgcacccgagagcgcccagc 412 Query: 350 atggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtctcggggtca 409 || ||||| ||| |||||||||| |||||||| | |||||| ||||| ||||| || || Sbjct: 411 atcgcccaccgggagtggatcacttccagctctctgttcttcgcgaacgtctccggatcc 352 Query: 410 gcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggtcaggta 466 || |||| ||| || ||||||| |||||||||| || ||||| |||||||||||||| Sbjct: 351 gccgacagccccgccgtgtccc-acccgtagtcaccggggaattcaccggtcaggta 296 Score = 71.9 bits (36), Expect = 3e-09 Identities = 66/76 (86%) Strand = Plus / Minus Query: 118 ccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcgagatgg 177 ||||| ||||| ||||||||| | ||||| ||||||||||| ||||||||||| || || Sbjct: 885 ccggggacgaaattggtggcgtaggcccaggcattgttgttcacggggtcggccaggtga 826 Query: 178 tcagcgaggttctcga 193 || ||||||||||||| Sbjct: 825 tcggcgaggttctcga 810
>gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II chlorophyll a/b binding protein (CABII) mRNA, partial cds Length = 714 Score = 137 bits (69), Expect = 6e-29 Identities = 187/225 (83%), Gaps = 1/225 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 |||||||| ||||||||||| |||||||| ||||||||| | |||||||||||||| Sbjct: 226 gggttgcccaggtagtccagcccgccctccgagaagatctgcgcgccggccttgaaccac 167 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || ||||| |||||||| |||||||| |||||| | ||| ||||| ||||| || ||| Sbjct: 166 accgcctcgccgaacttgacgccgttcttggccaggatctccgggaacacgcaccccagc 107 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 || || ||||| ||||| || |||||||||||||||||||||||||| ||||| ||| Sbjct: 106 gcgcccagcatcgcccaccgcgagtggatcacctccagctcgcggttccgcgcgaacgtc 47 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgcc 445 || ||||| || |||| ||| || ||||||| ||||||||||||| Sbjct: 46 tccgggtccgccgacagccccgccgtgtccc-acccgtagtcgcc 3 Score = 87.7 bits (44), Expect = 5e-14 Identities = 89/104 (85%) Strand = Plus / Minus Query: 115 ttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcgaga 174 |||||||| ||||||||||||||| | ||||| || |||||| ||||||||| |||| | Sbjct: 574 ttgccggggacgaagttggtggcgtaagcccaggcgttgttggcgacggggtcagcgaca 515 Query: 175 tggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 ||||| ||||||||||| || |||||||||||||||||||| Sbjct: 514 tggtcgaagaggttctcgatgggtcccttgccggtgacgatggc 471
>dbj|AB206466.1| Adiantum capillus-veneris AcCab1 gene for chlorophyll a/b-binding protein, complete cds Length = 1500 Score = 135 bits (68), Expect = 2e-28 Identities = 207/252 (82%), Gaps = 1/252 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| ||||||||||| || || |||||||| ||| |||||||||||| || ||||||| Sbjct: 972 ggctcgggttgccaagataatcaaggccgccatcggcgaagatctgggagccagccttga 913 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| ||||||||||| ||||| || ||||| ||||||| |||||| || |||| Sbjct: 912 accacacagcctcaccaaacttgacaccgttctttgccagcagctcgggcgtcacacagc 853 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 | | ||||| | ||||||||| | | | ||||||||||||||||| | ||||||||||| Sbjct: 852 ccaaggctcccaacatggcccatctggaatggatcacctccagctccctgttcttggcga 793 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 ||||||| ||||| || |||| ||||| ||||||| |||| ||||| |||||||||||| Sbjct: 792 aggtctctgggtctgcggacagaccagctgtgtccc-acccatagtcaccagggaactca 734 Query: 456 ccggtcaggtag 467 || || |||||| Sbjct: 733 ccagtgaggtag 722
>dbj|AB006081.1| Fagus crenata mRNA for chlorophyll a/b-binding protein, complete cds Length = 1010 Score = 135 bits (68), Expect = 2e-28 Identities = 219/268 (81%), Gaps = 1/268 (0%) Strand = Plus / Minus Query: 217 gcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaa 276 ||||||||| || | |||||| || || || || ||||| || |||| ||| |||||||| Sbjct: 494 gcttgggttacccaagtagtcaagcccaccttcactgaaaatttgggctccagccttgaa 435 Query: 277 ccaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagcc 336 |||||| |||||||| ||||| || ||||| ||||||| | ||| |||||||| || || Sbjct: 434 ccaaacggcctcaccaaacttaaccccgttacgggccaagagctcagggaagacacaccc 375 Query: 337 gagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaa 396 || ||||||||||||||||| | | |||||||||| || ||||| |||||||| || || Sbjct: 374 aagagctccaagcatggcccatctggagtggatcacttcaagctcacggttcttagcaaa 315 Query: 397 ggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcac 456 ||| || |||||||| || | |||||||||||||| | || ||||| |||||||| |||| Sbjct: 314 ggtttctgggtcagctgatagcccagcagtgtccc-agccatagtcaccagggaattcac 256 Query: 457 cggtcaggtagctcgggggctcaccaga 484 | || ||||| |||||||||||||| Sbjct: 255 cagtaaggtaagatgggggctcaccaga 228 Score = 40.1 bits (20), Expect = 9.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 617 cttcactgccttgccggcaa 636 |||||||||||||||||||| Sbjct: 104 cttcactgccttgccggcaa 85
>gb|AF479777.1| Chlamydomonas reinhardtii major light-harvesting complex II protein m10 (Lhcbm10) mRNA, complete cds Length = 1077 Score = 133 bits (67), Expect = 9e-28 Identities = 215/263 (81%), Gaps = 1/263 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 |||||||| |||||||||||||||||||| ||||||||||| |||||||||||||| Sbjct: 440 gggttgcccaggtagtccaggccgccctcagagaagatctgggcgccggccttgaaccag 381 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 |||||||| ||||||| |||| | |||||||| ||||||| || |||||| || Sbjct: 380 acagcctcgccgaactgggtgccgctcttggccagcagctcgggggtgatgcagcccaga 321 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 || || ||||||||||| ||| |||||||| |||||||||||||| ||||||| Sbjct: 320 gcgcccagcatggcccagcgggcgtggatcagctccagctcgcggtagcgcttgaaggtc 261 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || |||||||| |||| || || ||||||| | |||||||| || |||||||| || || Sbjct: 260 tccgggtcagcggacagaccggcggtgtccc-agccgtagtcaccggggaactcgccagt 202 Query: 461 caggtagctcgggggctcaccag 483 |||||||||||||||||| |||| Sbjct: 201 caggtagctcgggggctcgccag 179
>emb|X52742.1|NTCAB50 Tabacco Cab50 mRNA for major chlorophyll a/b binding protein Length = 964 Score = 133 bits (67), Expect = 9e-28 Identities = 218/267 (81%), Gaps = 1/267 (0%) Strand = Plus / Minus Query: 218 cttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaac 277 ||||||||||| | |||||| || || |||||||| || || |||||||| ||||||||| Sbjct: 522 cttgggttgcccaagtagtcaagtccaccctcgctaaaaatttgggatccagccttgaac 463 Query: 278 caaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccg 337 || || || ||||| ||||| || ||||| ||||||| | |||||||||||| || || Sbjct: 462 catactgcttcaccaaacttgaccccgttacgggccaagagctcggggaagacacaacca 403 Query: 338 agcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaag 397 || ||||||||||| ||||| | ||||||||||||||||| ||| || |||||||| || Sbjct: 402 agagctccaagcatagcccatctgcagtggatcacctccaactcacgattcttggcaaaa 343 Query: 398 gtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcacc 457 || || || ||||| || | ||||||||||||| | || ||||| |||||||| ||||| Sbjct: 342 gtttctggatcagctgaaagtccagcagtgtccc-atccatagtcaccagggaattcacc 284 Query: 458 ggtcaggtagctcgggggctcaccaga 484 |||| ||| || || | ||||||||| Sbjct: 283 cgtcaagtaacttggagactcaccaga 257 Score = 65.9 bits (33), Expect = 2e-07 Identities = 90/109 (82%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| ||||| || |||||||||||| | | ||| ||||||||||| || ||||| || | Sbjct: 869 actttccggggacaaagttggtggcgtaggaccaggcattgttgttaactgggtcagcaa 810 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 | ||||| || |||||||| | ||||||||| || |||||||| ||||| Sbjct: 809 ggtggtcggctaggttctccaatggaccctttccagtgacgatagcttg 761
>gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genomic sequence, complete sequence Length = 139771 Score = 131 bits (66), Expect = 4e-27 Identities = 202/246 (82%), Gaps = 1/246 (0%) Strand = Plus / Plus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 ||||| || |||||||| || || |||||| ||||||||| | |||||||||||||| Sbjct: 79324 gggttccccaggtagtcgagccccccctcggagaagatctgcgcgccggccttgaaccac 79383 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || ||||| ||||||||||| ||||| || ||| | ||| |||||||||||||| ||| Sbjct: 79384 accgcctccccgaacttcaccccgttcttggacaggatctccgggaagacgcagcccagc 79443 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 || || ||||| ||||| || ||||||||||||||||||| | |||| | ||||| ||| Sbjct: 79444 gcccccagcatcgcccaccgcgagtggatcacctccagctccctgttcctcgcgaacgtc 79503 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || ||||| || || | ||| || ||||||| |||||||||| || |||||||| ||||| Sbjct: 79504 tccgggtcggccgatagccccgccgtgtccc-acccgtagtctcccgggaactctccggt 79562 Query: 461 caggta 466 |||||| Sbjct: 79563 caggta 79568 Score = 99.6 bits (50), Expect = 1e-17 Identities = 92/106 (86%) Strand = Plus / Plus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||||||||| ||||||||||||||| ||||||| || |||||| |||||||||||||| Sbjct: 78974 acttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcga 79033 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 ||||| ||||||||||| || |||||||||||||||||||| Sbjct: 79034 cgtggtcgaagaggttctcgatggggcccttgccggtgacgatggc 79079
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 131 bits (66), Expect = 4e-27 Identities = 202/246 (82%), Gaps = 1/246 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 ||||| || |||||||| || || |||||| ||||||||| | |||||||||||||| Sbjct: 21808492 gggttccccaggtagtcgagccccccctcggagaagatctgcgcgccggccttgaaccac 21808433 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || ||||| ||||||||||| ||||| || ||| | ||| |||||||||||||| ||| Sbjct: 21808432 accgcctccccgaacttcaccccgttcttggacaggatctccgggaagacgcagcccagc 21808373 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 || || ||||| ||||| || ||||||||||||||||||| | |||| | ||||| ||| Sbjct: 21808372 gcccccagcatcgcccaccgcgagtggatcacctccagctccctgttcctcgcgaacgtc 21808313 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || ||||| || || | ||| || ||||||| |||||||||| || |||||||| ||||| Sbjct: 21808312 tccgggtcggccgatagccccgccgtgtccc-acccgtagtctcccgggaactctccggt 21808254 Query: 461 caggta 466 |||||| Sbjct: 21808253 caggta 21808248 Score = 99.6 bits (50), Expect = 1e-17 Identities = 92/106 (86%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||||||||| ||||||||||||||| ||||||| || |||||| |||||||||||||| Sbjct: 21808842 acttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcga 21808783 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 ||||| ||||||||||| || |||||||||||||||||||| Sbjct: 21808782 cgtggtcgaagaggttctcgatggggcccttgccggtgacgatggc 21808737
>emb|X16436.1|SACAB Mustard cab gene for chlorophyll a/b-binding protein Length = 2774 Score = 131 bits (66), Expect = 4e-27 Identities = 214/262 (81%), Gaps = 1/262 (0%) Strand = Plus / Minus Query: 217 gcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaa 276 |||||||||||| | |||||| || || || |||||||||||||| || ||||||||||| Sbjct: 2025 gcttgggttgcccaagtagtcaagtcctccttcgctgaagatctgtgaaccggccttgaa 1966 Query: 277 ccaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagcc 336 |||||| || || |||||||| || ||||| || |||| | ||| ||||| ||||| || Sbjct: 1965 ccaaaccgcttctccgaacttgactccgttacgagccaatagctcagggaaaacgcaacc 1906 Query: 337 gagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaa 396 || ||||| ||||||||||| | ||||||||| || || ||||| ||||| | ||||| Sbjct: 1905 tagggctccgagcatggcccatctgcagtggataacttctagctcacggtttctagcgaa 1846 Query: 397 ggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcac 456 |||||||||||||| || | ||||| ||||||| | || ||||| || |||||||| | Sbjct: 1845 agtctcggggtcagctgatagaccagcggtgtccc-atccatagtctccggggaactctc 1787 Query: 457 cggtcaggtagctcgggggctc 478 | || |||||||| |||||||| Sbjct: 1786 cagtaaggtagcttgggggctc 1765 Score = 77.8 bits (39), Expect = 5e-11 Identities = 87/103 (84%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| ||||| ||||||||||||||||| |||||||| ||||||||||| || || || | Sbjct: 2374 actttccggggacgaagttggtggcgaaggcccatgcgttgttgttgactggatcagcca 2315 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgat 215 |||||| ||||| ||||| | || ||||| ||||||||||| Sbjct: 2314 aatggtcggcgagattctccaacggtccctttccggtgacgat 2272
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 131 bits (66), Expect = 4e-27 Identities = 202/246 (82%), Gaps = 1/246 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 ||||| || |||||||| || || |||||| ||||||||| | |||||||||||||| Sbjct: 21801521 gggttccccaggtagtcgagccccccctcggagaagatctgcgcgccggccttgaaccac 21801462 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || ||||| ||||||||||| ||||| || ||| | ||| |||||||||||||| ||| Sbjct: 21801461 accgcctccccgaacttcaccccgttcttggacaggatctccgggaagacgcagcccagc 21801402 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 || || ||||| ||||| || ||||||||||||||||||| | |||| | ||||| ||| Sbjct: 21801401 gcccccagcatcgcccaccgcgagtggatcacctccagctccctgttcctcgcgaacgtc 21801342 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || ||||| || || | ||| || ||||||| |||||||||| || |||||||| ||||| Sbjct: 21801341 tccgggtcggccgatagccccgccgtgtccc-acccgtagtctcccgggaactctccggt 21801283 Query: 461 caggta 466 |||||| Sbjct: 21801282 caggta 21801277 Score = 99.6 bits (50), Expect = 1e-17 Identities = 92/106 (86%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||||||||| ||||||||||||||| ||||||| || |||||| |||||||||||||| Sbjct: 21801871 acttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcga 21801812 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 ||||| ||||||||||| || |||||||||||||||||||| Sbjct: 21801811 cgtggtcgaagaggttctcgatggggcccttgccggtgacgatggc 21801766
>emb|X68682.1|ZMLHCB Z.mays mRNA for type II light-harvesting chlorophyll a/b-binding protein Length = 1126 Score = 131 bits (66), Expect = 4e-27 Identities = 202/246 (82%), Gaps = 1/246 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 ||||| || ||||||||||| |||||||| ||||||||| | |||||||||||||| Sbjct: 476 gggttccccaggtagtccagcccgccctccgagaagatctgcgcgccggccttgaaccac 417 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || ||||| |||||||| |||||||| |||||| | ||| ||||| |||||||| ||| Sbjct: 416 accgcctcgccgaacttgacgccgttcttggccaggatctccgggaacacgcagcccagc 357 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 || || ||||| ||||| ||| ||||||||||||||||||| ||||| ||||| ||| Sbjct: 356 gcgcccagcatcgcccaccgggagtggatcacctccagctcccggttgcgcgcgaatgtc 297 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || ||||| || || | || || || |||| ||||||||||||| |||||||| ||||| Sbjct: 296 tccgggtcggccgagacgccggcggtctccc-acccgtagtcgccggggaactcgccggt 238 Query: 461 caggta 466 |||||| Sbjct: 237 caggta 232 Score = 87.7 bits (44), Expect = 5e-14 Identities = 89/104 (85%) Strand = Plus / Minus Query: 115 ttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcgaga 174 |||||||| |||||||| |||||| ||||||| || |||||| |||||||||||||| Sbjct: 824 ttgccggggacgaagttcgtggcgtatgcccaggcgttgttggcgacggggtcggcgacg 765 Query: 175 tggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 ||||| ||||||||||| || |||||||||||||||||||| Sbjct: 764 tggtcgaagaggttctcgatggggcccttgccggtgacgatggc 721
>emb|X15894.1|SACAB1 Sinapsis alba cab-1 gene for chlorophyll a/b-binding polypeptide Length = 2775 Score = 131 bits (66), Expect = 4e-27 Identities = 214/262 (81%), Gaps = 1/262 (0%) Strand = Plus / Minus Query: 217 gcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaa 276 |||||||||||| | |||||| || || || |||||||||||||| || ||||||||||| Sbjct: 2026 gcttgggttgcccaagtagtcaagtcctccttcgctgaagatctgtgaaccggccttgaa 1967 Query: 277 ccaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagcc 336 |||||| || || |||||||| || ||||| || |||| | ||| ||||| ||||| || Sbjct: 1966 ccaaaccgcttctccgaacttgactccgttacgagccaatagctcagggaaaacgcaacc 1907 Query: 337 gagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaa 396 || ||||| ||||||||||| | ||||||||| || || ||||| ||||| | ||||| Sbjct: 1906 tagggctccgagcatggcccatctgcagtggataacttctagctcacggtttctagcgaa 1847 Query: 397 ggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcac 456 |||||||||||||| || | ||||| ||||||| | || ||||| || |||||||| | Sbjct: 1846 agtctcggggtcagctgatagaccagcggtgtccc-atccatagtctccggggaactctc 1788 Query: 457 cggtcaggtagctcgggggctc 478 | || |||||||| |||||||| Sbjct: 1787 cagtaaggtagcttgggggctc 1766 Score = 77.8 bits (39), Expect = 5e-11 Identities = 87/103 (84%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| ||||| ||||||||||||||||| |||||||| ||||||||||| || || || | Sbjct: 2375 actttccggggacgaagttggtggcgaaggcccatgcgttgttgttgactggatcagcca 2316 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgat 215 |||||| ||||| ||||| | || ||||| ||||||||||| Sbjct: 2315 aatggtcggcgagattctccaacggtccctttccggtgacgat 2273
>gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding protein (RCABP89) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1027 Score = 131 bits (66), Expect = 4e-27 Identities = 202/246 (82%), Gaps = 1/246 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 ||||| || |||||||| || || |||||| ||||||||| | |||||||||||||| Sbjct: 480 gggttccccaggtagtcgagccccccctcggagaagatctgcgcgccggccttgaaccac 421 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || ||||| ||||||||||| ||||| || ||| | ||| |||||||||||||| ||| Sbjct: 420 accgcctccccgaacttcaccccgttcttggacaggatctccgggaagacgcagcccagc 361 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 || || ||||| ||||| || ||||||||||||||||||| | |||| | ||||| ||| Sbjct: 360 gcccccagcatcgcccaccgcgagtggatcacctccagctccctgttcctcgcgaacgtc 301 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || ||||| || || | ||| || ||||||| |||||||||| || |||||||| ||||| Sbjct: 300 tccgggtcggccgatagccccgccgtgtccc-acccgtagtctcccgggaactctccggt 242 Query: 461 caggta 466 |||||| Sbjct: 241 caggta 236 Score = 99.6 bits (50), Expect = 1e-17 Identities = 92/106 (86%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||||||||| ||||||||||||||| ||||||| || |||||| |||||||||||||| Sbjct: 830 acttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcga 771 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 ||||| ||||||||||| || |||||||||||||||||||| Sbjct: 770 cgtggtcgaagaggttctcgatggggcccttgccggtgacgatggc 725
>ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll binding AT2G34430 (LHB1B1) mRNA, complete cds Length = 1008 Score = 129 bits (65), Expect = 1e-26 Identities = 213/261 (81%), Gaps = 1/261 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 |||||||| | |||||||| || || |||||||||||||| || || |||||||||||| Sbjct: 508 gggttgcccaagtagtccaatcctccgtcgctgaagatctgtgaaccagccttgaaccaa 449 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || || || ||||||||||| ||||| | |||| | ||| ||||| |||||||| || Sbjct: 448 accgcttctccgaacttcactccgttcctagccaatagctcagggaaaacgcagcctagg 389 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 ||||| ||||||||||| | || |||||| || || ||||| |||||| | ||||||||| Sbjct: 388 gctccgagcatggcccatctgctgtggataacttctagctcacggttcctagcgaaggtc 329 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 ||||| || || || | || |||||||||| ||||||| || || |||||||| || || Sbjct: 328 tcgggatcggcggatagaccggcagtgtccc-acccgtaatcaccggggaactctccagt 270 Query: 461 caggtagctcgggggctcacc 481 ||||||||||| |||||||| Sbjct: 269 gaggtagctcggaggctcacc 249 Score = 75.8 bits (38), Expect = 2e-10 Identities = 89/106 (83%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| ||||| ||||||||||| ||||| |||||||||||||||||||| || || || | Sbjct: 861 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagcca 802 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 ||||| ||||||||||| | || ||||| |||||||| ||||| Sbjct: 801 agtggtccgcgaggttctccaacggtccctttccggtgacaatggc 756
>gb|BT015572.1| Arabidopsis thaliana At1g29910 mRNA sequence Length = 762 Score = 129 bits (65), Expect = 1e-26 Identities = 186/225 (82%), Gaps = 1/225 (0%) Strand = Plus / Minus Query: 248 tcgctgaagatctgggatccggccttgaaccaaacagcctcaccgaacttcacgccgttt 307 |||||||||||||| || || |||||||||||||| ||||| || ||||| || ||||| Sbjct: 380 tcgctgaagatctgtgaaccagccttgaaccaaactgcctctccaaacttgactccgttc 321 Query: 308 cgggccagcaactcggggaagacgcagccgagcgctccaagcatggcccaacggcagtgg 367 | ||||| | ||| |||||||||||||| || ||||| ||||||||||| | || |||| Sbjct: 320 ctggccaaaagctcagggaagacgcagcctagggctccgagcatggcccacctgctgtgg 261 Query: 368 atcacctccagctcgcggttcttggcgaaggtctcggggtcagcagacaacccagcagtg 427 || || || ||||| |||||| | ||||| |||||||| ||||| || | ||||| ||| Sbjct: 260 ataacttctagctcacggttccttgcgaatgtctcgggatcagctgaaagtccagcggtg 201 Query: 428 tcccaacccgtagtcgccagggaactcaccggtcaggtagctcgg 472 |||| | |||||||| || |||||||| ||||| ||||||||||| Sbjct: 200 tccc-atccgtagtctccggggaactctccggtaaggtagctcgg 157 Score = 81.8 bits (41), Expect = 3e-12 Identities = 92/109 (84%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| |||||||| ||||||||||| || ||||| || ||||||||||| || ||||| | Sbjct: 760 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggcca 701 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 ||||||||| |||||||| | || ||||| || |||||||||||||| Sbjct: 700 aatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttg 652
>gb|AF339687.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At2g34430) mRNA, complete cds Length = 851 Score = 129 bits (65), Expect = 1e-26 Identities = 213/261 (81%), Gaps = 1/261 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 |||||||| | |||||||| || || |||||||||||||| || || |||||||||||| Sbjct: 446 gggttgcccaagtagtccaatcctccgtcgctgaagatctgtgaaccagccttgaaccaa 387 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || || || ||||||||||| ||||| | |||| | ||| ||||| |||||||| || Sbjct: 386 accgcttctccgaacttcactccgttcctagccaatagctcagggaaaacgcagcctagg 327 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 ||||| ||||||||||| | || |||||| || || ||||| |||||| | ||||||||| Sbjct: 326 gctccgagcatggcccatctgctgtggataacttctagctcacggttcctagcgaaggtc 267 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 ||||| || || || | || |||||||||| ||||||| || || |||||||| || || Sbjct: 266 tcgggatcggcggatagaccggcagtgtccc-acccgtaatcaccggggaactctccagt 208 Query: 461 caggtagctcgggggctcacc 481 ||||||||||| |||||||| Sbjct: 207 gaggtagctcggaggctcacc 187 Score = 75.8 bits (38), Expect = 2e-10 Identities = 89/106 (83%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| ||||| ||||||||||| ||||| |||||||||||||||||||| || || || | Sbjct: 799 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagcca 740 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 ||||| ||||||||||| | || ||||| |||||||| ||||| Sbjct: 739 agtggtccgcgaggttctccaacggtccctttccggtgacaatggc 694
>gb|AF326864.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At2g34430) mRNA, complete cds Length = 1019 Score = 129 bits (65), Expect = 1e-26 Identities = 213/261 (81%), Gaps = 1/261 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 |||||||| | |||||||| || || |||||||||||||| || || |||||||||||| Sbjct: 508 gggttgcccaagtagtccaatcctccgtcgctgaagatctgtgaaccagccttgaaccaa 449 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || || || ||||||||||| ||||| | |||| | ||| ||||| |||||||| || Sbjct: 448 accgcttctccgaacttcactccgttcctagccaatagctcagggaaaacgcagcctagg 389 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 ||||| ||||||||||| | || |||||| || || ||||| |||||| | ||||||||| Sbjct: 388 gctccgagcatggcccatctgctgtggataacttctagctcacggttcctagcgaaggtc 329 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 ||||| || || || | || |||||||||| ||||||| || || |||||||| || || Sbjct: 328 tcgggatcggcggatagaccggcagtgtccc-acccgtaatcaccggggaactctccagt 270 Query: 461 caggtagctcgggggctcacc 481 ||||||||||| |||||||| Sbjct: 269 gaggtagctcggaggctcacc 249 Score = 75.8 bits (38), Expect = 2e-10 Identities = 89/106 (83%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| ||||| ||||||||||| ||||| |||||||||||||||||||| || || || | Sbjct: 861 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagcca 802 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 ||||| ||||||||||| | || ||||| |||||||| ||||| Sbjct: 801 agtggtccgcgaggttctccaacggtccctttccggtgacaatggc 756
>gb|AY120776.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein. (At2g34430) mRNA, complete cds Length = 1003 Score = 129 bits (65), Expect = 1e-26 Identities = 213/261 (81%), Gaps = 1/261 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 |||||||| | |||||||| || || |||||||||||||| || || |||||||||||| Sbjct: 508 gggttgcccaagtagtccaatcctccgtcgctgaagatctgtgaaccagccttgaaccaa 449 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || || || ||||||||||| ||||| | |||| | ||| ||||| |||||||| || Sbjct: 448 accgcttctccgaacttcactccgttcctagccaatagctcagggaaaacgcagcctagg 389 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 ||||| ||||||||||| | || |||||| || || ||||| |||||| | ||||||||| Sbjct: 388 gctccgagcatggcccatctgctgtggataacttctagctcacggttcctagcgaaggtc 329 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 ||||| || || || | || |||||||||| ||||||| || || |||||||| || || Sbjct: 328 tcgggatcggcggatagaccggcagtgtccc-acccgtaatcaccggggaactctccagt 270 Query: 461 caggtagctcgggggctcacc 481 ||||||||||| |||||||| Sbjct: 269 gaggtagctcggaggctcacc 249 Score = 75.8 bits (38), Expect = 2e-10 Identities = 89/106 (83%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| ||||| ||||||||||| ||||| |||||||||||||||||||| || || || | Sbjct: 861 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagcca 802 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 ||||| ||||||||||| | || ||||| |||||||| ||||| Sbjct: 801 agtggtccgcgaggttctccaacggtccctttccggtgacaatggc 756
>emb|BX817619.1|CNS0AAVV Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL33ZA06 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 994 Score = 129 bits (65), Expect = 1e-26 Identities = 186/225 (82%), Gaps = 1/225 (0%) Strand = Plus / Minus Query: 248 tcgctgaagatctgggatccggccttgaaccaaacagcctcaccgaacttcacgccgttt 307 |||||||||||||| || ||||||||||||||||| ||||| |||||||| || ||||| Sbjct: 472 tcgctgaagatctgtgaaccggccttgaaccaaaccgcctctccgaacttgactacgttt 413 Query: 308 cgggccagcaactcggggaagacgcagccgagcgctccaagcatggcccaacggcagtgg 367 | |||| | ||| |||||||||||||| || ||||| ||||||||||| | || |||| Sbjct: 412 ctagccaaaagctcagggaagacgcagcctagggctccgagcatggcccacctgctgtgg 353 Query: 368 atcacctccagctcgcggttcttggcgaaggtctcggggtcagcagacaacccagcagtg 427 || || || || || |||||| | ||||| |||||||||||||| || | || || ||| Sbjct: 352 ataacttctagttcacggttccttgcgaatgtctcggggtcagctgaaagtccggcggtg 293 Query: 428 tcccaacccgtagtcgccagggaactcaccggtcaggtagctcgg 472 |||| | |||||||| || |||||||| ||||| ||||||||||| Sbjct: 292 tccc-atccgtagtctccggggaactctccggtaaggtagctcgg 249 Score = 40.1 bits (20), Expect = 9.9 Identities = 41/48 (85%) Strand = Plus / Minus Query: 174 atggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 ||||||||| |||||||| | || ||||| || |||||||||||||| Sbjct: 791 atggtcagcaaggttctctatcggtcccttaccagtgacgatggcttg 744
>emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II type I chlorophyll a/b binding protein Length = 1301 Score = 129 bits (65), Expect = 1e-26 Identities = 213/261 (81%), Gaps = 1/261 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 |||||||| | |||||||| || || |||||||||||||| || || |||||||||||| Sbjct: 746 gggttgcccaagtagtccaatcctccgtcgctgaagatctgtgaaccagccttgaaccaa 687 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || || || ||||||||||| ||||| | |||| | ||| ||||| |||||||| || Sbjct: 686 accgcttctccgaacttcactccgttcctagccaatagctcagggaaaacgcagcctagg 627 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 ||||| ||||||||||| | || |||||| || || ||||| |||||| | ||||||||| Sbjct: 626 gctccgagcatggcccatctgctgtggataacttctagctcacggttcctagcgaaggtc 567 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 ||||| || || || | || |||||||||| ||||||| || || |||||||| || || Sbjct: 566 tcgggatcggcggatagaccggcagtgtccc-acccgtaatcaccggggaactctccagt 508 Query: 461 caggtagctcgggggctcacc 481 ||||||||||| |||||||| Sbjct: 507 gaggtagctcggaggctcacc 487 Score = 75.8 bits (38), Expect = 2e-10 Identities = 89/106 (83%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| ||||| ||||||||||| ||||| |||||||||||||||||||| || || || | Sbjct: 1099 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagcca 1040 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 ||||| ||||||||||| | || ||||| |||||||| ||||| Sbjct: 1039 agtggtccgcgaggttctccaacggtccctttccggtgacaatggc 994
>emb|X03909.1|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophyll a/b binding protein Length = 1109 Score = 129 bits (65), Expect = 1e-26 Identities = 186/225 (82%), Gaps = 1/225 (0%) Strand = Plus / Minus Query: 248 tcgctgaagatctgggatccggccttgaaccaaacagcctcaccgaacttcacgccgttt 307 |||||||||||||| || ||||||||||||||||| ||||| |||||||| || |||||| Sbjct: 639 tcgctgaagatctgtgaaccggccttgaaccaaaccgcctctccgaacttgactccgttt 580 Query: 308 cgggccagcaactcggggaagacgcagccgagcgctccaagcatggcccaacggcagtgg 367 | |||| | ||| |||||||||||||| || ||||| ||||| ||||| | || |||| Sbjct: 579 ctagccaaaagctcagggaagacgcagcctagggctccgagcatagcccacctgctgtgg 520 Query: 368 atcacctccagctcgcggttcttggcgaaggtctcggggtcagcagacaacccagcagtg 427 || || || || || |||||| | ||||| |||||||||||||| || | || || ||| Sbjct: 519 ataacttctagttcacggttccttgcgaatgtctcggggtcagctgaaagtccggcggtg 460 Query: 428 tcccaacccgtagtcgccagggaactcaccggtcaggtagctcgg 472 |||| | |||||||| || |||||||| ||||| ||||||||||| Sbjct: 459 tccc-atccgtagtctccggggaactctccggtaaggtagctcgg 416 Score = 89.7 bits (45), Expect = 1e-14 Identities = 93/109 (85%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| |||||||| |||||||||||||| |||||||| |||||||| || || ||||| | Sbjct: 1019 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 960 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 ||||||||| |||||||| | || ||||| || |||||||||||||| Sbjct: 959 aatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttg 911
>gb|BT002103.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein. (At2g34430) mRNA, complete cds Length = 853 Score = 129 bits (65), Expect = 1e-26 Identities = 213/261 (81%), Gaps = 1/261 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 |||||||| | |||||||| || || |||||||||||||| || || |||||||||||| Sbjct: 446 gggttgcccaagtagtccaatcctccgtcgctgaagatctgtgaaccagccttgaaccaa 387 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || || || ||||||||||| ||||| | |||| | ||| ||||| |||||||| || Sbjct: 386 accgcttctccgaacttcactccgttcctagccaatagctcagggaaaacgcagcctagg 327 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 ||||| ||||||||||| | || |||||| || || ||||| |||||| | ||||||||| Sbjct: 326 gctccgagcatggcccatctgctgtggataacttctagctcacggttcctagcgaaggtc 267 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 ||||| || || || | || |||||||||| ||||||| || || |||||||| || || Sbjct: 266 tcgggatcggcggatagaccggcagtgtccc-acccgtaatcaccggggaactctccagt 208 Query: 461 caggtagctcgggggctcacc 481 ||||||||||| |||||||| Sbjct: 207 gaggtagctcggaggctcacc 187 Score = 75.8 bits (38), Expect = 2e-10 Identities = 89/106 (83%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| ||||| ||||||||||| ||||| |||||||||||||||||||| || || || | Sbjct: 799 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagcca 740 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 ||||| ||||||||||| | || ||||| |||||||| ||||| Sbjct: 739 agtggtccgcgaggttctccaacggtccctttccggtgacaatggc 694
>emb|X14341.1|SOCABP S.oleracea chloroplast mRNA for chlorophyll a/b binding protein Length = 980 Score = 129 bits (65), Expect = 1e-26 Identities = 204/249 (81%), Gaps = 1/249 (0%) Strand = Plus / Minus Query: 218 cttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaac 277 |||||||| || | |||||| || || |||||||| ||||| || || || ||||| ||| Sbjct: 504 cttgggttacccaagtagtcaagcccaccctcgctaaagatttgtgaacccgccttaaac 445 Query: 278 caaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccg 337 ||||| |||||||||||||| || || || ||||||| | ||| ||||| || || || Sbjct: 444 caaacggcctcaccgaacttaacaccattacgggccaagagctctgggaaaacacaaccc 385 Query: 338 agcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaag 397 | ||||| | ||| ||||| | ||||||||| || || ||||| |||||||| |||||| Sbjct: 384 aatgctcccaacatagcccacctgcagtggataacttcaagctcacggttcttagcgaag 325 Query: 398 gtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcacc 457 || || |||||||| || | |||||||||||||||| |||||||| |||||||||||||| Sbjct: 324 gtttctgggtcagctgaaagcccagcagtgtcccaa-ccgtagtcaccagggaactcacc 266 Query: 458 ggtcaggta 466 ||| ||||| Sbjct: 265 ggtgaggta 257 Score = 50.1 bits (25), Expect = 0.010 Identities = 79/97 (81%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| ||||| || ||||||||||| || ||| ||||||||||| || ||||| || | Sbjct: 851 actttccggggacaaagttggtggcaaagttccaagcattgttgttaaccgggtcagcaa 792 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggt 209 | |||||||||||||| || | ||| ||||| ||||| Sbjct: 791 ggtggtcagcgaggttttccaatgggccctttccggt 755
>gb|M21396.1|SOYCBPA Soybean light-harvesting chlorophyll a/b-binding protein (LHCPII) mRNA, 3' end Length = 911 Score = 129 bits (65), Expect = 1e-26 Identities = 219/269 (81%), Gaps = 1/269 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 ||||| ||||||| | |||||| || || ||||| ||||| ||||| || |||||||||| Sbjct: 393 ggctttggttgcccaagtagtcaagcccaccctcactgaatatctgagacccggccttga 334 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| || ||||||||||| || ||||| ||||||| | |||||||| || |||| Sbjct: 333 accacgacgcttcaccgaacttgacaccgttgcgggccaagagttcggggaaaacacagc 274 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 | || ||||| | ||||||||| | | ||||||| || || || || ||||||||||| | Sbjct: 273 ccagggctcccaacatggcccatctggagtggatgacttcaagttcacggttcttggcaa 214 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 ||||||| ||||||||||| | |||||||||||||||| || ||||| || ||||| ||| Sbjct: 213 aggtctctgggtcagcagaaagcccagcagtgtcccaa-ccatagtcacctgggaattca 155 Query: 456 ccggtcaggtagctcgggggctcaccaga 484 || || |||||| |||||||||||||| Sbjct: 154 ccagtgaggtaggatgggggctcaccaga 126
>gb|M14444.1|TOMCBPB Tomato chlorophyll a/b-binding protein gene Cab-3C, complete cds Length = 1135 Score = 127 bits (64), Expect = 5e-26 Identities = 218/268 (81%), Gaps = 1/268 (0%) Strand = Plus / Minus Query: 217 gcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaa 276 ||||||||| || | |||||| || || ||||||||||| || || ||||| |||||||| Sbjct: 658 gcttgggtttcccaagtagtcaagtccaccctcgctgaaaatttgtgatccagccttgaa 599 Query: 277 ccaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagcc 336 ||| ||||| ||||||||||| || || || ||||||| | ||||||||| || || || Sbjct: 598 ccatacagcttcaccgaacttaacaccattacgggccaaaagctcggggaatacacatcc 539 Query: 337 gagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaa 396 || || |||||||||||||| | || || || ||||||| ||| |||||||| ||||| Sbjct: 538 aagagcaccaagcatggcccatctacaatgaataacctccaactcacggttcttagcgaa 479 Query: 397 ggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcac 456 || || |||||||| || | ||||||||||||| | ||||| || ||||| ||||||| Sbjct: 478 tgtttcagggtcagctgaaagtccagcagtgtccc-atccgtaatcaccaggaaactcac 420 Query: 457 cggtcaggtagctcgggggctcaccaga 484 |||||| |||||| |||| ||| ||||| Sbjct: 419 cggtcaagtagcttggggactccccaga 392 Score = 103 bits (52), Expect = 8e-19 Identities = 91/104 (87%) Strand = Plus / Minus Query: 118 ccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcgagatgg 177 ||||| || ||||| |||||||| ||||| |||||||| ||||| ||||| ||||||||| Sbjct: 999 ccggggacaaagtttgtggcgaaggcccaagcattgttattgactgggtcagcgagatgg 940 Query: 178 tcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 ||||| |||||||| | ||||||||| ||||||||||| ||||| Sbjct: 939 tcagcaaggttctccaatggaccctttccggtgacgatagcttg 896
>dbj|AB026686.1| Physcomitrella patens mRNA for chlorophyll a/b-binding protein precursor, complete cds Length = 964 Score = 127 bits (64), Expect = 5e-26 Identities = 206/252 (81%), Gaps = 1/252 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| |||||||| | |||||||| || ||||||||||||||||| | ||||||||||| Sbjct: 499 ggctggggttgcccaagtagtccaaacctccctcgctgaagatctgagctccggccttga 440 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 ||||||| |||||||||||||| || ||| | ||||| |||||| ||| | || | Sbjct: 439 accaaacggcctcaccgaacttaacaccgctcttggccaacaactctggggtcagacatc 380 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 | || ||||||||||||||||| || |||||||||||| ||||||||||| ||||| Sbjct: 379 ccagagctccaagcatggcccatcgagcgtggatcacctcgagctcgcggttgcgggcga 320 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 ||||||||||||| | || | ||||||||||||| | ||||| || |||| ||||||| Sbjct: 319 aggtctcggggtcggatgagagtccagcagtgtccc-agccgtaatcaccagcgaactca 261 Query: 456 ccggtcaggtag 467 ||| | |||||| Sbjct: 260 ccgttgaggtag 249 Score = 50.1 bits (25), Expect = 0.010 Identities = 46/53 (86%) Strand = Plus / Minus Query: 118 ccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggc 170 ||||||||||||||||||||| | ||||| || |||||| ||||||||||| Sbjct: 839 ccgggaacgaagttggtggcgtaggcccaggcgttgttggcaacggggtcggc 787
>gb|DQ226787.1| Boechera divaricarpa isolate SLW-B-B06 mRNA sequence Length = 827 Score = 125 bits (63), Expect = 2e-25 Identities = 190/231 (82%), Gaps = 1/231 (0%) Strand = Plus / Minus Query: 248 tcgctgaagatctgggatccggccttgaaccaaacagcctcaccgaacttcacgccgttt 307 ||||||||||| || || || |||||||||||||| ||||| |||||||| || ||||| Sbjct: 250 tcgctgaagatttgtgaacctgccttgaaccaaaccgcctctccgaacttgactccgttc 191 Query: 308 cgggccagcaactcggggaagacgcagccgagcgctccaagcatggcccaacggcagtgg 367 | ||||| | ||| |||||||||||||| || ||||| ||||||||||| | || |||| Sbjct: 190 ctggccaaaagctcagggaagacgcagcctagggctccgagcatggcccacctgctgtgg 131 Query: 368 atcacctccagctcgcggttcttggcgaaggtctcggggtcagcagacaacccagcagtg 427 || || || ||||| |||||| | || || |||||||||||||| || | ||||| ||| Sbjct: 130 ataacttctagctcacggttccttgcaaatgtctcggggtcagcggataggccagctgtg 71 Query: 428 tcccaacccgtagtcgccagggaactcaccggtcaggtagctcgggggctc 478 |||| | |||||||| || |||||||| || || ||||||||||| ||||| Sbjct: 70 tccc-atccgtagtctccggggaactctcctgtgaggtagctcggtggctc 21 Score = 81.8 bits (41), Expect = 3e-12 Identities = 92/109 (84%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| |||||||| |||||||||||||| |||||||| |||||||| || || ||||| | Sbjct: 630 actttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggcca 571 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 ||||||||| || ||||| | || ||||| || |||||||||||||| Sbjct: 570 aatggtcagcaagattctccaacggtcccttaccagtgacgatggcttg 522
>gb|AY430082.1| Trifolium pratense chlorophyll a/b binding protein mRNA, complete cds; nuclear gene for chloroplast product Length = 987 Score = 125 bits (63), Expect = 2e-25 Identities = 217/267 (81%), Gaps = 1/267 (0%) Strand = Plus / Minus Query: 218 cttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaac 277 ||||||||||| | |||||| || || |||||||| ||||| || ||||||||||||||| Sbjct: 504 cttgggttgcccaagtagtcaagtccaccctcgctaaagatttgagatccggccttgaac 445 Query: 278 caaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccg 337 ||||||||||| ||||| || || ||||| || | || | ||| ||||| || || || Sbjct: 444 caaacagcctcgccgaatttaacaccgttgcgagacaaaagctctgggaaaacacatccc 385 Query: 338 agcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaag 397 | ||||| | ||| ||||| | ||||||| || || ||||| |||||||||||||| Sbjct: 384 aaggctcctaacatagcccatctagagtggataacttcaagctcacggttcttggcgaat 325 Query: 398 gtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcacc 457 ||||| ||||||||||| | ||||||||||||||| |||||||| || |||||||| || Sbjct: 324 gtctctgggtcagcagaaagtccagcagtgtcccaa-ccgtagtcacctgggaactctcc 266 Query: 458 ggtcaggtagctcgggggctcaccaga 484 |||| ||| ||||||||||||||| Sbjct: 265 agtcaagtaagacgggggctcaccaga 239 Score = 81.8 bits (41), Expect = 3e-12 Identities = 83/97 (85%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| |||||||| ||||||||||| || ||||| || ||||||||||| ||||| || | Sbjct: 851 actttccgggaacaaagttggtggcaaaagcccaggcgttgttgttgactgggtcagcaa 792 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggt 209 |||||||||| |||||||| | |||||||| ||||| Sbjct: 791 gatggtcagcaaggttctccaaaggaccctttccggt 755
>gb|DQ122900.1| Chlamydomonas incerta chloroplast light-harvesting chlorophyll-a/b binding protein (LhcII-1.3) mRNA, complete cds; nuclear gene for chloroplast product Length = 1100 Score = 125 bits (63), Expect = 2e-25 Identities = 202/247 (81%), Gaps = 1/247 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 |||||||| ||||||||||||||||||||| ||||||||||| |||||||||||||| Sbjct: 434 gggttgcccaggtagtccaggccgccctcggagaagatctgggcgccggccttgaaccag 375 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 |||||||| ||||||| |||||| |||||||| ||||||| | |||||| || Sbjct: 374 acagcctcgccgaactgggtgccgttcttggccagcagctcgggggtcaggcagcccagg 315 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 || || ||||||||||| ||| |||||||| |||||||||||||| ||||||| Sbjct: 314 gcgcccagcatggcccagcgggcgtggatcagctccagctcgcggtagcgcttgaaggtc 255 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || |||||||| |||| || || ||||||| | |||||||| || |||||||| ||||| Sbjct: 254 tccgggtcagccgacaggccggcggtgtccc-agccgtagtcaccggggaactcgccggt 196 Query: 461 caggtag 467 ||||||| Sbjct: 195 caggtag 189
>gb|AY617086.1| Pinus roxburghii chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 125 bits (63), Expect = 2e-25 Identities = 202/247 (81%), Gaps = 1/247 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 ||||| || |||||||| || || ||||||||||| ||||| | ||| ||||||||||| Sbjct: 466 gggtttcccaggtagtcaagccctccctcgctgaaaatctgagctcccgccttgaaccac 407 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || |||||||||||||| || || |||| ||||| | ||| ||||| ||||| || || Sbjct: 406 acggcctcaccgaacttaactccatttctagccagaagctccgggaaaacgcaacccaga 347 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 || || ||||| ||||| |||||||||||||| |||||||| | |||||| || || ||| Sbjct: 346 gcgcccagcattgcccaccggcagtggatcacttccagctctctgttcttcgcaaaagtc 287 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || || || || || | ||| || ||||||| |||||||||| || |||||||||||||| Sbjct: 286 tctggatctgccgaaagccccgccgtgtccc-acccgtagtcaccggggaactcaccggt 228 Query: 461 caggtag 467 || |||| Sbjct: 227 caagtag 221
>gb|AY617085.1| Pinus merkusii chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 125 bits (63), Expect = 2e-25 Identities = 202/247 (81%), Gaps = 1/247 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 ||||| || |||||||| || || ||||||||||| ||||| | ||| ||||||||||| Sbjct: 466 gggtttcctaggtagtcaagccctccctcgctgaaaatctgagctcccgccttgaaccac 407 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || |||||||||||||| || || |||| ||||| | ||| ||||| ||||| || || Sbjct: 406 acggcctcaccgaacttaactccatttctcgccagaagctccgggaaaacgcaacccaga 347 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 || || ||||| ||||| |||||||||||||| |||||||| | |||||| || || ||| Sbjct: 346 gcgcccagcattgcccaccggcagtggatcacttccagctctctgttcttcgcaaaagtc 287 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || || || || || | ||| || ||||||| |||||||||| || |||||||||||||| Sbjct: 286 tctggatctgccgaaagccccgccgtgtccc-acccgtagtcaccggggaactcaccggt 228 Query: 461 caggtag 467 || |||| Sbjct: 227 caagtag 221
>gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (LHCPII) mRNA, complete cds Length = 998 Score = 125 bits (63), Expect = 2e-25 Identities = 202/247 (81%), Gaps = 1/247 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 ||||| || |||||||| || || ||||||||||| ||||| | ||||||||||||||| Sbjct: 512 gggtttcccaggtagtcaagccctccctcgctgaaaatctgagctccggccttgaaccac 453 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || ||||| |||||||| || || |||| ||||| | ||| ||||| ||||| || || Sbjct: 452 acggcctccccgaactttactccatttctcgccagaagctccgggaaaacgcaacccaga 393 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 || || ||||| ||||| |||||||||||||| |||||||| | |||||| || || ||| Sbjct: 392 gcgcccagcattgcccaccggcagtggatcacttccagctctctgttcttcgcaaaagtc 333 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || || || || || | ||| || ||||||| |||||||||| || |||||||||||||| Sbjct: 332 tctggatctgccgaaagccccgccgtgtccc-acccgtagtcaccggggaactcaccggt 274 Query: 461 caggtag 467 || |||| Sbjct: 273 caagtag 267 Score = 71.9 bits (36), Expect = 3e-09 Identities = 87/104 (83%) Strand = Plus / Minus Query: 115 ttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcgaga 174 |||||||| ||||||||||||||| | ||||| || |||||||| |||||||| || || Sbjct: 860 ttgccggggacgaagttggtggcgtaggcccaggcgttgttgttaacggggtcagccagg 801 Query: 175 tggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 || |||| ||||||||||| || || || |||||||| ||||| Sbjct: 800 tgatcagtgaggttctcgatgggtcctttcccggtgacaatggc 757
>gb|U21115.1|STU21115 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-6) gene, nuclear gene encoding chloroplast protein, partial cds Length = 405 Score = 125 bits (63), Expect = 2e-25 Identities = 184/223 (82%), Gaps = 1/223 (0%) Strand = Plus / Minus Query: 262 ggatccggccttgaaccaaacagcctcaccgaacttcacgccgtttcgggccagcaactc 321 |||||| || |||||||| ||||||||||| ||||| || ||||| ||||||| | ||| Sbjct: 405 ggatccagctttgaaccacacagcctcaccaaacttgacaccgttacgggccaagagctc 346 Query: 322 ggggaagacgcagccgagcgctccaagcatggcccaacggcagtggatcacctccagctc 381 |||||||| || || || || |||||||| ||||| | ||| ||||||||||| || || Sbjct: 345 agggaagacacatccaagagcaccaagcatagcccatctgcaatggatcacctcgagttc 286 Query: 382 gcggttcttggcgaaggtctcggggtcagcagacaacccagcagtgtcccaacccgtagt 441 ||||||||||| ||||| || ||||| || || | |||||||| |||| | ||||||| Sbjct: 285 acggttcttggcaaaggtttcagggtctgctgaaagtccagcagtatccc-agccgtagt 227 Query: 442 cgccagggaactcaccggtcaggtagctcgggggctcaccaga 484 | |||||||| |||||||||| |||||| |||| ||||||||| Sbjct: 226 caccagggaattcaccggtcaagtagcttggggactcaccaga 184
>gb|L36064.1|PRULHP Prunus persica (clone pAB19) light harvesting chlorophyll a/b binding protein (Lhcb-Pp1) gene, complete cds Length = 1912 Score = 125 bits (63), Expect = 2e-25 Identities = 180/219 (82%) Strand = Plus / Minus Query: 217 gcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaa 276 ||||||||| || | |||||| || || ||||| ||||| ||||||| || |||||||| Sbjct: 791 gcttgggtttcccaagtagtctagcccaccctcactgaatatctgggcgccagccttgaa 732 Query: 277 ccaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagcc 336 ||| ||||||||||||||||| || ||||| |||| || | || ||||| |||||||| Sbjct: 731 ccatacagcctcaccgaacttgaccccgttacgggacaagagttcagggaaaacgcagcc 672 Query: 337 gagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaa 396 || || |||||||||||||| | | ||||| || || ||||| ||||||||||| || Sbjct: 671 cagagcaccaagcatggcccatcttgaatggataacttcaagctcacggttcttggcaaa 612 Query: 397 ggtctcggggtcagcagacaacccagcagtgtcccaacc 435 |||||| |||||||| || | |||||||||||||||||| Sbjct: 611 ggtctctgggtcagctgagagcccagcagtgtcccaacc 573
>gb|DQ226825.1| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence Length = 775 Score = 123 bits (62), Expect = 9e-25 Identities = 209/258 (81%), Gaps = 1/258 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 |||||||| | |||||||| || || |||||||||||||| || |||| |||||||||| Sbjct: 277 gggttgcccaagtagtccaatcctccgtcgctgaagatctgtgaaccggycttgaaccaa 218 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || || || || |||||||| ||||| | |||| | ||| ||||| |||||||| || Sbjct: 217 accgcttctccraacttcactccgttcctagccaagagctcagggaaaacgcagcctagg 158 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 ||||| ||||||||||| | || |||||| || || ||||| |||||| ||||||||||| Sbjct: 157 gctccgagcatggcccatctgctgtggataacttctagctcacggttcctggcgaaggtc 98 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || || ||||| || | || || ||||||| | || ||||| || |||||||| ||||| Sbjct: 97 tctggatcagcggatagaccggcggtgtccc-atccatagtcaccggggaactctccggt 39 Query: 461 caggtagctcgggggctc 478 ||||||||||| ||||| Sbjct: 38 aaggtagctcggtggctc 21 Score = 105 bits (53), Expect = 2e-19 Identities = 95/109 (87%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| ||||| ||||||||||||||||| |||||||| ||||||||||| || || || | Sbjct: 630 actttccggggacgaagttggtggcgaaggcccatgcgttgttgttgactggatcagcca 571 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 |||||| ||||||||||| | ||| ||||| ||||||||||||||||| Sbjct: 570 aatggtcggcgaggttctccaatggtccctttccggtgacgatggcttg 522
>gb|AY617094.1| Pinus longaeva chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 759 Score = 123 bits (62), Expect = 9e-25 Identities = 205/252 (81%), Gaps = 1/252 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| ||||| || |||||||| || || ||||||||||| ||||| | ||| ||||||| Sbjct: 460 ggctagggtttcccaggtagtcaagycctccctcgctgaaaatctgagctcccgccttga 401 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| ||||| || |||||||| || || |||| |||||| | ||| ||||| ||||| | Sbjct: 400 accacacagcttccccgaactttactccatttctggccagaagctccgggaaaacgcaac 341 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 | || || || ||||| ||||| |||||||||||||| ||||| || | |||||| || | Sbjct: 340 ccagagcgcccagcattgcccaccggcagtggatcacttccagttctctgttcttcgcaa 281 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 | ||||| || || || || | ||| || ||||||| |||||||||| || ||||||||| Sbjct: 280 aagtctccggatccgccgaaagccccgcwgtgtccc-acccgtagtcacccgggaactca 222 Query: 456 ccggtcaggtag 467 ||||||| |||| Sbjct: 221 ccggtcaagtag 210 Score = 61.9 bits (31), Expect = 3e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 160 acggggtcggcgagatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 |||||||||||||| || |||||||||||||||| || ||||| |||||||| ||||| Sbjct: 758 acggggtcggcgaggtgatcagcgaggttctcgatgggtcccttcccggtgacaatggc 700
>gb|AY617083.1| Pinus radiata chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 123 bits (62), Expect = 9e-25 Identities = 198/242 (81%), Gaps = 1/242 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 ||||| || |||||||| || || ||||||||||| ||||| | ||| ||||||||||| Sbjct: 466 gggtttcccaggtagtcaagccctccctcgctgaaaatctgagctcccgccttgaaccac 407 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || |||||||||||||| || || |||| ||||| | ||| ||||| ||||| || || Sbjct: 406 actgcctcaccgaactttactccatttctcgccagaagctccgggaaaacgcaacccaga 347 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 || || ||||| ||||| |||||||||||||| |||||||| | |||||| || || ||| Sbjct: 346 gcgcccagcattgcccaccggcagtggatcacttccagctctctgttcttcgcaaaagtc 287 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || || || || || | ||| || ||||||| |||||||||| || |||||||||||||| Sbjct: 286 tctggatctgccgaaagccccgccgtgtccc-acccgtagtcaccggggaactcaccggt 228 Query: 461 ca 462 || Sbjct: 227 ca 226 Score = 54.0 bits (27), Expect = 7e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 160 acggggtcggcgagatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 ||||||||||| || || |||||||||||||||| || || || |||||||||||||| Sbjct: 769 acggggtcggccaggtgatcagcgaggttctcgatgggtcctttcccggtgacgatggc 711
>gb|AY617081.1| Pinus echinata chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 762 Score = 123 bits (62), Expect = 9e-25 Identities = 198/242 (81%), Gaps = 1/242 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 ||||| || |||||||| || || ||||||||||| ||||| | ||| ||||||||||| Sbjct: 466 gggtttcccaggtagtcaagccctccctcgctgaaaatctgagctcccgccttgaaccac 407 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || |||||||||||||| || || |||| ||||| | ||| ||||| ||||| || || Sbjct: 406 actgcctcaccgaactttactccatttctygccagaagctccgggaaaacgcaacccaga 347 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 || || ||||| ||||| |||||||||||||| |||||||| | |||||| || || ||| Sbjct: 346 gcgcccagcattgcccaccggcagtggatcacttccagctctctgttcttcgcaaaagtc 287 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || || || || || | ||| || ||||||| |||||||||| || |||||||||||||| Sbjct: 286 tctggatctgccgaaagccccgccgtgtccc-acccgtagtcaccggggaactcaccggt 228 Query: 461 ca 462 || Sbjct: 227 ca 226 Score = 42.1 bits (21), Expect = 2.5 Identities = 36/41 (87%) Strand = Plus / Minus Query: 178 tcagcgaggttctcgagtggacccttgccggtgacgatggc 218 |||||||||||||||| || || || |||||||||||||| Sbjct: 751 tcagcgaggttctcgatgggtcctttcccggtgacgatggc 711
>emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL46ZF04 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 959 Score = 123 bits (62), Expect = 9e-25 Identities = 210/258 (81%), Gaps = 1/258 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 |||||||| | |||||||| || || |||||| || |||| | ||||||||||||||| Sbjct: 485 gggttgcccaagtagtccaatcctccgtcgctgtagttctgtgtaccggccttgaaccaa 426 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || || || |||||||| || ||||| | |||| | ||| ||||| |||||||| || Sbjct: 425 accgcttctccgaactttactccgttcctagccaatagctcagggaaaacgcagcctagg 366 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 ||||| ||||||||||| | || |||||| || || ||||| |||||| |||||||||| Sbjct: 365 gctccgagcatggcccatctgctgtggataacttctagctcacggttcctggcgaaggtt 306 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || ||||| || || | ||||| |||||||| || |||||| || |||||||||||||| Sbjct: 305 tctgggtcggcggatagaccagcggtgtcccatcc-gtagtcaccggggaactcaccggt 247 Query: 461 caggtagctcgggggctc 478 ||||||||||||||||| Sbjct: 246 aaggtagctcgggggctc 229 Score = 89.7 bits (45), Expect = 1e-14 Identities = 93/109 (85%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| ||||| ||||||||||||||| | ||||| || ||||||| ||| |||||||| | Sbjct: 838 actttccggggacgaagttggtggcggaggcccaagcgttgttgtagactgggtcggcca 779 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 |||||| ||||||||||| | || ||||| ||||||||||||||||| Sbjct: 778 aatggtcggcgaggttctccaaaggtccctttccggtgacgatggcttg 730
>gb|AY086905.1| Arabidopsis thaliana clone 29298 mRNA, complete sequence Length = 1041 Score = 123 bits (62), Expect = 9e-25 Identities = 183/222 (82%), Gaps = 1/222 (0%) Strand = Plus / Minus Query: 248 tcgctgaagatctgggatccggccttgaaccaaacagcctcaccgaacttcacgccgttt 307 ||||| |||||||| || || |||||||||||||| ||||| || ||||| || ||||| Sbjct: 489 tcgctaaagatctgtgaaccagccttgaaccaaactgcctctccaaacttgactccgttc 430 Query: 308 cgggccagcaactcggggaagacgcagccgagcgctccaagcatggcccaacggcagtgg 367 | ||||| | || |||||||||||||| || ||||| ||||||||||| | || |||| Sbjct: 429 ctggccaaaagttcagggaagacgcagcctagggctccgagcatggcccacctgctgtgg 370 Query: 368 atcacctccagctcgcggttcttggcgaaggtctcggggtcagcagacaacccagcagtg 427 || || || ||||| |||||| | ||||| |||||||||||||| || | ||||| ||| Sbjct: 369 ataacttctagctcacggttccttgcgaatgtctcggggtcagcggatagaccagctgtg 310 Query: 428 tcccaacccgtagtcgccagggaactcaccggtcaggtagct 469 |||| | |||||||| ||||||||||| ||||| |||||||| Sbjct: 309 tccc-atccgtagtctccagggaactctccggtaaggtagct 269 Score = 81.8 bits (41), Expect = 3e-12 Identities = 92/109 (84%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| |||||||| ||||||||||| || ||||| || ||||||||||| || ||||| | Sbjct: 869 actttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggcca 810 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 ||||||||| |||||||| | || ||||| || |||||||||||||| Sbjct: 809 aatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttg 761
>dbj|AK066762.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013075I09, full insert sequence Length = 1106 Score = 123 bits (62), Expect = 9e-25 Identities = 201/246 (81%), Gaps = 1/246 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 ||||| || |||||||| || || |||||| ||||||||| | |||||||||||||| Sbjct: 491 gggttccccaggtagtcgagccccccctcggagaagatctgcgcgccggccttgaaccac 432 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || ||||| ||||||||||| ||||| || ||| | ||| |||||||||||||| ||| Sbjct: 431 accgcctccccgaacttcaccccgttcttggacaggatctccgggaagacgcagcccagc 372 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 || || ||||| ||||| || ||||||||||||||||||| | |||| | ||||| ||| Sbjct: 371 gcccccagcatcgcccaccgcgagtggatcacctccagctccctgttcctcgcgaacgtc 312 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || ||||| || || | ||| || ||||||| ||| |||||| || |||||||| ||||| Sbjct: 311 tccgggtcggccgatagccccgccgtgtccc-acctgtagtctcccgggaactctccggt 253 Query: 461 caggta 466 |||||| Sbjct: 252 caggta 247 Score = 99.6 bits (50), Expect = 1e-17 Identities = 92/106 (86%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||||||||| ||||||||||||||| ||||||| || |||||| |||||||||||||| Sbjct: 841 acttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcga 782 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 ||||| ||||||||||| || |||||||||||||||||||| Sbjct: 781 cgtggtcgaagaggttctcgatggggcccttgccggtgacgatggc 736
>gb|L07119.1|COTIIABINA Gossypium hirsutum chloroplast photosystem II chlorophyll A/B-binding protein gene, complete cds Length = 1260 Score = 123 bits (62), Expect = 9e-25 Identities = 201/246 (81%), Gaps = 1/246 (0%) Strand = Plus / Minus Query: 217 gcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaa 276 ||||||||| || | |||||| || || ||||| |||||||| || || ||||||||||| Sbjct: 644 gcttgggttacccaagtagtcaagtccaccctcactgaagatttgagacccggccttgaa 585 Query: 277 ccaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagcc 336 ||| ||||| ||||||||||| || ||||| | |||| || ||| ||||| || || || Sbjct: 584 ccatacagcttcaccgaacttgacaccgttcctagccaacagctcagggaaaacacaccc 525 Query: 337 gagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaa 396 || ||||| | ||||||||| | |||||| || || || ||||| |||||| | || || Sbjct: 524 aagagctcccaacatggcccatctgcagtgaatgacttcgagctcacggttcctagcaaa 465 Query: 397 ggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcac 456 ||||||||| ||||| || | ||||||||||||||| || ||||| ||||||||||||| Sbjct: 464 ggtctcgggatcagctgagagtccagcagtgtcccaa-ccatagtcaccagggaactcac 406 Query: 457 cggtca 462 |||||| Sbjct: 405 cggtca 400 Score = 67.9 bits (34), Expect = 4e-08 Identities = 88/106 (83%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| ||||| || ||||||||||| | ||||| |||||||||||||| ||||| || | Sbjct: 990 actttccggggacaaagttggtggcataggcccaagcattgttgttgactgggtcagcaa 931 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 | |||||||| | |||||| | ||| ||||| ||||| |||||||| Sbjct: 930 ggtggtcagccaagttctccaatggtccctttccggtcacgatggc 885
>dbj|D00642.1|RICLHCP2 Oryza sativa (japonica cultivar-group) mRNA for type II light-harvesting chlorophyll a/b binding protein of photosystem II (LHCPII), complete cds Length = 989 Score = 123 bits (62), Expect = 9e-25 Identities = 201/246 (81%), Gaps = 1/246 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 ||||| || |||||||| || || |||||| ||||||||| | |||||||||||||| Sbjct: 472 gggttccccaggtagtcgagccccccctcggagaagatctgcgcgccggccttgaaccac 413 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || ||||| ||||||||||| ||||| || ||| | ||| |||||||||||||| ||| Sbjct: 412 accgcctccccgaacttcaccccgttcttggacaggatctccgggaagacgcagcccagc 353 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 || || ||||| ||||| || ||||||||| ||||||||| | |||| | ||||| ||| Sbjct: 352 gcccccagcatcgcccaccgcgagtggatcaactccagctccctgttcctcgcgaacgtc 293 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || ||||| || || | ||| || ||||||| |||||||||| || |||||||| ||||| Sbjct: 292 tccgggtcggccgatagccccgccgtgtccc-acccgtagtctcccgggaactctccggt 234 Query: 461 caggta 466 |||||| Sbjct: 233 caggta 228 Score = 83.8 bits (42), Expect = 7e-13 Identities = 90/106 (84%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||||||||| ||||||||||||||| ||| ||| || |||||| ||||||||||| || Sbjct: 822 acttgccggggacgaagttggtggcgtatgaccaggcgttgttggcgacggggtcggtga 763 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 ||||| ||||||||||| || |||||||||||||||||||| Sbjct: 762 cgtggtcgaagaggttctcgatggggcccttgccggtgacgatggc 717
>ref|NM_102731.2| Arabidopsis thaliana CAB3 (CHLOROPHYLL A/B BINDING PROTEIN 3); chlorophyll binding AT1G29910 (CAB3) mRNA, complete cds Length = 1020 Score = 121 bits (61), Expect = 3e-24 Identities = 185/225 (82%), Gaps = 1/225 (0%) Strand = Plus / Minus Query: 248 tcgctgaagatctgggatccggccttgaaccaaacagcctcaccgaacttcacgccgttt 307 ||||| |||||||| || ||||||||||||||||| ||||| |||||||| || ||||| Sbjct: 475 tcgctaaagatctgtgaaccggccttgaaccaaaccgcctctccgaacttgactccgttc 416 Query: 308 cgggccagcaactcggggaagacgcagccgagcgctccaagcatggcccaacggcagtgg 367 | |||| | ||| |||||||||||||| || ||||| ||||| ||||| | || |||| Sbjct: 415 ctagccaaaagctcagggaagacgcagcctagggctccgagcatagcccacctgctgtgg 356 Query: 368 atcacctccagctcgcggttcttggcgaaggtctcggggtcagcagacaacccagcagtg 427 || || || ||||| |||||| | ||||| |||||||| ||||| || | ||||| ||| Sbjct: 355 ataacttctagctcacggttccttgcgaatgtctcgggatcagctgaaagtccagcggtg 296 Query: 428 tcccaacccgtagtcgccagggaactcaccggtcaggtagctcgg 472 |||| | |||||||| || |||||||| ||||| ||||||||||| Sbjct: 295 tccc-atccgtagtctccggggaactctccggtaaggtagctcgg 252 Score = 81.8 bits (41), Expect = 3e-12 Identities = 92/109 (84%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| |||||||| |||||||| ||||| |||||||| ||||||||||| || ||||| | Sbjct: 855 actttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcggcca 796 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 ||||||||| |||||||| | || ||||| || ||||| |||||||| Sbjct: 795 aatggtcagcaaggttctctatcggtcccttaccagtgacaatggcttg 747
>gb|AY114594.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910) mRNA, complete cds Length = 870 Score = 121 bits (61), Expect = 3e-24 Identities = 185/225 (82%), Gaps = 1/225 (0%) Strand = Plus / Minus Query: 248 tcgctgaagatctgggatccggccttgaaccaaacagcctcaccgaacttcacgccgttt 307 ||||| |||||||| || ||||||||||||||||| ||||| |||||||| || ||||| Sbjct: 422 tcgctaaagatctgtgaaccggccttgaaccaaaccgcctctccgaacttgactccgttc 363 Query: 308 cgggccagcaactcggggaagacgcagccgagcgctccaagcatggcccaacggcagtgg 367 | |||| | ||| |||||||||||||| || ||||| ||||| ||||| | || |||| Sbjct: 362 ctagccaaaagctcagggaagacgcagcctagggctccgagcatagcccacctgctgtgg 303 Query: 368 atcacctccagctcgcggttcttggcgaaggtctcggggtcagcagacaacccagcagtg 427 || || || ||||| |||||| | ||||| |||||||| ||||| || | ||||| ||| Sbjct: 302 ataacttctagctcacggttccttgcgaatgtctcgggatcagctgaaagtccagcggtg 243 Query: 428 tcccaacccgtagtcgccagggaactcaccggtcaggtagctcgg 472 |||| | |||||||| || |||||||| ||||| ||||||||||| Sbjct: 242 tccc-atccgtagtctccggggaactctccggtaaggtagctcgg 199 Score = 81.8 bits (41), Expect = 3e-12 Identities = 92/109 (84%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| |||||||| |||||||| ||||| |||||||| ||||||||||| || ||||| | Sbjct: 802 actttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcggcca 743 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 ||||||||| |||||||| | || ||||| || ||||| |||||||| Sbjct: 742 aatggtcagcaaggttctctatcggtcccttaccagtgacaatggcttg 694
>gb|AY065165.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910; F1N18.5) mRNA, complete cds Length = 1019 Score = 121 bits (61), Expect = 3e-24 Identities = 185/225 (82%), Gaps = 1/225 (0%) Strand = Plus / Minus Query: 248 tcgctgaagatctgggatccggccttgaaccaaacagcctcaccgaacttcacgccgttt 307 ||||| |||||||| || ||||||||||||||||| ||||| |||||||| || ||||| Sbjct: 475 tcgctaaagatctgtgaaccggccttgaaccaaaccgcctctccgaacttgactccgttc 416 Query: 308 cgggccagcaactcggggaagacgcagccgagcgctccaagcatggcccaacggcagtgg 367 | |||| | ||| |||||||||||||| || ||||| ||||| ||||| | || |||| Sbjct: 415 ctagccaaaagctcagggaagacgcagcctagggctccgagcatagcccacctgctgtgg 356 Query: 368 atcacctccagctcgcggttcttggcgaaggtctcggggtcagcagacaacccagcagtg 427 || || || ||||| |||||| | ||||| |||||||| ||||| || | ||||| ||| Sbjct: 355 ataacttctagctcacggttccttgcgaatgtctcgggatcagctgaaagtccagcggtg 296 Query: 428 tcccaacccgtagtcgccagggaactcaccggtcaggtagctcgg 472 |||| | |||||||| || |||||||| ||||| ||||||||||| Sbjct: 295 tccc-atccgtagtctccggggaactctccggtaaggtagctcgg 252 Score = 81.8 bits (41), Expect = 3e-12 Identities = 92/109 (84%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| |||||||| |||||||| ||||| |||||||| ||||||||||| || ||||| | Sbjct: 855 actttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcggcca 796 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 ||||||||| |||||||| | || ||||| || ||||| |||||||| Sbjct: 795 aatggtcagcaaggttctctatcggtcccttaccagtgacaatggcttg 747
>dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light harvesting a/b binding protein, complete cds Length = 1055 Score = 121 bits (61), Expect = 3e-24 Identities = 194/237 (81%), Gaps = 1/237 (0%) Strand = Plus / Minus Query: 230 aggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaaacagcctca 289 |||||||| || || ||||||||||||||||| | ||| ||||||||||| || |||||| Sbjct: 538 aggtagtcaagccctccctcgctgaagatctgagctcccgccttgaaccacaccgcctca 479 Query: 290 ccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagcgctccaagc 349 |||||||| || || || | || || | ||| ||||| ||||| ||||| || || ||| Sbjct: 478 ccgaactttactccattcctcgcaagaagctccgggaatacgcacccgagagcgcccagc 419 Query: 350 atggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtctcggggtca 409 || ||||| ||| |||||||||| |||||||| | |||||| ||||| ||||| || || Sbjct: 418 atcgcccaccgggagtggatcacttccagctctctgttcttcgcgaacgtctccggatcc 359 Query: 410 gcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggtcaggta 466 || || | ||| || ||||||| |||||||||| || ||||| |||||||||||||| Sbjct: 358 gccgaaagccccgccgtgtccc-acccgtagtcaccggggaattcaccggtcaggta 303 Score = 71.9 bits (36), Expect = 3e-09 Identities = 66/76 (86%) Strand = Plus / Minus Query: 118 ccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcgagatgg 177 ||||| ||||||||||||||| | ||||| ||||||||||| ||||||||||| || || Sbjct: 892 ccggggacgaagttggtggcgtaggcccaggcattgttgttcacggggtcggccaggtga 833 Query: 178 tcagcgaggttctcga 193 || || |||||||||| Sbjct: 832 tcggcaaggttctcga 817
>gb|AF330793.1|AF330793 Chlamydomonas reinhardtii light-harvesting complex II protein precursor (cabII-2) mRNA, complete cds Length = 1068 Score = 121 bits (61), Expect = 3e-24 Identities = 200/245 (81%), Gaps = 1/245 (0%) Strand = Plus / Minus Query: 223 gttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaaac 282 |||||| ||||||| |||||||||||| ||||||||||| |||||||||||||| || Sbjct: 420 gttgccgaggtagttcaggccgccctcagcgaagatctgggcgccggccttgaaccagac 361 Query: 283 agcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagcgc 342 ||||||||||||| | |||||| |||||||| ||||||| || |||||| || || Sbjct: 360 agcctcaccgaacgggatgccgttcttggccagcagctcgggggtgatgcagcccagagc 301 Query: 343 tccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtctc 402 || ||||||||||| ||| |||||||| |||||||||||||| ||||||||| Sbjct: 300 gcccagcatggcccagcgggcgtggatcagctccagctcgcggtagcgcttgaaggtctc 241 Query: 403 ggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggtca 462 |||||||| |||| || || ||||||| | ||||||||||| |||||||| || |||| Sbjct: 240 cgggtcagccgacagaccggcggtgtccc-agccgtagtcgccggggaactcgccagtca 182 Query: 463 ggtag 467 ||||| Sbjct: 181 ggtag 177
>emb|X58229.1|NTCAB7 Tobacco CAB7 gene for chlorophyll a/b binding protein Length = 1656 Score = 121 bits (61), Expect = 3e-24 Identities = 200/245 (81%), Gaps = 1/245 (0%) Strand = Plus / Minus Query: 218 cttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaac 277 ||||||||||| | |||||| || || ||||||||||| || || ||||| ||||||||| Sbjct: 956 cttgggttgcccaagtagtcaagtccaccctcgctgaaaatttgagatccagccttgaac 897 Query: 278 caaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccg 337 || ||||| ||||||||||| || || || || |||| | ||||||||||| || ||| Sbjct: 896 cagacagcttcaccgaacttgacaccattacgagccaagagttcggggaagacacaaccg 837 Query: 338 agcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaag 397 || ||||||||||| ||||| | ||||| |||||||| ||||| |||||||| || || Sbjct: 836 agagctccaagcatagcccatctacagtgaatcacctctagctcacggttcttagcaaaa 777 Query: 398 gtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcacc 457 || || || ||||| || | ||||||||||||| |||| || || |||||||||||||| Sbjct: 776 gtttctggatcagctgaaagtccagcagtgtccc-acccataatcaccagggaactcacc 718 Query: 458 ggtca 462 |||| Sbjct: 717 agtca 713
>emb|X03908.1|ATLHCP2 A.thaliana gene (LHCP AB 180) for chlorophyll a/b binding protein Length = 1060 Score = 121 bits (61), Expect = 3e-24 Identities = 185/225 (82%), Gaps = 1/225 (0%) Strand = Plus / Minus Query: 248 tcgctgaagatctgggatccggccttgaaccaaacagcctcaccgaacttcacgccgttt 307 ||||| |||||||| || ||||||||||||||||| ||||| |||||||| || ||||| Sbjct: 628 tcgctaaagatctgtgaaccggccttgaaccaaaccgcctctccgaacttgactccgttc 569 Query: 308 cgggccagcaactcggggaagacgcagccgagcgctccaagcatggcccaacggcagtgg 367 | |||| | ||| |||||||||||||| || ||||| ||||| ||||| | || |||| Sbjct: 568 ctagccaaaagctcagggaagacgcagcctagggctccgagcatagcccacctgctgtgg 509 Query: 368 atcacctccagctcgcggttcttggcgaaggtctcggggtcagcagacaacccagcagtg 427 || || || ||||| |||||| | ||||| |||||||| ||||| || | ||||| ||| Sbjct: 508 ataacttctagctcacggttccttgcgaatgtctcgggatcagctgaaagtccagcggtg 449 Query: 428 tcccaacccgtagtcgccagggaactcaccggtcaggtagctcgg 472 |||| | |||||||| || |||||||| ||||| ||||||||||| Sbjct: 448 tccc-atccgtagtctccggggaactctccggtaaggtagctcgg 405 Score = 89.7 bits (45), Expect = 1e-14 Identities = 93/109 (85%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| |||||||| |||||||| ||||| |||||||| ||||||||||| || ||||| | Sbjct: 1008 actttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcggcca 949 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 ||||||||| |||||||| | || ||||| || |||||||||||||| Sbjct: 948 aatggtcagcaaggttctctatcggtcccttaccagtgacgatggcttg 900
>dbj|AB012640.1| Nicotiana sylvestris Lhcb1*8 gene for light harvesting chlorophyll a/b-binding protein, complete cds Length = 3102 Score = 121 bits (61), Expect = 3e-24 Identities = 200/245 (81%), Gaps = 1/245 (0%) Strand = Plus / Minus Query: 218 cttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaac 277 ||||||||||| | |||||| || || ||||||||||| || || ||||| ||||||||| Sbjct: 2359 cttgggttgcccaagtagtcaagtccaccctcgctgaaaatttgagatccagccttgaac 2300 Query: 278 caaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccg 337 || ||||| ||||||||||| || || || || |||| | ||||||||||| || ||| Sbjct: 2299 cagacagcttcaccgaacttgacaccattacgagccaagagttcggggaagacacaaccg 2240 Query: 338 agcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaag 397 || ||||||||||| ||||| | ||||| |||||||| ||||| |||||||| || || Sbjct: 2239 agagctccaagcatagcccatctacagtgaatcacctctagctcacggttcttagcaaaa 2180 Query: 398 gtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcacc 457 || || || ||||| || | ||||||||||||| |||| || || |||||||||||||| Sbjct: 2179 gtttctggatcagctgaaagtccagcagtgtccc-acccataatcaccagggaactcacc 2121 Query: 458 ggtca 462 |||| Sbjct: 2120 agtca 2116
>gb|AY617092.1| Pinus monophylla chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 119 bits (60), Expect = 1e-23 Identities = 205/252 (81%), Gaps = 1/252 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| ||||| || |||||||| || || ||||||||||| ||||| | ||| ||||||| Sbjct: 471 ggctagggtttcccaggtagtcaagccctccctcgctgaaaatctgagctcccgccttga 412 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| ||||| || |||||||| || || |||| ||||| | ||| ||||| ||||| | Sbjct: 411 accacacagcttccccgaactttactccatttctcgccagaagctcygggaaaacgcaac 352 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 | || || || ||||| ||||| |||||||||||||| ||||| || | |||||| || | Sbjct: 351 ccagagcgcccagcattgcccaccggcagtggatcacttccagttctctgttcttcgcaa 292 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 | ||||| || || || || | ||| |||||||||| |||||||||| || ||||||||| Sbjct: 291 aagtctccggatccgccgaaagccccgcagtgtccc-acccgtagtcacccgggaactca 233 Query: 456 ccggtcaggtag 467 ||||||| |||| Sbjct: 232 ccggtcaagtag 221 Score = 69.9 bits (35), Expect = 1e-08 Identities = 53/59 (89%) Strand = Plus / Minus Query: 160 acggggtcggcgagatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 |||||||||||||| || |||||||||||||||| || ||||| |||||||||||||| Sbjct: 769 acggggtcggcgaggtgatcagcgaggttctcgatgggtcccttcccggtgacgatggc 711
>gb|AY171229.1| Chlamydomonas reinhardtii light-harvesting complex II protein (Lhcb) mRNA, complete cds; nuclear gene for chloroplast product Length = 1024 Score = 117 bits (59), Expect = 5e-23 Identities = 213/263 (80%), Gaps = 1/263 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 |||||||| ||||||||||| |||||||| ||||||||| | || ||||||||||| Sbjct: 442 gggttgcccaggtagtccagaccgccctcctggaagatctgagcaccagccttgaaccac 383 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || ||||| ||||| |||||||| | |||||| ||||||||||| |||||| || Sbjct: 382 acggcctcgccgaagggcacgccgtaggagcccagcagctcggggaagatgcagcccaga 323 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 || || ||||||||||| ||| |||||||| |||||||||||||| ||||||| Sbjct: 322 gcgccgagcatggcccagcgggcgtggatcagctccagctcgcggtagcgcttgaaggtc 263 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || |||||||| |||| || || ||||||| | |||||||| || |||||||| || || Sbjct: 262 tccgggtcagcggacagaccggcggtgtccc-agccgtagtcaccggggaactcgccagt 204 Query: 461 caggtagctcgggggctcaccag 483 |||||||||||||||||| |||| Sbjct: 203 caggtagctcgggggctcgccag 181
>gb|AY288914.1| Brassica oleracea chlorophyll a/b binding protein mRNA, complete cds; nuclear gene for chloroplast product Length = 1042 Score = 117 bits (59), Expect = 5e-23 Identities = 189/231 (81%), Gaps = 1/231 (0%) Strand = Plus / Minus Query: 248 tcgctgaagatctgggatccggccttgaaccaaacagcctcaccgaacttcacgccgttt 307 |||||||||||||| || ||||||||||||||||| ||||| |||||||| || ||||| Sbjct: 494 tcgctgaagatctgcgaaccggccttgaaccaaaccgcctctccgaacttgactccgttc 435 Query: 308 cgggccagcaactcggggaagacgcagccgagcgctccaagcatggcccaacggcagtgg 367 | ||||| || ||| |||||||||||||| || || || ||||||||||| | ||||||| Sbjct: 434 ctggccaacagctccgggaagacgcagcctagggcaccgagcatggcccacctgcagtgg 375 Query: 368 atcacctccagctcgcggttcttggcgaaggtctcggggtcagcagacaacccagcagtg 427 || || || ||||| |||||| | |||| |||||||| | || || | || || ||| Sbjct: 374 ataacttctagctcacggttcctcacgaacgtctcgggtacggctgagagacctgcggtg 315 Query: 428 tcccaacccgtagtcgccagggaactcaccggtcaggtagctcgggggctc 478 |||| | |||||||| || ||||||| ||||| ||||||||||| ||||| Sbjct: 314 tccc-atccgtagtctccggggaactgtccggtaaggtagctcggtggctc 265 Score = 61.9 bits (31), Expect = 3e-06 Identities = 67/79 (84%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| ||||||||||||||||| || || ||||||||||||||||| || || || || | Sbjct: 874 actttccgggaacgaagttggtagcaaaggcccatgcattgttgttaactggatcagcca 815 Query: 173 gatggtcagcgaggttctc 191 ||||||||| || ||||| Sbjct: 814 aatggtcagcaagattctc 796
>emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chlorophyll a/b-binding protein Length = 1006 Score = 117 bits (59), Expect = 5e-23 Identities = 201/247 (81%), Gaps = 1/247 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 ||||| || |||||||| || || ||||||||||| ||||| | ||| ||||||||||| Sbjct: 521 gggtttcccaggtagtcaagccctccctcgctgaaaatctgagctcccgccttgaaccag 462 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || |||||||||||||| || || |||| ||||| | ||| ||||| ||||| || || Sbjct: 461 acggcctcaccgaactttactccatttctcgccagaagctccgggaaaacgcaacccaga 402 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 || || ||||| ||||| |||||||||||||| |||||||| | |||||| || || || Sbjct: 401 gcgcccagcattgcccaccggcagtggatcacttccagctctctgttcttcgcaaaattc 342 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || || || || || | ||| || ||||||| |||||||||| || |||||||||||||| Sbjct: 341 tctggatctgccgaaagccccgccgtgtccc-acccgtagtcaccggggaactcaccggt 283 Query: 461 caggtag 467 || |||| Sbjct: 282 caagtag 276 Score = 79.8 bits (40), Expect = 1e-11 Identities = 88/104 (84%) Strand = Plus / Minus Query: 115 ttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcgaga 174 |||||||| ||||||||||||||| | ||||| || |||||||| |||||||| || || Sbjct: 869 ttgccggggacgaagttggtggcgtaggcccaggcgttgttgttaacggggtcagccagg 810 Query: 175 tggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 || |||||||||||||||| || || || |||||||| ||||| Sbjct: 809 tgatcagcgaggttctcgatgggtcctttcccggtgacaatggc 766
>gb|AF104630.1|AF104630 Chlamydomonas reinhardtii light harvesting complex II protein precursor (Lhcb2) mRNA, complete cds Length = 1200 Score = 117 bits (59), Expect = 5e-23 Identities = 201/247 (81%), Gaps = 1/247 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 |||||||| |||||||||||||||||||| ||||||||||| |||||||||||||| Sbjct: 446 gggttgcccaggtagtccaggccgccctcagagaagatctgggcgccggccttgaaccac 387 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || |||||||||||||| |||| | |||||||| ||||||| | |||||| || Sbjct: 386 acggcctcaccgaacttggtgccgctcttggccagcagctcgggggtcaggcagcccagg 327 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 || || ||||| ||||| ||| |||||||| |||||||||||||| ||||||| Sbjct: 326 gcgcccagcatagcccagcgggcgtggatcagctccagctcgcggtagcgcttgaaggtc 267 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || |||||||| |||| || |||||||||| | ||||||||||| |||||||| || || Sbjct: 266 tccgggtcagccgacagaccggcagtgtccc-agccgtagtcgccggggaactcgccagt 208 Query: 461 caggtag 467 ||||||| Sbjct: 207 caggtag 201
>dbj|AB051210.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b binding protein LhcII-4, complete cds Length = 988 Score = 117 bits (59), Expect = 5e-23 Identities = 213/263 (80%), Gaps = 1/263 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 |||||||| ||||||||||| |||||||| ||||||||| | || ||||||||||| Sbjct: 426 gggttgcccaggtagtccagaccgccctcctggaagatctgagcaccagccttgaaccac 367 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || ||||| ||||| |||||||| | |||||| ||||||||||| |||||| || Sbjct: 366 acggcctcgccgaagggcacgccgtaggagcccagcagctcggggaagatgcagcccaga 307 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 || || ||||||||||| ||| |||||||| |||||||||||||| ||||||| Sbjct: 306 gcgccgagcatggcccagcgggcgtggatcagctccagctcgcggtagcgcttgaaggtc 247 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || |||||||| |||| || || ||||||| | |||||||| || |||||||| || || Sbjct: 246 tccgggtcagcggacagaccggcggtgtccc-agccgtagtcaccggggaactcgccagt 188 Query: 461 caggtagctcgggggctcaccag 483 |||||||||||||||||| |||| Sbjct: 187 caggtagctcgggggctcgccag 165
>emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll a/b binding protein Length = 1197 Score = 115 bits (58), Expect = 2e-22 Identities = 197/242 (81%), Gaps = 1/242 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 ||||| || |||||||| || || ||||||||||| ||||| | ||| ||||||||||| Sbjct: 536 gggtttcccaggtagtcaagccctccctcgctgaaaatctgagctcccgccttgaaccac 477 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || |||||||||||||| || || |||| ||||| | ||| ||||| ||||| || || Sbjct: 476 acggcctcaccgaactttactccatttctcgccagaagctccgggaaaacgcaacccaga 417 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 || || ||||| ||||| |||| ||||||||| |||||||| | |||||| || || ||| Sbjct: 416 gcgcccagcattgcccaccggctgtggatcacttccagctctctgttcttcgcaaaagtc 357 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || || || || || | ||| || ||||||| |||||||||| || |||||||||||||| Sbjct: 356 tctggatctgccgaaagccccgccgtgtccc-acccgtagtcaccggggaactcaccggt 298 Query: 461 ca 462 || Sbjct: 297 ca 296 Score = 79.8 bits (40), Expect = 1e-11 Identities = 88/104 (84%) Strand = Plus / Minus Query: 115 ttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcgaga 174 |||||||| |||||||||||||| | ||||| || |||||| | ||||||||||| || Sbjct: 884 ttgccggggacgaagttggtggcataggcccaggcgttgttgctaacggggtcggccagg 825 Query: 175 tggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 || |||||||||||||||| || || || |||||||||||||| Sbjct: 824 tgatcagcgaggttctcgatgggtcctttcccggtgacgatggc 781
>gb|AY617084.1| Pinus contorta chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 115 bits (58), Expect = 2e-22 Identities = 197/242 (81%), Gaps = 1/242 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 ||||| || |||||||| || || ||||||||||| ||||| | ||| ||||||||||| Sbjct: 466 gggtttcccaggtagtcaagccctccctcgctgaaaatctgagctcccgccttgaaccac 407 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || |||||||||||||| || || |||| ||||| | ||| ||||| ||||| || || Sbjct: 406 acggcctcaccgaactttactccatttctcgccagaagctccgggaaaacgcaacccaga 347 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 || || ||||| ||||| |||| ||||||||| |||||||| | |||||| || || ||| Sbjct: 346 gcgcccagcattgcccaccggctgtggatcacttccagctctctgttcttcgcaaaagtc 287 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || || || || || | ||| || ||||||| |||||||||| || |||||||||||||| Sbjct: 286 tctggatctgccgaaagccccgccgtgtccc-acccgtagtcaccggggaactcaccggt 228 Query: 461 ca 462 || Sbjct: 227 ca 226 Score = 54.0 bits (27), Expect = 7e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 160 acggggtcggcgagatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 ||||||||||| || || |||||||||||||||| || || || |||||||||||||| Sbjct: 769 acggggtcggccaggtgatcagcgaggttctcgatgggtcctttcccggtgacgatggc 711
>gb|AY617082.1| Pinus ponderosa chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 115 bits (58), Expect = 2e-22 Identities = 197/242 (81%), Gaps = 1/242 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 ||||| || |||||||| || || ||||||||||| ||||| | ||| ||||||||||| Sbjct: 466 gggtttcccaggtagtcaagccctccctcgctgaaaatctgagctcccgccttgaaccac 407 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || ||||| |||||||| || || |||| ||||| | ||| ||||| ||||| || || Sbjct: 406 acggcctccccgaactttactccatttctcgccagaagctccgggaaaacgcaacccaga 347 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 || || ||||| ||||| |||||||||||||| |||||||| | |||||| || || ||| Sbjct: 346 gcgcccagcattgcccaccggcagtggatcacttccagctctctgttcttcgcaaaagtc 287 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || || || || || | ||| || ||||||| |||||||||| || |||||||||||||| Sbjct: 286 tctggatctgccgaaagccccgccgtgtccc-acccgtagtcaccggggaactcaccggt 228 Query: 461 ca 462 || Sbjct: 227 ca 226 Score = 54.0 bits (27), Expect = 7e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 160 acggggtcggcgagatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 ||||||||||| || || |||||||||||||||| || || || |||||||||||||| Sbjct: 769 acggggtcggccaggtgatcagcgaggttctcgatgggtcctttcccggtgacgatggc 711
>emb|AJ309102.1|PPI309102 Pinus pinaster partial mRNA for putative chlorophyll A-B binding protein type I Length = 684 Score = 115 bits (58), Expect = 2e-22 Identities = 182/222 (81%), Gaps = 1/222 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 ||||| || |||||||| ||||| ||||| ||| ||||| | |||||||||||||| Sbjct: 238 gggttccccaggtagtcgaggcctccctctgagaatatctgcgccccggccttgaaccac 179 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || || || || || ||||| |||||| ||||| || ||| ||||| |||||||||||| Sbjct: 178 acggcttccccaaatttcaccccgtttttggccaacagctccgggaaaacgcagccgagc 119 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 || || | ||||||||| | ||||||||||||||||||||| | || |||||||||||| Sbjct: 118 gcccccaacatggcccatctgcagtggatcacctccagctctctatttttggcgaaggtc 59 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtc 442 |||||||| || || | ||| || ||||||| |||||||||| Sbjct: 58 tcggggtcggccgagagcccggcggtgtccc-acccgtagtc 18 Score = 54.0 bits (27), Expect = 7e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 110 cttacttgccgggaacgaagttggtggcgaatgcccatgcattgttg 156 |||| |||||||||||||| ||||||||| | ||||| ||||||||| Sbjct: 591 cttatttgccgggaacgaaattggtggcgtaggcccaggcattgttg 545
>emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b binding protein Length = 2574 Score = 115 bits (58), Expect = 2e-22 Identities = 197/242 (81%), Gaps = 1/242 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 ||||| || |||||||| || || ||||||||||| ||||| | ||| ||||||||||| Sbjct: 1614 gggtttcccaggtagtcaagccctccctcgctgaaaatctgagctcccgccttgaaccac 1555 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || |||||||||||||| || || |||| ||||| | ||| ||||| ||||| || || Sbjct: 1554 acggcctcaccgaactttactccatttctcgccagaagctccgggaaaacgcaacccaga 1495 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 || || ||||| ||||| |||| ||||||||| |||||||| | |||||| || || ||| Sbjct: 1494 gcgcccagcattgcccaccggctgtggatcacttccagctctctgttcttcgcaaaagtc 1435 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || || || || || | ||| || ||||||| |||||||||| || |||||||||||||| Sbjct: 1434 tctggatctgccgaaagccccgccgtgtccc-acccgtagtcaccggggaactcaccggt 1376 Query: 461 ca 462 || Sbjct: 1375 ca 1374 Score = 79.8 bits (40), Expect = 1e-11 Identities = 88/104 (84%) Strand = Plus / Minus Query: 115 ttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcgaga 174 |||||||| |||||||||||||| | ||||| || |||||| | ||||||||||| || Sbjct: 1962 ttgccggggacgaagttggtggcataggcccaggcgttgttgctaacggggtcggccagg 1903 Query: 175 tggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 || |||||||||||||||| || || || |||||||||||||| Sbjct: 1902 tgatcagcgaggttctcgatgggtcctttcccggtgacgatggc 1859
>gb|AF022739.1|AF022739 Oryza sativa chlorophyll a-b binding protein mRNA, complete cds Length = 1100 Score = 115 bits (58), Expect = 2e-22 Identities = 200/246 (81%), Gaps = 1/246 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 ||||| || |||||||| || || |||||| ||||||||| | |||||||||||||| Sbjct: 487 gggttccccaggtagtcgagccccccctcggagaagatctgcgcgccggccttgaaccac 428 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || ||||| ||||| || || ||||| || ||| | ||||||||||| |||||| ||| Sbjct: 427 accgcctccccgaaattaaccccgttcttggacaggatctcggggaagaagcagcccagc 368 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 || || ||||| ||||| ||| ||||||||||||||||||| | |||| | ||||| ||| Sbjct: 367 gcccccagcattgcccaccgggagtggatcacctccagctccctgttcctcgcgaacgtc 308 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || ||||| || || | ||| || ||||||| |||||||||| || ||||||| ||||| Sbjct: 307 tccgggtcggccgatagccccgccgtgtccc-acccgtagtctcccgggaactttccggt 249 Query: 461 caggta 466 |||||| Sbjct: 248 caggta 243 Score = 67.9 bits (34), Expect = 4e-08 Identities = 88/106 (83%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||||||||| || || ||||||||| ||||||| || |||||| |||||||||||||| Sbjct: 837 acttgccggggacaaaattggtggcgtatgcccaggcgttgttggcgacggggtcggcga 778 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 ||||| | |||||||| || |||||||||||||||||||| Sbjct: 777 cgtggtcgaaaaagttctcgatggggcccttgccggtgacgatggc 732
>gb|AF003128.1|AF003128 Mesembryanthemum crystallinum chlorophyll a/b-binding protein (CAB2) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1027 Score = 115 bits (58), Expect = 2e-22 Identities = 203/250 (81%), Gaps = 1/250 (0%) Strand = Plus / Minus Query: 218 cttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaac 277 ||||||||||| | ||| || || || |||||||| |||||||||| ||||||||||||| Sbjct: 467 cttgggttgcccaagtaatcaagcccaccctcgctaaagatctgggctccggccttgaac 408 Query: 278 caaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccg 337 || ||||||||||| ||||| || ||||| || |||| | || |||||||| || || Sbjct: 407 cagacagcctcaccaaacttgacaccgttgcgagccaagagttctgggaagacacatcct 348 Query: 338 agcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaag 397 || || || | ||| ||||| ||||| || |||||||| ||||| |||||||| | || Sbjct: 347 agagcacccaacatagcccatcggcaatgaatcacctcgagctcacggttcttagtaaaa 288 Query: 398 gtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcacc 457 ||||| |||||||| || | |||||||||||||| | |||||||| || || || ||||| Sbjct: 287 gtctcagggtcagccgaaagcccagcagtgtccc-agccgtagtcaccgggaaattcacc 229 Query: 458 ggtcaggtag 467 ||| |||||| Sbjct: 228 ggtaaggtag 219 Score = 83.8 bits (42), Expect = 7e-13 Identities = 93/110 (84%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 ||||||| ||| | ||||| |||||||| ||||| ||||||||||| || |||||||| | Sbjct: 814 acttgcctggagcaaagtttgtggcgaaggcccaagcattgttgttaactgggtcggcaa 755 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttgg 222 | || ||||| |||||||| | ||||||||| ||||| || ||||||||| Sbjct: 754 ggtgatcagcaaggttctccaatggaccctttccggtcacaatggcttgg 705
>gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete sequence Length = 979 Score = 113 bits (57), Expect = 8e-22 Identities = 211/261 (80%), Gaps = 1/261 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 |||||||| | |||||||| || || |||||||||||||| || || |||||||||||| Sbjct: 508 gggttgcccaagtagtccaatcctccgtcgctgaagatctgtgaaccagccttgaaccaa 449 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || || || ||||||| || ||||| | |||| | ||| ||||| |||||||| || Sbjct: 448 accgcttctccgaactctactccgttcctagccaatagctcagggaaaacgcagcctagg 389 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 ||||| ||||||||||| | || |||||| || || ||||| |||||| | ||||||||| Sbjct: 388 gctccgagcatggcccatctgctgtggataacttctagctcacggttcctagcgaaggtc 329 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 ||||| || || || | || |||||||||| ||||||| || || |||||||| || || Sbjct: 328 tcgggatcggcggatagaccggcagtgtccc-acccgtaatcaccggggaactctccagt 270 Query: 461 caggtagctcgggggctcacc 481 ||||||||||| |||||||| Sbjct: 269 gaggtagctcggaggctcacc 249 Score = 75.8 bits (38), Expect = 2e-10 Identities = 89/106 (83%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| ||||| ||||||||||| ||||| |||||||||||||||||||| || || || | Sbjct: 861 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagcca 802 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 ||||| ||||||||||| | || ||||| |||||||| ||||| Sbjct: 801 agtggtccgcgaggttctccaacggtccctttccggtgacaatggc 756
>gb|M16887.1|SIPCAB White campion chlorophyll a/b-binding protein precursor (CAB) mRNA, partial cds Length = 642 Score = 113 bits (57), Expect = 8e-22 Identities = 177/217 (81%) Strand = Plus / Minus Query: 219 ttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaacc 278 ||||||||||||||||||| || || ||||| ||| ||||| || || |||||||||| Sbjct: 472 ttgggttgccaaggtagtcaagaccaccctcttggaatatctgagaccctgccttgaacc 413 Query: 279 aaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccga 338 |||| ||||| || || || || ||||| ||||| | ||||||||| ||||| || | Sbjct: 412 aaactgcctctccaaatttgactccgttcttagccaggagctcggggaaaacgcatccaa 353 Query: 339 gcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaagg 398 | || |||||||| ||||| | ||||||||||||||| ||||| |||||||| ||||| | Sbjct: 352 gggcaccaagcattgcccatctgcagtggatcacctctagctcacggttcttagcgaatg 293 Query: 399 tctcggggtcagcagacaacccagcagtgtcccaacc 435 | || |||||||| || | ||||||||||||||||| Sbjct: 292 tttctgggtcagctgagagtccagcagtgtcccaacc 256
>dbj|AB051209.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b binding protein LhcII-3, complete cds Length = 1256 Score = 113 bits (57), Expect = 8e-22 Identities = 199/245 (81%), Gaps = 1/245 (0%) Strand = Plus / Minus Query: 223 gttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaaac 282 |||||| ||||||| |||||||||||| ||||||||||| |||||||||||||| || Sbjct: 436 gttgccgaggtagttcaggccgccctcagcgaagatctgggcgccggccttgaaccagac 377 Query: 283 agcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagcgc 342 ||||||||||||| | |||||| |||||||| ||||||| || |||||| || || Sbjct: 376 agcctcaccgaacgggatgccgttcttggccagcagctcgggggtgatgcagcccagagc 317 Query: 343 tccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtctc 402 || ||||||||||| ||| |||||||| ||||| |||||||| ||||||||| Sbjct: 316 gcccagcatggcccagcgggcgtggatcagctccaactcgcggtagcgcttgaaggtctc 257 Query: 403 ggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggtca 462 |||||||| |||| || || ||||||| | ||||||||||| |||||||| || |||| Sbjct: 256 cgggtcagccgacagaccggcggtgtccc-agccgtagtcgccggggaactcgccagtca 198 Query: 463 ggtag 467 ||||| Sbjct: 197 ggtag 193
>dbj|AB051205.1| Chlamydomonas reinhardtii gene for light-harvesting chlorophyll-a/b binding protein LhcII-3, complete cds Length = 1508 Score = 113 bits (57), Expect = 8e-22 Identities = 199/245 (81%), Gaps = 1/245 (0%) Strand = Plus / Minus Query: 223 gttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaaac 282 |||||| ||||||| |||||||||||| ||||||||||| |||||||||||||| || Sbjct: 884 gttgccgaggtagttcaggccgccctcagcgaagatctgggcgccggccttgaaccagac 825 Query: 283 agcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagcgc 342 ||||||||||||| | |||||| |||||||| ||||||| || |||||| || || Sbjct: 824 agcctcaccgaacgggatgccgttcttggccagcagctcgggggtgatgcagcccagagc 765 Query: 343 tccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtctc 402 || ||||||||||| ||| |||||||| ||||| |||||||| ||||||||| Sbjct: 764 gcccagcatggcccagcgggcgtggatcagctccaactcgcggtagcgcttgaaggtctc 705 Query: 403 ggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggtca 462 |||||||| |||| || || ||||||| | ||||||||||| |||||||| || |||| Sbjct: 704 cgggtcagccgacagaccggcggtgtccc-agccgtagtcgccggggaactcgccagtca 646 Query: 463 ggtag 467 ||||| Sbjct: 645 ggtag 641
>dbj|AB012636.1| Nicotiana sylvestris Lhcb1*1 gene for light harvesting chlorophyll a/b-binding protein, complete cds Length = 3659 Score = 113 bits (57), Expect = 8e-22 Identities = 205/253 (81%), Gaps = 1/253 (0%) Strand = Plus / Minus Query: 217 gcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaa 276 |||||||||||| | |||||| || || |||||||| ||||| |||||||| |||||||| Sbjct: 586 gcttgggttgcccaagtagtcaagtccaccctcgctaaagatttgggatccagccttgaa 527 Query: 277 ccaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagcc 336 ||| ||||| || || ||||| || ||||| || |||| | ||| |||||||| || || Sbjct: 526 ccagacagcttcgccaaacttgacaccgttacgagccaagagctcagggaagacacatcc 467 Query: 337 gagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaa 396 || || |||||||| ||||| | ||||||||||||||| || || ||||||||||| || Sbjct: 466 aagagcaccaagcatagcccatctgcagtggatcacctcgagttcacggttcttggcaaa 407 Query: 397 ggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcac 456 ||| || || || || || | |||||||| |||| |||| || || |||||||| |||| Sbjct: 406 ggtttctggatctgctgaaagtccagcagtatccc-acccataatcaccagggaattcac 348 Query: 457 cggtcaggtagct 469 ||||| |||||| Sbjct: 347 tggtcaagtagct 335 Score = 63.9 bits (32), Expect = 7e-07 Identities = 86/104 (82%) Strand = Plus / Minus Query: 118 ccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcgagatgg 177 ||||| || ||||| |||||| | ||||| ||||||||||| || ||||| || || ||| Sbjct: 927 ccggggacaaagtttgtggcgtacgcccaagcattgttgttaactgggtctgcaaggtgg 868 Query: 178 tcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 ||||| |||||||| | ||| ||||| ||||| || |||||||| Sbjct: 867 tcagcaaggttctctaatgggccctttccggtaacaatggcttg 824
>emb|X54090.1|GHCAB G.hirsutum cab gene for chlorophyll ab binding protein Length = 1746 Score = 111 bits (56), Expect = 3e-21 Identities = 123/144 (85%), Gaps = 1/144 (0%) Strand = Plus / Minus Query: 323 gggaagacgcagccgagcgctccaagcatggcccaacggcagtggatcacctccagctcg 382 ||||| || ||||| || || |||||||| ||||| | |||||||||||||| ||||| Sbjct: 887 gggaaaacacagccaagggcaccaagcatagcccacctacagtggatcacctcaagctca 828 Query: 383 cggttcttggcgaaggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtc 442 ||||||||||| || ||||| |||||||| || || |||||||| |||| |||||||||| Sbjct: 827 cggttcttggcaaatgtctctgggtcagctgataatccagcagtatccc-acccgtagtc 769 Query: 443 gccagggaactcaccggtcaggta 466 |||||||| |||||||||||||| Sbjct: 768 cccagggaattcaccggtcaggta 745 Score = 69.9 bits (35), Expect = 1e-08 Identities = 68/79 (86%) Strand = Plus / Minus Query: 219 ttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaacc 278 |||||||||| || ||||| ||||| |||||| |||||| ||||| || |||||||||| Sbjct: 991 ttgggttgccgagatagtcaaggccaccctcggagaagatttgggaaccagccttgaacc 932 Query: 279 aaacagcctcaccgaactt 297 |||| ||||| |||||||| Sbjct: 931 aaaccgcctctccgaactt 913
>gb|AY617093.1| Pinus remota chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 111 bits (56), Expect = 3e-21 Identities = 204/252 (80%), Gaps = 1/252 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| ||||| || |||||||| || || ||||||||||| ||||| | ||| ||||||| Sbjct: 471 ggctagggtttcccaggtagtcaagccctccctcgctgaaaatctgagctcccgccttga 412 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| ||||| || |||||||| || || |||| ||||| | ||| ||||| ||||| | Sbjct: 411 accacacagcttccccgaactttactccatttctcgccagaagctccgggaaaacgcaac 352 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 | || || || ||||| ||||| |||||||||||||| |||| || | |||||| || | Sbjct: 351 ccagagcgcccagcattgcccaccggcagtggatcacttccaattctctgttcttcgcaa 292 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 | ||||| || || || || | ||| |||||||||| |||||||||| || ||||||||| Sbjct: 291 aagtctccggatccgccgaaagccccgcagtgtccc-acccgtagtcacccgggaactca 233 Query: 456 ccggtcaggtag 467 ||||||| |||| Sbjct: 232 ccggtcaagtag 221 Score = 69.9 bits (35), Expect = 1e-08 Identities = 53/59 (89%) Strand = Plus / Minus Query: 160 acggggtcggcgagatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 |||||||||||||| || |||||||||||||||| || ||||| |||||||||||||| Sbjct: 769 acggggtcggcgaggtgatcagcgaggttctcgatgggtcccttcccggtgacgatggc 711
>gb|AF039598.1| Prunus persica light harvesting chlorophyll A/B binding protein (Lhcb-Pp2) mRNA, complete cds Length = 955 Score = 111 bits (56), Expect = 3e-21 Identities = 198/244 (81%), Gaps = 1/244 (0%) Strand = Plus / Minus Query: 219 ttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaacc 278 ||||||||||||| ||||| ||||| |||||| |||||| || ||||| |||||||||| Sbjct: 448 ttgggttgccaagatagtcaaggccaccctcggagaagatttgagatccagccttgaacc 389 Query: 279 aaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccga 338 |||||||||| |||||||| || || || | ||| | || |||||||| || || | Sbjct: 388 aaacagcctcgccgaacttgacaccattctttgacaggatttctgggaagacacatccca 329 Query: 339 gcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaagg 398 | || |||||||||||||| |||| |||||||||||| ||||| | ||| || || || | Sbjct: 328 gtgcaccaagcatggcccatcggctgtggatcacctcaagctcaccgtttttcgcaaatg 269 Query: 399 tctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccg 458 |||| ||||| || || | ||||||||||||| | |||||||| |||||||| ||||| Sbjct: 268 tctcagggtctgcggatagtccagcagtgtccc-atccgtagtcaccagggaattcacca 210 Query: 459 gtca 462 |||| Sbjct: 209 gtca 206
>gb|AF247178.1|AF247178 Picea glauca needle chlorophyll a/b-binding protein mRNA, complete cds; nuclear gene for chloroplast product Length = 1096 Score = 111 bits (56), Expect = 3e-21 Identities = 150/180 (83%), Gaps = 1/180 (0%) Strand = Plus / Minus Query: 266 ccggccttgaaccaaacagcctcaccgaacttcacgccgtttcgggccagcaactcgggg 325 |||||||||||||| || || || || || ||||| ||| || ||||| || ||| ||| Sbjct: 478 ccggccttgaaccacacggcttccccaaatttcaccccggttttggccaacagctccggg 419 Query: 326 aagacgcagccgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcgg 385 || |||||||||||||| || | ||||||||| | || |||||||||||||||||| | | Sbjct: 418 aaaacgcagccgagcgcccccaacatggcccatctgctgtggatcacctccagctctctg 359 Query: 386 ttcttggcgaaggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgcc 445 || |||||||||||||| ||||| ||||| | ||| || ||||||| ||||||||||||| Sbjct: 358 tttttggcgaaggtctcagggtcggcagagagcccggcggtgtccc-acccgtagtcgcc 300 Score = 48.1 bits (24), Expect = 0.041 Identities = 39/44 (88%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttg 156 |||||||||||||||| ||||||||| | ||||| || |||||| Sbjct: 872 acttgccgggaacgaaattggtggcgtaggcccaggcgttgttg 829
>emb|Z75663.1|AGCHLABBP A.graveolens mRNA for chlorophyll a/b binding protein Length = 963 Score = 111 bits (56), Expect = 3e-21 Identities = 176/216 (81%) Strand = Plus / Minus Query: 217 gcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaa 276 ||||||||| || | |||||| || || |||||||||||||| || ||||| ||||| || Sbjct: 489 gcttgggttacccaagtagtcaagtccaccctcgctgaagatttgtgatccagccttaaa 430 Query: 277 ccaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagcc 336 ||| || ||||| || ||||| || || || || |||| | ||| |||||||| || || Sbjct: 429 ccacactgcctcgccaaacttgacaccattacgagccaagagctcagggaagacacaccc 370 Query: 337 gagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaa 396 || ||||||||||||||||| | | |||||||||| || || || ||||||||||| || Sbjct: 369 aagggctccaagcatggcccatctggagtggatcacttcaagttcacggttcttggcaaa 310 Query: 397 ggtctcggggtcagcagacaacccagcagtgtccca 432 ||||| |||||||| || | ||||||||||||||| Sbjct: 309 agtctcagggtcagccgaaagcccagcagtgtccca 274 Score = 65.9 bits (33), Expect = 2e-07 Identities = 81/97 (83%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| |||||||| ||||| ||||| || ||||| ||||||||||| || ||||| || | Sbjct: 835 actttccgggaacaaagttagtggcaaaggcccaggcattgttgttaacagggtctgcaa 776 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggt 209 | |||||||| | |||||| | ||||||||| ||||| Sbjct: 775 ggtggtcagccaagttctctaatggaccctttccggt 739
>dbj|AB115771.1| Physcomitrella patens subsp. patens PpLhcb1 gene for light-harvesting chlorophyll a/b-binding protein 1, complete cds Length = 1975 Score = 109 bits (55), Expect = 1e-20 Identities = 203/251 (80%), Gaps = 1/251 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| |||||||| | |||||||| || ||||||||||||||||||| ||||||||||| Sbjct: 1505 ggctagggttgcctaagtagtccaaacctccctcgctgaagatctgggctccggccttga 1446 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| || ||||| ||||||||||| ||| | |||||||| ||| ||| | ||| | Sbjct: 1445 accacacggcctcgccgaacttcacaccgctcttggccagcagctcaggggtcaggcacc 1386 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 | || ||||| ||||||||||| ||| |||||| ||||||| ||| | ||| ||||| Sbjct: 1385 ccagagctccgagcatggcccagcgggcgtggatgacctccaactccctgttgcgggcga 1326 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 ||||||||||||| | || | || || ||||||| | |||||||| |||| ||||||| Sbjct: 1325 aggtctcggggtccgacgagagtccggcggtgtccc-agccgtagtctccagcgaactca 1267 Query: 456 ccggtcaggta 466 ||| ||||||| Sbjct: 1266 ccgttcaggta 1256 Score = 67.9 bits (34), Expect = 4e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 115 ttgccgggaacgaagttggtggcgaatgcccatgcattgttg 156 |||||||||||||||||||||||| |||||||||| |||||| Sbjct: 1848 ttgccgggaacgaagttggtggcgtatgcccatgcgttgttg 1807 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Minus Query: 566 ttgcgcatggtgacgcgagcct 587 |||||||||||||||||||||| Sbjct: 783 ttgcgcatggtgacgcgagcct 762
>emb|X02357.1|PECAB13 Petunia gene for chlorophyll a/b binding protein cab 13 Length = 1019 Score = 109 bits (55), Expect = 1e-20 Identities = 215/267 (80%), Gaps = 1/267 (0%) Strand = Plus / Minus Query: 218 cttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaac 277 ||||||||||| | |||||| || || ||||| |||| || || ||||| ||||||||| Sbjct: 573 cttgggttgcccaagtagtcaagtccaccctctttgaatatttgagatccagccttgaac 514 Query: 278 caaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccg 337 || ||||| ||||| ||||| || || || ||||| | | ||| ||||||||||| || Sbjct: 513 catacagcttcaccaaacttgacaccattacgggcaaagagctcagggaagacgcaacca 454 Query: 338 agcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaag 397 || ||||||||||||| ||| | |||||||| |||||||| | |||||||||||||| Sbjct: 453 agagctccaagcatggtccatctacagtggattacctccagtttccggttcttggcgaaa 394 Query: 398 gtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcacc 457 || | ||||| || || | |||||||| |||| | || ||||| |||||||||||||| Sbjct: 393 gttgctgggtcggctgaaagtccagcagtatccc-atccatagtcaccagggaactcacc 335 Query: 458 ggtcaggtagctcgggggctcaccaga 484 |||| |||||| |||| ||||||||| Sbjct: 334 agtcaagtagcttggggcctcaccaga 308 Score = 65.9 bits (33), Expect = 2e-07 Identities = 75/89 (84%) Strand = Plus / Minus Query: 133 gtggcgaatgcccatgcattgttgttgacggggtcggcgagatggtcagcgaggttctcg 192 ||||| || ||||| ||||||||||| |||||||| || || || |||||||||||||| Sbjct: 900 gtggcaaaggcccacgcattgttgttaacggggtcagcaaggtgatcagcgaggttctcc 841 Query: 193 agtggacccttgccggtgacgatggcttg 221 | |||||| || |||||||| || ||||| Sbjct: 840 aatggaccttttccggtgacaatagcttg 812
>dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H12, full insert sequence Length = 1040 Score = 109 bits (55), Expect = 1e-20 Identities = 96/107 (89%), Gaps = 2/107 (1%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||||||||| ||||||||||||||| | |||||||| |||||||||||||||||||||| Sbjct: 862 acttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 803 Query: 173 gatggtc-agcgaggttctcgagtggacccttgccggtgacgatggc 218 | ||||| ||| |||||||| | || |||||||||||||||||||| Sbjct: 802 ggtggtcgagc-aggttctccaaggggcccttgccggtgacgatggc 757 Score = 61.9 bits (31), Expect = 3e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaacca 279 |||||||| |||||||| |||||||| ||| ||||||||||| |||||||||||||| Sbjct: 509 gggttgccgaggtagtcgaggccgccgtcggagaagatctgggcgccggccttgaacca 451 Score = 56.0 bits (28), Expect = 2e-04 Identities = 101/124 (81%), Gaps = 1/124 (0%) Strand = Plus / Minus Query: 331 gcagccgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttctt 390 |||||| ||||| || ||||| ||||| |||| |||||||||||||||| | | |||| | Sbjct: 396 gcagcccagcgcgccgagcatcgcccaccggccgtggatcacctccagcgccctgttcct 337 Query: 391 ggcgaaggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccaggga 450 ||||| | ||| ||||| || || | ||| || ||||||| |||| |||||||| |||| Sbjct: 336 cgcgaacgcctccgggtccgcggagagccccgccgtgtccc-acccatagtcgcccggga 278 Query: 451 actc 454 |||| Sbjct: 277 actc 274
>dbj|AP008949.1| Lotus japonicus genomic DNA, chromosome 2, clone:LjT44M23, TM1572a, complete sequence Length = 48924 Score = 109 bits (55), Expect = 1e-20 Identities = 107/123 (86%), Gaps = 1/123 (0%) Strand = Plus / Minus Query: 344 ccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtctcg 403 |||||||||||||| | || ||| |||||||| ||||| ||||||||||||||||| ||| Sbjct: 40228 ccaagcatggcccatctgctgtgaatcacctcgagctcacggttcttggcgaaggtttcg 40169 Query: 404 gggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggtcag 463 |||||||| || || ||||| ||||||| | |||||||| |||||||| ||||| ||||| Sbjct: 40168 gggtcagctgataatccagctgtgtccc-atccgtagtcaccagggaattcaccagtcag 40110 Query: 464 gta 466 ||| Sbjct: 40109 gta 40107 Score = 48.1 bits (24), Expect = 0.041 Identities = 63/76 (82%) Strand = Plus / Minus Query: 219 ttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaacc 278 |||||||||| | ||||| ||||| ||||| ||||||||||| || |||||||||| Sbjct: 40353 ttgggttgcctaaatagtcaaggccaccctcagagaagatctgggcaccagccttgaacc 40294 Query: 279 aaacagcctcaccgaa 294 | || ||||||||||| Sbjct: 40293 acactgcctcaccgaa 40278
>dbj|AB051208.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b binding protein LhcII-1.3, complete cds Length = 1107 Score = 109 bits (55), Expect = 1e-20 Identities = 200/247 (80%), Gaps = 1/247 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 |||||||| |||||||||||||||||||| ||||||||||| |||||||||||||| Sbjct: 468 gggttgcccaggtagtccaggccgccctcagagaagatctgggcgccggccttgaaccag 409 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 |||||||| ||||||| |||| | |||||||| ||||||| || |||||| || Sbjct: 408 acagcctcgccgaactgggtgccgctcttggccagcagctcgggggtgatgcagcccaga 349 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 || || ||||| ||||| ||| |||||||| |||||||||||||| ||||||| Sbjct: 348 gcgcccagcatagcccagcgggcgtggatcagctccagctcgcggtagcgcttgaaggtc 289 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || |||||||| |||| || || ||||||| | ||||||||||| |||||||| || || Sbjct: 288 tccgggtcagccgacagaccggcggtgtccc-agccgtagtcgccggggaactcgccagt 230 Query: 461 caggtag 467 ||||||| Sbjct: 229 caggtag 223
>dbj|AB051204.1| Chlamydomonas reinhardtii gene for light-harvesting chlorophyll-a/b binding protein LhcII-1.3, complete cds Length = 1835 Score = 109 bits (55), Expect = 1e-20 Identities = 200/247 (80%), Gaps = 1/247 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 |||||||| |||||||||||||||||||| ||||||||||| |||||||||||||| Sbjct: 1096 gggttgcccaggtagtccaggccgccctcagagaagatctgggcgccggccttgaaccag 1037 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 |||||||| ||||||| |||| | |||||||| ||||||| || |||||| || Sbjct: 1036 acagcctcgccgaactgggtgccgctcttggccagcagctcgggggtgatgcagcccaga 977 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 || || ||||| ||||| ||| |||||||| |||||||||||||| ||||||| Sbjct: 976 gcgcccagcatagcccagcgggcgtggatcagctccagctcgcggtagcgcttgaaggtc 917 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || |||||||| |||| || || ||||||| | ||||||||||| |||||||| || || Sbjct: 916 tccgggtcagccgacagaccggcggtgtccc-agccgtagtcgccggggaactcgccagt 858 Query: 461 caggtag 467 ||||||| Sbjct: 857 caggtag 851
>gb|AF295639.1| Beta vulgaris chlorophyll a/b binding protein (cab) gene, partial cds, nuclear gene for chloroplast product Length = 507 Score = 107 bits (54), Expect = 5e-20 Identities = 177/218 (81%) Strand = Plus / Minus Query: 218 cttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaac 277 |||||||| || | |||||| || || ||||| || ||||| || ||||| ||||||||| Sbjct: 226 cttgggttacccaagtagtcaagtccaccctcactaaagatttgtgatcctgccttgaac 167 Query: 278 caaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccg 337 ||||||||||| || ||||| || || || ||||| | |||||| ||||| || || || Sbjct: 166 caaacagcctcgccaaacttaacaccattgcgggctaacaactctgggaatacacaacct 107 Query: 338 agcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaag 397 | || || | ||||||||| | ||| ||||||||||| ||||| ||||||||||| ||| Sbjct: 106 aatgcgcccaacatggcccatctgcaatggatcacctcaagctcacggttcttggcaaag 47 Query: 398 gtctcggggtcagcagacaacccagcagtgtcccaacc 435 || || |||||||| || | ||||||||||||||||| Sbjct: 46 gtttctgggtcagctgagagtccagcagtgtcccaacc 9
>gb|U51632.1|PPU51632 Pinus palustris type 2 light-harvesting chlorophyll a/b-binding polypeptide (Lhcb2) mRNA, partial cds Length = 873 Score = 107 bits (54), Expect = 5e-20 Identities = 181/222 (81%), Gaps = 1/222 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 ||||| || |||||||| ||||| ||||| ||| ||||| | |||||||||||||| Sbjct: 389 gggttccccaggtagtcgaggcctccctctgagaatatctgagccccggccttgaaccac 330 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || || || || || ||||| |||||| ||||| || ||| ||||| |||||||| ||| Sbjct: 329 acggcttccccaaatttcaccccgtttttggccaacagctccgggaaaacgcagcccagc 270 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 || || | ||||||||| | | ||||||||||||||||||| | ||| |||||||||||| Sbjct: 269 gcccccaacatggcccatctggagtggatcacctccagctctctgtttttggcgaaggtc 210 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtc 442 ||||| || ||||| | ||| || ||||||| |||||||||| Sbjct: 209 tcgggatcggcagagagcccggctgtgtccc-acccgtagtc 169 Score = 54.0 bits (27), Expect = 7e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 110 cttacttgccgggaacgaagttggtggcgaatgcccatgcattgttg 156 |||| |||||||||||||| ||||||||| | ||||| ||||||||| Sbjct: 742 cttatttgccgggaacgaaattggtggcgtaggcccaggcattgttg 696
>emb|BX819530.1|CNS0A9V8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB87ZE01 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 291 Score = 105 bits (53), Expect = 2e-19 Identities = 95/109 (87%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| ||||| ||||||||||||||||| ||||| || ||||||||||| |||||||| | Sbjct: 167 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggcca 108 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 |||||| ||||||||||| | || ||||| ||||||||||||||||| Sbjct: 107 aatggtcggcgaggttctccaaaggtccctttccggtgacgatggcttg 59
>gb|AY617095.1| Pinus nelsonii chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 103 bits (52), Expect = 8e-19 Identities = 203/252 (80%), Gaps = 1/252 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| ||||| || |||||||| || || ||||||||||| ||||| | ||| ||||||| Sbjct: 471 ggctagggtttcccaggtagtcaagccctccctcgctgaaaatctgagctcccgccttga 412 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| || ||||| |||||||| || || |||| || || | ||| ||||| ||||| | Sbjct: 411 accagactgcctccccgaactttactccatttctcgcaagaagctccgggaaaacgcaac 352 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 | || || || ||||| ||||| |||||||||||||| |||| || | |||||| |||| Sbjct: 351 ccagagcgcccagcattgcccaccggcagtggatcacttccaattctctgttcttcgcga 292 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 | ||||| || || || || | ||| || ||||||| |||||||||| || ||||||||| Sbjct: 291 aagtctccggatccgccgaaagccccgctgtgtccc-acccgtagtcacccgggaactca 233 Query: 456 ccggtcaggtag 467 ||||||| |||| Sbjct: 232 ccggtcaagtag 221 Score = 69.9 bits (35), Expect = 1e-08 Identities = 53/59 (89%) Strand = Plus / Minus Query: 160 acggggtcggcgagatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 |||||||||||||| || |||||||||||||||| || ||||| |||||||||||||| Sbjct: 769 acggggtcggcgaggtgatcagcgaggttctcgatgggtccctttccggtgacgatggc 711
>gb|AY617090.1| Pinus monticola chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 103 bits (52), Expect = 8e-19 Identities = 203/252 (80%), Gaps = 1/252 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| ||||| ||||||||||| || || ||||||||||| ||||| | ||| ||||||| Sbjct: 471 ggctagggtttccaaggtagtcaagccctccctcgctgaaaatctgagctcccgccttga 412 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| || ||||| |||||||| || || ||| ||||| | ||| ||||| ||||| | Sbjct: 411 accacactgcctccccgaactttactccatttttcgccagaagctccgggaaaacgcaac 352 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 | || || || ||||| ||||| |||| ||||||||| ||||| || | |||||| || | Sbjct: 351 ccagagcgcccagcattgcccaccggctgtggatcacttccagttctctgttcttcgcaa 292 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 | ||||| || || || || | ||| || ||||||| |||||||||| || ||||||||| Sbjct: 291 atgtctccggatccgccgaaagccccgccgtgtccc-acccgtagtcacccgggaactca 233 Query: 456 ccggtcaggtag 467 ||||||| |||| Sbjct: 232 ccggtcaagtag 221 Score = 69.9 bits (35), Expect = 1e-08 Identities = 53/59 (89%) Strand = Plus / Minus Query: 160 acggggtcggcgagatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 |||||||||||||| || |||||||||||||||| || ||||| |||||||||||||| Sbjct: 769 acggggtcggcgaggtgatcagcgaggttctcgatgggtccctttccggtgacgatggc 711
>gb|AY617089.1| Pinus lambertiana chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 103 bits (52), Expect = 8e-19 Identities = 203/252 (80%), Gaps = 1/252 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| ||||| ||||||||||| || || ||||||||||| ||||| | ||| ||||||| Sbjct: 471 ggctagggtttccaaggtagtcaagccctccctcgctgaaaatctgagctcccgccttga 412 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| || ||||| |||||||| || || ||| ||||| | ||| ||||| ||||| | Sbjct: 411 accacactgcctccccgaactttactccatttttcgccagaagctccgggaaaacgcaac 352 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 | || || || ||||| ||||| |||| ||||||||| ||||| || | |||||| || | Sbjct: 351 ccagrgcgcccagcattgcccaccggctgtggatcacttccagttctctgttcttcgcaa 292 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 | ||||| || || || || | ||| || ||||||| |||||||||| || ||||||||| Sbjct: 291 atgtctccggatccgccgaaagccccgccgtgtccc-acccgtagtcacccgggaactca 233 Query: 456 ccggtcaggtag 467 ||||||| |||| Sbjct: 232 ccggtcaagtag 221 Score = 69.9 bits (35), Expect = 1e-08 Identities = 53/59 (89%) Strand = Plus / Minus Query: 160 acggggtcggcgagatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 |||||||||||||| || |||||||||||||||| || ||||| |||||||||||||| Sbjct: 769 acggggtcggcgaggtgatcagcgaggttctcgatgggtccctttccggtgacgatggc 711
>gb|AY617088.1| Pinus flexilis chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 103 bits (52), Expect = 8e-19 Identities = 203/252 (80%), Gaps = 1/252 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| ||||| ||||||||||| || || ||||||||||| ||||| | ||| ||||||| Sbjct: 471 ggctagggtttccaaggtagtcaagccctccctcgctgaaaatctgagctcccgccttga 412 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| || ||||| |||||||| || || ||| ||||| | ||| ||||| ||||| | Sbjct: 411 accacactgcctccccgaactttactccatttttcgccagaagctccgggaaaacgcaac 352 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 | || || || ||||| ||||| |||| ||||||||| ||||| || | |||||| || | Sbjct: 351 ccagagcgcccagcattgcccaccggctgtggatcacttccagttctctgttcttcgcaa 292 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 | ||||| || || || || | ||| || ||||||| |||||||||| || ||||||||| Sbjct: 291 atgtctccggatctgccgaaagccccgccgtgtccc-acccgtagtcacccgggaactca 233 Query: 456 ccggtcaggtag 467 ||||||| |||| Sbjct: 232 ccggtcaagtag 221 Score = 69.9 bits (35), Expect = 1e-08 Identities = 53/59 (89%) Strand = Plus / Minus Query: 160 acggggtcggcgagatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 |||||||||||||| || |||||||||||||||| || ||||| |||||||||||||| Sbjct: 769 acggggtcggcgaggtgatcagcgaggttctcgatgggtccctttccggtgacgatggc 711
>gb|U01964.1|GMU01964 Glycine max cv. Dare photosystem II type I chlorophyll a/b-binding protein (lhcb1*7) gene, complete cds Length = 1882 Score = 103 bits (52), Expect = 8e-19 Identities = 178/220 (80%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 ||||||||||||| | |||||| || || ||||| ||||| ||||| || |||||||||| Sbjct: 1205 ggcttgggttgcccaagtagtcaagcccaccctcactgaatatctgagacccggccttga 1146 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| || ||||| || ||||| || ||||| |||| || | || ||||| || |||| Sbjct: 1145 accacacggcctcgccaaacttgactccgttgcgggacaagagttcagggaaaacacagc 1086 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 | | ||||| | ||||||||| | | ||||||| || ||||| || ||||| ||||| | Sbjct: 1085 ccaaggctcccaacatggcccatctggagtggatgacttccagttcacggtttttggcaa 1026 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacc 435 | ||||| ||||||||||| | |||||||||||||||||| Sbjct: 1025 aagtctctgggtcagcagaaagcccagcagtgtcccaacc 986 Score = 48.1 bits (24), Expect = 0.041 Identities = 63/76 (82%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| |||||||| ||||| ||||| | ||||| |||||||||||||| ||||| || | Sbjct: 1550 actttccgggaacaaagtttgtggcataagcccaagcattgttgttgactgggtcagcaa 1491 Query: 173 gatggtcagcgaggtt 188 | || ||||| ||||| Sbjct: 1490 ggtgatcagcaaggtt 1475
>gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430/T31E10.23) mRNA, complete cds Length = 1009 Score = 101 bits (51), Expect = 3e-18 Identities = 191/235 (81%), Gaps = 2/235 (0%) Strand = Plus / Minus Query: 248 tcgctgaagatctgggatccggccttgaacc-aaacagcctcaccgaacttcacgccgtt 306 |||||||||||||| || || ||| |||||| |||| || || ||||||||||| ||||| Sbjct: 482 tcgctgaagatctgtgaaccagccctgaacccaaacggcttctccgaacttcactccgtt 423 Query: 307 tcgggccagcaactcggggaagacgcagccgagcgctccaagcatggcccaacggcagtg 366 | |||| | ||| ||||| |||||||| || ||||| ||||||||||| | || ||| Sbjct: 422 cctagccaatagctcagggaaaacgcagcctagggctccgagcatggcccatctgctgtg 363 Query: 367 gatcacctccagctcgcggttcttggcgaaggtctcggggtcagcagacaacccagcagt 426 ||| || || ||||| |||||| | |||||||||||||| || || || | || ||||| Sbjct: 362 gataacttctagctcacggttcctagcgaaggtctcgggatcggcggatagaccggcagt 303 Query: 427 gtcccaacccgtagtcgccagggaactcaccggtcaggtagctcgggggctcacc 481 ||||| ||||||| || || |||||||| || || ||||||||||| |||||||| Sbjct: 302 gtccc-acccgtaatcaccggggaactctccagtgaggtagctcggaggctcacc 249 Score = 75.8 bits (38), Expect = 2e-10 Identities = 89/106 (83%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| ||||| ||||||||||| ||||| |||||||||||||||||||| || || || | Sbjct: 867 actttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagcca 808 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 ||||| ||||||||||| | || ||||| |||||||| ||||| Sbjct: 807 agtggtccgcgaggttctccaacggtccctttccggtgacaatggc 762
>emb|X02360.1|PECAB22R Petunia gene for chlorophyll a/b binding protein cab 22R Length = 1187 Score = 101 bits (51), Expect = 3e-18 Identities = 214/267 (80%), Gaps = 1/267 (0%) Strand = Plus / Minus Query: 218 cttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaac 277 ||||||||||| | |||||| || || ||||| ||||| || || | ||| ||||||||| Sbjct: 685 cttgggttgcccaagtagtcaagtccaccctcactgaaaatttgagctccagccttgaac 626 Query: 278 caaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccg 337 || |||||||||||||| || | || || ||||| | | || |||||||| || || Sbjct: 625 catacagcctcaccgaatttgataccattacgggcaaagagttcagggaagacacaacca 566 Query: 338 agcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaag 397 || ||||||||||||||||| | |||||||| ||||||||||| ||||||||||| || Sbjct: 565 agagctccaagcatggcccatctacagtggatgacctccagctcacggttcttggcaaaa 506 Query: 398 gtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcacc 457 || || || ||||| || | |||||||| |||| | || ||||| | |||||||||||| Sbjct: 505 gtttcaggatcagccgaaagtccagcagtatccc-atccatagtcactagggaactcacc 447 Query: 458 ggtcaggtagctcgggggctcaccaga 484 |||| |||||| || | ||||||||| Sbjct: 446 agtcaagtagcttggtgcctcaccaga 420 Score = 48.1 bits (24), Expect = 0.041 Identities = 60/72 (83%) Strand = Plus / Minus Query: 144 ccatgcattgttgttgacggggtcggcgagatggtcagcgaggttctcgagtggaccctt 203 ||||||||||||||| || || || || || || || || |||||||| | ||||||||| Sbjct: 1001 ccatgcattgttgttaactggatcagcaaggtgatcggcaaggttctccaatggaccctt 942 Query: 204 gccggtgacgat 215 ||||||||||| Sbjct: 941 tccggtgacgat 930
>emb|X58230.1|NTCAB36 Tobacco CAB36 gene for chlorophyll a/b binding protein Length = 1986 Score = 101 bits (51), Expect = 3e-18 Identities = 103/119 (86%), Gaps = 1/119 (0%) Strand = Plus / Minus Query: 344 ccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtctcg 403 |||||||||||||||||||| ||||||||||| ||||| |||||| | ||||| ||||| Sbjct: 1057 ccaagcatggcccaacggcaatggatcacctcaagctcacggttcctagcgaatgtctct 998 Query: 404 gggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggtca 462 |||||||| || | ||||||||||||| ||||||| || || ||||||||||| |||| Sbjct: 997 gggtcagctgaaagtccagcagtgtccc-acccgtaatcacctgggaactcaccagtca 940 Score = 71.9 bits (36), Expect = 3e-09 Identities = 66/76 (86%) Strand = Plus / Minus Query: 219 ttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaacc 278 ||||||| ||||||||||| || ||||| || ||| ||||| |||||||||||||||| Sbjct: 1182 ttgggttaccaaggtagtcaagaccgccttctgagaatatctgagatccggccttgaacc 1123 Query: 279 aaacagcctcaccgaa 294 |||| ||||||||||| Sbjct: 1122 aaactgcctcaccgaa 1107
>gb|AF495472.1| Chlamydomonas reinhardtii major light-harvesting complex II protein m6 mRNA, complete cds; nuclear gene for chloroplast product Length = 1094 Score = 99.6 bits (50), Expect = 1e-17 Identities = 198/246 (80%), Gaps = 1/246 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 |||||||| |||||||||||||||||||| ||||||||||| |||||||||||||| Sbjct: 449 gggttgcccaggtagtccaggccgccctcagagaagatctgggcgccggccttgaaccag 390 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 |||||||| |||||||| |||| | |||||||| ||||||| |||||| || Sbjct: 389 acagcctcgccgaacttggtgccgctcttggccagcagctcgggggtctggcagcccagg 330 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 || || ||||| ||||| ||| |||||||| |||||||||||||| ||||||| Sbjct: 329 gcgcccagcatagcccagcgggcgtggatcagctccagctcgcggtagcgcttgaaggtc 270 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || |||||||| |||| || || ||||||| | ||||||||||| |||||||| || || Sbjct: 269 tccgggtcagcggacaggccggcggtgtccc-agccgtagtcgccggggaactcgccagt 211 Query: 461 caggta 466 |||||| Sbjct: 210 caggta 205
>gb|AF479779.1| Chlamydomonas reinhardtii major light-harvesting complex II protein m7 (Lhcbm7) mRNA, complete cds Length = 1016 Score = 99.6 bits (50), Expect = 1e-17 Identities = 137/166 (82%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 |||||||| |||||||||||||||||||| ||||||||||| |||||||||||||| Sbjct: 436 gggttgcccaggtagtccaggccgccctcagagaagatctgggcgccggccttgaaccag 377 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 |||||||| ||||||| |||| | |||||||| ||||||| || |||||| || Sbjct: 376 acagcctcgccgaactgggtgccgctcttggccagcagctcgggggtgatgcagcccaga 317 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggt 386 || || ||||| ||||| ||| |||||||| |||||||||||||| Sbjct: 316 gcgcccagcatagcccagcgggcgtggatcagctccagctcgcggt 271
>gb|AF220527.1|AF220527 Euphorbia esula chlorophyll a/b binding protein precursor, mRNA, complete cds Length = 927 Score = 99.6 bits (50), Expect = 1e-17 Identities = 201/250 (80%), Gaps = 1/250 (0%) Strand = Plus / Minus Query: 232 gtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaaacagcctcacc 291 |||||| || || ||||| || || ||||| || || ||||||||||| || ||||| || Sbjct: 444 gtagtctagaccaccctcactaaatatctgagaccctgccttgaaccacactgcctcccc 385 Query: 292 gaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagcgctccaagcat 351 || ||||| ||||| ||||||| | ||| ||||| || || || || ||||||||||| Sbjct: 384 aaatttcacaccgttccgggccaagagctccgggaaaacacatccaagagctccaagcat 325 Query: 352 ggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtctcggggtcagc 411 ||||| | |||||||||| || ||||| ||||||||||| ||||| || |||||||| Sbjct: 324 agcccatcttgagtggatcacttcgagctcacggttcttggcaaaggtttctgggtcagc 265 Query: 412 agacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggtcaggtagctcg 471 || | || |||||||||| | || ||||| || ||||| |||||||||| |||||| | Sbjct: 264 tgagagtccggcagtgtccc-agccatagtcaccggggaattcaccggtcaagtagcttg 206 Query: 472 ggggctcacc 481 |||||||||| Sbjct: 205 ggggctcacc 196 Score = 50.1 bits (25), Expect = 0.010 Identities = 49/57 (85%) Strand = Plus / Minus Query: 111 ttacttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtc 167 |||||| ||||| ||||||||||| || || ||||| ||||||||||| || ||||| Sbjct: 807 ttactttccggggacgaagttggtcgcaaaagcccaagcattgttgttaaccgggtc 751
>dbj|AK058315.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-A06, full insert sequence Length = 685 Score = 99.6 bits (50), Expect = 1e-17 Identities = 92/106 (86%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||||||||| ||||||||||||||| ||||||| || |||||| |||||||||||||| Sbjct: 416 acttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcga 357 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 ||||| ||||||||||| || |||||||||||||||||||| Sbjct: 356 cgtggtcgaagaggttctcgatggggcccttgccggtgacgatggc 311
>gb|J01253.1|PEACAB15 Pea major chlorophyll a/b-binding thylakoid protein (polypeptide 15) mRNA, clone pAB96 Length = 822 Score = 99.6 bits (50), Expect = 1e-17 Identities = 198/246 (80%), Gaps = 1/246 (0%) Strand = Plus / Minus Query: 217 gcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaa 276 |||||||||||| | |||||| || || |||||||| ||||| || ||||| |||||||| Sbjct: 340 gcttgggttgcccaagtagtcaagtccaccctcgctaaagatttgagatcctgccttgaa 281 Query: 277 ccaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagcc 336 ||| ||||| |||||||| || || ||||| || | || | ||| |||||||| || || Sbjct: 280 ccatacagcttcaccgaatttaacaccgttgcgagacaaaagctctgggaagacacatcc 221 Query: 337 gagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaa 396 | ||||| | ||| ||||| | | ||||||| || || ||||| ||||||||||| || Sbjct: 220 caaggctcccaacatagcccatctggagtggataacttcaagctcacggttcttggcaaa 161 Query: 397 ggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcac 456 ||||| || || ||||| | ||||||||||||||| |||||||| || |||||||| | Sbjct: 160 tgtctctggatcggcagaaagtccagcagtgtcccaa-ccgtagtcacctgggaactctc 102 Query: 457 cggtca 462 |||||| Sbjct: 101 cggtca 96
>gb|M24072.1|CRECABA C.reinhardtii encoding chlorophyll a/b-binding protein (cabII-1) gene, complete cds Length = 2290 Score = 99.6 bits (50), Expect = 1e-17 Identities = 198/246 (80%), Gaps = 1/246 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 |||||||| |||||||||||||||||||| ||||||||||| |||||||||||||| Sbjct: 1224 gggttgcccaggtagtccaggccgccctcagagaagatctgggcgccggccttgaaccag 1165 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 |||||||| |||||||| |||| | |||||||| ||||||| |||||| || Sbjct: 1164 acagcctcgccgaacttggtgccgctcttggccagcagctcgggggtctggcagcccagg 1105 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 || || ||||| ||||| ||| |||||||| |||||||||||||| ||||||| Sbjct: 1104 gcgcccagcatagcccagcgggcgtggatcagctccagctcgcggtagcgcttgaaggtc 1045 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggt 460 || |||||||| |||| || || ||||||| | ||||||||||| |||||||| || || Sbjct: 1044 tccgggtcagcggacaggccggcggtgtccc-agccgtagtcgccggggaactcgccagt 986 Query: 461 caggta 466 |||||| Sbjct: 985 caggta 980
>dbj|AB013728.1| Cryptomeria japonica mRNA for light-harvesting chlorophyll a/b-binding protein of photosystem II, complete cds Length = 935 Score = 99.6 bits (50), Expect = 1e-17 Identities = 218/270 (80%), Gaps = 3/270 (1%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| |||||||| | ||||||| |||||||| ||||||||||| || || ||||||| Sbjct: 465 ggctagggttgcccaaatagtccaaaccgccctcactgaagatctgtgagcccgccttga 406 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 ||||||| || || ||||||||||| || |||||| ||| | ||| ||||| ||||| | Sbjct: 405 accaaaccgcttccccgaacttcacaccatttcggctcagaagctccgggaaaacgcacc 346 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 |||| ||||| | ||| ||||| ||| || || || |||||||| | ||||||||| | Sbjct: 345 cgagagctcccaacattgcccaccgggcatgaataacttccagctctctgttcttggcaa 286 Query: 396 aggtctcggggtc-agcagacaacccagcagtgtcccaacccgtagtcgccagggaactc 454 | ||||| ||||| || |||| || || ||||||| |||||||||| || ||||| || Sbjct: 285 aagtctctgggtctggctgacagaccggcggtgtccc-acccgtagtcacc-gggaattc 228 Query: 455 accggtcaggtagctcgggggctcaccaga 484 ||||||||||||| |||||||||||||| Sbjct: 227 accggtcaggtaggatgggggctcaccaga 198 Score = 54.0 bits (27), Expect = 7e-04 Identities = 84/103 (81%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| |||||||| ||||| ||||| | ||||| || ||||||||||| ||||| || | Sbjct: 810 acttcccgggaacaaagttagtggcataagcccaggcgttgttgttgacagggtctgcca 751 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgat 215 ||||||| || | |||||| || ||||| || ||||| ||||| Sbjct: 750 gatggtcggccaagttctccaggggaccttttccggtaacgat 708
>emb|X61915.1|PTCABP P.thunbergii cab gene Length = 5419 Score = 97.6 bits (49), Expect = 5e-17 Identities = 182/225 (80%), Gaps = 1/225 (0%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 ||||| || |||||||| ||||| ||||| ||| ||||| | |||||||||||||| Sbjct: 2717 gggttccccaggtagtcaaggcctccctctgagaatatctgcgccccggccttgaaccac 2658 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 ||||| || || || ||||| || ||| ||||| || ||| ||||| | ||||||||| Sbjct: 2657 acagcttccccaaatttcaccccatttttggccaacagctccgggaaaaggcagccgagg 2598 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtc 400 ||||| | ||||||||| | ||||||||||||||||||||| | ||| || ||||||||| Sbjct: 2597 gctcccaacatggcccatctgcagtggatcacctccagctctctgttttttgcgaaggtc 2538 Query: 401 tcggggtcagcagacaacccagcagtgtcccaacccgtagtcgcc 445 || || || || || | || |||||||||| ||||||||||||| Sbjct: 2537 tctggatccgccgagaggccggcagtgtccc-acccgtagtcgcc 2494
>gb|AF417304.1| Castanea sativa putative chlorophyll-A-B-binding protein mRNA, partial cds Length = 446 Score = 97.6 bits (49), Expect = 5e-17 Identities = 82/93 (88%) Strand = Plus / Minus Query: 340 cgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggt 399 |||||||||||||||||| |||| |||||||||||||||||| |||||||| || || || Sbjct: 413 cgctccaagcatggcccatcggctgtggatcacctccagctcacggttcttagcaaatgt 354 Query: 400 ctcggggtcagcagacaacccagcagtgtccca 432 ||| ||||| || || || |||||||||||||| Sbjct: 353 ctcagggtctgcggataatccagcagtgtccca 321
>gb|DQ418483.1| Zingiber officinale chloroplast chlorophyll a/b-binding protein mRNA, partial cds; nuclear gene for chloroplast product Length = 393 Score = 97.6 bits (49), Expect = 5e-17 Identities = 103/121 (85%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| |||||||| ||||| || || ||||||||| ||||||||| || |||||||||| Sbjct: 183 ggctggggttgccgaggtaatcgagtccgccctcggagaagatctgcgacccggccttga 124 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 ||||||| ||||| |||||||| |||||||| |||| || | ||| ||||||||||||| Sbjct: 123 accaaaccgcctcgccgaacttgacgccgttgcgggagaggagctccgggaagacgcagc 64 Query: 336 c 336 | Sbjct: 63 c 63
>emb|BX821952.1|CNS0AABH Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL87ZD09 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 949 Score = 97.6 bits (49), Expect = 5e-17 Identities = 94/109 (86%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| ||||| ||||||||||||||||| ||||| || |||||||| || |||||||| | Sbjct: 828 actttccggggacgaagttggtggcgaaggcccaagcgttgttgttaactgggtcggcaa 769 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 |||||| ||||||||||| | || ||||| ||||||||||||||||| Sbjct: 768 aatggtcggcgaggttctccaaaggtccctttccggtgacgatggcttg 720 Score = 95.6 bits (48), Expect = 2e-16 Identities = 130/156 (83%), Gaps = 1/156 (0%) Strand = Plus / Minus Query: 323 gggaagacgcagccgagcgctccaagcatggcccaacggcagtggatcacctccagctcg 382 ||||| |||||||| || ||||| |||||||||| | || |||||| || || ||||| Sbjct: 371 gggaaaacgcagcctagggctccgagcatggcccttctgctgtggataacttctagctca 312 Query: 383 cggttcttggcgaaggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtc 442 |||||| ||||||||||||| ||||| || || | | ||| |||||||| || |||||| Sbjct: 311 cggttcctggcgaaggtctctgggtcggcggatagacaagcggtgtcccatcc-gtagtc 253 Query: 443 gccagggaactcaccggtcaggtagctcgggggctc 478 || |||||||||||||| ||||||||||||||||| Sbjct: 252 accggggaactcaccggtaaggtagctcgggggctc 217 Score = 54.0 bits (27), Expect = 7e-04 Identities = 63/75 (84%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 |||||||||| |||||| | || || |||||||||||||| || |||||||||||| || Sbjct: 475 gggttgccaaagtagtcaaatcctccgtcgctgaagatctgtgacccggccttgaacaaa 416 Query: 281 acagcctcaccgaac 295 || || || |||||| Sbjct: 415 accgcttctccgaac 401
>emb|X13407.1|PTCAB Pinus thunbergii cab mRNA for light-harvesting chlorophyll a/b binding protein Length = 978 Score = 97.6 bits (49), Expect = 5e-17 Identities = 115/137 (83%) Strand = Plus / Minus Query: 266 ccggccttgaaccaaacagcctcaccgaacttcacgccgtttcgggccagcaactcgggg 325 |||||||||||||| ||||| || || || |||| || ||| ||||| || ||| ||| Sbjct: 453 ccggccttgaaccacacagcttccccaaatttcaacccatttttggccaacagctccggg 394 Query: 326 aagacgcagccgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcgg 385 || ||||||||||||||||| | ||||||||| | ||||||||||||||||||||| | | Sbjct: 393 aaaacgcagccgagcgctcccaacatggcccatctgcagtggatcacctccagctctctg 334 Query: 386 ttcttggcgaaggtctc 402 || || ||||||||||| Sbjct: 333 ttttttgcgaaggtctc 317
>emb|AJ000765.1|CRAJ765 Chlamydomonas reinhardtii mRNA for calreticulin Length = 2336 Score = 95.6 bits (48), Expect = 2e-16 Identities = 142/172 (82%), Gaps = 1/172 (0%) Strand = Plus / Plus Query: 312 ccagcaactcggggaagacgcagccgagcgctccaagcatggcccaacggcagtggatca 371 |||||| ||||||||||| |||||| || || || ||||||||||| ||| |||||||| Sbjct: 71 ccagcagctcggggaagatgcagcccagagcgccgagcatggcccagcgggcgtggatca 130 Query: 372 cctccagctcgcggttcttggcgaaggtctcggggtcagcagacaacccagcagtgtccc 431 |||||||||||||| ||||||||| |||||||| |||| || || ||||||| Sbjct: 131 gctccagctcgcggtagcgcttgaaggtctccgggtcagcggacaggccggcggtgtccc 190 Query: 432 aacccgtagtcgccagggaactcaccggtcaggtagctcgggggctcaccag 483 | |||||||| || |||||||| || |||||||||||||||||||| |||| Sbjct: 191 -agccgtagtcaccggggaactcgccagtcaggtagctcgggggctcgccag 241
>gb|DQ018376.1| Pinus krempfii chloroplast putative light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 752 Score = 95.6 bits (48), Expect = 2e-16 Identities = 202/252 (80%), Gaps = 1/252 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| ||||| || |||||||| || || ||||||||||| ||||| | ||| ||||||| Sbjct: 468 ggctagggtttcccaggtagtcaagccctccctcgctgaaaatctgagctcccgccttga 409 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| || ||||| |||||||| || || |||| ||||| | ||| ||||| ||||| | Sbjct: 408 accacactgcctctccgaactttactccatttctcgccagaagctccgggaaaacgcaac 349 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 | || || || ||||| ||||| |||| ||||||||| ||||| || | |||| | || | Sbjct: 348 ccagggcgcccagcattgcccaccggctgtggatcacttccagttctctgttcctcgcaa 289 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 | ||||| || || || || | ||| || ||||||| |||||||||| || ||||||||| Sbjct: 288 aagtctccggatccgccgaaagccccgccgtgtccc-acccgtagtcacctgggaactca 230 Query: 456 ccggtcaggtag 467 ||||||| |||| Sbjct: 229 ccggtcaagtag 218 Score = 58.0 bits (29), Expect = 4e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 178 tcagcgaggttctcgagtggacccttgccggtgacgatggc 218 |||||||||||||||| || |||||||||||||||||||| Sbjct: 748 tcagcgaggttctcgatgggtcccttgccggtgacgatggc 708
>gb|DQ018375.1| Pinus gerardiana chloroplast putative light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 760 Score = 95.6 bits (48), Expect = 2e-16 Identities = 202/252 (80%), Gaps = 1/252 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| ||||| || |||||||| || || ||||||||||| ||||| | ||| ||||||| Sbjct: 471 ggctagggtttcccaggtagtcaagccctccctcgctgaaaatctgagctcccgccttga 412 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| || ||||| |||||||| || || |||| ||||| | ||| ||||| ||||| | Sbjct: 411 accacactgcctccccgaactttactccatttctcgccagaagctccgggaaaacgcaac 352 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 | || || || ||||| ||||| |||||||||||||| ||||| || | |||||| || | Sbjct: 351 ccagagcgcccagcattgcccaccggcagtggatcacttccagttctctgttcttcgcaa 292 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 | ||||| || || || || | || || || |||| |||||||||| || ||||||||| Sbjct: 291 atgtctccggatccgccgaaaggcccgccgtatccc-acccgtagtcacccgggaactca 233 Query: 456 ccggtcaggtag 467 ||||||| |||| Sbjct: 232 ccggtcaagtag 221 Score = 44.1 bits (22), Expect = 0.63 Identities = 43/50 (86%) Strand = Plus / Minus Query: 169 gcgagatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 ||||| || |||||||||||||||| || ||||| |||||||| ||||| Sbjct: 760 gcgaggtgatcagcgaggttctcgatgggtccctttccggtgacaatggc 711
>gb|AY617091.1| Pinus strobus chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 95.6 bits (48), Expect = 2e-16 Identities = 202/252 (80%), Gaps = 1/252 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| ||||| || |||||||| || || ||||||||||| ||||| | ||| ||||||| Sbjct: 471 ggctagggtttcccaggtagtcaagccctccctcgctgaaaatctgagctcccgccttga 412 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| || ||||| |||||||| || || ||| ||||| | ||| ||||| ||||| | Sbjct: 411 accacactgcctckccgaactttactccatttttcgccagaagctccgggaaaacgcaac 352 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 | || || || ||||| ||||| |||| ||||||||| ||||| || | |||||| || | Sbjct: 351 ccagagcgcccagcattgcccaccggctgtggatcacttccagttctctgttcttcgcaa 292 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 | ||||| || || || || | ||| || ||||||| |||||||||| || ||||||||| Sbjct: 291 atgtctccggatccgccgaaagccccgccgtgtccc-acccgtagtcacccgggaactca 233 Query: 456 ccggtcaggtag 467 ||||||| |||| Sbjct: 232 ccggtcaagtag 221 Score = 69.9 bits (35), Expect = 1e-08 Identities = 53/59 (89%) Strand = Plus / Minus Query: 160 acggggtcggcgagatggtcagcgaggttctcgagtggacccttgccggtgacgatggc 218 |||||||||||||| || |||||||||||||||| || ||||| |||||||||||||| Sbjct: 769 acggggtcggcgaggtgatcagcgaggttctcgatgggtccctttccggtgacgatggc 711
>gb|AY617087.1| Pinus chiapensis chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 95.6 bits (48), Expect = 2e-16 Identities = 202/252 (80%), Gaps = 1/252 (0%) Strand = Plus / Minus Query: 216 ggcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttga 275 |||| ||||| ||||||| ||| || || ||||||||||| ||||| | ||| ||||||| Sbjct: 471 ggctagggtttccaaggtggtcaagccctccctcgctgaaaatctgagctcccgccttga 412 Query: 276 accaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagc 335 |||| || ||||| |||||||| || || ||| ||||| | ||| ||||| ||||| | Sbjct: 411 accacactgcctccccgaactttactccatttttcgccagaagctccgggaaaacgcaac 352 Query: 336 cgagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcga 395 | || || || ||||| ||||| |||| ||||||||| ||||| || | |||||| || | Sbjct: 351 ccagagcgcccagcattgcccaccggctgtggatcacttccagttctctgttcttcgcaa 292 Query: 396 aggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactca 455 | ||||| || || || || | ||| || ||||||| |||||||||| || ||||||||| Sbjct: 291 atgtctccggatccgccgaaagccccgccgtgtccc-acccgtagtcacccgggaactca 233 Query: 456 ccggtcaggtag 467 ||||||| |||| Sbjct: 232 ccggtcaagtag 221 Score = 63.9 bits (32), Expect = 7e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 160 acggggtcggcgagatggtcagcgaggttctcgagtggacccttgccggtgacgat 215 |||||||||||||| || |||||||||||||||| || ||||| ||||||||||| Sbjct: 769 acggggtcggcgaggtgatcagcgaggttctcgatgggtccctttccggtgacgat 714
>gb|M97171.1|SOYCAB6A Glycine max chlorophyll a/b binding protein type II (Cab-6) gene, complete cds; nuclear gene for chloroplast product Length = 1322 Score = 95.6 bits (48), Expect = 2e-16 Identities = 199/248 (80%), Gaps = 1/248 (0%) Strand = Plus / Minus Query: 219 ttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaacc 278 |||||||||| | |||||| || || ||||| ||||||||| || || |||||||||| Sbjct: 763 ttgggttgcccaagtagtcaagtcctccctccgagaagatctgtgaaccagccttgaacc 704 Query: 279 aaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccga 338 | || ||||| ||||| ||||| || || | || | ||| |||||| |||||| | Sbjct: 703 acacggcctcgccgaatttcacaccattcttctcaaggatctctgggaaggtgcagccaa 644 Query: 339 gcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaagg 398 | || |||||||||||||| | || ||| |||||||||||||| |||||| ||||||||| Sbjct: 643 gtgcaccaagcatggcccatctgctgtgaatcacctccagctcccggttcctggcgaagg 584 Query: 399 tctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccg 458 | || |||||||| || | ||||||||||||| | |||||||| || ||||| || ||| Sbjct: 583 tttccgggtcagctgatagtccagcagtgtccc-atccgtagtcaccggggaattctccg 525 Query: 459 gtcaggta 466 |||||||| Sbjct: 524 gtcaggta 517
>emb|X54856.1|CMCAB C.moewusii cab mRNA for chlorophyll a/b binding protein Length = 1011 Score = 95.6 bits (48), Expect = 2e-16 Identities = 91/104 (87%), Gaps = 1/104 (0%) Strand = Plus / Minus Query: 364 gtggatcacctccagctcgcggttcttggcgaaggtctcggggtcagcagacaacccagc 423 |||||||||||||||||| |||| ||| |||||||||||||||||| |||| ||||| Sbjct: 305 gtggatcacctccagctcacggtacttcttgaaggtctcggggtcagcggacagaccagc 246 Query: 424 agtgtcccaacccgtagtcgccagggaactcaccggtcaggtag 467 |||||||| | |||||||| || |||||||| |||||||||||| Sbjct: 245 agtgtccc-agccgtagtcaccggggaactcgccggtcaggtag 203 Score = 65.9 bits (33), Expect = 2e-07 Identities = 63/73 (86%) Strand = Plus / Minus Query: 225 tgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaaacag 284 |||| |||||||||||||| |||||| ||||||||||| |||||||||||||| || | Sbjct: 447 tgcccaggtagtccaggccaccctcggagaagatctgggcaccggccttgaaccacacgg 388 Query: 285 cctcaccgaactt 297 ||| |||||||| Sbjct: 387 gctcgccgaactt 375 Score = 48.1 bits (24), Expect = 0.041 Identities = 57/68 (83%) Strand = Plus / Minus Query: 151 ttgttgttgacggggtcggcgagatggtcagcgaggttctcgagtggacccttgccggtg 210 |||||| || ||||||| || || |||||||| ||||||| || || ||||||||||| Sbjct: 763 ttgttggtgccggggtcagccaggtggtcagccaggttctggatggggcccttgccggtc 704 Query: 211 acgatggc 218 |||||||| Sbjct: 703 acgatggc 696
>gb|AF133340.1|AF133340 Phalaenopsis sp. 'KCbutterfly' putative chlorophyll a/b-binding protein mRNA, complete cds Length = 1118 Score = 95.6 bits (48), Expect = 2e-16 Identities = 153/188 (81%) Strand = Plus / Minus Query: 245 ccctcgctgaagatctgggatccggccttgaaccaaacagcctcaccgaacttcacgccg 304 ||||||||||||||||| || || || |||||||| || ||||| || ||||| ||||| Sbjct: 511 ccctcgctgaagatctgagaaccagctttgaaccacaccgcctcgccaaactttacgcca 452 Query: 305 tttcgggccagcaactcggggaagacgcagccgagcgctccaagcatggcccaacggcag 364 || || |||| | ||| ||||||| ||| || || || || | ||||||||| || || Sbjct: 451 ttgcgagccaaaagctctgggaagatgcaacccagtgcacccaacatggcccaccgtgag 392 Query: 365 tggatcacctccagctcgcggttcttggcgaaggtctcggggtcagcagacaacccagca 424 ||||| ||||||||||| || ||||| |||||||| || ||||| || ||||| |||||| Sbjct: 391 tggatgacctccagctcccgattcttagcgaaggtttctgggtccgccgacaagccagca 332 Query: 425 gtgtccca 432 |||||||| Sbjct: 331 gtgtccca 324
>dbj|AB050125.1| Amaranthus tricolor cab1b mRNA for type I chlorophyll a/b-binding protein b, partial cds Length = 461 Score = 95.6 bits (48), Expect = 2e-16 Identities = 157/192 (81%), Gaps = 1/192 (0%) Strand = Plus / Minus Query: 251 ctgaagatctgggatccggccttgaaccaaacagcctcaccgaacttcacgccgtttcgg 310 |||||||| || || || ||||||||||||||||| ||||| ||||| || || || ||| Sbjct: 191 ctgaagatttgtgagcccgccttgaaccaaacagcttcaccaaacttaacaccattacgg 132 Query: 311 gccagcaactcggggaagacgcagccgagcgctccaagcatggcccaacggcagtggatc 370 |||| | |||||| || || ||||| | || || | ||||||||| |||||||| || Sbjct: 131 gccaagagctcgggaaaaacacagcccaaagcacccaacatggcccatcggcagtgaatg 72 Query: 371 acctccagctcgcggttcttggcgaaggtctcggggtcagcagacaacccagcagtgtcc 430 ||||| ||||| |||||||| || ||||| || |||||||| || | ||||||||||||| Sbjct: 71 acctcaagctcacggttcttagcaaaggtttccgggtcagctgaaagcccagcagtgtcc 12 Query: 431 caacccgtagtc 442 | |||||||||| Sbjct: 11 c-acccgtagtc 1
>gb|AY845253.1| Pisum sativum light-harvesting chlorophyll-a/b binding protein Lhcb1 mRNA, complete cds Length = 801 Score = 93.7 bits (47), Expect = 8e-16 Identities = 201/251 (80%), Gaps = 1/251 (0%) Strand = Plus / Minus Query: 217 gcttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaa 276 |||||||||||| | |||||| || || |||||||| ||||| || ||||| |||||||| Sbjct: 453 gcttgggttgcccaagtagtcaagtccaccctcgctaaagatttgagatcctgccttgaa 394 Query: 277 ccaaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagcc 336 ||| ||||| |||||||| || || ||||| || | || | ||| |||||||| || || Sbjct: 393 ccatacagcttcaccgaatttaacaccgttgcgagacaaaagctctgggaagacacatcc 334 Query: 337 gagcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaa 396 | || || | ||| ||||| | | ||||||| || || ||||| |||||||||| ||| Sbjct: 333 caaagcacccaacatagcccatctggagtggatgacttcaagctcacggttcttggagaa 274 Query: 397 ggtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcac 456 ||||| ||||||||||| | || |||||||||||| |||||||| || |||||||| | Sbjct: 273 tgtctctgggtcagcagagagtccggcagtgtcccaa-ccgtagtcaccggggaactctc 215 Query: 457 cggtcaggtag 467 | |||| |||| Sbjct: 214 cagtcaagtag 204 Score = 61.9 bits (31), Expect = 3e-06 Identities = 67/79 (84%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| |||||||| ||||||||||| ||| ||||||||||||||| || ||||||| | Sbjct: 799 actttccgggaacaaagttggtggcatatgaccatgcattgttgttaactgggtcggaaa 740 Query: 173 gatggtcagcgaggttctc 191 |||| ||||| || ||||| Sbjct: 739 gatgatcagcaagattctc 721
>gb|AY219853.1| Nicotiana tabacum chlorophyll a/b binding protein mRNA, complete cds Length = 946 Score = 93.7 bits (47), Expect = 8e-16 Identities = 105/123 (85%), Gaps = 1/123 (0%) Strand = Plus / Minus Query: 344 ccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtctcg 403 |||||||||||||||||||| ||||||||||| || || ||||| | ||||| ||||| Sbjct: 382 ccaagcatggcccaacggcaatggatcacctcaagttcacggtttctagcgaatgtctct 323 Query: 404 gggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggtcag 463 |||||||| || | ||||||||||||||| || ||||| || |||||||||||||| || Sbjct: 322 gggtcagctgagagtccagcagtgtcccaa-ccatagtcacctgggaactcaccggtgag 264 Query: 464 gta 466 ||| Sbjct: 263 gta 261 Score = 56.0 bits (28), Expect = 2e-04 Identities = 64/76 (84%) Strand = Plus / Minus Query: 219 ttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaacc 278 |||||||||| |||||||| || || || || |||||| |||| ||| |||||||||| Sbjct: 507 ttgggttgccgaggtagtcaagtccaccttccgagaagatttgggctcctgccttgaacc 448 Query: 279 aaacagcctcaccgaa 294 ||||||| |||||||| Sbjct: 447 aaacagcttcaccgaa 432
>gb|AF279248.1|AF279248 Vigna radiata LHCII type II chlorophyll a/b-binding protein (CipLhcb2) mRNA, complete cds; nuclear gene for chloroplast product Length = 1033 Score = 93.7 bits (47), Expect = 8e-16 Identities = 105/123 (85%), Gaps = 1/123 (0%) Strand = Plus / Minus Query: 344 ccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaaggtctcg 403 |||||||||||||| | || ||| |||||||||| ||| |||||| |||| ||||| || Sbjct: 379 ccaagcatggcccatctgctgtgaatcacctccaactcacggttcctggcaaaggtttca 320 Query: 404 gggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcaccggtcag 463 |||||||| || || ||||| ||||||| | |||||||| |||||||| ||||||||||| Sbjct: 319 gggtcagctgataatccagctgtgtccc-atccgtagtcaccagggaattcaccggtcag 261 Query: 464 gta 466 ||| Sbjct: 260 gta 258
>emb|AJ131044.1|CAR131044 Cicer arietinum mRNA for chlorophyll a/b binding protein Length = 983 Score = 93.7 bits (47), Expect = 8e-16 Identities = 213/267 (79%), Gaps = 1/267 (0%) Strand = Plus / Minus Query: 218 cttgggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaac 277 |||||||| || | |||||| || || ||||| || ||||| || ||||| ||||||||| Sbjct: 466 cttgggttacccaagtagtcaagtccaccctcactaaagatttgtgatccagccttgaac 407 Query: 278 caaacagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccg 337 || ||||| |||||||| || || || ||||||| || | ||| ||||| || || || Sbjct: 406 catacagcttcaccgaatttaacaccatttcgggacaaaagctctgggaacacacatccc 347 Query: 338 agcgctccaagcatggcccaacggcagtggatcacctccagctcgcggttcttggcgaag 397 | ||||| | ||| ||||| | || |||||| |||||||| || ||||| || || || Sbjct: 346 aatgctcccaacatagcccacctgctgtggattacctccagttcacggtttttcgcaaat 287 Query: 398 gtctcggggtcagcagacaacccagcagtgtcccaacccgtagtcgccagggaactcacc 457 ||||| ||||||||||| | |||||||||||||||| || ||||| || |||||||| || Sbjct: 286 gtctctgggtcagcagaaagcccagcagtgtcccaa-ccatagtcacctgggaactctcc 228 Query: 458 ggtcaggtagctcgggggctcaccaga 484 |||| ||| ||||||||||||||| Sbjct: 227 agtcaagtacgacgggggctcaccaga 201 Score = 81.8 bits (41), Expect = 3e-12 Identities = 92/109 (84%) Strand = Plus / Minus Query: 113 acttgccgggaacgaagttggtggcgaatgcccatgcattgttgttgacggggtcggcga 172 |||| |||||||| ||||||||||| | |||||||||||||||||||| ||||| | | Sbjct: 813 actttccgggaacaaagttggtggcataggcccatgcattgttgttgacagggtcagaaa 754 Query: 173 gatggtcagcgaggttctcgagtggacccttgccggtgacgatggcttg 221 |||||||||| |||||||| | |||||||| || ||||| || ||||| Sbjct: 753 gatggtcagcaaggttctccaaaggaccctttccagtgacaatagcttg 705
>gb|AF495473.1| Chlamydomonas reinhardtii major light-harvesting complex II protein m1 gene, complete cds; nuclear gene for chloroplast product Length = 1934 Score = 91.7 bits (46), Expect = 3e-15 Identities = 136/166 (81%) Strand = Plus / Minus Query: 221 gggttgccaaggtagtccaggccgccctcgctgaagatctgggatccggccttgaaccaa 280 |||||||| ||||||||||| |||||||| ||||||||| | || ||||||||||| Sbjct: 1002 gggttgcccaggtagtccagaccgccctcctggaagatctgagcaccagccttgaaccac 943 Query: 281 acagcctcaccgaacttcacgccgtttcgggccagcaactcggggaagacgcagccgagc 340 || ||||| ||||| |||||||| | |||||| ||||||||||| |||||| || Sbjct: 942 acggcctcgccgaagggcacgccgtaggagcccagcagctcggggaagatgcagcccaga 883 Query: 341 gctccaagcatggcccaacggcagtggatcacctccagctcgcggt 386 || || ||||||||||| ||| |||||||| |||||||||||||| Sbjct: 882 gcgccgagcatggcccagcgggcgtggatcagctccagctcgcggt 837 Score = 50.1 bits (25), Expect = 0.010 Identities = 34/37 (91%) Strand = Plus / Minus Query: 447 gggaactcaccggtcaggtagctcgggggctcaccag 483 |||||||| || |||||||||||||||||||| |||| Sbjct: 524 gggaactcgccagtcaggtagctcgggggctcgccag 488 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,900,400 Number of Sequences: 3902068 Number of extensions: 3900400 Number of successful extensions: 69538 Number of sequences better than 10.0: 386 Number of HSP's better than 10.0 without gapping: 386 Number of HSP's successfully gapped in prelim test: 1 Number of HSP's that attempted gapping in prelim test: 67616 Number of HSP's gapped (non-prelim): 1528 length of query: 723 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 700 effective length of database: 17,143,297,704 effective search space: 12000308392800 effective search space used: 12000308392800 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)