Clone Name | rbasd2o08 |
---|---|
Clone Library Name | barley_pub |
>dbj|BA000023.2| Sulfolobus tokodaii str. 7 DNA, complete genome Length = 2694756 Score = 44.1 bits (22), Expect = 0.20 Identities = 22/22 (100%) Strand = Plus / Minus Query: 186 ttgctcttttttgttgcttctt 207 |||||||||||||||||||||| Sbjct: 387064 ttgctcttttttgttgcttctt 387043
>dbj|AK148701.1| Mus musculus 2 days neonate sympathetic ganglion cDNA, RIKEN full-length enriched library, clone:7120437D01 product:hypothetical protein, full insert sequence Length = 2040 Score = 44.1 bits (22), Expect = 0.20 Identities = 22/22 (100%) Strand = Plus / Minus Query: 192 ttttttgttgcttcttgtcatg 213 |||||||||||||||||||||| Sbjct: 1544 ttttttgttgcttcttgtcatg 1523
>gb|AC156033.6| Mus musculus BAC clone RP23-377G8 from chromosome 12, complete sequence Length = 216718 Score = 44.1 bits (22), Expect = 0.20 Identities = 22/22 (100%) Strand = Plus / Minus Query: 192 ttttttgttgcttcttgtcatg 213 |||||||||||||||||||||| Sbjct: 92790 ttttttgttgcttcttgtcatg 92769
>dbj|AK042921.1| Mus musculus 7 days neonate cerebellum cDNA, RIKEN full-length enriched library, clone:A730039L15 product:unclassifiable, full insert sequence Length = 2134 Score = 44.1 bits (22), Expect = 0.20 Identities = 22/22 (100%) Strand = Plus / Minus Query: 192 ttttttgttgcttcttgtcatg 213 |||||||||||||||||||||| Sbjct: 1638 ttttttgttgcttcttgtcatg 1617
>emb|CR381658.11| Zebrafish DNA sequence from clone CH211-245M20 in linkage group 3, complete sequence Length = 159132 Score = 44.1 bits (22), Expect = 0.20 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 gaattgctcttttttgttgctt 204 |||||||||||||||||||||| Sbjct: 3344 gaattgctcttttttgttgctt 3323
>gb|AY868979.1| Uncultured alpha proteobacterium clone I3K-0178 16S ribosomal RNA gene, partial sequence Length = 452 Score = 42.1 bits (21), Expect = 0.81 Identities = 21/21 (100%) Strand = Plus / Minus Query: 26 aaccgatggcaaatgaagatg 46 ||||||||||||||||||||| Sbjct: 45 aaccgatggcaaatgaagatg 25
>gb|AC137595.2| Oryza sativa (japonica cultivar-group) chromosome 9 BAC clone OSJNBa0094K23, complete sequence Length = 167482 Score = 42.1 bits (21), Expect = 0.81 Identities = 21/21 (100%) Strand = Plus / Minus Query: 98 gataaaaataaaccagcttca 118 ||||||||||||||||||||| Sbjct: 97995 gataaaaataaaccagcttca 97975
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 42.1 bits (21), Expect = 0.81 Identities = 21/21 (100%) Strand = Plus / Minus Query: 98 gataaaaataaaccagcttca 118 ||||||||||||||||||||| Sbjct: 19502588 gataaaaataaaccagcttca 19502568
>emb|AL663103.4| Mouse DNA sequence from clone RP23-267D13 on chromosome 11, complete sequence Length = 238478 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 193 tttttgttgcttcttgtcat 212 |||||||||||||||||||| Sbjct: 16270 tttttgttgcttcttgtcat 16289
>gb|AC005549.1|AC005549 Homo sapiens chromosome 17, clone hRPK.215_E_13, complete sequence Length = 147416 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 36 aaatgaagatgtatgcaaat 55 |||||||||||||||||||| Sbjct: 138344 aaatgaagatgtatgcaaat 138363
>emb|CT025674.13| Mouse DNA sequence from clone RP24-364I17 on chromosome 13, complete sequence Length = 117646 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 102 aaaataaaccagcttcaacc 121 |||||||||||||||||||| Sbjct: 24552 aaaataaaccagcttcaacc 24571 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,292,287 Number of Sequences: 3902068 Number of extensions: 2292287 Number of successful extensions: 40217 Number of sequences better than 10.0: 11 Number of HSP's better than 10.0 without gapping: 11 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 40188 Number of HSP's gapped (non-prelim): 29 length of query: 247 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 225 effective length of database: 17,147,199,772 effective search space: 3858119948700 effective search space used: 3858119948700 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)