ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd3d04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY037163.1| Homo sapiens ribosomal protein L15 mRNA, complete... 797 0.0
2dbj|AB181483.1| Bromus inermis BiRP2 mRNA for ribosomal protein,... 765 0.0
3ref|NM_184952.1| Oryza sativa (japonica cultivar-group), mRNA 531 e-147
4dbj|AK121762.1| Oryza sativa (japonica cultivar-group) cDNA clon... 531 e-147
5dbj|AK104774.1| Oryza sativa (japonica cultivar-group) cDNA clon... 531 e-147
6dbj|AK060928.1| Oryza sativa (japonica cultivar-group) cDNA clon... 531 e-147
7dbj|AK066806.1| Oryza sativa (japonica cultivar-group) cDNA clon... 523 e-145
8gb|BT016488.1| Zea mays clone Contig321 mRNA sequence 519 e-144
9gb|BT016564.1| Zea mays clone Contig397 mRNA sequence 492 e-136
10gb|AY109334.1| Zea mays CL3259_2 mRNA sequence 466 e-128
11gb|AF457938.1| Zea mays clone cho1c.pk002.b21, mRNA sequence 319 7e-84
12gb|AF475099.1| Triticum aestivum 60S ribosomal protein L15 mRNA,... 283 4e-73
13gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 242 1e-60
14dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 242 1e-60
15gb|AC109602.6| Oryza sativa chromosome 3 BAC OSJNBa0087M10 genom... 242 1e-60
16gb|AC090874.9| Oryza sativa chromosome 3 BAC OJ1523_A02 genomic ... 242 1e-60
17gb|AC137610.2| Oryza sativa (japonica cultivar-group) chromosome... 236 8e-59
18dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 236 8e-59
19ref|NM_117843.2| Arabidopsis thaliana structural constituent of ... 159 2e-35
20gb|AY122965.1| Arabidopsis thaliana putative 60S ribosomal prote... 159 2e-35
21gb|AY072118.1| Arabidopsis thaliana putative 60S ribosomal prote... 159 2e-35
22gb|AY087088.1| Arabidopsis thaliana clone 31538 mRNA, complete s... 159 2e-35
23emb|BX828288.1|CNS0A3VG Arabidopsis thaliana Full-length cDNA Co... 151 4e-33
24dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 143 9e-31
25emb|BX827071.1|CNS0A47Q Arabidopsis thaliana Full-length cDNA Co... 143 9e-31
26dbj|AP006054.3| Oryza sativa (japonica cultivar-group) genomic D... 143 9e-31
27dbj|AP005852.2| Oryza sativa (japonica cultivar-group) genomic D... 143 9e-31
28gb|AC146855.5| Medicago truncatula clone mth2-16c23, complete se... 137 6e-29
29gb|AY086316.1| Arabidopsis thaliana clone 23771 mRNA, complete s... 129 1e-26
30gb|BT013339.1| Lycopersicon esculentum clone 135132F, mRNA sequence 117 5e-23
31gb|AF051207.1|AF051207 Picea mariana probable 60S ribosomal prot... 115 2e-22
32gb|AF051244.1|AF051244 Picea mariana probable 60S ribosomal prot... 113 8e-22
33gb|AF154663.1| Nicotiana tabacum clone PR55 mRNA sequence 111 3e-21
34gb|DQ427604.1| Sorghum propinquum locus CSU784 genomic sequence 107 5e-20
35gb|DQ427603.1| Sorghum bicolor voucher PI585454 locus CSU784 gen... 107 5e-20
36gb|DQ427602.1| Sorghum bicolor voucher PI267539 locus CSU784 gen... 107 5e-20
37gb|DQ427601.1| Sorghum bicolor voucher PI267408 locus CSU784 gen... 107 5e-20
38gb|DQ427600.1| Sorghum bicolor voucher PI221607 locus CSU784 gen... 107 5e-20
39gb|DQ427599.1| Sorghum bicolor voucher PI152702 locus CSU784 gen... 107 5e-20
40gb|DQ427598.1| Sorghum bicolor voucher NSL92371 locus CSU784 gen... 107 5e-20
41gb|DQ427597.1| Sorghum bicolor voucher NSL87902 locus CSU784 gen... 107 5e-20
42gb|DQ427596.1| Sorghum bicolor voucher NSL87666 locus CSU784 gen... 107 5e-20
43gb|DQ427595.1| Sorghum bicolor voucher NSL77217 locus CSU784 gen... 107 5e-20
44gb|DQ427594.1| Sorghum bicolor voucher NSL77034 locus CSU784 gen... 107 5e-20
45gb|DQ427593.1| Sorghum bicolor voucher NSL56174 locus CSU784 gen... 107 5e-20
46gb|DQ427592.1| Sorghum bicolor voucher NSL56003 locus CSU784 gen... 107 5e-20
47gb|DQ427591.1| Sorghum bicolor voucher NSL51365 locus CSU784 gen... 107 5e-20
48gb|DQ427590.1| Sorghum bicolor voucher NSL51030 locus CSU784 gen... 107 5e-20
49gb|DQ427589.1| Sorghum bicolor voucher NSL50875 locus CSU784 gen... 107 5e-20
50gb|DQ427588.1| Sorghum bicolor voucher BTx623 locus CSU784 genom... 107 5e-20
51gb|AF088912.1|AF088912 Petunia x hybrida ribosomal protein L15 m... 107 5e-20
52ref|XM_745122.1| Aspergillus fumigatus Af293 ribosomal L15 (Afu1... 105 2e-19
53dbj|AP007155.1| Aspergillus oryzae RIB40 genomic DNA, SC003 98 5e-17
54ref|NM_117842.2| Arabidopsis thaliana MSH4 (MUTS-LIKE PROTEIN 4)... 94 7e-16
55emb|Z97343.1|ATFCA8 Arabidopsis thaliana DNA chromosome 4, ESSA ... 94 7e-16
56emb|AL161546.2|ATCHRIV46 Arabidopsis thaliana DNA chromosome 4, ... 94 7e-16
57dbj|AB226246.1| Aspergillus oryzae cDNA, contig sequence: AoEST3105 94 7e-16
58dbj|AB224338.1| Aspergillus oryzae cDNA, contig sequence: AoEST1183 92 3e-15
59gb|AF230646.1|AF230646 Tortula ruralis large subunit ribosomal p... 92 3e-15
60ref|NM_117773.2| Arabidopsis thaliana structural constituent of ... 88 5e-14
61gb|AY143818.1| Arabidopsis thaliana At4g16720/dl4385c mRNA, comp... 88 5e-14
62gb|AY133797.1| Arabidopsis thaliana clone U10046 putative riboso... 88 5e-14
63gb|AF370352.1| Arabidopsis thaliana putative ribosomal protein (... 88 5e-14
64gb|AY075603.1| Arabidopsis thaliana AT4g16720/dl4385c mRNA, comp... 88 5e-14
65gb|AY058841.1| Arabidopsis thaliana AT4g16720/dl4385c mRNA, comp... 88 5e-14
66emb|BX826781.1|CNS0A442 Arabidopsis thaliana Full-length cDNA Co... 88 5e-14
67emb|BX828421.1|CNS0A3XR Arabidopsis thaliana Full-length cDNA Co... 88 5e-14
68emb|Y08859.1|NP60SRL15 N.plumbaginifolia mRNA for 60S ribosomal ... 88 5e-14
69emb|Y15321.1|ASRP115 Aspergillus niger mRNA for ribosomal protei... 84 7e-13
70gb|DQ284461.1| Solanum tuberosum clone 071F06 60S ribosomal prot... 84 7e-13
71emb|BX827700.1|CNS0A3Y3 Arabidopsis thaliana Full-length cDNA Co... 82 3e-12
72ref|XM_652957.1| Aspergillus nidulans FGSC A4 60S ribosomal prot... 76 2e-10
73emb|BX826761.1|CNS0A47D Arabidopsis thaliana Full-length cDNA Co... 76 2e-10
74ref|XM_503229.1| Yarrowia lipolytica CLIB122, YALI0D24387g predi... 72 3e-09
75emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB1... 72 3e-09
76ref|XM_952106.1| Neurospora crassa OR74A 60S RIBOSOMAL PROTEIN L... 70 1e-08
77ref|XM_328214.1| Neurospora crassa OR74A 60S RIBOSOMAL PROTEIN L... 70 1e-08
78emb|Z97341.2|ATFCA6 Arabidopsis thaliana DNA chromosome 4, ESSA ... 70 1e-08
79emb|AL669999.1|NCB21D9 Neurospora crassa DNA linkage group II BA... 70 1e-08
80emb|AL161544.2|ATCHRIV44 Arabidopsis thaliana DNA chromosome 4, ... 70 1e-08
81gb|AY850936.1| Pectinaria gouldii ribosomal protein L15 mRNA, co... 66 2e-07
82gb|AY111002.1| Zea mays CL3259_1 mRNA sequence 66 2e-07
83gb|AY857429.1| Suberites domuncula L15 mRNA, partial cds 62 3e-06
84ref|XM_381021.1| Gibberella zeae PH-1 chromosome 1 RL15_NEUCR 60... 60 1e-05
85emb|BX053479.1|CNS09DFF Single read from an extremity of a full-... 60 1e-05
86emb|BX072434.1|CNS09S1Y Single read from an extremity of a full-... 60 1e-05
87emb|BX072433.1|CNS09S1X Single read from an extremity of a full-... 60 1e-05
88emb|BX051216.1|CNS09BOK Single read from an extremity of a full-... 60 1e-05
89emb|BX047576.1|CNS098VG Single read from an extremity of a full-... 60 1e-05
90emb|BX047575.1|CNS098VF Single read from an extremity of a full-... 60 1e-05
91emb|BX037929.1|CNS091FH Single read from an extremity of a full-... 60 1e-05
92emb|BX037928.1|CNS091FG Single read from an extremity of a full-... 60 1e-05
93emb|BX033074.1|CNS08XOM Single read from an extremity of a full-... 60 1e-05
94emb|BX032977.1|CNS08XLX Single read from an extremity of a full-... 60 1e-05
95emb|BX032976.1|CNS08XLW Single read from an extremity of a full-... 60 1e-05
96emb|BX030496.1|CNS08VP0 Single read from an extremity of a full-... 60 1e-05
97emb|BX027332.1|CNS08T94 Single read from an extremity of a full-... 60 1e-05
98emb|BX026784.1|CNS08STW Single read from an extremity of a full-... 60 1e-05
99emb|BX026783.1|CNS08STV Single read from an extremity of a full-... 60 1e-05
100emb|BX026696.1|CNS08SRG Single read from an extremity of a full-... 60 1e-05
101emb|BX026695.1|CNS08SRF Single read from an extremity of a full-... 60 1e-05
102emb|BX025590.1|CNS08RWQ Single read from an extremity of a full-... 60 1e-05
103emb|BX025478.1|CNS08RTM Single read from an extremity of a full-... 60 1e-05
104emb|BX020533.1|CNS08O09 Single read from an extremity of a full-... 60 1e-05
105emb|BX018248.1|CNS08M8S Single read from an extremity of a full-... 60 1e-05
106emb|BX017046.1|CNS08LBE Single read from an extremity of a full-... 60 1e-05
107emb|BX016992.1|CNS08L9W Single read from an extremity of a full-... 60 1e-05
108emb|BX010475.1|CNS08G8V Single read from an extremity of a full-... 60 1e-05
109ref|XM_315009.2| Anopheles gambiae str. PEST ENSANGP00000021358 ... 60 1e-05
110ref|XM_557554.1| Anopheles gambiae str. PEST ENSANGP00000026442 ... 60 1e-05
111gb|AY249425.1| Siniperca kneri ribosomal protein L15 (rpl15) mRN... 58 4e-05
112gb|AY249417.1| Lateolabrax japonicus ribosomal protein L15 (rpl1... 58 4e-05
113gb|AE016819.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 58 4e-05
114ref|NM_211115.1| Eremothecium gossypii AFR214Cp (AFR214C), mRNA 58 4e-05
115gb|AY249416.1| Hypophthalmichthys molitrix ribosomal protein L15... 56 2e-04
116gb|U21746.1|BNU21746 Brassica napus ribosomal protein RL10 mRNA,... 56 2e-04
117emb|CR717031.2|CNS0GG7K Tetraodon nigroviridis full-length cDNA 54 6e-04
118ref|XM_341132.2| PREDICTED: Rattus norvegicus similar to chromos... 54 6e-04
119emb|BX052270.1|CNS09CHU Single read from an extremity of a full-... 52 0.003
120emb|BX052269.1|CNS09CHT Single read from an extremity of a full-... 52 0.003
121emb|Z69976.1|AGG5RIB6 A.gambiae mRNA for ribosomal protein RL10 52 0.003
122ref|XM_461011.1| Debaryomyces hansenii CBS767 hypothetical prote... 50 0.010
123gb|AF548318.1| Branchiostoma belcheri ribosomal protein L15 mRNA... 50 0.010
124gb|AY249420.1| Monopterus albus ribosomal protein L15 (rpl15) mR... 50 0.010
125emb|CR382138.1| Debaryomyces hansenii chromosome F of strain CBS... 50 0.010
126emb|AL116499.1|CNS01D8B Botrytis cinerea strain T4 cDNA library 50 0.010
127emb|AL114521.1|CNS01BPD Botrytis cinerea strain T4 cDNA library 50 0.010
128emb|AL111401.1|CNS019AP Botrytis cinerea strain T4 cDNA library 50 0.010
129gb|AC162614.2| Mus musculus chromosome 7, clone RP23-421O10, com... 48 0.039
130gb|AC108840.13| Mus musculus chromosome 1, clone RP23-348P7, com... 48 0.039
131gb|BC081441.1| Mus musculus ribosomal protein L15, mRNA (cDNA cl... 48 0.039
132gb|BC081442.1| Mus musculus ribosomal protein L15, mRNA (cDNA cl... 48 0.039
133gb|BC079842.1| Mus musculus ribosomal protein L15, mRNA (cDNA cl... 48 0.039
134ref|NM_025586.2| Mus musculus ribosomal protein L15 (Rpl15), mRNA 48 0.039
135gb|AC155314.2| Mus musculus BAC clone RP23-275G21 from chromosom... 48 0.039
136gb|AC164431.2| Mus musculus BAC clone RP23-430N15 from chromosom... 48 0.039
137gb|BC100335.1| Mus musculus ribosomal protein L15, mRNA (cDNA cl... 48 0.039
138gb|AC165079.2| Mus musculus BAC clone RP24-92K17 from chromosome... 48 0.039
139ref|XR_002583.1| PREDICTED: Mus musculus similar to ribosomal pr... 48 0.039
140ref|XM_909622.2| PREDICTED: Mus musculus similar to ribosomal pr... 48 0.039
141ref|XM_975199.1| PREDICTED: Mus musculus similar to ribosomal pr... 48 0.039
142ref|XM_357471.4| PREDICTED: Mus musculus similar to ribosomal pr... 48 0.039
143ref|XM_912278.2| PREDICTED: Mus musculus similar to ribosomal pr... 48 0.039
144gb|AC130212.4| Mus musculus BAC clone RP23-461L3 from chromosome... 48 0.039
145gb|BC087917.1| Mus musculus ribosomal protein L15, mRNA (cDNA cl... 48 0.039
146ref|NM_016989.1| Rattus norvegicus adenylate cyclase activating ... 48 0.039
147ref|XM_778953.1| PREDICTED: Strongylocentrotus purpuratus simila... 48 0.039
148gb|AY249421.1| Mylopharyngodon piceus ribosomal protein L15 (rpl... 48 0.039
149gb|AY249414.1| Ctenopharyngodon idella ribosomal protein L15 (rp... 48 0.039
150gb|AY249412.1| Aristichthys nobilis ribosomal protein L15 (rpl15... 48 0.039
151ref|XM_774933.1| PREDICTED: Strongylocentrotus purpuratus simila... 48 0.039
152ref|XM_796630.1| PREDICTED: Strongylocentrotus purpuratus simila... 48 0.039
153gb|AC162911.2| Mus musculus BAC clone RP24-363M14 from chromosom... 48 0.039
154gb|AC164004.3| Mus musculus chromosome 5, clone RP23-58C20, comp... 48 0.039
155gb|BC100561.1| Mus musculus ribosomal protein L15, mRNA (cDNA cl... 48 0.039
156emb|AL663115.11| Mouse DNA sequence from clone RP23-452C23 on ch... 48 0.039
157emb|AL031798.1|SPCC576 S.pombe chromosome III cosmid c576 48 0.039
158emb|AL663059.5| Mouse DNA sequence from clone RP23-331C1 on chro... 48 0.039
159dbj|AK152711.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 48 0.039
160dbj|AK159183.1| Mus musculus osteoclast-like cell cDNA, RIKEN fu... 48 0.039
161dbj|AK151138.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 48 0.039
162dbj|AK168807.1| Mus musculus 17 days embryo kidney cDNA, RIKEN f... 48 0.039
163dbj|AK169662.1| Mus musculus 2 days neonate thymus thymic cells ... 48 0.039
164dbj|AK159626.1| Mus musculus osteoclast-like cell cDNA, RIKEN fu... 48 0.039
165dbj|AK168125.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-... 48 0.039
166dbj|AK167996.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length... 48 0.039
167dbj|AK010931.1| Mus musculus 13 days embryo liver cDNA, RIKEN fu... 48 0.039
168dbj|AK010916.1| Mus musculus 13 days embryo liver cDNA, RIKEN fu... 48 0.039
169dbj|AK010674.1| Mus musculus ES cells cDNA, RIKEN full-length en... 48 0.039
170dbj|AK010319.1| Mus musculus ES cells cDNA, RIKEN full-length en... 48 0.039
171ref|NM_001023429.1| Schizosaccharomyces pombe 972h- hypothetical... 48 0.039
172dbj|AK019386.1| Mus musculus 12 days embryo head cDNA, RIKEN ful... 48 0.039
173dbj|AK012423.1| Mus musculus 11 days embryo whole body cDNA, RIK... 48 0.039
174dbj|AK002234.1| Mus musculus adult male kidney cDNA, RIKEN full-... 48 0.039
175dbj|AK012025.1| Mus musculus 10 days embryo whole body cDNA, RIK... 48 0.039
176ref|NM_139114.2| Rattus norvegicus ribosomal protein L15 (Rpl15)... 48 0.039
177gb|AF401570.1| Ictalurus punctatus ribosomal protein L15 mRNA, c... 48 0.039
178ref|XM_573353.1| PREDICTED: Rattus norvegicus similar to ribosom... 48 0.039
179ref|XM_578067.1| PREDICTED: Rattus norvegicus similar to 60S rib... 48 0.039
180dbj|AK186686.1| Mus musculus cDNA, clone:Y0G0138F10, strand:minu... 48 0.039
181gb|BC091735.1| Mus musculus ribosomal protein L15, mRNA (cDNA cl... 48 0.039
182gb|BC078724.1| Rattus norvegicus ribosomal protein L15, mRNA (cD... 48 0.039
183gb|AC102476.14| Mus musculus chromosome 5, clone RP24-396L12, co... 48 0.039
184emb|CT027556.11| Mouse DNA sequence from clone RP23-405M23 on ch... 48 0.039
185gb|AC153864.5| Mus musculus 10 BAC RP23-345N8 (Roswell Park Canc... 48 0.039
186gb|AC154579.3| Mus musculus BAC clone RP23-376B1 from chromosome... 48 0.039
187gb|AC159308.4| Mus musculus BAC clone RP23-187B11 from chromosom... 48 0.039
188gb|M63006.1|RATPACAP Rat pituitary adenylate cyclase activating ... 48 0.039
189gb|BC075894.1| Danio rerio zgc:92114, mRNA (cDNA clone MGC:92114... 46 0.16
190ref|NM_001003447.1| Danio rerio zgc:92114 (zgc:92114), mRNA 46 0.16
191emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete ... 46 0.16
192ref|XM_800323.1| Trypanosoma cruzi strain CL Brener ribosomal pr... 46 0.16
193ref|XM_809599.1| Trypanosoma cruzi strain CL Brener ribosomal pr... 46 0.16
194emb|CR734570.2|CNS0GTKP Tetraodon nigroviridis full-length cDNA 46 0.16
195emb|CR734567.2|CNS0GTKM Tetraodon nigroviridis full-length cDNA 46 0.16
196emb|CR733808.2|CNS0GSZJ Tetraodon nigroviridis full-length cDNA 46 0.16
197emb|CR711628.2|CNS0GC1K Tetraodon nigroviridis full-length cDNA 46 0.16
198emb|CR728168.2|CNS0GOSU Tetraodon nigroviridis full-length cDNA 46 0.16
199emb|CR720763.2|CNS0GJ35 Tetraodon nigroviridis full-length cDNA 46 0.16
200emb|CR719152.2|CNS0GHUE Tetraodon nigroviridis full-length cDNA 46 0.16
201emb|CR718902.2|CNS0GHNG Tetraodon nigroviridis full-length cDNA 46 0.16
202emb|CR718782.2|CNS0GHK4 Tetraodon nigroviridis full-length cDNA 46 0.16
203emb|CR718398.2|CNS0GH9G Tetraodon nigroviridis full-length cDNA 46 0.16
204emb|CR716858.2|CNS0GG2R Tetraodon nigroviridis full-length cDNA 46 0.16
205emb|CR714869.2|CNS0GEJL Tetraodon nigroviridis full-length cDNA 46 0.16
206emb|CR714305.2|CNS0GE3X Tetraodon nigroviridis full-length cDNA 46 0.16
207emb|CR713772.2|CNS0GDP4 Tetraodon nigroviridis full-length cDNA 46 0.16
208emb|CR712144.2|CNS0GCFW Tetraodon nigroviridis full-length cDNA 46 0.16
209emb|CR710759.2|CNS0GBDF Tetraodon nigroviridis full-length cDNA 46 0.16
210emb|CR710317.2|CNS0GB15 Tetraodon nigroviridis full-length cDNA 46 0.16
211emb|CR708878.2|CNS0G9X6 Tetraodon nigroviridis full-length cDNA 46 0.16
212emb|CR709040.2|CNS0GA1O Tetraodon nigroviridis full-length cDNA 46 0.16
213emb|CR707595.2|CNS0G8XJ Tetraodon nigroviridis full-length cDNA 46 0.16
214emb|CR707410.2|CNS0G8SE Tetraodon nigroviridis full-length cDNA 46 0.16
215emb|CR705983.2|CNS0G7OR Tetraodon nigroviridis full-length cDNA 46 0.16
216emb|CR705928.2|CNS0G7N8 Tetraodon nigroviridis full-length cDNA 46 0.16
217emb|CR705779.2|CNS0G7J3 Tetraodon nigroviridis full-length cDNA 46 0.16
218emb|CR704933.2|CNS0G6VL Tetraodon nigroviridis full-length cDNA 46 0.16
219emb|CR705198.2|CNS0G72Y Tetraodon nigroviridis full-length cDNA 46 0.16
220emb|CR703639.2|CNS0G5VN Tetraodon nigroviridis full-length cDNA 46 0.16
221emb|CR700763.2|CNS0G3NR Tetraodon nigroviridis full-length cDNA 46 0.16
222emb|CR699990.2|CNS0G32A Tetraodon nigroviridis full-length cDNA 46 0.16
223emb|CR691310.2|CNS0FWD6 Tetraodon nigroviridis full-length cDNA 46 0.16
224emb|CR691298.2|CNS0FWCU Tetraodon nigroviridis full-length cDNA 46 0.16
225emb|CR699239.2|CNS0G2HF Tetraodon nigroviridis full-length cDNA 46 0.16
226emb|CR699166.2|CNS0G2FE Tetraodon nigroviridis full-length cDNA 46 0.16
227emb|CR695796.2|CNS0FZTS Tetraodon nigroviridis full-length cDNA 46 0.16
228emb|CR693271.2|CNS0FXVN Tetraodon nigroviridis full-length cDNA 46 0.16
229emb|CR690989.2|CNS0FW49 Tetraodon nigroviridis full-length cDNA 46 0.16
230emb|CR685900.2|CNS0FS6W Tetraodon nigroviridis full-length cDNA 46 0.16
231emb|CR689623.2|CNS0FV2B Tetraodon nigroviridis full-length cDNA 46 0.16
232emb|CR689269.2|CNS0FUSH Tetraodon nigroviridis full-length cDNA 46 0.16
233emb|CR687161.2|CNS0FT5X Tetraodon nigroviridis full-length cDNA 46 0.16
234emb|CR685664.2|CNS0FS0C Tetraodon nigroviridis full-length cDNA 46 0.16
235emb|CR685351.2|CNS0FRRN Tetraodon nigroviridis full-length cDNA 46 0.16
236emb|CR684589.2|CNS0FR6H Tetraodon nigroviridis full-length cDNA 46 0.16
237emb|CR684547.2|CNS0FR5B Tetraodon nigroviridis full-length cDNA 46 0.16
238emb|CR684350.2|CNS0FQZU Tetraodon nigroviridis full-length cDNA 46 0.16
239emb|CR680312.2|CNS0FNVO Tetraodon nigroviridis full-length cDNA 46 0.16
240emb|CR679130.2|CNS0FMYU Tetraodon nigroviridis full-length cDNA 46 0.16
241emb|CR678082.2|CNS0FM5Z Tetraodon nigroviridis full-length cDNA 46 0.16
242emb|CR677103.2|CNS0FLEZ Tetraodon nigroviridis full-length cDNA 46 0.16
243emb|CR669366.2|CNS0FFGC Tetraodon nigroviridis full-length cDNA 46 0.16
244emb|CR669127.2|CNS0FF9P Tetraodon nigroviridis full-length cDNA 46 0.16
245emb|CR669121.2|CNS0FF9J Tetraodon nigroviridis full-length cDNA 46 0.16
246emb|CR668410.2|CNS0FEPS Tetraodon nigroviridis full-length cDNA 46 0.16
247emb|CR666986.2|CNS0FDM8 Tetraodon nigroviridis full-length cDNA 46 0.16
248emb|CR667078.2|CNS0FDOS Tetraodon nigroviridis full-length cDNA 46 0.16
249emb|CR666318.2|CNS0FD3O Tetraodon nigroviridis full-length cDNA 46 0.16
250emb|CR662640.2|CNS0FA9I Tetraodon nigroviridis full-length cDNA 46 0.16
251emb|CR662573.2|CNS0FA7N Tetraodon nigroviridis full-length cDNA 46 0.16
252emb|CR661005.2|CNS0F903 Tetraodon nigroviridis full-length cDNA 46 0.16
253emb|CR660094.2|CNS0F8AS Tetraodon nigroviridis full-length cDNA 46 0.16
254emb|CR659251.2|CNS0F7ND Tetraodon nigroviridis full-length cDNA 46 0.16
255emb|CR656801.2|CNS0F5RB Tetraodon nigroviridis full-length cDNA 46 0.16
256emb|CR655598.2|CNS0F4TW Tetraodon nigroviridis full-length cDNA 46 0.16
257emb|CR655120.2|CNS0F4GM Tetraodon nigroviridis full-length cDNA 46 0.16
258emb|CR653307.2|CNS0F329 Tetraodon nigroviridis full-length cDNA 46 0.16
259emb|CR653744.2|CNS0F3EE Tetraodon nigroviridis full-length cDNA 46 0.16
260emb|CR652573.2|CNS0F2HV Tetraodon nigroviridis full-length cDNA 46 0.16
261emb|CR648485.2|CNS0EZCB Tetraodon nigroviridis full-length cDNA 46 0.16
262emb|CR648437.2|CNS0EZAZ Tetraodon nigroviridis full-length cDNA 46 0.16
263emb|CR650271.2|CNS0F0PX Tetraodon nigroviridis full-length cDNA 46 0.16
264emb|CR649963.2|CNS0F0HD Tetraodon nigroviridis full-length cDNA 46 0.16
265emb|CR649859.2|CNS0F0EH Tetraodon nigroviridis full-length cDNA 46 0.16
266emb|CR648859.2|CNS0EZMP Tetraodon nigroviridis full-length cDNA 46 0.16
267emb|CR643269.2|CNS0EVBF Tetraodon nigroviridis full-length cDNA 46 0.16
268emb|CR646136.2|CNS0EXJ2 Tetraodon nigroviridis full-length cDNA 46 0.16
269emb|CR645141.2|CNS0EWRF Tetraodon nigroviridis full-length cDNA 46 0.16
270emb|CR643412.2|CNS0EVFE Tetraodon nigroviridis full-length cDNA 46 0.16
271emb|CR643348.2|CNS0EVDM Tetraodon nigroviridis full-length cDNA 46 0.16
272emb|CR642539.2|CNS0EUR5 Tetraodon nigroviridis full-length cDNA 46 0.16
273emb|CR642233.2|CNS0EUIN Tetraodon nigroviridis full-length cDNA 46 0.16
274emb|CR640915.2|CNS0ETI1 Tetraodon nigroviridis full-length cDNA 46 0.16
275emb|CR640867.2|CNS0ETGP Tetraodon nigroviridis full-length cDNA 46 0.16
276emb|CR639480.2|CNS0ESE6 Tetraodon nigroviridis full-length cDNA 46 0.16
277emb|CR636481.2|CNS0EQ2V Tetraodon nigroviridis full-length cDNA 46 0.16
278emb|CR634246.2|CNS0EOCS Tetraodon nigroviridis full-length cDNA 46 0.16
279emb|CR634241.2|CNS0EOCN Tetraodon nigroviridis full-length cDNA 46 0.16
280emb|CR634597.2|CNS0EOMJ Tetraodon nigroviridis full-length cDNA 46 0.16
281gb|AY249411.1| Anguilla japonica ribosomal protein L15 (rpl15) m... 46 0.16
282emb|BX927163.31| Zebrafish DNA sequence from clone DKEY-126A1 in... 46 0.16
283emb|CR938545.1| Single read from an extremity of a full-length c... 46 0.16
284emb|CR938171.1| Single read from an extremity of a full-length c... 46 0.16
285emb|CR938148.1| Single read from an extremity of a full-length c... 46 0.16
286dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, c... 46 0.16
287gb|AE011843.1| Xanthomonas axonopodis pv. citri str. 306, secti... 46 0.16
288gb|AY611064.1| Tsuga canadensis putative 60S ribosomal protein L... 46 0.16
289gb|AY130347.1| Branchiostoma lanceolatum ribosomal protein L15 m... 46 0.16
290gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete... 46 0.16
291gb|AC111100.13| Mus musculus chromosome 3, clone RP23-179J8, com... 44 0.61
292gb|AC124083.14| Mus musculus chromosome 5, clone RP24-400H4, com... 44 0.61
293ref|XR_003353.1| PREDICTED: Mus musculus similar to ribosomal pr... 44 0.61
294gb|AC131715.3| Mus musculus BAC clone RP23-180N22 from chromosom... 44 0.61
295gb|BT011039.1| Drosophila melanogaster LP10071 full insert cDNA 44 0.61
296gb|AC163108.5| Mus musculus BAC clone RP23-46L17 from chromosome... 44 0.61
297emb|CR812469.6| Zebrafish DNA sequence from clone DKEY-286F3 in ... 44 0.61
298emb|BX037811.1|CNS091C7 Single read from an extremity of a full-... 44 0.61
299emb|CR937760.1| Single read from an extremity of a cDNA clone ma... 44 0.61
300emb|AL731896.10| Mouse DNA sequence from clone RP23-348D11 on ch... 44 0.61
301gb|AY094841.1| Drosophila melanogaster RE01373 full insert cDNA 44 0.61
302ref|NM_067563.2| Caenorhabditis elegans Ribosomal Protein, Large... 44 0.61
303ref|NM_001015156.1| Drosophila melanogaster CG17420-PB.3 (CG1742... 44 0.61
304ref|NM_001015155.1| Drosophila melanogaster CG17420-PA.3 (CG1742... 44 0.61
305gb|AY130348.1| Myxine glutinosa ribosomal protein L15 mRNA, part... 44 0.61
306gb|U88168.1| Caenorhabditis elegans cosmid K11H12, complete sequ... 44 0.61
307gb|CP000192.1| Drosophila melanogaster genomic scaffold 21100002... 44 0.61
308gb|AF030251.1|AF030251 Drosophila melanogaster ribosomal L15 (YL... 44 0.61
309emb|AL833799.8| Mouse DNA sequence from clone RP23-26L11 on chro... 44 0.61
310gb|AC115846.7| Mus musculus chromosome 1, clone RP24-245O4, comp... 42 2.4
311gb|AC119943.12| Mus musculus chromosome 10, clone RP24-271F24, c... 42 2.4
312gb|AY563555.1| Epinephelus coioides ribosomal protein L15 (rpl15... 42 2.4
313ref|XM_916944.2| PREDICTED: Mus musculus similar to ribosomal pr... 42 2.4
314ref|XR_003904.1| PREDICTED: Mus musculus hypothetical protein LO... 42 2.4
315ref|XR_004852.1| PREDICTED: Mus musculus hypothetical protein LO... 42 2.4
316ref|XR_001938.1| PREDICTED: Mus musculus hypothetical protein LO... 42 2.4
317ref|XM_990577.1| PREDICTED: Mus musculus similar to ribosomal pr... 42 2.4
318ref|XM_001004374.1| PREDICTED: Mus musculus similar to ribosomal... 42 2.4
319gb|CP000353.1| Ralstonia metallidurans CH34 megaplasmid, complet... 42 2.4
320ref|XM_761725.1| Giardia lamblia ATCC 50803 60S ribosomal protei... 42 2.4
321ref|XM_661109.1| Cryptosporidium hominis TU502 60S ribosomal pro... 42 2.4
322emb|CR450812.5| Zebrafish DNA sequence from clone CH211-161H7, c... 42 2.4
323gb|AY249419.1| Paramisgurnus dabryanus ribosomal protein L15 (rp... 42 2.4
324gb|AY249418.1| Megalobrama amblycephala ribosomal protein L15 (r... 42 2.4
325gb|AY249410.1| Rana nigromaculata ribosomal protein L15 (rpl15) ... 42 2.4
326gb|AC091202.3| Drosophila melanogaster 3L BAC RP98-30A3 (Roswell... 42 2.4
327ref|XM_693309.1| PREDICTED: Danio rerio similar to Cystatin B (L... 42 2.4
328gb|AC159001.2| Mus musculus BAC clone RP24-221A23 from chromosom... 42 2.4
329gb|AC152074.3| Mus musculus BAC clone RP24-549B12 from chromosom... 42 2.4
330dbj|AK051961.1| Mus musculus 12 days embryo eyeball cDNA, RIKEN ... 42 2.4
331emb|AL111758.1|CNS019KM Botrytis cinerea strain T4 cDNA library 42 2.4
332gb|AC114783.5| Homo sapiens BAC clone RP11-600N14 from 2, comple... 42 2.4
333gb|AC021534.19| Homo sapiens chromosome 17, clone RP11-398J5, co... 42 2.4
334gb|AY130349.1| Petromyzon marinus ribosomal protein L15 mRNA, pa... 42 2.4
335ref|XM_574175.1| PREDICTED: Rattus norvegicus similar to ribosom... 42 2.4
336ref|XM_344285.2| PREDICTED: Rattus norvegicus similar to ribosom... 42 2.4
337gb|AC097449.3| Homo sapiens BAC clone CTD-2140E23 from 2, comple... 42 2.4
338emb|AL844842.29| Mouse DNA sequence from clone RP23-354G20 on ch... 42 2.4
339emb|BX005128.4| Zebrafish DNA sequence from clone CH211-129H14 i... 42 2.4
340dbj|AK058998.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.4
341emb|Z73201.1|SCYLR029C S.cerevisiae chromosome XII reading frame... 42 2.4
342gb|AE003563.4| Drosophila melanogaster chromosome 3L, section 22... 42 2.4
343gb|AC004349.1|AC004349 Drosophila melanogaster DNA sequence (P1 ... 42 2.4
344gb|AC120136.9| Mus musculus chromosome 1, clone RP23-277E3, comp... 42 2.4
345emb|AL670259.6| Mouse DNA sequence from clone RP23-321M16 on chr... 42 2.4
346dbj|D14675.1|YSCYL10A S.cerevisiae gene for ribosomal protein YL... 42 2.4
347ref|XM_633045.1| Dictyostelium discoideum hypothetical protein (... 40 9.6
348gb|AC146373.5| Pan troglodytes BAC clone RP43-60G24 from 7, comp... 40 9.6
349gb|AC146163.3| Pan troglodytes BAC clone RP43-24D16 from 7, comp... 40 9.6
350ref|XM_444915.1| Candida glabrata CBS138 hypothetical protein (C... 40 9.6
351gb|AC110789.6| Homo sapiens BAC clone RP11-516D7 from 4, complet... 40 9.6
352gb|AC004745.2| Homo sapiens BAC clone CTA-281B9 from 7, complete... 40 9.6
353emb|AL391358.14| Human DNA sequence from clone RP11-197B12 on ch... 40 9.6
354emb|AL031276.1|HS1118D24 Human DNA sequence from clone RP5-1118D... 40 9.6
355gb|AY249422.1| Misgurnus anguillicaudatus ribosomal protein L15 ... 40 9.6
356emb|CR380947.1| Candida glabrata strain CBS138 chromosome A comp... 40 9.6
357gb|AC138781.4| Homo sapiens BAC clone RP11-366H4 from 4, complet... 40 9.6
358gb|AC117661.20| Mus musculus chromosome 6, clone RP23-343P1, com... 40 9.6
359emb|AL606764.19| Mouse DNA sequence from clone RP23-412P21 on ch... 40 9.6
360gb|AF522322.1| Gadus morhua ribosomal protein L15 mRNA, partial cds 40 9.6
361gb|AE010202.1| Pyrococcus furiosus DSM 3638, section 77 of 173 o... 40 9.6
362gb|AC154542.2| Mus musculus BAC clone RP23-458O22 from chromosom... 40 9.6
363gb|AC102373.13| Mus musculus chromosome 3, clone RP23-263O17, co... 40 9.6
364gb|AC073254.6| Homo sapiens BAC clone RP11-176L22 from 2, comple... 40 9.6
365gb|AC133529.3| Homo sapiens BAC clone RP11-458M1 from 4, complet... 40 9.6
366gb|AF441167.1| Spodoptera frugiperda 60S ribosomal protein L15 m... 40 9.6
367gb|AC122362.5| Mus musculus BAC clone RP23-430N1 from chromosome... 40 9.6
368gb|AC174449.2| Mus musculus BAC clone RP23-338O19 from chromosom... 40 9.6
369emb|X78167.1|RNSDRPL15 R.norvegicus (Sprague Dawley) ribosomal p... 40 9.6
370dbj|AP001360.5| Homo sapiens genomic DNA, chromosome 11 clone:RP... 40 9.6
371emb|AL929095.13| Mouse DNA sequence from clone RP24-576M16 on ch... 40 9.6
372emb|AL732475.6| Mouse DNA sequence from clone RP23-202H24 on chr... 40 9.6
373gb|M17145.1|RCCICL4 Castor bean (R.communis) isocitrate lyase mR... 40 9.6

>gb|AY037163.1| Homo sapiens ribosomal protein L15 mRNA, complete cds
          Length = 821

 Score =  797 bits (402), Expect = 0.0
 Identities = 553/598 (92%), Gaps = 4/598 (0%)
 Strand = Plus / Minus

                                                                       
Query: 104 agcataggacaggttccacataacacaacagcaca-aagcttaacggtagcggcgaaggg 162
           ||||||||||||||||||||  ||| |||| |||  ||||||||||||||||||| ||||
Sbjct: 690 agcataggacaggttccacaggacataacaccacgtaagcttaacggtagcggcggaggg 631

                                                                       
Query: 163 agacagtctggttcctcttccaagtggctctccttgagggcctgttcttgtggtggcggt 222
           |||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 630 agacggtctggttcctcttccaggtggctctccttgagggcctgttcttgtggtggcggt 571

                                                                       
Query: 223 gacccttgccacgcagaccacggaacttctttccagctgaagtgagaccacgcagctcac 282
           ||||||||||||||||||||||||| |||||||| || || |||||||||||||||||||
Sbjct: 570 gacccttgccacgcagaccacggaatttctttcctgcagaggtgagaccacgcagctcac 511

                                                                       
Query: 283 ggtgcttatgcacaggcttgcagagccagttgatccttgggtcgttacggacagcactgt 342
           ||||||| |||||||||||||||||||||||||||||||| ||||| |||||||| ||||
Sbjct: 510 ggtgcttgtgcacaggcttgcagagccagttgatccttggatcgttgcggacagcgctgt 451

                                                                       
Query: 343 gtgcaacatcaacaaggatgacctcaaagtacttgtaggtagaatcctcattcacccagt 402
           | ||||||||||||||||||||||||||||||||||||||  | ||||||||||||||||
Sbjct: 450 gagcaacatcaacaaggatgacctcaaagtacttgtaggtgaagtcctcattcacccagt 391

                                                                       
Query: 403 aggagttgagcacacgaagaccaccaagcttgcgcccagctctttcctcagcaacagacc 462
           |||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 390 aggagttgaggacacgaagaccaccaagcctgcgcccagctctttcctcagcaacagacc 331

                                                                       
Query: 463 tcttgttcctttggaacttgagctgggtaatacccctggtgcttgggcttaccataaaca 522
           |||||||||| ||||||||||| ||||||||| ||||||||||||||||| |||||||||
Sbjct: 330 tcttgttcctctggaacttgagttgggtaata-ccctggtgcttgggcttgccataaaca 272

                                                                       
Query: 523 atacccttgggcacgggcctcttccggccaccacgcctgacacggatccggtagacaaca 582
           |||||||||||||| || | ||||| ||||||||| || |||||||| |||||||  |||
Sbjct: 271 atacccttgggcactgggcgcttcctgccaccacgtctcacacggatacggtagatcaca 212

                                                                       
Query: 583 tagccctgctttgccttgaatccgagacggcgtgccctgtcggggcgggtgggccctggt 642
           || ||||| || |||||||| |||||||||||||||||||||||||||||||| ||||||
Sbjct: 211 taaccctgtttggccttgaagccgagacggcgtgccctgtcggggcgggtggg-cctggt 153

                                                                     
Query: 643 gatgcgcacgatggccggctgcttgcctgtacttccagcaacgcacgcgctgcacgaa 700
           |||||| |||||||| |||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 152 gatgcggacgatggcgggctgc-tgcctgtactcccagcaacgcacgcgctgcacgaa 96



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 15  atagcaaatagtttaacagacatgcctgga 44
           ||||||||||||| ||||| ||||||||||
Sbjct: 767 atagcaaatagttcaacaggcatgcctgga 738



to top

>dbj|AB181483.1| Bromus inermis BiRP2 mRNA for ribosomal protein, complete cds
          Length = 878

 Score =  765 bits (386), Expect = 0.0
 Identities = 521/562 (92%), Gaps = 3/562 (0%)
 Strand = Plus / Minus

                                                                       
Query: 139 aagcttaacggtagcggcgaagggagacagtctggttcctcttccaagtggctctccttg 198
           |||||||||||||||| || |||||||| |||||||| | |||||| ||||||||||| |
Sbjct: 672 aagcttaacggtagcgacggagggagacggtctggttgcgcttccatgtggctctcctcg 613

                                                                       
Query: 199 agggcctgttcttgtggtggcggtgacccttgccacgcagaccacggaacttctttccag 258
           |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 612 agggcctgttcttgtggtggcggtgacccttgccgcgcagaccacggaacttctttccag 553

                                                                       
Query: 259 ctgaagtgagaccacgcagctcacggtgcttatgcacaggcttgcagagccagttgatcc 318
           |||| |||||||||||||||||||||||||| |||||||||||||| |||||||||||||
Sbjct: 552 ctgaggtgagaccacgcagctcacggtgcttgtgcacaggcttgcacagccagttgatcc 493

                                                                       
Query: 319 ttgggtcgttacggacagcactgtgtgcaacatcaacaaggatgacctcaaagtacttgt 378
           | ||||| || ||||| ||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 492 tcgggtcattgcggacggcattgtgtgcaacatcaacaaggatgacctcaaagtacttgt 433

                                                                       
Query: 379 aggtagaatcctcattcacccagtaggagttgagcacacgaagaccaccaagcttgcgcc 438
           ||||||| ||||||||||||||||||||||||||||||||||| ||||||||  ||||||
Sbjct: 432 aggtagagtcctcattcacccagtaggagttgagcacacgaagtccaccaagtctgcgcc 373

                                                                       
Query: 439 cagctctttcctcagcaacagacctcttgttcctttggaacttgagctgggtaatacccc 498
           |||||||||| ||||||||||||||||||||||| ||||||||||||||||| ||| |||
Sbjct: 372 cagctctttcttcagcaacagacctcttgttcctctggaacttgagctgggtgata-ccc 314

                                                                       
Query: 499 tggtgcttgggcttaccataaacaatacccttgggcacgggcctcttccggccaccacgc 558
           |||||||| ||||||||||| || |||||||||||||| |||||||||| ||||||||||
Sbjct: 313 tggtgctttggcttaccatagacgatacccttgggcactggcctcttcctgccaccacgc 254

                                                                       
Query: 559 ctgacacggatccggtagacaacatagccctgctttgccttgaatccgagacggcgtgcc 618
           ||||||||||| |||||||| ||||| |||||||| |||||||| ||||||||||| |||
Sbjct: 253 ctgacacggatacggtagaccacataaccctgcttggccttgaagccgagacggcgagcc 194

                                                                       
Query: 619 ctgtcggggcgggtgggccctggtgatgcgcacgatggccggctgcttgcctgtacttcc 678
           ||||||||||||||||| ||||||||||||||||||||| |||||| |||||||||| ||
Sbjct: 193 ctgtcggggcgggtggg-cctggtgatgcgcacgatggcgggctgc-tgcctgtactccc 136

                                 
Query: 679 agcaacgcacgcgctgcacgaa 700
           |||| ||||||||||| |||||
Sbjct: 135 agcagcgcacgcgctggacgaa 114



to top

>ref|NM_184952.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 874

 Score =  531 bits (268), Expect = e-147
 Identities = 490/560 (87%), Gaps = 3/560 (0%)
 Strand = Plus / Minus

                                                                       
Query: 141 gcttaacggtagcggcgaagggagacagtctggttcctcttccaagtggctctccttgag 200
           |||||||| || |||||||| |||||||||||||| | |||||| || || || |  || 
Sbjct: 662 gcttaacgataacggcgaagagagacagtctggttgcgcttccaggtagccctgcgggac 603

                                                                       
Query: 201 ggcctgttcttgtggtggcggtgacccttgccacgcagaccacggaacttctttccagct 260
           ||||||  |||||||||   |||||||||||| |||||||||||| ||||||| ||||| 
Sbjct: 602 ggcctggccttgtggtgagtgtgacccttgccgcgcagaccacggtacttcttgccagca 543

                                                                       
Query: 261 gaagtgagaccacgcagctcacggtgcttatgcacaggcttgcagagccagttgatcctt 320
           || ||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 542 gaggtgagaccacggagctcacggtgcttgtgcacaggcttgcagagccagttgatcctt 483

                                                                       
Query: 321 gggtcgttacggacagcactgtgtgcaacatcaacaaggatgacctcaaagtacttgtag 380
           ||||| || |||| ||||||||| |||||||| |||||||||| ||||||||||||||||
Sbjct: 482 gggtcattgcggatagcactgtgagcaacatccacaaggatgatctcaaagtacttgtag 423

                                                                       
Query: 381 gtagaatcctcattcacccagtaggagttgagcacacgaagaccaccaagcttgcgccca 440
           || || ||||| ||||||||||||||||||||||| |  || || || | ||||||||||
Sbjct: 422 gtggagtcctcgttcacccagtaggagttgagcaccctgagtccgcccaacttgcgccca 363

                                                                       
Query: 441 gctctttcctcagcaacagacctcttgttcctttggaacttgagctgggtaatacccctg 500
           ||||| ||||||||||| |||||||||||||| ||||||||||||||||| ||| |||||
Sbjct: 362 gctctctcctcagcaactgacctcttgttcctctggaacttgagctgggtgata-ccctg 304

                                                                       
Query: 501 gtgcttgggcttaccataaacaatacccttgggcacgggcctcttccggccaccacgcct 560
           |||||||||||| || || ||||||||||||||||| |||||||||| ||||||||||||
Sbjct: 303 gtgcttgggcttgccgtagacaatacccttgggcactggcctcttcctgccaccacgcct 244

                                                                       
Query: 561 gacacggatccggtagacaacatagccctgctttgccttgaatccgagacggcgtgccct 620
            |||||||  ||||| || ||||| |||||||| |||||| | ||||| ||||| ||| |
Sbjct: 243 cacacggacacggtaaaccacataaccctgcttggccttgtagccgaggcggcgggcctt 184

                                                                       
Query: 621 gtcggggcgggtgggccctggtgatgcgcacgatggccggctgcttgcctgtacttccag 680
           |||||||||||||||  | ||||| ||| ||||||||||||||| |||||||||| ||||
Sbjct: 183 gtcggggcgggtggg-gcgggtgaggcggacgatggccggctgc-tgcctgtactcccag 126

                               
Query: 681 caacgcacgcgctgcacgaa 700
           || |||||||||||||||||
Sbjct: 125 caccgcacgcgctgcacgaa 106



to top

>dbj|AK121762.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033090F15, full
           insert sequence
          Length = 906

 Score =  531 bits (268), Expect = e-147
 Identities = 490/560 (87%), Gaps = 3/560 (0%)
 Strand = Plus / Minus

                                                                       
Query: 141 gcttaacggtagcggcgaagggagacagtctggttcctcttccaagtggctctccttgag 200
           |||||||| || |||||||| |||||||||||||| | |||||| || || || |  || 
Sbjct: 685 gcttaacgataacggcgaagagagacagtctggttgcgcttccaggtagccctgcgggac 626

                                                                       
Query: 201 ggcctgttcttgtggtggcggtgacccttgccacgcagaccacggaacttctttccagct 260
           ||||||  |||||||||   |||||||||||| |||||||||||| ||||||| ||||| 
Sbjct: 625 ggcctggccttgtggtgagtgtgacccttgccgcgcagaccacggtacttcttgccagca 566

                                                                       
Query: 261 gaagtgagaccacgcagctcacggtgcttatgcacaggcttgcagagccagttgatcctt 320
           || ||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 565 gaggtgagaccacggagctcacggtgcttgtgcacaggcttgcagagccagttgatcctt 506

                                                                       
Query: 321 gggtcgttacggacagcactgtgtgcaacatcaacaaggatgacctcaaagtacttgtag 380
           ||||| || |||| ||||||||| |||||||| |||||||||| ||||||||||||||||
Sbjct: 505 gggtcattgcggatagcactgtgagcaacatccacaaggatgatctcaaagtacttgtag 446

                                                                       
Query: 381 gtagaatcctcattcacccagtaggagttgagcacacgaagaccaccaagcttgcgccca 440
           || || ||||| ||||||||||||||||||||||| |  || || || | ||||||||||
Sbjct: 445 gtggagtcctcgttcacccagtaggagttgagcaccctgagtccgcccaacttgcgccca 386

                                                                       
Query: 441 gctctttcctcagcaacagacctcttgttcctttggaacttgagctgggtaatacccctg 500
           ||||| ||||||||||| |||||||||||||| ||||||||||||||||| ||| |||||
Sbjct: 385 gctctctcctcagcaactgacctcttgttcctctggaacttgagctgggtgata-ccctg 327

                                                                       
Query: 501 gtgcttgggcttaccataaacaatacccttgggcacgggcctcttccggccaccacgcct 560
           |||||||||||| || || ||||||||||||||||| |||||||||| ||||||||||||
Sbjct: 326 gtgcttgggcttgccgtagacaatacccttgggcactggcctcttcctgccaccacgcct 267

                                                                       
Query: 561 gacacggatccggtagacaacatagccctgctttgccttgaatccgagacggcgtgccct 620
            |||||||  ||||| || ||||| |||||||| |||||| | ||||| ||||| ||| |
Sbjct: 266 cacacggacacggtaaaccacataaccctgcttggccttgtagccgaggcggcgggcctt 207

                                                                       
Query: 621 gtcggggcgggtgggccctggtgatgcgcacgatggccggctgcttgcctgtacttccag 680
           |||||||||||||||  | ||||| ||| ||||||||||||||| |||||||||| ||||
Sbjct: 206 gtcggggcgggtggg-gcgggtgaggcggacgatggccggctgc-tgcctgtactcccag 149

                               
Query: 681 caacgcacgcgctgcacgaa 700
           || |||||||||||||||||
Sbjct: 148 caccgcacgcgctgcacgaa 129



to top

>dbj|AK104774.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-B07, full
           insert sequence
          Length = 886

 Score =  531 bits (268), Expect = e-147
 Identities = 490/560 (87%), Gaps = 3/560 (0%)
 Strand = Plus / Minus

                                                                       
Query: 141 gcttaacggtagcggcgaagggagacagtctggttcctcttccaagtggctctccttgag 200
           |||||||| || |||||||| |||||||||||||| | |||||| || || || |  || 
Sbjct: 685 gcttaacgataacggcgaagagagacagtctggttgcgcttccaggtagccctgcgggac 626

                                                                       
Query: 201 ggcctgttcttgtggtggcggtgacccttgccacgcagaccacggaacttctttccagct 260
           ||||||  |||||||||   |||||||||||| |||||||||||| ||||||| ||||| 
Sbjct: 625 ggcctggccttgtggtgagtgtgacccttgccgcgcagaccacggtacttcttgccagca 566

                                                                       
Query: 261 gaagtgagaccacgcagctcacggtgcttatgcacaggcttgcagagccagttgatcctt 320
           || ||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 565 gaggtgagaccacggagctcacggtgcttgtgcacaggcttgcagagccagttgatcctt 506

                                                                       
Query: 321 gggtcgttacggacagcactgtgtgcaacatcaacaaggatgacctcaaagtacttgtag 380
           ||||| || |||| ||||||||| |||||||| |||||||||| ||||||||||||||||
Sbjct: 505 gggtcattgcggatagcactgtgagcaacatccacaaggatgatctcaaagtacttgtag 446

                                                                       
Query: 381 gtagaatcctcattcacccagtaggagttgagcacacgaagaccaccaagcttgcgccca 440
           || || ||||| ||||||||||||||||||||||| |  || || || | ||||||||||
Sbjct: 445 gtggagtcctcgttcacccagtaggagttgagcaccctgagtccgcccaacttgcgccca 386

                                                                       
Query: 441 gctctttcctcagcaacagacctcttgttcctttggaacttgagctgggtaatacccctg 500
           ||||| ||||||||||| |||||||||||||| ||||||||||||||||| ||| |||||
Sbjct: 385 gctctctcctcagcaactgacctcttgttcctctggaacttgagctgggtgata-ccctg 327

                                                                       
Query: 501 gtgcttgggcttaccataaacaatacccttgggcacgggcctcttccggccaccacgcct 560
           |||||||||||| || || ||||||||||||||||| |||||||||| ||||||||||||
Sbjct: 326 gtgcttgggcttgccgtagacaatacccttgggcactggcctcttcctgccaccacgcct 267

                                                                       
Query: 561 gacacggatccggtagacaacatagccctgctttgccttgaatccgagacggcgtgccct 620
            |||||||  ||||| || ||||| |||||||| |||||| | ||||| ||||| ||| |
Sbjct: 266 cacacggacacggtaaaccacataaccctgcttggccttgtagccgaggcggcgggcctt 207

                                                                       
Query: 621 gtcggggcgggtgggccctggtgatgcgcacgatggccggctgcttgcctgtacttccag 680
           |||||||||||||||  | ||||| ||| ||||||||||||||| |||||||||| ||||
Sbjct: 206 gtcggggcgggtggg-gcgggtgaggcggacgatggccggctgc-tgcctgtactcccag 149

                               
Query: 681 caacgcacgcgctgcacgaa 700
           || |||||||||||||||||
Sbjct: 148 caccgcacgcgctgcacgaa 129



to top

>dbj|AK060928.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-201-A06, full
           insert sequence
          Length = 886

 Score =  531 bits (268), Expect = e-147
 Identities = 490/560 (87%), Gaps = 3/560 (0%)
 Strand = Plus / Minus

                                                                       
Query: 141 gcttaacggtagcggcgaagggagacagtctggttcctcttccaagtggctctccttgag 200
           |||||||| || |||||||| |||||||||||||| | |||||| || || || |  || 
Sbjct: 685 gcttaacgataacggcgaagagagacagtctggttgcgcttccaggtagccctgcgggac 626

                                                                       
Query: 201 ggcctgttcttgtggtggcggtgacccttgccacgcagaccacggaacttctttccagct 260
           ||||||  |||||||||   |||||||||||| |||||||||||| ||||||| ||||| 
Sbjct: 625 ggcctggccttgtggtgagtgtgacccttgccgcgcagaccacggtacttcttgccagca 566

                                                                       
Query: 261 gaagtgagaccacgcagctcacggtgcttatgcacaggcttgcagagccagttgatcctt 320
           || ||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 565 gaggtgagaccacggagctcacggtgcttgtgcacaggcttgcagagccagttgatcctt 506

                                                                       
Query: 321 gggtcgttacggacagcactgtgtgcaacatcaacaaggatgacctcaaagtacttgtag 380
           ||||| || |||| ||||||||| |||||||| |||||||||| ||||||||||||||||
Sbjct: 505 gggtcattgcggatagcactgtgagcaacatccacaaggatgatctcaaagtacttgtag 446

                                                                       
Query: 381 gtagaatcctcattcacccagtaggagttgagcacacgaagaccaccaagcttgcgccca 440
           || || ||||| ||||||||||||||||||||||| |  || || || | ||||||||||
Sbjct: 445 gtggagtcctcgttcacccagtaggagttgagcaccctgagtccgcccaacttgcgccca 386

                                                                       
Query: 441 gctctttcctcagcaacagacctcttgttcctttggaacttgagctgggtaatacccctg 500
           ||||| ||||||||||| |||||||||||||| ||||||||||||||||| ||| |||||
Sbjct: 385 gctctctcctcagcaactgacctcttgttcctctggaacttgagctgggtgata-ccctg 327

                                                                       
Query: 501 gtgcttgggcttaccataaacaatacccttgggcacgggcctcttccggccaccacgcct 560
           |||||||||||| || || ||||||||||||||||| |||||||||| ||||||||||||
Sbjct: 326 gtgcttgggcttgccgtagacaatacccttgggcactggcctcttcctgccaccacgcct 267

                                                                       
Query: 561 gacacggatccggtagacaacatagccctgctttgccttgaatccgagacggcgtgccct 620
            |||||||  ||||| || ||||| |||||||| |||||| | ||||| ||||| ||| |
Sbjct: 266 cacacggacacggtaaaccacataaccctgcttggccttgtagccgaggcggcgggcctt 207

                                                                       
Query: 621 gtcggggcgggtgggccctggtgatgcgcacgatggccggctgcttgcctgtacttccag 680
           |||||||||||||||  | ||||| ||| ||||||||||||||| |||||||||| ||||
Sbjct: 206 gtcggggcgggtggg-gcgggtgaggcggacgatggccggctgc-tgcctgtactcccag 149

                               
Query: 681 caacgcacgcgctgcacgaa 700
           || |||||||||||||||||
Sbjct: 148 caccgcacgcgctgcacgaa 129



to top

>dbj|AK066806.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013079I04, full
           insert sequence
          Length = 811

 Score =  523 bits (264), Expect = e-145
 Identities = 489/560 (87%), Gaps = 3/560 (0%)
 Strand = Plus / Minus

                                                                       
Query: 141 gcttaacggtagcggcgaagggagacagtctggttcctcttccaagtggctctccttgag 200
           |||||||| || |||||||| |||||||||||||| | |||||| || || || |  || 
Sbjct: 635 gcttaacgataacggcgaagagagacagtctggttgcgcttccaggtagccctgcgggac 576

                                                                       
Query: 201 ggcctgttcttgtggtggcggtgacccttgccacgcagaccacggaacttctttccagct 260
           ||||||  |||||||||   |||||||||||| |||||||||||| ||||||| ||||| 
Sbjct: 575 ggcctggccttgtggtgagtgtgacccttgccgcgcagaccacggtacttcttgccagca 516

                                                                       
Query: 261 gaagtgagaccacgcagctcacggtgcttatgcacaggcttgcagagccagttgatcctt 320
           || ||||||||||| |||||| ||||||| ||||||||||||||||||||||||||||||
Sbjct: 515 gaggtgagaccacggagctcatggtgcttgtgcacaggcttgcagagccagttgatcctt 456

                                                                       
Query: 321 gggtcgttacggacagcactgtgtgcaacatcaacaaggatgacctcaaagtacttgtag 380
           ||||| || |||| ||||||||| |||||||| |||||||||| ||||||||||||||||
Sbjct: 455 gggtcattgcggatagcactgtgagcaacatccacaaggatgatctcaaagtacttgtag 396

                                                                       
Query: 381 gtagaatcctcattcacccagtaggagttgagcacacgaagaccaccaagcttgcgccca 440
           || || ||||| ||||||||||||||||||||||| |  || || || | ||||||||||
Sbjct: 395 gtggagtcctcgttcacccagtaggagttgagcaccctgagtccgcccaacttgcgccca 336

                                                                       
Query: 441 gctctttcctcagcaacagacctcttgttcctttggaacttgagctgggtaatacccctg 500
           ||||| ||||||||||| |||||||||||||| ||||||||||||||||| ||| |||||
Sbjct: 335 gctctctcctcagcaactgacctcttgttcctctggaacttgagctgggtgata-ccctg 277

                                                                       
Query: 501 gtgcttgggcttaccataaacaatacccttgggcacgggcctcttccggccaccacgcct 560
           |||||||||||| || || ||||||||||||||||| |||||||||| ||||||||||||
Sbjct: 276 gtgcttgggcttgccgtagacaatacccttgggcactggcctcttcctgccaccacgcct 217

                                                                       
Query: 561 gacacggatccggtagacaacatagccctgctttgccttgaatccgagacggcgtgccct 620
            |||||||  ||||| || ||||| |||||||| |||||| | ||||| ||||| ||| |
Sbjct: 216 cacacggacacggtaaaccacataaccctgcttggccttgtagccgaggcggcgggcctt 157

                                                                       
Query: 621 gtcggggcgggtgggccctggtgatgcgcacgatggccggctgcttgcctgtacttccag 680
           |||||||||||||||  | ||||| ||| ||||||||||||||| |||||||||| ||||
Sbjct: 156 gtcggggcgggtggg-gcgggtgaggcggacgatggccggctgc-tgcctgtactcccag 99

                               
Query: 681 caacgcacgcgctgcacgaa 700
           || |||||||||||||||||
Sbjct: 98  caccgcacgcgctgcacgaa 79



to top

>gb|BT016488.1| Zea mays clone Contig321 mRNA sequence
          Length = 924

 Score =  519 bits (262), Expect = e-144
 Identities = 484/554 (87%), Gaps = 3/554 (0%)
 Strand = Plus / Minus

                                                                       
Query: 147 cggtagcggcgaagggagacagtctggttcctcttccaagtggctctccttgagggcctg 206
           ||||||||||| |||||||  |||||||| | |||||| |||||||||||||||||||||
Sbjct: 673 cggtagcggcggagggagagggtctggttgcgcttccaggtggctctccttgagggcctg 614

                                                                       
Query: 207 ttcttgtggtggcggtgacccttgccacgcagaccacggaacttctttccagctgaagtg 266
           ||||||||||||  ||| |||||||||||||| |||||| ||||||| || ||||| |||
Sbjct: 613 ttcttgtggtgggtgtggcccttgccacgcaggccacggtacttcttgcctgctgaggtg 554

                                                                       
Query: 267 agaccacgcagctcacggtgcttatgcacaggcttgcagagccagttgatccttgggtcg 326
           || ||||| |||||||||||||| |||||||| ||||| |||||||||||||| ||||||
Sbjct: 553 aggccacggagctcacggtgcttgtgcacagggttgcatagccagttgatcctcgggtcg 494

                                                                       
Query: 327 ttacggacagcactgtgtgcaacatcaacaaggatgacctcaaagtacttgtaggtagaa 386
            |   ||  ||  |||| ||||| || |||||||||| |||||||||||||||||||  |
Sbjct: 493 gttttgatggctttgtgggcaacgtccacaaggatgatctcaaagtacttgtaggtacta 434

                                                                       
Query: 387 tcctcattcacccagtaggagttgagcacacgaagaccaccaagcttgcgcccagctctt 446
           ||||||||||||||||||||||| || || |  || ||||||||||| || |||||||| 
Sbjct: 433 tcctcattcacccagtaggagttaagaaccctcagtccaccaagcttacgtccagctctc 374

                                                                       
Query: 447 tcctcagcaacagacctcttgttcctttggaacttgagctgggtaatacccctggtgctt 506
           |||||||| ||||||||||||||||| ||||||||||||||||| ||| |||||||||||
Sbjct: 373 tcctcagcgacagacctcttgttcctctggaacttgagctgggtgata-ccctggtgctt 315

                                                                       
Query: 507 gggcttaccataaacaatacccttgggcacgggcctcttccggccaccacgcctgacacg 566
           |||||| ||||| ||||||||||||||||| |||||||||| |||||||||| | |||||
Sbjct: 314 gggcttgccatagacaatacccttgggcacaggcctcttcctgccaccacgcttcacacg 255

                                                                       
Query: 567 gatccggtagacaacatagccctgctttgccttgaatccgagacggcgtgccctgtcggg 626
           ||  |||||||||||||| |||||||| |||||| | |||||||| || ||| |||||||
Sbjct: 254 gacacggtagacaacatatccctgcttggccttgtagccgagacgacgggccttgtcggg 195

                                                                       
Query: 627 gcgggtgggccctggtgatgcgcacgatggccggctgcttgcctgtacttccagcaacgc 686
           ||||||||| |||||||| ||| ||||||| ||||||| |||||||| | |||||| |||
Sbjct: 194 gcgggtggg-cctggtgaggcggacgatggacggctgc-tgcctgtagtcccagcagcgc 137

                         
Query: 687 acgcgctgcacgaa 700
           ||||||||||||||
Sbjct: 136 acgcgctgcacgaa 123



to top

>gb|BT016564.1| Zea mays clone Contig397 mRNA sequence
          Length = 807

 Score =  492 bits (248), Expect = e-136
 Identities = 482/556 (86%), Gaps = 3/556 (0%)
 Strand = Plus / Minus

                                                                       
Query: 145 aacggtagcggcgaagggagacagtctggttcctcttccaagtggctctccttgagggcc 204
           ||||||||||||| ||||| |  |||||||| | |||||| ||||| ||||| || ||||
Sbjct: 655 aacggtagcggcggagggacagggtctggttgcgcttccaggtggccctcctggacggcc 596

                                                                       
Query: 205 tgttcttgtggtggcggtgacccttgccacgcagaccacggaacttctttccagctgaag 264
           |||||||||||||   ||| |||||||||||||| |||||||||||||| || || || |
Sbjct: 595 tgttcttgtggtgagtgtggcccttgccacgcaggccacggaacttcttgcctgcagagg 536

                                                                       
Query: 265 tgagaccacgcagctcacggtgcttatgcacaggcttgcagagccagttgatccttgggt 324
           |||||||||| |||||||||||||| |||||||| ||||| ||||||||||| |||||||
Sbjct: 535 tgagaccacggagctcacggtgcttgtgcacaggattgcatagccagttgattcttgggt 476

                                                                       
Query: 325 cgttacggacagcactgtgtgcaacatcaacaaggatgacctcaaagtacttgtaggtag 384
           |||| ||||  ||  |||| || |||||||| ||||||| ||| ||||||||||||||  
Sbjct: 475 cgttgcggatggcggtgtgggccacatcaaccaggatgatctcgaagtacttgtaggtgc 416

                                                                       
Query: 385 aatcctcattcacccagtaggagttgagcacacgaagaccaccaagcttgcgcccagctc 444
            ||||||||||||||||||||||||||| || |  || ||||||||||| || ||||| |
Sbjct: 415 tatcctcattcacccagtaggagttgagaaccctgagtccaccaagctttcgtccagccc 356

                                                                       
Query: 445 tttcctcagcaacagacctcttgttcctttggaacttgagctgggtaatacccctggtgc 504
           |||||||||||||||| ||||||||||| ||||||||||||||||| ||| |||||||||
Sbjct: 355 tttcctcagcaacagatctcttgttcctctggaacttgagctgggtgata-ccctggtgc 297

                                                                       
Query: 505 ttgggcttaccataaacaatacccttgggcacgggcctcttccggccaccacgcctgaca 564
           |||||||| ||||| ||||||||||| ||||| |||||||||| ||| |||||| |||||
Sbjct: 296 ttgggcttgccatagacaatacccttcggcacaggcctcttcctgccgccacgcttgaca 237

                                                                       
Query: 565 cggatccggtagacaacatagccctgctttgccttgaatccgagacggcgtgccctgtcg 624
           ||||  ||||| |||||||| |||||||| |||||| | ||||| ||||| ||| |||||
Sbjct: 236 cggacgcggtaaacaacatacccctgcttggccttgtagccgaggcggcgggccttgtcg 177

                                                                       
Query: 625 gggcgggtgggccctggtgatgcgcacgatggccggctgcttgcctgtacttccagcaac 684
           ||||||||||| ||| |||| ||| ||||||||||||||| |||||||||| |||||| |
Sbjct: 176 gggcgggtggg-ccttgtgaggcggacgatggccggctgc-tgcctgtactcccagcagc 119

                           
Query: 685 gcacgcgctgcacgaa 700
           ||||||| ||||||||
Sbjct: 118 gcacgcgttgcacgaa 103



to top

>gb|AY109334.1| Zea mays CL3259_2 mRNA sequence
          Length = 1585

 Score =  466 bits (235), Expect = e-128
 Identities = 410/467 (87%), Gaps = 1/467 (0%)
 Strand = Plus / Plus

                                                                        
Query: 145  aacggtagcggcgaagggagacagtctggttcctcttccaagtggctctccttgagggcc 204
            ||||||||||||| ||||| |  |||||||| | |||||| ||||| ||||| || ||||
Sbjct: 933  aacggtagcggcggagggacagggtctggttgcgcttccaggtggccctcctcgacggcc 992

                                                                        
Query: 205  tgttcttgtggtggcggtgacccttgccacgcagaccacggaacttctttccagctgaag 264
            |||||||||||||   ||| |||||||||||||| |||||||||||||| || || || |
Sbjct: 993  tgttcttgtggtgagtgtggcccttgccacgcaggccacggaacttcttgcctgcagagg 1052

                                                                        
Query: 265  tgagaccacgcagctcacggtgcttatgcacaggcttgcagagccagttgatccttgggt 324
            |||||||||| |||||||||||||| |||||||| ||||| |||||||||||||||||||
Sbjct: 1053 tgagaccacggagctcacggtgcttgtgcacaggattgcatagccagttgatccttgggt 1112

                                                                        
Query: 325  cgttacggacagcactgtgtgcaacatcaacaaggatgacctcaaagtacttgtaggtag 384
            |||| ||||  ||| |||| || |||||||||||||||| ||||||||||||||||||  
Sbjct: 1113 cgttgcggatggcagtgtgggccacatcaacaaggatgatctcaaagtacttgtaggtgc 1172

                                                                        
Query: 385  aatcctcattcacccagtaggagttgagcacacgaagaccaccaagcttgcgcccagctc 444
             ||||||||||||||||||||||||||| || |  || ||||||||||| || ||||| |
Sbjct: 1173 tatcctcattcacccagtaggagttgagaaccctgagtccaccaagctttcgtccagccc 1232

                                                                        
Query: 445  tttcctcagcaacagacctcttgttcctttggaacttgagctgggtaatacccctggtgc 504
            | |||||||||||||||||||||||||| ||||||||||||||||| ||| |||||||||
Sbjct: 1233 tctcctcagcaacagacctcttgttcctctggaacttgagctgggtgata-ccctggtgc 1291

                                                                        
Query: 505  ttgggcttaccataaacaatacccttgggcacgggcctcttccggccaccacgcctgaca 564
            |||||||| ||||| ||||||||||| ||||| |||||||||| |||||||||||| |||
Sbjct: 1292 ttgggcttgccatagacaatacccttcggcacaggcctcttcctgccaccacgcctcaca 1351

                                                           
Query: 565  cggatccggtagacaacatagccctgctttgccttgaatccgagacg 611
            ||||  ||||| |||||||| |||||||| |||||||| ||||||||
Sbjct: 1352 cggacacggtaaacaacatacccctgcttggccttgaagccgagacg 1398



 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 54/60 (90%), Gaps = 1/60 (1%)
 Strand = Plus / Plus

                                                                        
Query: 641  gtgatgcgcacgatggccggctgcttgcctgtacttccagcaacgcacgcgctgcacgaa 700
            |||| ||| ||||||||||||||| |||||||||| |||||| |||||||| ||||||||
Sbjct: 1427 gtgaggcggacgatggccggctgc-tgcctgtactcccagcagcgcacgcgttgcacgaa 1485



to top

>gb|AF457938.1| Zea mays clone cho1c.pk002.b21, mRNA sequence
          Length = 522

 Score =  319 bits (161), Expect = 7e-84
 Identities = 358/417 (85%), Gaps = 5/417 (1%)
 Strand = Plus / Minus

                                                                       
Query: 285 tgcttatgcacaggcttgcagagccagttgatccttggg-tcgttacggacagcactgtg 343
           ||||| |||||||| ||||| ||||||||||||||| |  || || ||||  | | ||||
Sbjct: 507 tgcttgtgcacaggattgcatagccagttgatcctttgaatcattgcggatggtagtgtg 448

                                                                       
Query: 344 tgcaacatcaacaaggatgacctcaaagtacttgtaggtagaatcctcattcacccagta 403
            || ||||||||||| || | ||||||||||||||||||   ||||||||||||||||||
Sbjct: 447 ggccacatcaacaagaat-atctcaaagtacttgtaggtgctatcctcattcacccagta 389

                                                                       
Query: 404 ggagttgagcacacgaagaccaccaagcttgcgcccagctctttcctcagcaacagacct 463
           ||||||||| || |  || ||||||||||| || ||||| || |||||||||||||||||
Sbjct: 388 ggagttgagaaccctgagtccaccaagctttcgtccagccctctcctcagcaacagacct 329

                                                                       
Query: 464 cttgttcctttggaacttgagctgggtaatacccctggtgcttgggcttaccataaacaa 523
           ||||||||| ||||||||||||||||| ||| ||||||||||| ||||| ||||| ||||
Sbjct: 328 cttgttcctctggaacttgagctgggtgata-ccctggtgctttggcttgccatagacaa 270

                                                                       
Query: 524 tacccttgggcacgggcctcttccggccaccacgcctgacacggatccggtagacaacat 583
           |||| || ||||| |||||||||| |||||||||||| |||||||  ||||| |||||||
Sbjct: 269 tacctttaggcacaggcctcttcctgccaccacgcctaacacggacacggtaaacaacat 210

                                                                       
Query: 584 agccctgctttgccttgaatccgagacggcgtgccctgtcggggcgggtgggccctggtg 643
           | |||||||| |||||| | ||||| ||||| ||| |||| ||||| ||||| ||| |||
Sbjct: 209 aaccctgcttggccttgtagccgaggcggcgcgccttgtcagggcgagtggg-ccttgtg 151

                                                                    
Query: 644 atgcgcacgatggccggctgcttgcctgtacttccagcaacgcacgcgctgcacgaa 700
           | ||| ||||||||||||||| |||||||||| |||||| |||||||||||||||||
Sbjct: 150 aggcggacgatggccggctgc-tgcctgtactcccagcagcgcacgcgctgcacgaa 95



to top

>gb|AF475099.1| Triticum aestivum 60S ribosomal protein L15 mRNA, partial cds
          Length = 246

 Score =  283 bits (143), Expect = 4e-73
 Identities = 225/247 (91%), Gaps = 4/247 (1%)
 Strand = Plus / Minus

                                                                       
Query: 450 tcagcaacagacctcttgttcctt-tggaacttgagctgggtaatacccctggtgcttgg 508
           |||||||||||||||||||||||  ||||||||||| |||||||||||| |||||||| |
Sbjct: 246 tcagcaacagacctcttgttcctgctggaacttgagttgggtaataccc-tggtgcttag 188

                                                                       
Query: 509 gcttaccataaacaatacccttgggcacgggcctcttccggccaccacgcctgacacgga 568
           |||| ||||||||||||||||||||||| || | ||||| ||||||||| || |||||||
Sbjct: 187 gcttgccataaacaatacccttgggcactgggcgcttcctgccaccacgtctcacacgga 128

                                                                       
Query: 569 tccggtagacaacatagccctgctttgccttgaatccgagacggcgtgccctgtcggggc 628
           | |||||||| ||||| |||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 127 tacggtagaccacatacccctgcttggccttgaagccgagacggcgtgccctgtcggggc 68

                                                                       
Query: 629 gggtgggccctggtgatgcgcacgatggccggctgcttgcctgtacttccagcaacgcac 688
           ||||||| |||||||||||| |||||||| |||||| |||||||||| ||||||||||||
Sbjct: 67  gggtggg-cctggtgatgcggacgatggcgggctgc-tgcctgtactcccagcaacgcac 10

                  
Query: 689 gcgctgc 695
           |||||||
Sbjct: 9   gcgctgc 3



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  242 bits (122), Expect = 1e-60
 Identities = 212/242 (87%)
 Strand = Plus / Plus

                                                                            
Query: 141      gcttaacggtagcggcgaagggagacagtctggttcctcttccaagtggctctccttgag 200
                |||||||| || |||||||| |||||||||||||| | |||||| || || || |  || 
Sbjct: 22144740 gcttaacgataacggcgaagagagacagtctggttgcgcttccaggtagccctgcgggac 22144799

                                                                            
Query: 201      ggcctgttcttgtggtggcggtgacccttgccacgcagaccacggaacttctttccagct 260
                ||||||  |||||||||   |||||||||||| |||||||||||| ||||||| ||||| 
Sbjct: 22144800 ggcctggccttgtggtgagtgtgacccttgccgcgcagaccacggtacttcttgccagca 22144859

                                                                            
Query: 261      gaagtgagaccacgcagctcacggtgcttatgcacaggcttgcagagccagttgatcctt 320
                || ||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 22144860 gaggtgagaccacggagctcacggtgcttgtgcacaggcttgcagagccagttgatcctt 22144919

                                                                            
Query: 321      gggtcgttacggacagcactgtgtgcaacatcaacaaggatgacctcaaagtacttgtag 380
                ||||| || |||| ||||||||| |||||||| |||||||||| ||||||||||||||||
Sbjct: 22144920 gggtcattgcggatagcactgtgagcaacatccacaaggatgatctcaaagtacttgtag 22144979

                  
Query: 381      gt 382
                ||
Sbjct: 22144980 gt 22144981



 Score =  204 bits (103), Expect = 3e-49
 Identities = 179/203 (88%), Gaps = 1/203 (0%)
 Strand = Plus / Plus

                                                                            
Query: 388      cctcattcacccagtaggagttgagcacacgaagaccaccaagcttgcgcccagctcttt 447
                |||| ||||||||||||||||||||||| |  || || || | ||||||||||||||| |
Sbjct: 22145079 cctcgttcacccagtaggagttgagcaccctgagtccgcccaacttgcgcccagctctct 22145138

                                                                            
Query: 448      cctcagcaacagacctcttgttcctttggaacttgagctgggtaatacccctggtgcttg 507
                |||||||||| |||||||||||||| ||||||||||||||||| |||||| |||||||||
Sbjct: 22145139 cctcagcaactgacctcttgttcctctggaacttgagctgggtgataccc-tggtgcttg 22145197

                                                                            
Query: 508      ggcttaccataaacaatacccttgggcacgggcctcttccggccaccacgcctgacacgg 567
                ||||| || || ||||||||||||||||| |||||||||| |||||||||||| ||||||
Sbjct: 22145198 ggcttgccgtagacaatacccttgggcactggcctcttcctgccaccacgcctcacacgg 22145257

                                       
Query: 568      atccggtagacaacatagccctg 590
                |  ||||| || ||||| |||||
Sbjct: 22145258 acacggtaaaccacataaccctg 22145280



 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 100/114 (87%), Gaps = 2/114 (1%)
 Strand = Plus / Plus

                                                                            
Query: 587      cctgctttgccttgaatccgagacggcgtgccctgtcggggcgggtgggccctggtgatg 646
                ||||||| |||||| | ||||| ||||| ||| |||||||||||||||| |  ||||| |
Sbjct: 22145822 cctgcttggccttgtagccgaggcggcgggccttgtcggggcgggtggggcg-ggtgagg 22145880

                                                                      
Query: 647      cgcacgatggccggctgcttgcctgtacttccagcaacgcacgcgctgcacgaa 700
                || |||||||||||||||| ||||||||| |||||| |||||||||||||||||
Sbjct: 22145881 cggacgatggccggctgct-gcctgtactcccagcaccgcacgcgctgcacgaa 22145933



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  242 bits (122), Expect = 1e-60
 Identities = 212/242 (87%)
 Strand = Plus / Plus

                                                                            
Query: 141      gcttaacggtagcggcgaagggagacagtctggttcctcttccaagtggctctccttgag 200
                |||||||| || |||||||| |||||||||||||| | |||||| || || || |  || 
Sbjct: 22137769 gcttaacgataacggcgaagagagacagtctggttgcgcttccaggtagccctgcgggac 22137828

                                                                            
Query: 201      ggcctgttcttgtggtggcggtgacccttgccacgcagaccacggaacttctttccagct 260
                ||||||  |||||||||   |||||||||||| |||||||||||| ||||||| ||||| 
Sbjct: 22137829 ggcctggccttgtggtgagtgtgacccttgccgcgcagaccacggtacttcttgccagca 22137888

                                                                            
Query: 261      gaagtgagaccacgcagctcacggtgcttatgcacaggcttgcagagccagttgatcctt 320
                || ||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 22137889 gaggtgagaccacggagctcacggtgcttgtgcacaggcttgcagagccagttgatcctt 22137948

                                                                            
Query: 321      gggtcgttacggacagcactgtgtgcaacatcaacaaggatgacctcaaagtacttgtag 380
                ||||| || |||| ||||||||| |||||||| |||||||||| ||||||||||||||||
Sbjct: 22137949 gggtcattgcggatagcactgtgagcaacatccacaaggatgatctcaaagtacttgtag 22138008

                  
Query: 381      gt 382
                ||
Sbjct: 22138009 gt 22138010



 Score =  204 bits (103), Expect = 3e-49
 Identities = 179/203 (88%), Gaps = 1/203 (0%)
 Strand = Plus / Plus

                                                                            
Query: 388      cctcattcacccagtaggagttgagcacacgaagaccaccaagcttgcgcccagctcttt 447
                |||| ||||||||||||||||||||||| |  || || || | ||||||||||||||| |
Sbjct: 22138108 cctcgttcacccagtaggagttgagcaccctgagtccgcccaacttgcgcccagctctct 22138167

                                                                            
Query: 448      cctcagcaacagacctcttgttcctttggaacttgagctgggtaatacccctggtgcttg 507
                |||||||||| |||||||||||||| ||||||||||||||||| |||||| |||||||||
Sbjct: 22138168 cctcagcaactgacctcttgttcctctggaacttgagctgggtgataccc-tggtgcttg 22138226

                                                                            
Query: 508      ggcttaccataaacaatacccttgggcacgggcctcttccggccaccacgcctgacacgg 567
                ||||| || || ||||||||||||||||| |||||||||| |||||||||||| ||||||
Sbjct: 22138227 ggcttgccgtagacaatacccttgggcactggcctcttcctgccaccacgcctcacacgg 22138286

                                       
Query: 568      atccggtagacaacatagccctg 590
                |  ||||| || ||||| |||||
Sbjct: 22138287 acacggtaaaccacataaccctg 22138309



 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 100/114 (87%), Gaps = 2/114 (1%)
 Strand = Plus / Plus

                                                                            
Query: 587      cctgctttgccttgaatccgagacggcgtgccctgtcggggcgggtgggccctggtgatg 646
                ||||||| |||||| | ||||| ||||| ||| |||||||||||||||| |  ||||| |
Sbjct: 22138851 cctgcttggccttgtagccgaggcggcgggccttgtcggggcgggtggggcg-ggtgagg 22138909

                                                                      
Query: 647      cgcacgatggccggctgcttgcctgtacttccagcaacgcacgcgctgcacgaa 700
                || |||||||||||||||| ||||||||| |||||| |||||||||||||||||
Sbjct: 22138910 cggacgatggccggctgct-gcctgtactcccagcaccgcacgcgctgcacgaa 22138962



to top

>gb|AC109602.6| Oryza sativa chromosome 3 BAC OSJNBa0087M10 genomic sequence,
            complete sequence
          Length = 167397

 Score =  242 bits (122), Expect = 1e-60
 Identities = 212/242 (87%)
 Strand = Plus / Minus

                                                                        
Query: 141  gcttaacggtagcggcgaagggagacagtctggttcctcttccaagtggctctccttgag 200
            |||||||| || |||||||| |||||||||||||| | |||||| || || || |  || 
Sbjct: 3542 gcttaacgataacggcgaagagagacagtctggttgcgcttccaggtagccctgcgggac 3483

                                                                        
Query: 201  ggcctgttcttgtggtggcggtgacccttgccacgcagaccacggaacttctttccagct 260
            ||||||  |||||||||   |||||||||||| |||||||||||| ||||||| ||||| 
Sbjct: 3482 ggcctggccttgtggtgagtgtgacccttgccgcgcagaccacggtacttcttgccagca 3423

                                                                        
Query: 261  gaagtgagaccacgcagctcacggtgcttatgcacaggcttgcagagccagttgatcctt 320
            || ||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 3422 gaggtgagaccacggagctcacggtgcttgtgcacaggcttgcagagccagttgatcctt 3363

                                                                        
Query: 321  gggtcgttacggacagcactgtgtgcaacatcaacaaggatgacctcaaagtacttgtag 380
            ||||| || |||| ||||||||| |||||||| |||||||||| ||||||||||||||||
Sbjct: 3362 gggtcattgcggatagcactgtgagcaacatccacaaggatgatctcaaagtacttgtag 3303

              
Query: 381  gt 382
            ||
Sbjct: 3302 gt 3301



 Score =  204 bits (103), Expect = 3e-49
 Identities = 179/203 (88%), Gaps = 1/203 (0%)
 Strand = Plus / Minus

                                                                        
Query: 388  cctcattcacccagtaggagttgagcacacgaagaccaccaagcttgcgcccagctcttt 447
            |||| ||||||||||||||||||||||| |  || || || | ||||||||||||||| |
Sbjct: 3203 cctcgttcacccagtaggagttgagcaccctgagtccgcccaacttgcgcccagctctct 3144

                                                                        
Query: 448  cctcagcaacagacctcttgttcctttggaacttgagctgggtaatacccctggtgcttg 507
            |||||||||| |||||||||||||| ||||||||||||||||| ||| ||||||||||||
Sbjct: 3143 cctcagcaactgacctcttgttcctctggaacttgagctgggtgata-ccctggtgcttg 3085

                                                                        
Query: 508  ggcttaccataaacaatacccttgggcacgggcctcttccggccaccacgcctgacacgg 567
            ||||| || || ||||||||||||||||| |||||||||| |||||||||||| ||||||
Sbjct: 3084 ggcttgccgtagacaatacccttgggcactggcctcttcctgccaccacgcctcacacgg 3025

                                   
Query: 568  atccggtagacaacatagccctg 590
            |  ||||| || ||||| |||||
Sbjct: 3024 acacggtaaaccacataaccctg 3002



 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 100/114 (87%), Gaps = 2/114 (1%)
 Strand = Plus / Minus

                                                                        
Query: 587  cctgctttgccttgaatccgagacggcgtgccctgtcggggcgggtgggccctggtgatg 646
            ||||||| |||||| | ||||| ||||| ||| |||||||||||||||| |  ||||| |
Sbjct: 2460 cctgcttggccttgtagccgaggcggcgggccttgtcggggcgggtggggcg-ggtgagg 2402

                                                                  
Query: 647  cgcacgatggccggctgcttgcctgtacttccagcaacgcacgcgctgcacgaa 700
            || |||||||||||||||| ||||||||| |||||| |||||||||||||||||
Sbjct: 2401 cggacgatggccggctgct-gcctgtactcccagcaccgcacgcgctgcacgaa 2349



to top

>gb|AC090874.9| Oryza sativa chromosome 3 BAC OJ1523_A02 genomic sequence, complete
             sequence
          Length = 132987

 Score =  242 bits (122), Expect = 1e-60
 Identities = 212/242 (87%)
 Strand = Plus / Minus

                                                                         
Query: 141   gcttaacggtagcggcgaagggagacagtctggttcctcttccaagtggctctccttgag 200
             |||||||| || |||||||| |||||||||||||| | |||||| || || || |  || 
Sbjct: 80122 gcttaacgataacggcgaagagagacagtctggttgcgcttccaggtagccctgcgggac 80063

                                                                         
Query: 201   ggcctgttcttgtggtggcggtgacccttgccacgcagaccacggaacttctttccagct 260
             ||||||  |||||||||   |||||||||||| |||||||||||| ||||||| ||||| 
Sbjct: 80062 ggcctggccttgtggtgagtgtgacccttgccgcgcagaccacggtacttcttgccagca 80003

                                                                         
Query: 261   gaagtgagaccacgcagctcacggtgcttatgcacaggcttgcagagccagttgatcctt 320
             || ||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 80002 gaggtgagaccacggagctcacggtgcttgtgcacaggcttgcagagccagttgatcctt 79943

                                                                         
Query: 321   gggtcgttacggacagcactgtgtgcaacatcaacaaggatgacctcaaagtacttgtag 380
             ||||| || |||| ||||||||| |||||||| |||||||||| ||||||||||||||||
Sbjct: 79942 gggtcattgcggatagcactgtgagcaacatccacaaggatgatctcaaagtacttgtag 79883

               
Query: 381   gt 382
             ||
Sbjct: 79882 gt 79881



 Score =  204 bits (103), Expect = 3e-49
 Identities = 179/203 (88%), Gaps = 1/203 (0%)
 Strand = Plus / Minus

                                                                         
Query: 388   cctcattcacccagtaggagttgagcacacgaagaccaccaagcttgcgcccagctcttt 447
             |||| ||||||||||||||||||||||| |  || || || | ||||||||||||||| |
Sbjct: 79783 cctcgttcacccagtaggagttgagcaccctgagtccgcccaacttgcgcccagctctct 79724

                                                                         
Query: 448   cctcagcaacagacctcttgttcctttggaacttgagctgggtaatacccctggtgcttg 507
             |||||||||| |||||||||||||| ||||||||||||||||| ||| ||||||||||||
Sbjct: 79723 cctcagcaactgacctcttgttcctctggaacttgagctgggtgata-ccctggtgcttg 79665

                                                                         
Query: 508   ggcttaccataaacaatacccttgggcacgggcctcttccggccaccacgcctgacacgg 567
             ||||| || || ||||||||||||||||| |||||||||| |||||||||||| ||||||
Sbjct: 79664 ggcttgccgtagacaatacccttgggcactggcctcttcctgccaccacgcctcacacgg 79605

                                    
Query: 568   atccggtagacaacatagccctg 590
             |  ||||| || ||||| |||||
Sbjct: 79604 acacggtaaaccacataaccctg 79582



 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 100/114 (87%), Gaps = 2/114 (1%)
 Strand = Plus / Minus

                                                                         
Query: 587   cctgctttgccttgaatccgagacggcgtgccctgtcggggcgggtgggccctggtgatg 646
             ||||||| |||||| | ||||| ||||| ||| |||||||||||||||| |  ||||| |
Sbjct: 79040 cctgcttggccttgtagccgaggcggcgggccttgtcggggcgggtggggcg-ggtgagg 78982

                                                                   
Query: 647   cgcacgatggccggctgcttgcctgtacttccagcaacgcacgcgctgcacgaa 700
             || |||||||||||||||| ||||||||| |||||| |||||||||||||||||
Sbjct: 78981 cggacgatggccggctgct-gcctgtactcccagcaccgcacgcgctgcacgaa 78929



to top

>gb|AC137610.2| Oryza sativa (japonica cultivar-group) chromosome 5 BAC clone
             OSJNBa0018H09, complete sequence
          Length = 155329

 Score =  236 bits (119), Expect = 8e-59
 Identities = 183/203 (90%), Gaps = 1/203 (0%)
 Strand = Plus / Minus

                                                                         
Query: 388   cctcattcacccagtaggagttgagcacacgaagaccaccaagcttgcgcccagctcttt 447
             |||||||||||||||||||||||||||| |  || ||||| |||||||| |||||||| |
Sbjct: 51566 cctcattcacccagtaggagttgagcaccctgagtccacccagcttgcgtccagctctct 51507

                                                                         
Query: 448   cctcagcaacagacctcttgttcctttggaacttgagctgggtaatacccctggtgcttg 507
             |||||||||| |||||||||||||| ||||||||||||||||||||| ||||||||||||
Sbjct: 51506 cctcagcaactgacctcttgttcctctggaacttgagctgggtaata-ccctggtgcttg 51448

                                                                         
Query: 508   ggcttaccataaacaatacccttgggcacgggcctcttccggccaccacgcctgacacgg 567
             ||||| ||||| ||||||||||||||||| |||||||||| ||||||||||||||| || 
Sbjct: 51447 ggcttgccatagacaatacccttgggcactggcctcttcctgccaccacgcctgacgcga 51388

                                    
Query: 568   atccggtagacaacatagccctg 590
             |  ||||| || |||||||||||
Sbjct: 51387 acacggtaaaccacatagccctg 51365



 Score =  206 bits (104), Expect = 7e-50
 Identities = 209/244 (85%)
 Strand = Plus / Minus

                                                                         
Query: 139   aagcttaacggtagcggcgaagggagacagtctggttcctcttccaagtggctctccttg 198
             |||||||||||||||| ||||| ||||| |||||||| | |||||| ||||| || |  |
Sbjct: 51908 aagcttaacggtagcgacgaagagagacggtctggttgcgcttccaggtggccctgcggg 51849

                                                                         
Query: 199   agggcctgttcttgtggtggcggtgacccttgccacgcagaccacggaacttctttccag 258
             | || |||  |||||||||   ||| || ||||| ||||| |||||| ||||||| ||||
Sbjct: 51848 aaggtctggccttgtggtgagtgtggcctttgccgcgcaggccacggtacttcttgccag 51789

                                                                         
Query: 259   ctgaagtgagaccacgcagctcacggtgcttatgcacaggcttgcagagccagttgatcc 318
             | || ||||| ||||| |||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 51788 cagaggtgaggccacggagctcacggtgcttgtgcacaggcttgcagagccagttgatcc 51729

                                                                         
Query: 319   ttgggtcgttacggacagcactgtgtgcaacatcaacaaggatgacctcaaagtacttgt 378
             ||||||| || |||| ||| ||||| |||||||| |||||||||| ||||||||||||||
Sbjct: 51728 ttgggtcattgcggatagcgctgtgagcaacatccacaaggatgatctcaaagtacttgt 51669

                 
Query: 379   aggt 382
             ||||
Sbjct: 51668 aggt 51665



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 98/114 (85%), Gaps = 2/114 (1%)
 Strand = Plus / Minus

                                                                         
Query: 587   cctgctttgccttgaatccgagacggcgtgccctgtcggggcgggtgggccctggtgatg 646
             ||||||| |||||| | ||||| ||||| ||| ||||||||||||||||  | ||||| |
Sbjct: 50602 cctgcttggccttgtagccgaggcggcgggccttgtcggggcgggtggg-gcgggtgagg 50544

                                                                   
Query: 647   cgcacgatggccggctgcttgcctgtacttccagcaacgcacgcgctgcacgaa 700
             || ||||||||||||||| || | ||||| |||||| |||||||||||||||||
Sbjct: 50543 cggacgatggccggctgc-tggcggtactcccagcagcgcacgcgctgcacgaa 50491



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  236 bits (119), Expect = 8e-59
 Identities = 183/203 (90%), Gaps = 1/203 (0%)
 Strand = Plus / Minus

                                                                            
Query: 388      cctcattcacccagtaggagttgagcacacgaagaccaccaagcttgcgcccagctcttt 447
                |||||||||||||||||||||||||||| |  || ||||| |||||||| |||||||| |
Sbjct: 11149312 cctcattcacccagtaggagttgagcaccctgagtccacccagcttgcgtccagctctct 11149253

                                                                            
Query: 448      cctcagcaacagacctcttgttcctttggaacttgagctgggtaatacccctggtgcttg 507
                |||||||||| |||||||||||||| ||||||||||||||||||||| ||||||||||||
Sbjct: 11149252 cctcagcaactgacctcttgttcctctggaacttgagctgggtaata-ccctggtgcttg 11149194

                                                                            
Query: 508      ggcttaccataaacaatacccttgggcacgggcctcttccggccaccacgcctgacacgg 567
                ||||| ||||| ||||||||||||||||| |||||||||| ||||||||||||||| || 
Sbjct: 11149193 ggcttgccatagacaatacccttgggcactggcctcttcctgccaccacgcctgacgcga 11149134

                                       
Query: 568      atccggtagacaacatagccctg 590
                |  ||||| || |||||||||||
Sbjct: 11149133 acacggtaaaccacatagccctg 11149111



 Score =  206 bits (104), Expect = 7e-50
 Identities = 209/244 (85%)
 Strand = Plus / Minus

                                                                            
Query: 139      aagcttaacggtagcggcgaagggagacagtctggttcctcttccaagtggctctccttg 198
                |||||||||||||||| ||||| ||||| |||||||| | |||||| ||||| || |  |
Sbjct: 11149654 aagcttaacggtagcgacgaagagagacggtctggttgcgcttccaggtggccctgcggg 11149595

                                                                            
Query: 199      agggcctgttcttgtggtggcggtgacccttgccacgcagaccacggaacttctttccag 258
                | || |||  |||||||||   ||| || ||||| ||||| |||||| ||||||| ||||
Sbjct: 11149594 aaggtctggccttgtggtgagtgtggcctttgccgcgcaggccacggtacttcttgccag 11149535

                                                                            
Query: 259      ctgaagtgagaccacgcagctcacggtgcttatgcacaggcttgcagagccagttgatcc 318
                | || ||||| ||||| |||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 11149534 cagaggtgaggccacggagctcacggtgcttgtgcacaggcttgcagagccagttgatcc 11149475

                                                                            
Query: 319      ttgggtcgttacggacagcactgtgtgcaacatcaacaaggatgacctcaaagtacttgt 378
                ||||||| || |||| ||| ||||| |||||||| |||||||||| ||||||||||||||
Sbjct: 11149474 ttgggtcattgcggatagcgctgtgagcaacatccacaaggatgatctcaaagtacttgt 11149415

                    
Query: 379      aggt 382
                ||||
Sbjct: 11149414 aggt 11149411



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 98/114 (85%), Gaps = 2/114 (1%)
 Strand = Plus / Minus

                                                                            
Query: 587      cctgctttgccttgaatccgagacggcgtgccctgtcggggcgggtgggccctggtgatg 646
                ||||||| |||||| | ||||| ||||| ||| ||||||||||||||||  | ||||| |
Sbjct: 11148348 cctgcttggccttgtagccgaggcggcgggccttgtcggggcgggtggg-gcgggtgagg 11148290

                                                                      
Query: 647      cgcacgatggccggctgcttgcctgtacttccagcaacgcacgcgctgcacgaa 700
                || ||||||||||||||| || | ||||| |||||| |||||||||||||||||
Sbjct: 11148289 cggacgatggccggctgc-tggcggtactcccagcagcgcacgcgctgcacgaa 11148237



to top

>ref|NM_117843.2| Arabidopsis thaliana structural constituent of ribosome AT4G17390
           mRNA, complete cds
          Length = 876

 Score =  159 bits (80), Expect = 2e-35
 Identities = 345/432 (79%), Gaps = 1/432 (0%)
 Strand = Plus / Minus

                                                                       
Query: 204 ctgttcttgtggtggcggtgacccttgccacgcagaccacggaacttctttccagctgaa 263
           ||||||||||||| |  ||||||||| ||||| ||||||||   |||||||||  | || 
Sbjct: 621 ctgttcttgtggttgttgtgaccctttccacgaagaccacgattcttctttccttcggag 562

                                                                       
Query: 264 gtgagaccacgcagctcacggtgcttatgcacaggcttgcagagccagttgatccttggg 323
           |||||||| |  || || | |||||| |||||||| ||||||| ||||||||||||||| 
Sbjct: 561 gtgagacctctgagttctctgtgcttgtgcacagggttgcagatccagttgatccttgga 502

                                                                       
Query: 324 tcgttacggacagcactgtgtgcaacatcaacaaggatgacctcaaagtacttgtaggta 383
           || || ||||| ||| ||||||||   || |||||||| | |||  ||||||||||||||
Sbjct: 501 tcatttcggacggcattgtgtgcagggtctacaaggataatctcgtagtacttgtaggta 442

                                                                       
Query: 384 gaatcctcattcacccagtaggagttgagcacacgaagaccaccaagcttgcgcccagct 443
           || |||||||| | |||||||||||| |  || | ||| || || || ||||| ||||| 
Sbjct: 441 gagtcctcattgagccagtaggagttaacaaccctaaggcctcccagtttgcgaccagca 382

                                                                       
Query: 444 ctttcctcagcaacagacctcttgttcctttggaacttgagctgggtaatacccctggtg 503
           | ||||||||||||||| |||||  | |  ||||| |||||||| || |   ||||||| 
Sbjct: 381 cgttcctcagcaacagatctcttactacgctggaatttgagctgtgtca-ctccctggtt 323

                                                                       
Query: 504 cttgggcttaccataaacaatacccttgggcacgggcctcttccggccaccacgcctgac 563
             |||| ||||| || || |||||||| ||||| |||||||| || |||||||| |||||
Sbjct: 322 ggtgggtttaccgtacacgatacccttaggcactggcctcttgcgtccaccacgtctgac 263

                                                                       
Query: 564 acggatccggtagacaacatagccctgctttgccttgaatccgagacggcgtgccctgtc 623
            || |  |||||||||||| | |||||||| |||||| | |||||||| || ||| ||||
Sbjct: 262 tcgaacacggtagacaacaaacccctgcttggccttgtagccgagacgacgagccttgtc 203

                       
Query: 624 ggggcgggtggg 635
           ||| || |||||
Sbjct: 202 gggacgagtggg 191



to top

>gb|AY122965.1| Arabidopsis thaliana putative 60S ribosomal protein L15-like
           protein (At4g17390) mRNA, complete cds
          Length = 646

 Score =  159 bits (80), Expect = 2e-35
 Identities = 345/432 (79%), Gaps = 1/432 (0%)
 Strand = Plus / Minus

                                                                       
Query: 204 ctgttcttgtggtggcggtgacccttgccacgcagaccacggaacttctttccagctgaa 263
           ||||||||||||| |  ||||||||| ||||| ||||||||   |||||||||  | || 
Sbjct: 554 ctgttcttgtggttgttgtgaccctttccacgaagaccacgattcttctttccttcggag 495

                                                                       
Query: 264 gtgagaccacgcagctcacggtgcttatgcacaggcttgcagagccagttgatccttggg 323
           |||||||| |  || || | |||||| |||||||| ||||||| ||||||||||||||| 
Sbjct: 494 gtgagacctctgagttctctgtgcttgtgcacagggttgcagatccagttgatccttgga 435

                                                                       
Query: 324 tcgttacggacagcactgtgtgcaacatcaacaaggatgacctcaaagtacttgtaggta 383
           || || ||||| ||| ||||||||   || |||||||| | |||  ||||||||||||||
Sbjct: 434 tcatttcggacggcattgtgtgcagggtctacaaggataatctcgtagtacttgtaggta 375

                                                                       
Query: 384 gaatcctcattcacccagtaggagttgagcacacgaagaccaccaagcttgcgcccagct 443
           || |||||||| | |||||||||||| |  || | ||| || || || ||||| ||||| 
Sbjct: 374 gagtcctcattgagccagtaggagttaacaaccctaaggcctcccagtttgcgaccagca 315

                                                                       
Query: 444 ctttcctcagcaacagacctcttgttcctttggaacttgagctgggtaatacccctggtg 503
           | ||||||||||||||| |||||  | |  ||||| |||||||| || |   ||||||| 
Sbjct: 314 cgttcctcagcaacagatctcttactacgctggaatttgagctgtgtca-ctccctggtt 256

                                                                       
Query: 504 cttgggcttaccataaacaatacccttgggcacgggcctcttccggccaccacgcctgac 563
             |||| ||||| || || |||||||| ||||| |||||||| || |||||||| |||||
Sbjct: 255 ggtgggtttaccgtacacgatacccttaggcactggcctcttgcgtccaccacgtctgac 196

                                                                       
Query: 564 acggatccggtagacaacatagccctgctttgccttgaatccgagacggcgtgccctgtc 623
            || |  |||||||||||| | |||||||| |||||| | |||||||| || ||| ||||
Sbjct: 195 tcgaacacggtagacaacaaacccctgcttggccttgtagccgagacgacgagccttgtc 136

                       
Query: 624 ggggcgggtggg 635
           ||| || |||||
Sbjct: 135 gggacgagtggg 124



to top

>gb|AY072118.1| Arabidopsis thaliana putative 60S ribosomal protein L15-like
           protein (At4g17390) mRNA, complete cds
          Length = 820

 Score =  159 bits (80), Expect = 2e-35
 Identities = 345/432 (79%), Gaps = 1/432 (0%)
 Strand = Plus / Minus

                                                                       
Query: 204 ctgttcttgtggtggcggtgacccttgccacgcagaccacggaacttctttccagctgaa 263
           ||||||||||||| |  ||||||||| ||||| ||||||||   |||||||||  | || 
Sbjct: 577 ctgttcttgtggttgttgtgaccctttccacgaagaccacgattcttctttccttcggag 518

                                                                       
Query: 264 gtgagaccacgcagctcacggtgcttatgcacaggcttgcagagccagttgatccttggg 323
           |||||||| |  || || | |||||| |||||||| ||||||| ||||||||||||||| 
Sbjct: 517 gtgagacctctgagttctctgtgcttgtgcacagggttgcagatccagttgatccttgga 458

                                                                       
Query: 324 tcgttacggacagcactgtgtgcaacatcaacaaggatgacctcaaagtacttgtaggta 383
           || || ||||| ||| ||||||||   || |||||||| | |||  ||||||||||||||
Sbjct: 457 tcatttcggacggcattgtgtgcagggtctacaaggataatctcgtagtacttgtaggta 398

                                                                       
Query: 384 gaatcctcattcacccagtaggagttgagcacacgaagaccaccaagcttgcgcccagct 443
           || |||||||| | |||||||||||| |  || | ||| || || || ||||| ||||| 
Sbjct: 397 gagtcctcattgagccagtaggagttaacaaccctaaggcctcccagtttgcgaccagca 338

                                                                       
Query: 444 ctttcctcagcaacagacctcttgttcctttggaacttgagctgggtaatacccctggtg 503
           | ||||||||||||||| |||||  | |  ||||| |||||||| || |   ||||||| 
Sbjct: 337 cgttcctcagcaacagatctcttactacgctggaatttgagctgtgtca-ctccctggtt 279

                                                                       
Query: 504 cttgggcttaccataaacaatacccttgggcacgggcctcttccggccaccacgcctgac 563
             |||| ||||| || || |||||||| ||||| |||||||| || |||||||| |||||
Sbjct: 278 ggtgggtttaccgtacacgatacccttaggcactggcctcttgcgtccaccacgtctgac 219

                                                                       
Query: 564 acggatccggtagacaacatagccctgctttgccttgaatccgagacggcgtgccctgtc 623
            || |  |||||||||||| | |||||||| |||||| | |||||||| || ||| ||||
Sbjct: 218 tcgaacacggtagacaacaaacccctgcttggccttgtagccgagacgacgagccttgtc 159

                       
Query: 624 ggggcgggtggg 635
           ||| || |||||
Sbjct: 158 gggacgagtggg 147



to top

>gb|AY087088.1| Arabidopsis thaliana clone 31538 mRNA, complete sequence
          Length = 754

 Score =  159 bits (80), Expect = 2e-35
 Identities = 345/432 (79%), Gaps = 1/432 (0%)
 Strand = Plus / Minus

                                                                       
Query: 204 ctgttcttgtggtggcggtgacccttgccacgcagaccacggaacttctttccagctgaa 263
           ||||||||||||| |  ||||||||| ||||| ||||||||   |||||||||  | || 
Sbjct: 581 ctgttcttgtggttgttgtgaccctttccacgaagaccacgattcttctttccttcggag 522

                                                                       
Query: 264 gtgagaccacgcagctcacggtgcttatgcacaggcttgcagagccagttgatccttggg 323
           |||||||| |  || || | |||||| |||||||| ||||||| ||||||||||||||| 
Sbjct: 521 gtgagacctctgagttctctgtgcttgtgcacagggttgcagatccagttgatccttgga 462

                                                                       
Query: 324 tcgttacggacagcactgtgtgcaacatcaacaaggatgacctcaaagtacttgtaggta 383
           || || ||||| ||| ||||||||   || |||||||| | |||  ||||||||||||||
Sbjct: 461 tcatttcggacggcattgtgtgcagggtctacaaggataatctcgtagtacttgtaggta 402

                                                                       
Query: 384 gaatcctcattcacccagtaggagttgagcacacgaagaccaccaagcttgcgcccagct 443
           || |||||||| | |||||||||||| |  || | ||| || || || ||||| ||||| 
Sbjct: 401 gagtcctcattgagccagtaggagttaacaaccctaaggcctcccagtttgcgaccagca 342

                                                                       
Query: 444 ctttcctcagcaacagacctcttgttcctttggaacttgagctgggtaatacccctggtg 503
           | ||||||||||||||| |||||  | |  ||||| |||||||| || |   ||||||| 
Sbjct: 341 cgttcctcagcaacagatctcttactacgctggaatttgagctgtgtca-ctccctggtt 283

                                                                       
Query: 504 cttgggcttaccataaacaatacccttgggcacgggcctcttccggccaccacgcctgac 563
             |||| ||||| || || |||||||| ||||| |||||||| || |||||||| |||||
Sbjct: 282 ggtgggtttaccgtacacgatacccttaggcactggcctcttgcgtccaccacgtctgac 223

                                                                       
Query: 564 acggatccggtagacaacatagccctgctttgccttgaatccgagacggcgtgccctgtc 623
            || |  |||||||||||| | |||||||| |||||| | |||||||| || ||| ||||
Sbjct: 222 tcgaacacggtagacaacaaacccctgcttggccttgtagccgagacgacgagccttgtc 163

                       
Query: 624 ggggcgggtggg 635
           ||| || |||||
Sbjct: 162 gggacgagtggg 151



to top

>emb|BX828288.1|CNS0A3VG Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH71ZC09 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 737

 Score =  151 bits (76), Expect = 4e-33
 Identities = 344/432 (79%), Gaps = 1/432 (0%)
 Strand = Plus / Minus

                                                                       
Query: 204 ctgttcttgtggtggcggtgacccttgccacgcagaccacggaacttctttccagctgaa 263
           ||||||||||||| |  ||||||||| ||||| ||||||||   |||||||||  | || 
Sbjct: 551 ctgttcttgtggttgttgtgaccctttccacgaagaccacgattcttctttccttcggag 492

                                                                       
Query: 264 gtgagaccacgcagctcacggtgcttatgcacaggcttgcagagccagttgatccttggg 323
           |||||||| |  || || | |||||| || ||||| ||||||| ||||||||||||||| 
Sbjct: 491 gtgagacctctgagttctctgtgcttgtgtacagggttgcagatccagttgatccttgga 432

                                                                       
Query: 324 tcgttacggacagcactgtgtgcaacatcaacaaggatgacctcaaagtacttgtaggta 383
           || || ||||| ||| ||||||||   || |||||||| | |||  ||||||||||||||
Sbjct: 431 tcatttcggacggcattgtgtgcagggtctacaaggataatctcgtagtacttgtaggta 372

                                                                       
Query: 384 gaatcctcattcacccagtaggagttgagcacacgaagaccaccaagcttgcgcccagct 443
           || |||||||| | |||||||||||| |  || | ||| || || || ||||| ||||| 
Sbjct: 371 gagtcctcattgagccagtaggagttaacaaccctaaggcctcccagtttgcgaccagca 312

                                                                       
Query: 444 ctttcctcagcaacagacctcttgttcctttggaacttgagctgggtaatacccctggtg 503
           | ||||||||||||||| |||||  | |  ||||| |||||||| || |   ||||||| 
Sbjct: 311 cgttcctcagcaacagatctcttactacgctggaatttgagctgtgtca-ctccctggtt 253

                                                                       
Query: 504 cttgggcttaccataaacaatacccttgggcacgggcctcttccggccaccacgcctgac 563
             |||| ||||| || || |||||||| ||||| |||||||| || |||||||| |||||
Sbjct: 252 ggtgggtttaccgtacacgatacccttaggcactggcctcttgcgtccaccacgtctgac 193

                                                                       
Query: 564 acggatccggtagacaacatagccctgctttgccttgaatccgagacggcgtgccctgtc 623
            || |  |||||||||||| | |||||||| |||||| | |||||||| || ||| ||||
Sbjct: 192 tcgaacacggtagacaacaaacccctgcttggccttgtagccgagacgacgagccttgtc 133

                       
Query: 624 ggggcgggtggg 635
           ||| || |||||
Sbjct: 132 gggacgagtggg 121



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score =  143 bits (72), Expect = 9e-31
 Identities = 149/172 (86%), Gaps = 2/172 (1%)
 Strand = Plus / Minus

                                                                            
Query: 388      cctcattcacccagtaggagttgagcacacgaagaccaccaagcttgcgcccagctcttt 447
                |||| ||||||||||||||| ||||||| |  || ||||| ||||||||||||||    |
Sbjct: 11538407 cctcgttcacccagtaggaggtgagcaccctgagtccacccagcttgcgcccagc-agct 11538349

                                                                            
Query: 448      cctcagcaacagacctcttgttcctttggaacttgagctgggtaatacccctggtgcttg 507
                |||||||||| |||||||||||||| ||||||||||||||||| ||| ||||||||||||
Sbjct: 11538348 cctcagcaactgacctcttgttcctctggaacttgagctgggtgata-ccctggtgcttg 11538290

                                                                    
Query: 508      ggcttaccataaacaatacccttgggcacgggcctcttccggccaccacgcc 559
                || || |  ||||| ||||||||| |||| |||||||||| |||||||||||
Sbjct: 11538289 ggtttgctgtaaacgatacccttgtgcactggcctcttcctgccaccacgcc 11538238



 Score =  115 bits (58), Expect = 2e-22
 Identities = 125/146 (85%), Gaps = 1/146 (0%)
 Strand = Plus / Minus

                                                                            
Query: 228      ttgccacgcagaccacggaacttctttccagctgaagtgagaccacgcagctcacggtgc 287
                ||||| ||||| |||||| |||| || ||||| || ||||||||| | ||||| | ||||
Sbjct: 11538663 ttgccgcgcaggccacggtacttgttgccagcagaggtgagaccatggagctcgccgtgc 11538604

                                                                            
Query: 288      ttatgcacaggcttgcagagccagttgatcctt-gggtcgttacggacagcactgtgtgc 346
                || |||||||||||||||||||||||||||||| |||||||  ||||  || ||||| ||
Sbjct: 11538603 ttgtgcacaggcttgcagagccagttgatccttggggtcgtcgcggatggcgctgtgagc 11538544

                                          
Query: 347      aacatcaacaaggatgacctcaaagt 372
                |||||| |||||||||| ||||||||
Sbjct: 11538543 aacatccacaaggatgatctcaaagt 11538518



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                          
Query: 143      ttaacggtagcggcgaagggagacagtctggttcctcttcca 184
                |||||||||||| ||||| ||||| |||||||| | ||||||
Sbjct: 11538751 ttaacggtagcgccgaagagagacggtctggttgcgcttcca 11538710



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                                 
Query: 587      cctgctttgccttgaatccgagacggcgtgccctgtcggggcgggtggg 635
                ||||||| ||||||   ||||| ||||| ||| ||||||||||||||||
Sbjct: 11536099 cctgcttggccttgtcgccgaggcggcgggccttgtcggggcgggtggg 11536051



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 677      ccagcaacgcacgcgctgcacgaa 700
                |||||| |||||||||||||||||
Sbjct: 11536020 ccagcaccgcacgcgctgcacgaa 11535997



to top

>emb|BX827071.1|CNS0A47Q Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB91ZE04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 755

 Score =  143 bits (72), Expect = 9e-31
 Identities = 343/432 (79%), Gaps = 1/432 (0%)
 Strand = Plus / Minus

                                                                       
Query: 204 ctgttcttgtggtggcggtgacccttgccacgcagaccacggaacttctttccagctgaa 263
           ||||||||||||| |  ||||||||| ||||| ||||||||   |||||||||  | || 
Sbjct: 551 ctgttcttgtggttgttgtgaccctttccacgaagaccacgattcttctttccttcggag 492

                                                                       
Query: 264 gtgagaccacgcagctcacggtgcttatgcacaggcttgcagagccagttgatccttggg 323
           |||||||| |  || || | || ||| |||||||| ||||||| ||||||||||||||| 
Sbjct: 491 gtgagacctctgagttctctgttcttgtgcacagggttgcagatccagttgatccttgga 432

                                                                       
Query: 324 tcgttacggacagcactgtgtgcaacatcaacaaggatgacctcaaagtacttgtaggta 383
           || || ||||| ||| ||||||||   || |||||||| | |||  ||||||||||||||
Sbjct: 431 tcatttcggacggcattgtgtgcagggtctacaaggataatctcgtagtacttgtaggta 372

                                                                       
Query: 384 gaatcctcattcacccagtaggagttgagcacacgaagaccaccaagcttgcgcccagct 443
           || |||||||| | |||||||||||  |  || | ||| || || || ||||| ||||| 
Sbjct: 371 gagtcctcattgagccagtaggagtgaacaaccctaaggcctcccagtttgcgaccagca 312

                                                                       
Query: 444 ctttcctcagcaacagacctcttgttcctttggaacttgagctgggtaatacccctggtg 503
           | ||||||||||||||| |||||  | |  ||||| |||||||| || |   ||||||| 
Sbjct: 311 cgttcctcagcaacagatctcttactacgctggaatttgagctgtgtca-ctccctggtt 253

                                                                       
Query: 504 cttgggcttaccataaacaatacccttgggcacgggcctcttccggccaccacgcctgac 563
             |||| ||||| || || |||||||| ||||| |||||||| || |||||||| |||||
Sbjct: 252 ggtgggtttaccgtacacgatacccttaggcactggcctcttgcgtccaccacgtctgac 193

                                                                       
Query: 564 acggatccggtagacaacatagccctgctttgccttgaatccgagacggcgtgccctgtc 623
            || |  |||||||||||| | |||||||| |||||| | |||||||| || ||| ||||
Sbjct: 192 tcgaacacggtagacaacaaacccctgcttggccttgtagccgagacgacgagccttgtc 133

                       
Query: 624 ggggcgggtggg 635
           ||| || |||||
Sbjct: 132 gggacgagtggg 121



to top

>dbj|AP006054.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0417E03
          Length = 133019

 Score =  143 bits (72), Expect = 9e-31
 Identities = 149/172 (86%), Gaps = 2/172 (1%)
 Strand = Plus / Minus

                                                                          
Query: 388    cctcattcacccagtaggagttgagcacacgaagaccaccaagcttgcgcccagctcttt 447
              |||| ||||||||||||||| ||||||| |  || ||||| ||||||||||||||    |
Sbjct: 107650 cctcgttcacccagtaggaggtgagcaccctgagtccacccagcttgcgcccagc-agct 107592

                                                                          
Query: 448    cctcagcaacagacctcttgttcctttggaacttgagctgggtaatacccctggtgcttg 507
              |||||||||| |||||||||||||| ||||||||||||||||| ||| ||||||||||||
Sbjct: 107591 cctcagcaactgacctcttgttcctctggaacttgagctgggtgata-ccctggtgcttg 107533

                                                                  
Query: 508    ggcttaccataaacaatacccttgggcacgggcctcttccggccaccacgcc 559
              || || |  ||||| ||||||||| |||| |||||||||| |||||||||||
Sbjct: 107532 ggtttgctgtaaacgatacccttgtgcactggcctcttcctgccaccacgcc 107481



 Score =  115 bits (58), Expect = 2e-22
 Identities = 125/146 (85%), Gaps = 1/146 (0%)
 Strand = Plus / Minus

                                                                          
Query: 228    ttgccacgcagaccacggaacttctttccagctgaagtgagaccacgcagctcacggtgc 287
              ||||| ||||| |||||| |||| || ||||| || ||||||||| | ||||| | ||||
Sbjct: 107906 ttgccgcgcaggccacggtacttgttgccagcagaggtgagaccatggagctcgccgtgc 107847

                                                                          
Query: 288    ttatgcacaggcttgcagagccagttgatcctt-gggtcgttacggacagcactgtgtgc 346
              || |||||||||||||||||||||||||||||| |||||||  ||||  || ||||| ||
Sbjct: 107846 ttgtgcacaggcttgcagagccagttgatccttggggtcgtcgcggatggcgctgtgagc 107787

                                        
Query: 347    aacatcaacaaggatgacctcaaagt 372
              |||||| |||||||||| ||||||||
Sbjct: 107786 aacatccacaaggatgatctcaaagt 107761



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                        
Query: 143    ttaacggtagcggcgaagggagacagtctggttcctcttcca 184
              |||||||||||| ||||| ||||| |||||||| | ||||||
Sbjct: 107994 ttaacggtagcgccgaagagagacggtctggttgcgcttcca 107953



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                               
Query: 587    cctgctttgccttgaatccgagacggcgtgccctgtcggggcgggtggg 635
              ||||||| ||||||   ||||| ||||| ||| ||||||||||||||||
Sbjct: 105342 cctgcttggccttgtcgccgaggcggcgggccttgtcggggcgggtggg 105294



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 677    ccagcaacgcacgcgctgcacgaa 700
              |||||| |||||||||||||||||
Sbjct: 105263 ccagcaccgcacgcgctgcacgaa 105240



to top

>dbj|AP005852.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0414E10
          Length = 141760

 Score =  143 bits (72), Expect = 9e-31
 Identities = 149/172 (86%), Gaps = 2/172 (1%)
 Strand = Plus / Minus

                                                                         
Query: 388   cctcattcacccagtaggagttgagcacacgaagaccaccaagcttgcgcccagctcttt 447
             |||| ||||||||||||||| ||||||| |  || ||||| ||||||||||||||    |
Sbjct: 16293 cctcgttcacccagtaggaggtgagcaccctgagtccacccagcttgcgcccagc-agct 16235

                                                                         
Query: 448   cctcagcaacagacctcttgttcctttggaacttgagctgggtaatacccctggtgcttg 507
             |||||||||| |||||||||||||| ||||||||||||||||| ||| ||||||||||||
Sbjct: 16234 cctcagcaactgacctcttgttcctctggaacttgagctgggtgata-ccctggtgcttg 16176

                                                                 
Query: 508   ggcttaccataaacaatacccttgggcacgggcctcttccggccaccacgcc 559
             || || |  ||||| ||||||||| |||| |||||||||| |||||||||||
Sbjct: 16175 ggtttgctgtaaacgatacccttgtgcactggcctcttcctgccaccacgcc 16124



 Score =  115 bits (58), Expect = 2e-22
 Identities = 125/146 (85%), Gaps = 1/146 (0%)
 Strand = Plus / Minus

                                                                         
Query: 228   ttgccacgcagaccacggaacttctttccagctgaagtgagaccacgcagctcacggtgc 287
             ||||| ||||| |||||| |||| || ||||| || ||||||||| | ||||| | ||||
Sbjct: 16549 ttgccgcgcaggccacggtacttgttgccagcagaggtgagaccatggagctcgccgtgc 16490

                                                                         
Query: 288   ttatgcacaggcttgcagagccagttgatcctt-gggtcgttacggacagcactgtgtgc 346
             || |||||||||||||||||||||||||||||| |||||||  ||||  || ||||| ||
Sbjct: 16489 ttgtgcacaggcttgcagagccagttgatccttggggtcgtcgcggatggcgctgtgagc 16430

                                       
Query: 347   aacatcaacaaggatgacctcaaagt 372
             |||||| |||||||||| ||||||||
Sbjct: 16429 aacatccacaaggatgatctcaaagt 16404



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                       
Query: 143   ttaacggtagcggcgaagggagacagtctggttcctcttcca 184
             |||||||||||| ||||| ||||| |||||||| | ||||||
Sbjct: 16637 ttaacggtagcgccgaagagagacggtctggttgcgcttcca 16596



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                              
Query: 587   cctgctttgccttgaatccgagacggcgtgccctgtcggggcgggtggg 635
             ||||||| ||||||   ||||| ||||| ||| ||||||||||||||||
Sbjct: 13985 cctgcttggccttgtcgccgaggcggcgggccttgtcggggcgggtggg 13937



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 677   ccagcaacgcacgcgctgcacgaa 700
             |||||| |||||||||||||||||
Sbjct: 13906 ccagcaccgcacgcgctgcacgaa 13883



to top

>gb|AC146855.5| Medicago truncatula clone mth2-16c23, complete sequence
          Length = 137979

 Score =  137 bits (69), Expect = 6e-29
 Identities = 199/241 (82%), Gaps = 1/241 (0%)
 Strand = Plus / Plus

                                                                         
Query: 305   gagccagttgatccttgggtcgttacggacagcactgtgtgcaacatcaacaaggatgac 364
             |||||||||||| ||||| || || |  | |||||| || ||||||||||| |  |||||
Sbjct: 46435 gagccagttgattcttggatcatttcttatagcactatgagcaacatcaaccaaaatgac 46494

                                                                         
Query: 365   ctcaaagtacttgtaggtagaatcctcattcacccagtaggagttgagcacacgaagacc 424
             |||||| |||||| |||||||||||||||| ||||||||||| ||||| || | ||| ||
Sbjct: 46495 ctcaaaatacttgaaggtagaatcctcattgacccagtaggaattgagaaccctaaggcc 46554

                                                                         
Query: 425   accaagcttgcgcccagctctttcctcagcaacagacctcttgttcctttggaacttgag 484
             ||| ||||| | |||||| |  ||||| || |||||||||||| ||||||| ||||||||
Sbjct: 46555 accgagcttcctcccagcacgctcctcggcgacagacctcttgctcctttgaaacttgag 46614

                                                                         
Query: 485   ctgggtaatacccctggtgcttgggcttaccataaacaatacccttgggcacgggcctct 544
              |||||||   |||||||   |||||||||| || |||||||||||||  || |||||||
Sbjct: 46615 ttgggtaa-ctccctggttagtgggcttaccgtatacaatacccttggaaacaggcctct 46673

              
Query: 545   t 545
             |
Sbjct: 46674 t 46674



to top

>gb|AY086316.1| Arabidopsis thaliana clone 23771 mRNA, complete sequence
          Length = 834

 Score =  129 bits (65), Expect = 1e-26
 Identities = 261/325 (80%), Gaps = 1/325 (0%)
 Strand = Plus / Minus

                                                                       
Query: 276 agctcacggtgcttatgcacaggcttgcagagccagttgatccttgggtcgttacggaca 335
           |||||||||||||| || || || ||||||| ||||||||| || ||||| ||||| |||
Sbjct: 549 agctcacggtgcttgtgaactgggttgcagatccagttgattctcgggtcattacgcaca 490

                                                                       
Query: 336 gcactgtgtgcaacatcaacaaggatgacctcaaagtacttgtaggtagaatcctcattc 395
           ||| |||||||    ||||| | ||||| |||  ||||||||||||| ||||||||||| 
Sbjct: 489 gcattgtgtgctgggtcaaccaagatgatctcgtagtacttgtaggtcgaatcctcattg 430

                                                                       
Query: 396 acccagtaggagttgagcacacgaagaccaccaagcttgcgcccagctctttcctcagca 455
           | |||||| |||||||  || |  |||||||| |  || |  ||||| |  |||||||||
Sbjct: 429 agccagtaagagttgacaactctgagaccacccaatttcctgccagcacgctcctcagca 370

                                                                       
Query: 456 acagacctcttgttcctttggaacttgagctgggtaatacccctggtgcttgggcttacc 515
           ||||||| |||| | |  ||||||||||| || || |  ||| ||||   | ||||||||
Sbjct: 369 acagaccgcttgctacgctggaacttgagttgtgtcactccc-tggtttgttggcttacc 311

                                                                       
Query: 516 ataaacaatacccttgggcacgggcctcttccggccaccacgcctgacacggatccggta 575
           ||| ||||||||||| ||||| |||||||| || |||||||| || |||||||  |||||
Sbjct: 310 atacacaatacccttaggcactggcctcttgcgtccaccacgtctcacacggacacggta 251

                                    
Query: 576 gacaacatagccctgctttgccttg 600
            |||||| |||||||||| ||||||
Sbjct: 250 cacaacaaagccctgcttggccttg 226



to top

>gb|BT013339.1| Lycopersicon esculentum clone 135132F, mRNA sequence
          Length = 841

 Score =  117 bits (59), Expect = 5e-23
 Identities = 222/275 (80%), Gaps = 1/275 (0%)
 Strand = Plus / Minus

                                                                       
Query: 363 acctcaaagtacttgtaggtagaatcctcattcacccagtaggagttgagcacacgaaga 422
           |||||||||||||||||||||||||||||||| | |||||| || ||||| || | ||||
Sbjct: 438 acctcaaagtacttgtaggtagaatcctcattaatccagtaagaattgaggactctaaga 379

                                                                       
Query: 423 ccaccaagcttgcgcccagctctttcctcagcaacagacctcttgttcctttggaacttg 482
           ||||| |  || |  ||||| |  |||||||||||||| | |||| | |  ||||| |||
Sbjct: 378 ccacccaatttccttccagcacgctcctcagcaacagatcgcttgctgcgctggaatttg 319

                                                                       
Query: 483 agctgggtaatacccctggtgcttgggcttaccataaacaatacccttgggcacgggcct 542
           || |||||||  ||| ||||   |||| |||||||| ||||||||||||| ||| |||||
Sbjct: 318 agttgggtaactccc-tggttggtgggtttaccatacacaatacccttggacactggcct 260

                                                                       
Query: 543 cttccggccaccacgcctgacacggatccggtagacaacatagccctgctttgccttgaa 602
           |||||  ||||||||  | ||||| |  |||||||| |||||||||||||| |||||| |
Sbjct: 259 cttccttccaccacgtttcacacgaacacggtagaccacatagccctgcttggccttgta 200

                                              
Query: 603 tccgagacggcgtgccctgtcggggcgggtgggcc 637
            || |  ||||||||| |||| || ||||| ||||
Sbjct: 199 acccaatcggcgtgccttgtcaggacgggtaggcc 165



 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                       
Query: 249 ttctttccagctgaagtgagaccacgcagctcacggtgcttatgcacaggcttgcagagc 308
           ||||| |||||||||||||||||||| || || | |||||||||||| || ||||||| |
Sbjct: 552 ttcttaccagctgaagtgagaccacgtagttctctgtgcttatgcactgggttgcagatc 493

                               
Query: 309 cagttgatccttgggtcgtt 328
           |||||||||||||| |||||
Sbjct: 492 cagttgatccttggatcgtt 473



to top

>gb|AF051207.1|AF051207 Picea mariana probable 60S ribosomal protein L15 (Sb11) mRNA,
           complete cds
          Length = 898

 Score =  115 bits (58), Expect = 2e-22
 Identities = 119/138 (86%), Gaps = 1/138 (0%)
 Strand = Plus / Minus

                                                                       
Query: 474 tggaacttgagctgggtaatacccctggtgcttgggcttaccataaacaatacccttggg 533
           |||||||||||||||||||||||| || | ||||||||||||||||||||||||||| ||
Sbjct: 314 tggaacttgagctgggtaataccc-tgattcttgggcttaccataaacaatacccttagg 256

                                                                       
Query: 534 cacgggcctcttccggccaccacgcctgacacggatccggtagacaacatagccctgctt 593
            || || |||||||  || ||||||||||| |  | ||||||||||||||| || |||||
Sbjct: 255 aacaggtctcttcctacctccacgcctgactcttacccggtagacaacataaccttgctt 196

                             
Query: 594 tgccttgaatccgagacg 611
            |||||| | ||||||||
Sbjct: 195 cgccttgtagccgagacg 178



to top

>gb|AF051244.1|AF051244 Picea mariana probable 60S ribosomal protein L15 (Sb62) mRNA,
           complete cds
          Length = 897

 Score =  113 bits (57), Expect = 8e-22
 Identities = 121/141 (85%), Gaps = 1/141 (0%)
 Strand = Plus / Minus

                                                                       
Query: 474 tggaacttgagctgggtaatacccctggtgcttgggcttaccataaacaatacccttggg 533
           ||||||||||| ||||| |||||| || | ||||||||| ||||| ||||||||||||||
Sbjct: 364 tggaacttgagttgggtgataccc-tgattcttgggcttcccatagacaatacccttggg 306

                                                                       
Query: 534 cacgggcctcttccggccaccacgcctgacacggatccggtagacaacatagccctgctt 593
           ||| ||||||||||| ||||||||||| || || |  ||||| |||||||| ||||||||
Sbjct: 305 cactggcctcttccgcccaccacgccttactcgtactcggtaaacaacataaccctgctt 246

                                
Query: 594 tgccttgaatccgagacggcg 614
            |||||| |||| || |||||
Sbjct: 245 ggccttgtatccaaggcggcg 225



to top

>gb|AF154663.1| Nicotiana tabacum clone PR55 mRNA sequence
          Length = 888

 Score =  111 bits (56), Expect = 3e-21
 Identities = 137/164 (83%)
 Strand = Plus / Minus

                                                                       
Query: 249 ttctttccagctgaagtgagaccacgcagctcacggtgcttatgcacaggcttgcagagc 308
           ||||| |||||||||||||||||||| || || | |||||||||||| || ||||||| |
Sbjct: 586 ttcttaccagctgaagtgagaccacgaagttctctgtgcttatgcactgggttgcagatc 527

                                                                       
Query: 309 cagttgatccttgggtcgttacggacagcactgtgtgcaacatcaacaaggatgacctca 368
           ||||| |||||||| || |||||||  |||   || ||    ||||| ||||| ||||||
Sbjct: 526 cagttaatccttggatcattacggatggcagcatgggcttggtcaactaggatcacctca 467

                                                       
Query: 369 aagtacttgtaggtagaatcctcattcacccagtaggagttgag 412
           |||||||||||||| ||||||||||| | ||||||||| |||||
Sbjct: 466 aagtacttgtaggtggaatcctcattaatccagtaggaattgag 423



 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 77/88 (87%)
 Strand = Plus / Minus

                                                                       
Query: 506 tgggcttaccataaacaatacccttgggcacgggcctcttccggccaccacgcctgacac 565
           ||||||||||||| |||||||| ||||| || ||||||||||  ||||||||| ||||||
Sbjct: 330 tgggcttaccatacacaatacctttgggaacaggcctcttccttccaccacgcttgacac 271

                                       
Query: 566 ggatccggtagacaacatagccctgctt 593
           | |  |||||||| ||||||||||||||
Sbjct: 270 gaacacggtagaccacatagccctgctt 243



to top

>gb|DQ427604.1| Sorghum propinquum locus CSU784 genomic sequence
          Length = 655

 Score =  107 bits (54), Expect = 5e-20
 Identities = 101/114 (88%), Gaps = 2/114 (1%)
 Strand = Plus / Minus

                                                                       
Query: 587 cctgctttgccttgaatccgagacggcgtgccctgtcggggcgggtgggccctggtgatg 646
           ||||||| |||||| | ||||| ||||| ||| |||||||||||||||| ||| |||| |
Sbjct: 231 cctgcttggccttgtagccgaggcggcgggccttgtcggggcgggtggg-ccttgtgagg 173

                                                                 
Query: 647 cgcacgatggccggctgcttgcctgtacttccagcaacgcacgcgctgcacgaa 700
           || ||||||||||||||| |||||||||| |||||| |||||||||||||||||
Sbjct: 172 cggacgatggccggctgc-tgcctgtactcccagcagcgcacgcgctgcacgaa 120



to top

>gb|DQ427603.1| Sorghum bicolor voucher PI585454 locus CSU784 genomic sequence
          Length = 658

 Score =  107 bits (54), Expect = 5e-20
 Identities = 101/114 (88%), Gaps = 2/114 (1%)
 Strand = Plus / Minus

                                                                       
Query: 587 cctgctttgccttgaatccgagacggcgtgccctgtcggggcgggtgggccctggtgatg 646
           ||||||| |||||| | ||||| ||||| ||| |||||||||||||||| ||| |||| |
Sbjct: 231 cctgcttggccttgtagccgaggcggcgggccttgtcggggcgggtggg-ccttgtgagg 173

                                                                 
Query: 647 cgcacgatggccggctgcttgcctgtacttccagcaacgcacgcgctgcacgaa 700
           || ||||||||||||||| |||||||||| |||||| |||||||||||||||||
Sbjct: 172 cggacgatggccggctgc-tgcctgtactcccagcagcgcacgcgctgcacgaa 120



to top

>gb|DQ427602.1| Sorghum bicolor voucher PI267539 locus CSU784 genomic sequence
          Length = 658

 Score =  107 bits (54), Expect = 5e-20
 Identities = 101/114 (88%), Gaps = 2/114 (1%)
 Strand = Plus / Minus

                                                                       
Query: 587 cctgctttgccttgaatccgagacggcgtgccctgtcggggcgggtgggccctggtgatg 646
           ||||||| |||||| | ||||| ||||| ||| |||||||||||||||| ||| |||| |
Sbjct: 231 cctgcttggccttgtagccgaggcggcgggccttgtcggggcgggtggg-ccttgtgagg 173

                                                                 
Query: 647 cgcacgatggccggctgcttgcctgtacttccagcaacgcacgcgctgcacgaa 700
           || ||||||||||||||| |||||||||| |||||| |||||||||||||||||
Sbjct: 172 cggacgatggccggctgc-tgcctgtactcccagcagcgcacgcgctgcacgaa 120



to top

>gb|DQ427601.1| Sorghum bicolor voucher PI267408 locus CSU784 genomic sequence
          Length = 658

 Score =  107 bits (54), Expect = 5e-20
 Identities = 101/114 (88%), Gaps = 2/114 (1%)
 Strand = Plus / Minus

                                                                       
Query: 587 cctgctttgccttgaatccgagacggcgtgccctgtcggggcgggtgggccctggtgatg 646
           ||||||| |||||| | ||||| ||||| ||| |||||||||||||||| ||| |||| |
Sbjct: 231 cctgcttggccttgtagccgaggcggcgggccttgtcggggcgggtggg-ccttgtgagg 173

                                                                 
Query: 647 cgcacgatggccggctgcttgcctgtacttccagcaacgcacgcgctgcacgaa 700
           || ||||||||||||||| |||||||||| |||||| |||||||||||||||||
Sbjct: 172 cggacgatggccggctgc-tgcctgtactcccagcagcgcacgcgctgcacgaa 120



to top

>gb|DQ427600.1| Sorghum bicolor voucher PI221607 locus CSU784 genomic sequence
          Length = 658

 Score =  107 bits (54), Expect = 5e-20
 Identities = 101/114 (88%), Gaps = 2/114 (1%)
 Strand = Plus / Minus

                                                                       
Query: 587 cctgctttgccttgaatccgagacggcgtgccctgtcggggcgggtgggccctggtgatg 646
           ||||||| |||||| | ||||| ||||| ||| |||||||||||||||| ||| |||| |
Sbjct: 231 cctgcttggccttgtagccgaggcggcgggccttgtcggggcgggtggg-ccttgtgagg 173

                                                                 
Query: 647 cgcacgatggccggctgcttgcctgtacttccagcaacgcacgcgctgcacgaa 700
           || ||||||||||||||| |||||||||| |||||| |||||||||||||||||
Sbjct: 172 cggacgatggccggctgc-tgcctgtactcccagcagcgcacgcgctgcacgaa 120



to top

>gb|DQ427599.1| Sorghum bicolor voucher PI152702 locus CSU784 genomic sequence
          Length = 658

 Score =  107 bits (54), Expect = 5e-20
 Identities = 101/114 (88%), Gaps = 2/114 (1%)
 Strand = Plus / Minus

                                                                       
Query: 587 cctgctttgccttgaatccgagacggcgtgccctgtcggggcgggtgggccctggtgatg 646
           ||||||| |||||| | ||||| ||||| ||| |||||||||||||||| ||| |||| |
Sbjct: 231 cctgcttggccttgtagccgaggcggcgggccttgtcggggcgggtggg-ccttgtgagg 173

                                                                 
Query: 647 cgcacgatggccggctgcttgcctgtacttccagcaacgcacgcgctgcacgaa 700
           || ||||||||||||||| |||||||||| |||||| |||||||||||||||||
Sbjct: 172 cggacgatggccggctgc-tgcctgtactcccagcagcgcacgcgctgcacgaa 120



to top

>gb|DQ427598.1| Sorghum bicolor voucher NSL92371 locus CSU784 genomic sequence
          Length = 658

 Score =  107 bits (54), Expect = 5e-20
 Identities = 101/114 (88%), Gaps = 2/114 (1%)
 Strand = Plus / Minus

                                                                       
Query: 587 cctgctttgccttgaatccgagacggcgtgccctgtcggggcgggtgggccctggtgatg 646
           ||||||| |||||| | ||||| ||||| ||| |||||||||||||||| ||| |||| |
Sbjct: 231 cctgcttggccttgtagccgaggcggcgggccttgtcggggcgggtggg-ccttgtgagg 173

                                                                 
Query: 647 cgcacgatggccggctgcttgcctgtacttccagcaacgcacgcgctgcacgaa 700
           || ||||||||||||||| |||||||||| |||||| |||||||||||||||||
Sbjct: 172 cggacgatggccggctgc-tgcctgtactcccagcagcgcacgcgctgcacgaa 120



to top

>gb|DQ427597.1| Sorghum bicolor voucher NSL87902 locus CSU784 genomic sequence
          Length = 658

 Score =  107 bits (54), Expect = 5e-20
 Identities = 101/114 (88%), Gaps = 2/114 (1%)
 Strand = Plus / Minus

                                                                       
Query: 587 cctgctttgccttgaatccgagacggcgtgccctgtcggggcgggtgggccctggtgatg 646
           ||||||| |||||| | ||||| ||||| ||| |||||||||||||||| ||| |||| |
Sbjct: 231 cctgcttggccttgtagccgaggcggcgggccttgtcggggcgggtggg-ccttgtgagg 173

                                                                 
Query: 647 cgcacgatggccggctgcttgcctgtacttccagcaacgcacgcgctgcacgaa 700
           || ||||||||||||||| |||||||||| |||||| |||||||||||||||||
Sbjct: 172 cggacgatggccggctgc-tgcctgtactcccagcagcgcacgcgctgcacgaa 120



to top

>gb|DQ427596.1| Sorghum bicolor voucher NSL87666 locus CSU784 genomic sequence
          Length = 658

 Score =  107 bits (54), Expect = 5e-20
 Identities = 101/114 (88%), Gaps = 2/114 (1%)
 Strand = Plus / Minus

                                                                       
Query: 587 cctgctttgccttgaatccgagacggcgtgccctgtcggggcgggtgggccctggtgatg 646
           ||||||| |||||| | ||||| ||||| ||| |||||||||||||||| ||| |||| |
Sbjct: 231 cctgcttggccttgtagccgaggcggcgggccttgtcggggcgggtggg-ccttgtgagg 173

                                                                 
Query: 647 cgcacgatggccggctgcttgcctgtacttccagcaacgcacgcgctgcacgaa 700
           || ||||||||||||||| |||||||||| |||||| |||||||||||||||||
Sbjct: 172 cggacgatggccggctgc-tgcctgtactcccagcagcgcacgcgctgcacgaa 120



to top

>gb|DQ427595.1| Sorghum bicolor voucher NSL77217 locus CSU784 genomic sequence
          Length = 658

 Score =  107 bits (54), Expect = 5e-20
 Identities = 101/114 (88%), Gaps = 2/114 (1%)
 Strand = Plus / Minus

                                                                       
Query: 587 cctgctttgccttgaatccgagacggcgtgccctgtcggggcgggtgggccctggtgatg 646
           ||||||| |||||| | ||||| ||||| ||| |||||||||||||||| ||| |||| |
Sbjct: 231 cctgcttggccttgtagccgaggcggcgggccttgtcggggcgggtggg-ccttgtgagg 173

                                                                 
Query: 647 cgcacgatggccggctgcttgcctgtacttccagcaacgcacgcgctgcacgaa 700
           || ||||||||||||||| |||||||||| |||||| |||||||||||||||||
Sbjct: 172 cggacgatggccggctgc-tgcctgtactcccagcagcgcacgcgctgcacgaa 120



to top

>gb|DQ427594.1| Sorghum bicolor voucher NSL77034 locus CSU784 genomic sequence
          Length = 658

 Score =  107 bits (54), Expect = 5e-20
 Identities = 101/114 (88%), Gaps = 2/114 (1%)
 Strand = Plus / Minus

                                                                       
Query: 587 cctgctttgccttgaatccgagacggcgtgccctgtcggggcgggtgggccctggtgatg 646
           ||||||| |||||| | ||||| ||||| ||| |||||||||||||||| ||| |||| |
Sbjct: 231 cctgcttggccttgtagccgaggcggcgggccttgtcggggcgggtggg-ccttgtgagg 173

                                                                 
Query: 647 cgcacgatggccggctgcttgcctgtacttccagcaacgcacgcgctgcacgaa 700
           || ||||||||||||||| |||||||||| |||||| |||||||||||||||||
Sbjct: 172 cggacgatggccggctgc-tgcctgtactcccagcagcgcacgcgctgcacgaa 120



to top

>gb|DQ427593.1| Sorghum bicolor voucher NSL56174 locus CSU784 genomic sequence
          Length = 658

 Score =  107 bits (54), Expect = 5e-20
 Identities = 101/114 (88%), Gaps = 2/114 (1%)
 Strand = Plus / Minus

                                                                       
Query: 587 cctgctttgccttgaatccgagacggcgtgccctgtcggggcgggtgggccctggtgatg 646
           ||||||| |||||| | ||||| ||||| ||| |||||||||||||||| ||| |||| |
Sbjct: 231 cctgcttggccttgtagccgaggcggcgggccttgtcggggcgggtggg-ccttgtgagg 173

                                                                 
Query: 647 cgcacgatggccggctgcttgcctgtacttccagcaacgcacgcgctgcacgaa 700
           || ||||||||||||||| |||||||||| |||||| |||||||||||||||||
Sbjct: 172 cggacgatggccggctgc-tgcctgtactcccagcagcgcacgcgctgcacgaa 120



to top

>gb|DQ427592.1| Sorghum bicolor voucher NSL56003 locus CSU784 genomic sequence
          Length = 658

 Score =  107 bits (54), Expect = 5e-20
 Identities = 101/114 (88%), Gaps = 2/114 (1%)
 Strand = Plus / Minus

                                                                       
Query: 587 cctgctttgccttgaatccgagacggcgtgccctgtcggggcgggtgggccctggtgatg 646
           ||||||| |||||| | ||||| ||||| ||| |||||||||||||||| ||| |||| |
Sbjct: 231 cctgcttggccttgtagccgaggcggcgggccttgtcggggcgggtggg-ccttgtgagg 173

                                                                 
Query: 647 cgcacgatggccggctgcttgcctgtacttccagcaacgcacgcgctgcacgaa 700
           || ||||||||||||||| |||||||||| |||||| |||||||||||||||||
Sbjct: 172 cggacgatggccggctgc-tgcctgtactcccagcagcgcacgcgctgcacgaa 120



to top

>gb|DQ427591.1| Sorghum bicolor voucher NSL51365 locus CSU784 genomic sequence
          Length = 658

 Score =  107 bits (54), Expect = 5e-20
 Identities = 101/114 (88%), Gaps = 2/114 (1%)
 Strand = Plus / Minus

                                                                       
Query: 587 cctgctttgccttgaatccgagacggcgtgccctgtcggggcgggtgggccctggtgatg 646
           ||||||| |||||| | ||||| ||||| ||| |||||||||||||||| ||| |||| |
Sbjct: 231 cctgcttggccttgtagccgaggcggcgggccttgtcggggcgggtggg-ccttgtgagg 173

                                                                 
Query: 647 cgcacgatggccggctgcttgcctgtacttccagcaacgcacgcgctgcacgaa 700
           || ||||||||||||||| |||||||||| |||||| |||||||||||||||||
Sbjct: 172 cggacgatggccggctgc-tgcctgtactcccagcagcgcacgcgctgcacgaa 120



to top

>gb|DQ427590.1| Sorghum bicolor voucher NSL51030 locus CSU784 genomic sequence
          Length = 658

 Score =  107 bits (54), Expect = 5e-20
 Identities = 101/114 (88%), Gaps = 2/114 (1%)
 Strand = Plus / Minus

                                                                       
Query: 587 cctgctttgccttgaatccgagacggcgtgccctgtcggggcgggtgggccctggtgatg 646
           ||||||| |||||| | ||||| ||||| ||| |||||||||||||||| ||| |||| |
Sbjct: 231 cctgcttggccttgtagccgaggcggcgggccttgtcggggcgggtggg-ccttgtgagg 173

                                                                 
Query: 647 cgcacgatggccggctgcttgcctgtacttccagcaacgcacgcgctgcacgaa 700
           || ||||||||||||||| |||||||||| |||||| |||||||||||||||||
Sbjct: 172 cggacgatggccggctgc-tgcctgtactcccagcagcgcacgcgctgcacgaa 120



to top

>gb|DQ427589.1| Sorghum bicolor voucher NSL50875 locus CSU784 genomic sequence
          Length = 658

 Score =  107 bits (54), Expect = 5e-20
 Identities = 101/114 (88%), Gaps = 2/114 (1%)
 Strand = Plus / Minus

                                                                       
Query: 587 cctgctttgccttgaatccgagacggcgtgccctgtcggggcgggtgggccctggtgatg 646
           ||||||| |||||| | ||||| ||||| ||| |||||||||||||||| ||| |||| |
Sbjct: 231 cctgcttggccttgtagccgaggcggcgggccttgtcggggcgggtggg-ccttgtgagg 173

                                                                 
Query: 647 cgcacgatggccggctgcttgcctgtacttccagcaacgcacgcgctgcacgaa 700
           || ||||||||||||||| |||||||||| |||||| |||||||||||||||||
Sbjct: 172 cggacgatggccggctgc-tgcctgtactcccagcagcgcacgcgctgcacgaa 120



to top

>gb|DQ427588.1| Sorghum bicolor voucher BTx623 locus CSU784 genomic sequence
          Length = 658

 Score =  107 bits (54), Expect = 5e-20
 Identities = 101/114 (88%), Gaps = 2/114 (1%)
 Strand = Plus / Minus

                                                                       
Query: 587 cctgctttgccttgaatccgagacggcgtgccctgtcggggcgggtgggccctggtgatg 646
           ||||||| |||||| | ||||| ||||| ||| |||||||||||||||| ||| |||| |
Sbjct: 231 cctgcttggccttgtagccgaggcggcgggccttgtcggggcgggtggg-ccttgtgagg 173

                                                                 
Query: 647 cgcacgatggccggctgcttgcctgtacttccagcaacgcacgcgctgcacgaa 700
           || ||||||||||||||| |||||||||| |||||| |||||||||||||||||
Sbjct: 172 cggacgatggccggctgc-tgcctgtactcccagcagcgcacgcgctgcacgaa 120



to top

>gb|AF088912.1|AF088912 Petunia x hybrida ribosomal protein L15 mRNA, complete cds
          Length = 912

 Score =  107 bits (54), Expect = 5e-20
 Identities = 138/166 (83%)
 Strand = Plus / Minus

                                                                       
Query: 247 acttctttccagctgaagtgagaccacgcagctcacggtgcttatgcacaggcttgcaga 306
           ||||||| ||||||||||| |||||||| || || | |||||||||||| || |||||||
Sbjct: 532 acttcttaccagctgaagtaagaccacgtagttctctgtgcttatgcactgggttgcaga 473

                                                                       
Query: 307 gccagttgatccttgggtcgttacggacagcactgtgtgcaacatcaacaaggatgacct 366
            ||||||||||||||| ||||| |||| ||||   |||||    ||||| |  || ||||
Sbjct: 472 tccagttgatccttggatcgttgcggatagcagcatgtgcttggtcaaccaatattacct 413

                                                         
Query: 367 caaagtacttgtaggtagaatcctcattcacccagtaggagttgag 412
           ||||||||||||||||||||||||| || | |||||| || |||||
Sbjct: 412 caaagtacttgtaggtagaatcctcgttaatccagtaagaattgag 367



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 74/85 (87%)
 Strand = Plus / Minus

                                                                       
Query: 506 tgggcttaccataaacaatacccttgggcacgggcctcttccggccaccacgcctgacac 565
           |||| |||||||| |||||||||||||| || ||||||||||  ||||||||| ||||||
Sbjct: 274 tgggtttaccatacacaatacccttgggaactggcctcttccttccaccacgcttgacac 215

                                    
Query: 566 ggatccggtagacaacatagccctg 590
           | |  |||||||| |||||||||||
Sbjct: 214 gaacacggtagaccacatagccctg 190



to top

>ref|XM_745122.1| Aspergillus fumigatus Af293 ribosomal L15 (Afu1g04660) partial mRNA
          Length = 699

 Score =  105 bits (53), Expect = 2e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                       
Query: 525 acccttgggcacgggcctcttccggccaccacgcctgacacggatccggtagacaacata 584
           |||||||||||| |||||||| ||||||||||| || |||||||  ||||||| ||||||
Sbjct: 321 acccttgggcacaggcctcttgcggccaccacgtctcacacggacacggtagataacata 262

                                                        
Query: 585 gccctgctttgccttgaatccgagacggcgtgccctgtcggggcg 629
           ||||||||| |||||| | |||||||| || ||| ||||||||||
Sbjct: 261 gccctgcttggccttgtagccgagacgacgagccttgtcggggcg 217



 Score = 48.1 bits (24), Expect = 0.039
 Identities = 57/68 (83%)
 Strand = Plus / Minus

                                                                       
Query: 351 tcaacaaggatgacctcaaagtacttgtaggtagaatcctcattcacccagtaggagttg 410
           ||||| |||||||||||  ||||||||||||| || ||||  || | |||||||||||| 
Sbjct: 494 tcaacgaggatgacctcgtagtacttgtaggtggagtcctggttgatccagtaggagttc 435

                   
Query: 411 agcacacg 418
           || |||||
Sbjct: 434 aggacacg 427



to top

>dbj|AP007155.1| Aspergillus oryzae RIB40 genomic DNA, SC003
          Length = 4170692

 Score = 97.6 bits (49), Expect = 5e-17
 Identities = 91/105 (86%)
 Strand = Plus / Plus

                                                                           
Query: 525     acccttgggcacgggcctcttccggccaccacgcctgacacggatccggtagacaacata 584
               |||||||||  |||||||||| |||||||| || || |||||||| ||||||||||||||
Sbjct: 2423490 acccttgggtgcgggcctcttacggccaccgcgtctcacacggatacggtagacaacata 2423549

                                                            
Query: 585     gccctgctttgccttgaatccgagacggcgtgccctgtcggggcg 629
                |||||||| |||||| |||||||||| || ||| | ||||||||
Sbjct: 2423550 accctgcttggccttgtatccgagacgacgagccttatcggggcg 2423594



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                           
Query: 354     acaaggatgacctcaaagtacttgtaggtagaatcctcattcacccagtaggagttgagc 413
               |||||||| ||||| |||||||||||||| || ||||  || | |||||||||||| || 
Sbjct: 2423246 acaaggataacctcgaagtacttgtaggtggagtcctggttgatccagtaggagttcagg 2423305

                    
Query: 414     acacg 418
               |||||
Sbjct: 2423306 acacg 2423310



to top

>ref|NM_117842.2| Arabidopsis thaliana MSH4 (MUTS-LIKE PROTEIN 4); ATP binding /
            damaged DNA binding AT4G17380 (MSH4) mRNA, complete cds
          Length = 3023

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 152/187 (81%)
 Strand = Plus / Plus

                                                                        
Query: 204  ctgttcttgtggtggcggtgacccttgccacgcagaccacggaacttctttccagctgaa 263
            ||||||||||||| |  ||||||||| ||||| ||||||||   |||||||||  | || 
Sbjct: 2837 ctgttcttgtggttgttgtgaccctttccacgaagaccacgattcttctttccttcggag 2896

                                                                        
Query: 264  gtgagaccacgcagctcacggtgcttatgcacaggcttgcagagccagttgatccttggg 323
            |||||||| |  || || | |||||| |||||||| ||||||| ||||||||||||||| 
Sbjct: 2897 gtgagacctctgagttctctgtgcttgtgcacagggttgcagatccagttgatccttgga 2956

                                                                        
Query: 324  tcgttacggacagcactgtgtgcaacatcaacaaggatgacctcaaagtacttgtaggta 383
            || || ||||| ||| ||||||||   || |||||||| | |||  ||||||||||||||
Sbjct: 2957 tcatttcggacggcattgtgtgcagggtctacaaggataatctcgtagtacttgtaggta 3016

                   
Query: 384  gaatcct 390
            || ||||
Sbjct: 3017 gagtcct 3023



to top

>emb|Z97343.1|ATFCA8 Arabidopsis thaliana DNA chromosome 4, ESSA I FCA contig fragment No. 8
          Length = 207674

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 152/187 (81%)
 Strand = Plus / Plus

                                                                         
Query: 204   ctgttcttgtggtggcggtgacccttgccacgcagaccacggaacttctttccagctgaa 263
             ||||||||||||| |  ||||||||| ||||| ||||||||   |||||||||  | || 
Sbjct: 79239 ctgttcttgtggttgttgtgaccctttccacgaagaccacgattcttctttccttcggag 79298

                                                                         
Query: 264   gtgagaccacgcagctcacggtgcttatgcacaggcttgcagagccagttgatccttggg 323
             |||||||| |  || || | |||||| |||||||| ||||||| ||||||||||||||| 
Sbjct: 79299 gtgagacctctgagttctctgtgcttgtgcacagggttgcagatccagttgatccttgga 79358

                                                                         
Query: 324   tcgttacggacagcactgtgtgcaacatcaacaaggatgacctcaaagtacttgtaggta 383
             || || ||||| ||| ||||||||   || |||||||| | |||  ||||||||||||||
Sbjct: 79359 tcatttcggacggcattgtgtgcagggtctacaaggataatctcgtagtacttgtaggta 79418

                    
Query: 384   gaatcct 390
             || ||||
Sbjct: 79419 gagtcct 79425



to top

>emb|AL161546.2|ATCHRIV46 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 46
          Length = 198788

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 152/187 (81%)
 Strand = Plus / Plus

                                                                         
Query: 204   ctgttcttgtggtggcggtgacccttgccacgcagaccacggaacttctttccagctgaa 263
             ||||||||||||| |  ||||||||| ||||| ||||||||   |||||||||  | || 
Sbjct: 68604 ctgttcttgtggttgttgtgaccctttccacgaagaccacgattcttctttccttcggag 68663

                                                                         
Query: 264   gtgagaccacgcagctcacggtgcttatgcacaggcttgcagagccagttgatccttggg 323
             |||||||| |  || || | |||||| |||||||| ||||||| ||||||||||||||| 
Sbjct: 68664 gtgagacctctgagttctctgtgcttgtgcacagggttgcagatccagttgatccttgga 68723

                                                                         
Query: 324   tcgttacggacagcactgtgtgcaacatcaacaaggatgacctcaaagtacttgtaggta 383
             || || ||||| ||| ||||||||   || |||||||| | |||  ||||||||||||||
Sbjct: 68724 tcatttcggacggcattgtgtgcagggtctacaaggataatctcgtagtacttgtaggta 68783

                    
Query: 384   gaatcct 390
             || ||||
Sbjct: 68784 gagtcct 68790



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 64/77 (83%)
 Strand = Plus / Plus

                                                                         
Query: 506   tgggcttaccataaacaatacccttgggcacgggcctcttccggccaccacgcctgacac 565
             |||| ||||| || || |||||||| ||||| |||||||| || |||||||| ||||| |
Sbjct: 69009 tgggtttaccgtacacgatacccttaggcactggcctcttgcgtccaccacgtctgactc 69068

                              
Query: 566   ggatccggtagacaaca 582
             | |  ||||||||||||
Sbjct: 69069 gaacacggtagacaaca 69085



to top

>dbj|AB226246.1| Aspergillus oryzae cDNA, contig sequence: AoEST3105
          Length = 903

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 89/103 (86%)
 Strand = Plus / Minus

                                                                       
Query: 527 ccttgggcacgggcctcttccggccaccacgcctgacacggatccggtagacaacatagc 586
           |||||||  |||||||||| |||||||| || || |||||||| |||||||||||||| |
Sbjct: 320 ccttgggtgcgggcctcttacggccaccgcgtctcacacggatacggtagacaacataac 261

                                                      
Query: 587 cctgctttgccttgaatccgagacggcgtgccctgtcggggcg 629
           ||||||| |||||| |||||||||| || ||| | ||||||||
Sbjct: 260 cctgcttggccttgtatccgagacgacgagccttatcggggcg 218



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 354 acaaggatgacctcaaagtacttgtaggtagaatcctcattcacccagtaggagttgagc 413
           |||||||| ||||| |||||||||||||| || ||||  || | |||||||||||| || 
Sbjct: 493 acaaggataacctcgaagtacttgtaggtggagtcctggttgatccagtaggagttcagg 434

                
Query: 414 acacg 418
           |||||
Sbjct: 433 acacg 429



to top

>dbj|AB224338.1| Aspergillus oryzae cDNA, contig sequence: AoEST1183
          Length = 907

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 90/105 (85%)
 Strand = Plus / Minus

                                                                       
Query: 525 acccttgggcacgggcctcttccggccaccacgcctgacacggatccggtagacaacata 584
           |||||||||  |||||||||| |||||||| |  || |||||||| ||||||||||||||
Sbjct: 540 acccttgggtgcgggcctcttacggccaccgcntctcacacggatacggtagacaacata 481

                                                        
Query: 585 gccctgctttgccttgaatccgagacggcgtgccctgtcggggcg 629
            |||||||| |||||| |||||||||| || ||| | ||||||||
Sbjct: 480 accctgcttggccttgtatccgagacgacgagccttatcggggcg 436



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 354 acaaggatgacctcaaagtacttgtaggtagaatcctcattcacccagtaggagttgagc 413
           |||||||| ||||| |||||||||||||| || ||||  || | |||||||||||| || 
Sbjct: 784 acaaggataacctcgaagtacttgtaggtggagtcctggttgatccagtaggagttcagg 725

                
Query: 414 acacg 418
           |||||
Sbjct: 724 acacg 720



to top

>gb|AF230646.1|AF230646 Tortula ruralis large subunit ribosomal protein L15 (Rpl15) mRNA,
           complete cds
          Length = 786

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 165/202 (81%), Gaps = 2/202 (0%)
 Strand = Plus / Minus

                                                                       
Query: 357 aggatgacctcaaagtacttgtaggtagaatcctcattcacccagtaggagttgagcaca 416
           ||||||| ||| ||||||||||| || || ||||  || | ||||||||||||||| || 
Sbjct: 456 aggatgatctcgaagtacttgtacgtcgagtcctggttgatccagtaggagttgagaacc 397

                                                                       
Query: 417 cgaagaccaccaagcttgcgcccagctctttcctcagcaacagacctcttgttcctttgg 476
           |  || || |||||||||||||| || |  ||||| || |||||||||  ||| |  |||
Sbjct: 396 ctgaggcctccaagcttgcgccctgcacgctcctccgccacagacctcaagttacgctgg 337

                                                                       
Query: 477 aacttgagctgggtaatacccctggtgcttgggctta-ccataaacaatacccttgggca 535
           ||||| ||||| || |||||| |||| |||||||||  ||||| ||||||||||||| ||
Sbjct: 336 aacttaagctgcgtgataccc-tggttcttgggcttttccatacacaatacccttggcca 278

                                 
Query: 536 cgggcctcttccggccaccacg 557
           | |||||||||||||| |||||
Sbjct: 277 ccggcctcttccggcctccacg 256



to top

>ref|NM_117773.2| Arabidopsis thaliana structural constituent of ribosome AT4G16720
           mRNA, complete cds
          Length = 873

 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 113/136 (83%)
 Strand = Plus / Minus

                                                                       
Query: 276 agctcacggtgcttatgcacaggcttgcagagccagttgatccttgggtcgttacggaca 335
           |||||||||||||| || || || ||||||| ||||||||| || ||||| ||||| |||
Sbjct: 549 agctcacggtgcttgtgaactgggttgcagatccagttgattctcgggtcattacgcaca 490

                                                                       
Query: 336 gcactgtgtgcaacatcaacaaggatgacctcaaagtacttgtaggtagaatcctcattc 395
           ||| |||||||    ||||| | ||||| |||  ||||||||||||| ||||||||||| 
Sbjct: 489 gcattgtgtgctgggtcaaccaagatgatctcgtagtacttgtaggtcgaatcctcattg 430

                           
Query: 396 acccagtaggagttga 411
           | |||||| |||||||
Sbjct: 429 agccagtaagagttga 414



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 80/93 (86%)
 Strand = Plus / Minus

                                                                       
Query: 508 ggcttaccataaacaatacccttgggcacgggcctcttccggccaccacgcctgacacgg 567
           ||||||||||| ||||||||||| ||||| |||||||| || |||||||| || ||||| 
Sbjct: 318 ggcttaccatacacaatacccttaggcactggcctcttgcgtccaccacgtctcacacgt 259

                                            
Query: 568 atccggtagacaacatagccctgctttgccttg 600
           |  ||||| |||||| |||||||||| ||||||
Sbjct: 258 acacggtacacaacaaagccctgcttggccttg 226



to top

>gb|AY143818.1| Arabidopsis thaliana At4g16720/dl4385c mRNA, complete cds
          Length = 615

 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 113/136 (83%)
 Strand = Plus / Minus

                                                                       
Query: 276 agctcacggtgcttatgcacaggcttgcagagccagttgatccttgggtcgttacggaca 335
           |||||||||||||| || || || ||||||| ||||||||| || ||||| ||||| |||
Sbjct: 482 agctcacggtgcttgtgaactgggttgcagatccagttgattctcgggtcattacgcaca 423

                                                                       
Query: 336 gcactgtgtgcaacatcaacaaggatgacctcaaagtacttgtaggtagaatcctcattc 395
           ||| |||||||    ||||| | ||||| |||  ||||||||||||| ||||||||||| 
Sbjct: 422 gcattgtgtgctgggtcaaccaagatgatctcgtagtacttgtaggtcgaatcctcattg 363

                           
Query: 396 acccagtaggagttga 411
           | |||||| |||||||
Sbjct: 362 agccagtaagagttga 347



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 80/93 (86%)
 Strand = Plus / Minus

                                                                       
Query: 508 ggcttaccataaacaatacccttgggcacgggcctcttccggccaccacgcctgacacgg 567
           ||||||||||| ||||||||||| ||||| |||||||| || |||||||| || ||||| 
Sbjct: 251 ggcttaccatacacaatacccttaggcactggcctcttgcgtccaccacgtctcacacgt 192

                                            
Query: 568 atccggtagacaacatagccctgctttgccttg 600
           |  ||||| |||||| |||||||||| ||||||
Sbjct: 191 acacggtacacaacaaagccctgcttggccttg 159



to top

>gb|AY133797.1| Arabidopsis thaliana clone U10046 putative ribosomal protein
           (At4g16720) mRNA, complete cds
          Length = 646

 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 113/136 (83%)
 Strand = Plus / Minus

                                                                       
Query: 276 agctcacggtgcttatgcacaggcttgcagagccagttgatccttgggtcgttacggaca 335
           |||||||||||||| || || || ||||||| ||||||||| || ||||| ||||| |||
Sbjct: 482 agctcacggtgcttgtgaactgggttgcagatccagttgattctcgggtcattacgcaca 423

                                                                       
Query: 336 gcactgtgtgcaacatcaacaaggatgacctcaaagtacttgtaggtagaatcctcattc 395
           ||| |||||||    ||||| | ||||| |||  ||||||||||||| ||||||||||| 
Sbjct: 422 gcattgtgtgctgggtcaaccaagatgatctcgtagtacttgtaggtcgaatcctcattg 363

                           
Query: 396 acccagtaggagttga 411
           | |||||| |||||||
Sbjct: 362 agccagtaagagttga 347



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 80/93 (86%)
 Strand = Plus / Minus

                                                                       
Query: 508 ggcttaccataaacaatacccttgggcacgggcctcttccggccaccacgcctgacacgg 567
           ||||||||||| ||||||||||| ||||| |||||||| || |||||||| || ||||| 
Sbjct: 251 ggcttaccatacacaatacccttaggcactggcctcttgcgtccaccacgtctcacacgt 192

                                            
Query: 568 atccggtagacaacatagccctgctttgccttg 600
           |  ||||| |||||| |||||||||| ||||||
Sbjct: 191 acacggtacacaacaaagccctgcttggccttg 159



to top

>gb|AF370352.1| Arabidopsis thaliana putative ribosomal protein (At4g16720) mRNA,
           complete cds
          Length = 831

 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 113/136 (83%)
 Strand = Plus / Minus

                                                                       
Query: 276 agctcacggtgcttatgcacaggcttgcagagccagttgatccttgggtcgttacggaca 335
           |||||||||||||| || || || ||||||| ||||||||| || ||||| ||||| |||
Sbjct: 537 agctcacggtgcttgtgaactgggttgcagatccagttgattctcgggtcattacgcaca 478

                                                                       
Query: 336 gcactgtgtgcaacatcaacaaggatgacctcaaagtacttgtaggtagaatcctcattc 395
           ||| |||||||    ||||| | ||||| |||  ||||||||||||| ||||||||||| 
Sbjct: 477 gcattgtgtgctgggtcaaccaagatgatctcgtagtacttgtaggtcgaatcctcattg 418

                           
Query: 396 acccagtaggagttga 411
           | |||||| |||||||
Sbjct: 417 agccagtaagagttga 402



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 80/93 (86%)
 Strand = Plus / Minus

                                                                       
Query: 508 ggcttaccataaacaatacccttgggcacgggcctcttccggccaccacgcctgacacgg 567
           ||||||||||| ||||||||||| ||||| |||||||| || |||||||| || ||||| 
Sbjct: 306 ggcttaccatacacaatacccttaggcactggcctcttgcgtccaccacgtctcacacgt 247

                                            
Query: 568 atccggtagacaacatagccctgctttgccttg 600
           |  ||||| |||||| |||||||||| ||||||
Sbjct: 246 acacggtacacaacaaagccctgcttggccttg 214



to top

>gb|AY075603.1| Arabidopsis thaliana AT4g16720/dl4385c mRNA, complete cds
          Length = 764

 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 113/136 (83%)
 Strand = Plus / Minus

                                                                       
Query: 276 agctcacggtgcttatgcacaggcttgcagagccagttgatccttgggtcgttacggaca 335
           |||||||||||||| || || || ||||||| ||||||||| || ||||| ||||| |||
Sbjct: 509 agctcacggtgcttgtgaactgggttgcagatccagttgattctcgggtcattacgcaca 450

                                                                       
Query: 336 gcactgtgtgcaacatcaacaaggatgacctcaaagtacttgtaggtagaatcctcattc 395
           ||| |||||||    ||||| | ||||| |||  ||||||||||||| ||||||||||| 
Sbjct: 449 gcattgtgtgctgggtcaaccaagatgatctcgtagtacttgtaggtcgaatcctcattg 390

                           
Query: 396 acccagtaggagttga 411
           | |||||| |||||||
Sbjct: 389 agccagtaagagttga 374



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 80/93 (86%)
 Strand = Plus / Minus

                                                                       
Query: 508 ggcttaccataaacaatacccttgggcacgggcctcttccggccaccacgcctgacacgg 567
           ||||||||||| ||||||||||| ||||| |||||||| || |||||||| || ||||| 
Sbjct: 278 ggcttaccatacacaatacccttaggcactggcctcttgcgtccaccacgtctcacacgt 219

                                            
Query: 568 atccggtagacaacatagccctgctttgccttg 600
           |  ||||| |||||| |||||||||| ||||||
Sbjct: 218 acacggtacacaacaaagccctgcttggccttg 186



to top

>gb|AY058841.1| Arabidopsis thaliana AT4g16720/dl4385c mRNA, complete cds
          Length = 773

 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 113/136 (83%)
 Strand = Plus / Minus

                                                                       
Query: 276 agctcacggtgcttatgcacaggcttgcagagccagttgatccttgggtcgttacggaca 335
           |||||||||||||| || || || ||||||| ||||||||| || ||||| ||||| |||
Sbjct: 509 agctcacggtgcttgtgaactgggttgcagatccagttgattctcgggtcattacgcaca 450

                                                                       
Query: 336 gcactgtgtgcaacatcaacaaggatgacctcaaagtacttgtaggtagaatcctcattc 395
           ||| |||||||    ||||| | ||||| |||  ||||||||||||| ||||||||||| 
Sbjct: 449 gcattgtgtgctgggtcaaccaagatgatctcgtagtacttgtaggtcgaatcctcattg 390

                           
Query: 396 acccagtaggagttga 411
           | |||||| |||||||
Sbjct: 389 agccagtaagagttga 374



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 80/93 (86%)
 Strand = Plus / Minus

                                                                       
Query: 508 ggcttaccataaacaatacccttgggcacgggcctcttccggccaccacgcctgacacgg 567
           ||||||||||| ||||||||||| ||||| |||||||| || |||||||| || ||||| 
Sbjct: 278 ggcttaccatacacaatacccttaggcactggcctcttgcgtccaccacgtctcacacgt 219

                                            
Query: 568 atccggtagacaacatagccctgctttgccttg 600
           |  ||||| |||||| |||||||||| ||||||
Sbjct: 218 acacggtacacaacaaagccctgcttggccttg 186



to top

>emb|BX826781.1|CNS0A442 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB62ZG04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 744

 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 113/136 (83%)
 Strand = Plus / Minus

                                                                       
Query: 276 agctcacggtgcttatgcacaggcttgcagagccagttgatccttgggtcgttacggaca 335
           |||||||||||||| || || || ||||||| ||||||||| || ||||| ||||| |||
Sbjct: 479 agctcacggtgcttgtgaactgggttgcagatccagttgattctcgggtcattacgcaca 420

                                                                       
Query: 336 gcactgtgtgcaacatcaacaaggatgacctcaaagtacttgtaggtagaatcctcattc 395
           ||| |||||||    ||||| | ||||| |||  ||||||||||||| ||||||||||| 
Sbjct: 419 gcattgtgtgctgggtcaaccaagatgatctcgtagtacttgtaggtcgaatcctcattg 360

                           
Query: 396 acccagtaggagttga 411
           | |||||| |||||||
Sbjct: 359 agccagtaagagttga 344



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 80/93 (86%)
 Strand = Plus / Minus

                                                                       
Query: 508 ggcttaccataaacaatacccttgggcacgggcctcttccggccaccacgcctgacacgg 567
           ||||||||||| ||||||||||| ||||| |||||||| || |||||||| || ||||| 
Sbjct: 248 ggcttaccatacacaatacccttaggcactggcctcttgcgtccaccacgtctcacacgt 189

                                            
Query: 568 atccggtagacaacatagccctgctttgccttg 600
           |  ||||| |||||| |||||||||| ||||||
Sbjct: 188 acacggtacacaacaaagccctgcttggccttg 156



to top

>emb|BX828421.1|CNS0A3XR Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH87ZH03 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 784

 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 113/136 (83%)
 Strand = Plus / Minus

                                                                       
Query: 276 agctcacggtgcttatgcacaggcttgcagagccagttgatccttgggtcgttacggaca 335
           |||||||||||||| || || || ||||||| ||||||||| || ||||| ||||| |||
Sbjct: 524 agctcacggtgcttgtgaactgggttgcagatccagttgattctcgggtcattacgcaca 465

                                                                       
Query: 336 gcactgtgtgcaacatcaacaaggatgacctcaaagtacttgtaggtagaatcctcattc 395
           ||| |||||||    ||||| | ||||| |||  ||||||||||||| ||||||||||| 
Sbjct: 464 gcattgtgtgctgggtcaaccaagatgatctcgtagtacttgtaggtcgaatcctcattg 405

                           
Query: 396 acccagtaggagttga 411
           | |||||| |||||||
Sbjct: 404 agccagtaagagttga 389



 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 79/93 (84%)
 Strand = Plus / Minus

                                                                       
Query: 508 ggcttaccataaacaatacccttgggcacgggcctcttccggccaccacgcctgacacgg 567
           ||||||||||| ||||||||||| ||||| |||||||| || |||||||| || | ||| 
Sbjct: 293 ggcttaccatacacaatacccttaggcactggcctcttgcgtccaccacgtctcaaacgt 234

                                            
Query: 568 atccggtagacaacatagccctgctttgccttg 600
           |  ||||| |||||| |||||||||| ||||||
Sbjct: 233 acacggtacacaacaaagccctgcttggccttg 201



to top

>emb|Y08859.1|NP60SRL15 N.plumbaginifolia mRNA for 60S ribosomal protein L15
          Length = 620

 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 134/164 (81%)
 Strand = Plus / Minus

                                                                       
Query: 249 ttctttccagctgaagtgagaccacgcagctcacggtgcttatgcacaggcttgcagagc 308
           ||||| || ||||| ||||||||||| || || |  ||||||||||| || ||||||| |
Sbjct: 173 ttcttaccggctgaggtgagaccacgaagttctctatgcttatgcactgggttgcagatc 114

                                                                       
Query: 309 cagttgatccttgggtcgttacggacagcactgtgtgcaacatcaacaaggatgacctca 368
           |||||||||||||| ||||| || | ||||   || ||  | ||||| |  || ||||||
Sbjct: 113 cagttgatccttggatcgttgcgaatagcagcatgggcggcgtcaactaatatcacctca 54

                                                       
Query: 369 aagtacttgtaggtagaatcctcattcacccagtaggagttgag 412
           |||||||||||||||||||||||||| | |||||| || |||||
Sbjct: 53  aagtacttgtaggtagaatcctcattaatccagtaagaattgag 10



to top

>emb|Y15321.1|ASRP115 Aspergillus niger mRNA for ribosomal protein L15
          Length = 805

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 536 cgggcctcttccggccaccacgcctgacacggatccggtagacaacatagccctgctttg 595
           |||| ||||| || ||||| || || |||||||| ||||||||||||||||||||||| |
Sbjct: 247 cgggtctcttacgaccaccgcgtctcacacggatacggtagacaacatagccctgcttgg 188

                                             
Query: 596 ccttgaatccgagacggcgtgccctgtcggggcg 629
           ||||| | |||||||| || ||| ||||||||||
Sbjct: 187 ccttgtagccgagacgacgagccttgtcggggcg 154



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 357 aggatgacctcaaagtacttgtaggtagaatcctcattcacccagtaggagttgagcaca 416
           ||||||||||| |||||||||||||| || ||||  || | |||||||||||| || |||
Sbjct: 425 aggatgacctcgaagtacttgtaggtggagtcctggttgatccagtaggagttcaggaca 366

             
Query: 417 cg 418
           ||
Sbjct: 365 cg 364



to top

>gb|DQ284461.1| Solanum tuberosum clone 071F06 60S ribosomal protein L15-like mRNA,
           complete cds
          Length = 721

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 66/74 (89%)
 Strand = Plus / Minus

                                                                       
Query: 249 ttctttccagctgaagtgagaccacgcagctcacggtgcttatgcacaggcttgcagagc 308
           ||||| ||||||||||||||||||||||  || | |||||||||||| || ||||||| |
Sbjct: 517 ttcttaccagctgaagtgagaccacgcaattctctgtgcttatgcactgggttgcagatc 458

                         
Query: 309 cagttgatccttgg 322
           ||||||||||||||
Sbjct: 457 cagttgatccttgg 444



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 109/132 (82%)
 Strand = Plus / Minus

                                                                       
Query: 506 tgggcttaccataaacaatacccttgggcacgggcctcttccggccaccacgcctgacac 565
           ||||||||||||| |||||||||||||  || ||||||||||  ||||||||  | ||||
Sbjct: 261 tgggcttaccatacacaatacccttggaaacaggcctcttccttccaccacgtttcacac 202

                                                                       
Query: 566 ggatccggtagacaacatagccctgctttgccttgaatccgagacggcgtgccctgtcgg 625
           | |  || ||||| |||||||||||||| |||||| |||| |  ||||||||| |||| |
Sbjct: 201 gaacacgatagaccacatagccctgcttggccttgtatcccaagcggcgtgccttgtcag 142

                       
Query: 626 ggcgggtgggcc 637
           | ||||| ||||
Sbjct: 141 gacgggtaggcc 130



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                       
Query: 363 acctcaaagtacttgtaggtagaatcctcattcacccagtaggagttgagcacacgaaga 422
           |||| ||||||||||||||||||||||||||| | |||||| ||||| || || | ||||
Sbjct: 403 acctaaaagtacttgtaggtagaatcctcattaatccagtaagagttcaggactctaaga 344

                                                 
Query: 423 ccaccaagcttgcgcccagctctttcctcagcaacaga 460
           ||||| | ||| |  ||||| |  ||||||||||||||
Sbjct: 343 ccacccaacttccttccagcacgctcctcagcaacaga 306



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 145 aacggtagcggcgaagggagacagtctggttcctcttccaagtggctctccttgaggg 202
           ||||||| |||||||| || | |||||||||||| ||||| || || || ||||||||
Sbjct: 621 aacggtaacggcgaagagatagagtctggttccttttccaggttgcccttcttgaggg 564



to top

>emb|BX827700.1|CNS0A3Y3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH11ZE06 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 784

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 80/93 (86%)
 Strand = Plus / Minus

                                                                       
Query: 508 ggcttaccataaacaatacccttgggcacgggcctcttccggccaccacgcctgacacgg 567
           ||||||||||| ||||||||||| ||||| |||||||| || |||||||| || ||||| 
Sbjct: 248 ggcttaccatacacaatacccttaggcactggcctcttgcgtccaccacgtctcacacgt 189

                                            
Query: 568 atccggtagacaacatagccctgctttgccttg 600
           |  ||||| |||||| |||||||||| ||||||
Sbjct: 188 acacggtacacaacaaagccctgcttggccttg 156



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 112/136 (82%)
 Strand = Plus / Minus

                                                                       
Query: 276 agctcacggtgcttatgcacaggcttgcagagccagttgatccttgggtcgttacggaca 335
           |||||||||||||| |  || || ||||||| ||||||||| || ||||| ||||| |||
Sbjct: 479 agctcacggtgcttgttaactgggttgcagatccagttgattctcgggtcattacgcaca 420

                                                                       
Query: 336 gcactgtgtgcaacatcaacaaggatgacctcaaagtacttgtaggtagaatcctcattc 395
           ||| |||||||    ||||| | ||||| |||  ||||||||||||| ||||||||||| 
Sbjct: 419 gcattgtgtgctgggtcaaccaagatgatctcgtagtacttgtaggtcgaatcctcattg 360

                           
Query: 396 acccagtaggagttga 411
           | |||||| |||||||
Sbjct: 359 agccagtaagagttga 344



to top

>ref|XM_652957.1| Aspergillus nidulans FGSC A4 60S ribosomal protein L15 (AN0445.2),
           mRNA
          Length = 612

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 86/102 (84%)
 Strand = Plus / Minus

                                                                       
Query: 525 acccttgggcacgggcctcttccggccaccacgcctgacacggatccggtagacaacata 584
           ||||||||| ||||||||||| |||||||| || |  |||||||  ||||||| ||||||
Sbjct: 234 acccttgggaacgggcctcttgcggccaccgcggcgcacacggacacggtagataacata 175

                                                     
Query: 585 gccctgctttgccttgaatccgagacggcgtgccctgtcggg 626
            |||||||| |||||| | |||||||| || ||| |||||||
Sbjct: 174 tccctgcttagccttgtaaccgagacgacgggccttgtcggg 133



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                       
Query: 354 acaaggatgacctcaaagtacttgtaggtagaatcctcattcacccagtaggagttgagc 413
           |||||||||||||| |||||||||||||| || ||||  || | |||||||||||| || 
Sbjct: 404 acaaggatgacctcgaagtacttgtaggtggagtcctggttgatccagtaggagttcagg 345

                
Query: 414 acacg 418
           |||||
Sbjct: 344 acacg 340



to top

>emb|BX826761.1|CNS0A47D Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB61ZC02 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 253

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 107/130 (82%)
 Strand = Plus / Minus

                                                                       
Query: 506 tgggcttaccataaacaatacccttgggcacgggcctcttccggccaccacgcctgacac 565
           |||| ||||| || || |||||||| ||||| |||||||| || |||||||| ||||| |
Sbjct: 234 tgggtttaccgtacacgatacccttaggcactggcctcttgcgtccaccacgtctgactc 175

                                                                       
Query: 566 ggatccggtagacaacatagccctgctttgccttgaatccgagacggcgtgccctgtcgg 625
           | |  |||||||||||| | |||||||| |||||| | |||||||| || ||| ||||||
Sbjct: 174 gaacacggtagacaacaaacccctgcttggccttgtagccgagacgacgagccttgtcgg 115

                     
Query: 626 ggcgggtggg 635
           | || |||||
Sbjct: 114 gacgagtggg 105



to top

>ref|XM_503229.1| Yarrowia lipolytica CLIB122, YALI0D24387g predicted mRNA
          Length = 612

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                   
Query: 357 aggatgacctcaaagtacttgtaggtagaatcctcattcacccagtaggagttgag 412
           |||||||||||||||||||||||||| || ||||  || |||||||||||||||||
Sbjct: 401 aggatgacctcaaagtacttgtaggtggagtcctggttgacccagtaggagttgag 346



to top

>emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB122 of Yarrowia lipolytica
          Length = 3633272

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                       
Query: 357     aggatgacctcaaagtacttgtaggtagaatcctcattcacccagtaggagttgag 412
               |||||||||||||||||||||||||| || ||||  || |||||||||||||||||
Sbjct: 3231935 aggatgacctcaaagtacttgtaggtggagtcctggttgacccagtaggagttgag 3231880



to top

>ref|XM_952106.1| Neurospora crassa OR74A 60S RIBOSOMAL PROTEIN L15 (NCU01776.1)
           partial mRNA
          Length = 612

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 92/111 (82%)
 Strand = Plus / Minus

                                                                       
Query: 525 acccttgggcacgggcctcttccggccaccacgcctgacacggatccggtagacaacata 584
           ||||||||| |||||| |||| || ||||| || | |||||||   |||||||  |||||
Sbjct: 234 acccttggggacgggcttcttgcgaccaccgcgacggacacgggcgcggtagatgacata 175

                                                              
Query: 585 gccctgctttgccttgaatccgagacggcgtgccctgtcggggcgggtggg 635
           ||||||||| |||||| | ||||| ||||| ||| ||||||||||| ||||
Sbjct: 174 gccctgcttggccttgtagccgaggcggcgggccttgtcggggcggctggg 124



 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 354 acaaggatgacctcaaagtacttgtaggtagaatcctcattcacccagtaggagttgagc 413
           |||||||| ||||| ||||||||||||||||| ||||  || | ||||||||||||||| 
Sbjct: 404 acaaggataacctcgaagtacttgtaggtagagtcctggttgatccagtaggagttgagg 345

                   
Query: 414 acacgaag 421
           || |||||
Sbjct: 344 acgcgaag 337



to top

>ref|XM_328214.1| Neurospora crassa OR74A 60S RIBOSOMAL PROTEIN L15 (NCU01776.1)
           partial mRNA
          Length = 612

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 92/111 (82%)
 Strand = Plus / Minus

                                                                       
Query: 525 acccttgggcacgggcctcttccggccaccacgcctgacacggatccggtagacaacata 584
           ||||||||| |||||| |||| || ||||| || | |||||||   |||||||  |||||
Sbjct: 234 acccttggggacgggcttcttgcgaccaccgcgacggacacgggcgcggtagatgacata 175

                                                              
Query: 585 gccctgctttgccttgaatccgagacggcgtgccctgtcggggcgggtggg 635
           ||||||||| |||||| | ||||| ||||| ||| ||||||||||| ||||
Sbjct: 174 gccctgcttggccttgtagccgaggcggcgggccttgtcggggcggctggg 124



 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 354 acaaggatgacctcaaagtacttgtaggtagaatcctcattcacccagtaggagttgagc 413
           |||||||| ||||| ||||||||||||||||| ||||  || | ||||||||||||||| 
Sbjct: 404 acaaggataacctcgaagtacttgtaggtagagtcctggttgatccagtaggagttgagg 345

                   
Query: 414 acacgaag 421
           || |||||
Sbjct: 344 acgcgaag 337



to top

>emb|Z97341.2|ATFCA6 Arabidopsis thaliana DNA chromosome 4, ESSA I FCA contig fragment No. 6
          Length = 213788

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 71/83 (85%)
 Strand = Plus / Plus

                                                                          
Query: 508    ggcttaccataaacaatacccttgggcacgggcctcttccggccaccacgcctgacacgg 567
              ||||||||||| ||||||||||| ||||| |||||||| || |||||||| || ||||| 
Sbjct: 165107 ggcttaccatacacaatacccttaggcactggcctcttgcgtccaccacgtctcacacgt 165166

                                     
Query: 568    atccggtagacaacatagccctg 590
              |  ||||| |||||| |||||||
Sbjct: 165167 acacggtacacaacaaagccctg 165189



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 95/115 (82%)
 Strand = Plus / Plus

                                                                          
Query: 276    agctcacggtgcttatgcacaggcttgcagagccagttgatccttgggtcgttacggaca 335
              |||||||||||||| || || || ||||||| ||||||||| || ||||| ||||| |||
Sbjct: 164790 agctcacggtgcttgtgaactgggttgcagatccagttgattctcgggtcattacgcaca 164849

                                                                     
Query: 336    gcactgtgtgcaacatcaacaaggatgacctcaaagtacttgtaggtagaatcct 390
              ||| |||||||    ||||| | ||||| |||  ||||||||||||| |||||||
Sbjct: 164850 gcattgtgtgctgggtcaaccaagatgatctcgtagtacttgtaggtcgaatcct 164904



to top

>emb|AL669999.1|NCB21D9 Neurospora crassa DNA linkage group II BAC clone B21D9
          Length = 71024

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 92/111 (82%)
 Strand = Plus / Plus

                                                                         
Query: 525   acccttgggcacgggcctcttccggccaccacgcctgacacggatccggtagacaacata 584
             ||||||||| |||||| |||| || ||||| || | |||||||   |||||||  |||||
Sbjct: 25470 acccttggggacgggcttcttgcgaccaccgcgacggacacgggcgcggtagatgacata 25529

                                                                
Query: 585   gccctgctttgccttgaatccgagacggcgtgccctgtcggggcgggtggg 635
             ||||||||| |||||| | ||||| ||||| ||| ||||||||||| ||||
Sbjct: 25530 gccctgcttggccttgtagccgaggcggcgggccttgtcggggcggctggg 25580



 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 59/68 (86%)
 Strand = Plus / Plus

                                                                         
Query: 354   acaaggatgacctcaaagtacttgtaggtagaatcctcattcacccagtaggagttgagc 413
             |||||||| ||||| ||||||||||||||||| ||||  || | ||||||||||||||| 
Sbjct: 25239 acaaggataacctcgaagtacttgtaggtagagtcctggttgatccagtaggagttgagg 25298

                     
Query: 414   acacgaag 421
             || |||||
Sbjct: 25299 acgcgaag 25306



to top

>emb|AL161544.2|ATCHRIV44 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 44
          Length = 198735

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 71/83 (85%)
 Strand = Plus / Plus

                                                                          
Query: 508    ggcttaccataaacaatacccttgggcacgggcctcttccggccaccacgcctgacacgg 567
              ||||||||||| ||||||||||| ||||| |||||||| || |||||||| || ||||| 
Sbjct: 143035 ggcttaccatacacaatacccttaggcactggcctcttgcgtccaccacgtctcacacgt 143094

                                     
Query: 568    atccggtagacaacatagccctg 590
              |  ||||| |||||| |||||||
Sbjct: 143095 acacggtacacaacaaagccctg 143117



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 95/115 (82%)
 Strand = Plus / Plus

                                                                          
Query: 276    agctcacggtgcttatgcacaggcttgcagagccagttgatccttgggtcgttacggaca 335
              |||||||||||||| || || || ||||||| ||||||||| || ||||| ||||| |||
Sbjct: 142718 agctcacggtgcttgtgaactgggttgcagatccagttgattctcgggtcattacgcaca 142777

                                                                     
Query: 336    gcactgtgtgcaacatcaacaaggatgacctcaaagtacttgtaggtagaatcct 390
              ||| |||||||    ||||| | ||||| |||  ||||||||||||| |||||||
Sbjct: 142778 gcattgtgtgctgggtcaaccaagatgatctcgtagtacttgtaggtcgaatcct 142832



to top

>gb|AY850936.1| Pectinaria gouldii ribosomal protein L15 mRNA, complete cds
          Length = 803

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 93/113 (82%)
 Strand = Plus / Minus

                                                                       
Query: 525 acccttgggcacgggcctcttccggccaccacgcctgacacggatccggtagacaacata 584
           ||||||||||||||||||||| ||||||||||| |  ||||| |  |||||||  || ||
Sbjct: 272 acccttgggcacgggcctcttgcggccaccacggcgcacacgaacacggtagatcacgta 213

                                                                
Query: 585 gccctgctttgccttgaatccgagacggcgtgccctgtcggggcgggtgggcc 637
            ||||||||||||||| | |||||   |||||| |  || |||||||||||||
Sbjct: 212 accctgctttgccttgtagccgagcttgcgtgcacgctctgggcgggtgggcc 160



to top

>gb|AY111002.1| Zea mays CL3259_1 mRNA sequence
          Length = 1526

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 42/45 (93%)
 Strand = Plus / Plus

                                                         
Query: 503  gcttgggcttaccataaacaatacccttgggcacgggcctcttcc 547
            |||||||||| ||||| ||||||||||||||||| ||||||||||
Sbjct: 1109 gcttgggcttgccatagacaatacccttgggcacaggcctcttcc 1153



to top

>gb|AY857429.1| Suberites domuncula L15 mRNA, partial cds
          Length = 570

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 64/75 (85%)
 Strand = Plus / Minus

                                                                       
Query: 354 acaaggatgacctcaaagtacttgtaggtagaatcctcattcacccagtaggagttgagc 413
           ||||| |||||||||||| ||||||||   || |||||   ||||||||| |||||||||
Sbjct: 404 acaagaatgacctcaaagaacttgtagactgagtcctcggccacccagtaagagttgagc 345

                          
Query: 414 acacgaagaccacca 428
           |||||||| ||||||
Sbjct: 344 acacgaagtccacca 330



to top

>ref|XM_381021.1| Gibberella zeae PH-1 chromosome 1 RL15_NEUCR 60S ribosomal protein
           L15 (FG00845.1) partial mRNA
          Length = 612

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 550 ccaccacgcctgacacggatccggtagacaacatagccctgctttgccttgaatccgaga 609
           |||||||| | ||| ||||  |||||||  |||||||||||||| |||||| ||||||||
Sbjct: 209 ccaccacggcggacgcggacacggtagatgacatagccctgcttggccttgtatccgaga 150

                         
Query: 610 cggcgtgccctgtc 623
           ||||| ||| ||||
Sbjct: 149 cggcgagccttgtc 136



 Score = 48.1 bits (24), Expect = 0.039
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 357 aggatgacctcaaagtacttgtaggtagaatcctcattcacccagtaggagttgag 412
           |||||||||||  |||||||||||||||| ||||  || | |||||| ||||||||
Sbjct: 401 aggatgacctcgtagtacttgtaggtagagtcctggttgatccagtaagagttgag 346



to top

>emb|BX053479.1|CNS09DFF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31AF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 531

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 584 agccctgctttgccttgaatccgagacggcgtgccctgtcggggcg 629
           |||||||||| |||||| ||||||||||||||||| |||| |||||
Sbjct: 125 agccctgcttggccttgtatccgagacggcgtgccttgtccgggcg 80



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 250 tctttccagctgaagtgagaccacgcagctcacggtgcttatgcac 295
           |||||||||| |||||||||||||| || ||||| ||||| |||||
Sbjct: 458 tctttccagcggaagtgagaccacgaagttcacgatgcttgtgcac 413



to top

>emb|BX072434.1|CNS09S1Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAD1BD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 690

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 584 agccctgctttgccttgaatccgagacggcgtgccctgtcggggcg 629
           |||||||||| |||||| ||||||||||||||||| |||| |||||
Sbjct: 559 agccctgcttggccttgtatccgagacggcgtgccttgtccgggcg 604



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                         
Query: 250 tctttccagctgaagtgagaccacgcagctcacggtgcttatgcac 295
           |||||||||| |||||||||||||| || ||||| ||||| |||||
Sbjct: 226 tctttccagcggaagtgagaccacgaagttcacgatgcttgtgcac 271



to top

>emb|BX072433.1|CNS09S1X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAD1BD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 676

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 584 agccctgctttgccttgaatccgagacggcgtgccctgtcggggcg 629
           |||||||||| |||||| ||||||||||||||||| |||| |||||
Sbjct: 243 agccctgcttggccttgtatccgagacggcgtgccttgtccgggcg 198



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 250 tctttccagctgaagtgagaccacgcagctcacggtgcttatgcac 295
           |||||||||| |||||||||||||| || ||||| ||||| |||||
Sbjct: 576 tctttccagcggaagtgagaccacgaagttcacgatgcttgtgcac 531



to top

>emb|BX051216.1|CNS09BOK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC28BF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 212

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 584 agccctgctttgccttgaatccgagacggcgtgccctgtcggggcg 629
           |||||||||| |||||| ||||||||||||||||| |||| |||||
Sbjct: 199 agccctgcttggccttgtatccgagacggcgtgccttgtccgggcg 154



to top

>emb|BX047576.1|CNS098VG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC22AE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 821

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 584 agccctgctttgccttgaatccgagacggcgtgccctgtcggggcg 629
           |||||||||| |||||| ||||||||||||||||| |||| |||||
Sbjct: 549 agccctgcttggccttgtatccgagacggcgtgccttgtccgggcg 594



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                         
Query: 250 tctttccagctgaagtgagaccacgcagctcacggtgcttatgcac 295
           |||||||||| |||||||||||||| || ||||| ||||| |||||
Sbjct: 216 tctttccagcggaagtgagaccacgaagttcacgatgcttgtgcac 261



to top

>emb|BX047575.1|CNS098VF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC22AE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 798

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 584 agccctgctttgccttgaatccgagacggcgtgccctgtcggggcg 629
           |||||||||| |||||| ||||||||||||||||| |||| |||||
Sbjct: 217 agccctgcttggccttgtatccgagacggcgtgccttgtccgggcg 172



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 250 tctttccagctgaagtgagaccacgcagctcacggtgcttatgcac 295
           |||||||||| |||||||||||||| || ||||| ||||| |||||
Sbjct: 550 tctttccagcggaagtgagaccacgaagttcacgatgcttgtgcac 505



to top

>emb|BX037929.1|CNS091FH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB2AD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 665

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 584 agccctgctttgccttgaatccgagacggcgtgccctgtcggggcg 629
           |||||||||| |||||| ||||||||||||||||| |||| |||||
Sbjct: 571 agccctgcttggccttgtatccgagacggcgtgccttgtccgggcg 616



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                         
Query: 250 tctttccagctgaagtgagaccacgcagctcacggtgcttatgcac 295
           |||||||||| |||||||||||||| || ||||| ||||| |||||
Sbjct: 238 tctttccagcggaagtgagaccacgaagttcacgatgcttgtgcac 283



to top

>emb|BX037928.1|CNS091FG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2AD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 747

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 584 agccctgctttgccttgaatccgagacggcgtgccctgtcggggcg 629
           |||||||||| |||||| ||||||||||||||||| |||| |||||
Sbjct: 238 agccctgcttggccttgtatccgagacggcgtgccttgtccgggcg 193



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 250 tctttccagctgaagtgagaccacgcagctcacggtgcttatgcac 295
           |||||||||| |||||||||||||| || ||||| ||||| |||||
Sbjct: 571 tctttccagcggaagtgagaccacgaagttcacgatgcttgtgcac 526



to top

>emb|BX033074.1|CNS08XOM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49BD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 807

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 584 agccctgctttgccttgaatccgagacggcgtgccctgtcggggcg 629
           |||||||||| |||||| ||||||||||||||||| |||| |||||
Sbjct: 221 agccctgcttggccttgtatccgagacggcgtgccttgtccgggcg 176



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 250 tctttccagctgaagtgagaccacgcagctcacggtgcttatgcac 295
           |||||||||| |||||||||||||| || ||||| ||||| |||||
Sbjct: 554 tctttccagcggaagtgagaccacgaagttcacgatgcttgtgcac 509



to top

>emb|BX032977.1|CNS08XLX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49AH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 584 agccctgctttgccttgaatccgagacggcgtgccctgtcggggcg 629
           |||||||||| |||||| ||||||||||||||||| |||| |||||
Sbjct: 530 agccctgcttggccttgtatccgagacggcgtgccttgtccgggcg 575



to top

>emb|BX032976.1|CNS08XLW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49AH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 926

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 584 agccctgctttgccttgaatccgagacggcgtgccctgtcggggcg 629
           |||||||||| |||||| ||||||||||||||||| |||| |||||
Sbjct: 341 agccctgcttggccttgtatccgagacggcgtgccttgtccgggcg 296



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 250 tctttccagctgaagtgagaccacgcagctcacggtgcttatgcac 295
           |||||||||| |||||||||||||| || ||||| ||||| |||||
Sbjct: 674 tctttccagcggaagtgagaccacgaagttcacgatgcttgtgcac 629



to top

>emb|BX030496.1|CNS08VP0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA45CB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 419

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 584 agccctgctttgccttgaatccgagacggcgtgccctgtcggggcg 629
           |||||||||| |||||| ||||||||||||||||| |||| |||||
Sbjct: 212 agccctgcttggccttgtatccgagacggcgtgccttgtccgggcg 167



to top

>emb|BX027332.1|CNS08T94 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA40DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 502

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 584 agccctgctttgccttgaatccgagacggcgtgccctgtcggggcg 629
           |||||||||| |||||| ||||||||||||||||| |||| |||||
Sbjct: 230 agccctgcttggccttgtatccgagacggcgtgccttgtccgggcg 185



to top

>emb|BX026784.1|CNS08STW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA40AH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 771

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 584 agccctgctttgccttgaatccgagacggcgtgccctgtcggggcg 629
           |||||||||| |||||| ||||||||||||||||| |||| |||||
Sbjct: 531 agccctgcttggccttgtatccgagacggcgtgccttgtccgggcg 576



to top

>emb|BX026783.1|CNS08STV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA40AH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 790

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 584 agccctgctttgccttgaatccgagacggcgtgccctgtcggggcg 629
           |||||||||| |||||| ||||||||||||||||| |||| |||||
Sbjct: 218 agccctgcttggccttgtatccgagacggcgtgccttgtccgggcg 173



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 250 tctttccagctgaagtgagaccacgcagctcacggtgcttatgcac 295
           |||||||||| |||||||||||||| || ||||| ||||| |||||
Sbjct: 552 tctttccagcggaagtgagaccacgaagttcacgatgcttgtgcac 507



to top

>emb|BX026696.1|CNS08SRG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA40AD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 797

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 584 agccctgctttgccttgaatccgagacggcgtgccctgtcggggcg 629
           |||||||||| |||||| ||||||||||||||||| |||| |||||
Sbjct: 531 agccctgcttggccttgtatccgagacggcgtgccttgtccgggcg 576



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                         
Query: 250 tctttccagctgaagtgagaccacgcagctcacggtgcttatgcac 295
           |||||||||| |||||||||||||| || ||||| ||||| |||||
Sbjct: 198 tctttccagcggaagtgagaccacgaagttcacgatgcttgtgcac 243



to top

>emb|BX026695.1|CNS08SRF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA40AD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 803

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 584 agccctgctttgccttgaatccgagacggcgtgccctgtcggggcg 629
           |||||||||| |||||| ||||||||||||||||| |||| |||||
Sbjct: 220 agccctgcttggccttgtatccgagacggcgtgccttgtccgggcg 175



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 250 tctttccagctgaagtgagaccacgcagctcacggtgcttatgcac 295
           |||||||||| |||||||||||||| || ||||| ||||| |||||
Sbjct: 553 tctttccagcggaagtgagaccacgaagttcacgatgcttgtgcac 508



to top

>emb|BX025590.1|CNS08RWQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA39AH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 832

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 584 agccctgctttgccttgaatccgagacggcgtgccctgtcggggcg 629
           |||||||||| |||||| ||||||||||||||||| |||| |||||
Sbjct: 227 agccctgcttggccttgtatccgagacggcgtgccttgtccgggcg 182



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 250 tctttccagctgaagtgagaccacgcagctcacggtgcttatgcac 295
           |||||||||| |||||||||||||| || ||||| ||||| |||||
Sbjct: 560 tctttccagcggaagtgagaccacgaagttcacgatgcttgtgcac 515



to top

>emb|BX025478.1|CNS08RTM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA39AD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 708

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 584 agccctgctttgccttgaatccgagacggcgtgccctgtcggggcg 629
           |||||||||| |||||| ||||||||||||||||| |||| |||||
Sbjct: 216 agccctgcttggccttgtatccgagacggcgtgccttgtccgggcg 171



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 250 tctttccagctgaagtgagaccacgcagctcacggtgcttatgcac 295
           |||||||||| |||||||||||||| || ||||| ||||| |||||
Sbjct: 549 tctttccagcggaagtgagaccacgaagttcacgatgcttgtgcac 504



to top

>emb|BX020533.1|CNS08O09 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA30BA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 812

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 584 agccctgctttgccttgaatccgagacggcgtgccctgtcggggcg 629
           |||||||||| |||||| ||||||||||||||||| |||| |||||
Sbjct: 525 agccctgcttggccttgtatccgagacggcgtgccttgtccgggcg 570



to top

>emb|BX018248.1|CNS08M8S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA27CF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 791

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 584 agccctgctttgccttgaatccgagacggcgtgccctgtcggggcg 629
           |||||||||| |||||| ||||||||||||||||| |||| |||||
Sbjct: 207 agccctgcttggccttgtatccgagacggcgtgccttgtccgggcg 162



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 250 tctttccagctgaagtgagaccacgcagctcacggtgcttatgcac 295
           |||||||||| |||||||||||||| || ||||| ||||| |||||
Sbjct: 540 tctttccagcggaagtgagaccacgaagttcacgatgcttgtgcac 495



to top

>emb|BX017046.1|CNS08LBE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA25CE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 307

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 584 agccctgctttgccttgaatccgagacggcgtgccctgtcggggcg 629
           |||||||||| |||||| ||||||||||||||||| |||| |||||
Sbjct: 155 agccctgcttggccttgtatccgagacggcgtgccttgtccgggcg 110



to top

>emb|BX016992.1|CNS08L9W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA25CB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 816

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 584 agccctgctttgccttgaatccgagacggcgtgccctgtcggggcg 629
           |||||||||| |||||| ||||||||||||||||| |||| |||||
Sbjct: 226 agccctgcttggccttgtatccgagacggcgtgccttgtccgggcg 181



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 250 tctttccagctgaagtgagaccacgcagctcacggtgcttatgcac 295
           |||||||||| |||||||||||||| || ||||| ||||| |||||
Sbjct: 559 tctttccagcggaagtgagaccacgaagttcacgatgcttgtgcac 514



to top

>emb|BX010475.1|CNS08G8V Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA16DD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 796

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 584 agccctgctttgccttgaatccgagacggcgtgccctgtcggggcg 629
           |||||||||| |||||| ||||||||||||||||| |||| |||||
Sbjct: 205 agccctgcttggccttgtatccgagacggcgtgccttgtccgggcg 160



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 250 tctttccagctgaagtgagaccacgcagctcacggtgcttatgcac 295
           |||||||||| |||||||||||||| || ||||| ||||| |||||
Sbjct: 538 tctttccagcggaagtgagaccacgaagttcacgatgcttgtgcac 493



to top

>ref|XM_315009.2| Anopheles gambiae str. PEST ENSANGP00000021358
           (ENSANGG00000018869), partial mRNA
          Length = 719

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 584 agccctgctttgccttgaatccgagacggcgtgccctgtcggggcg 629
           |||||||||| |||||| ||||||||||||||||| |||| |||||
Sbjct: 172 agccctgcttggccttgtatccgagacggcgtgccttgtccgggcg 127



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 250 tctttccagctgaagtgagaccacgcagctcacggtgcttatgcac 295
           |||||||||| |||||||||||||| || ||||| ||||| |||||
Sbjct: 505 tctttccagcggaagtgagaccacgaagttcacgatgcttgtgcac 460



to top

>ref|XM_557554.1| Anopheles gambiae str. PEST ENSANGP00000026442
           (ENSANGG00000018869), mRNA
          Length = 840

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 584 agccctgctttgccttgaatccgagacggcgtgccctgtcggggcg 629
           |||||||||| |||||| ||||||||||||||||| |||| |||||
Sbjct: 293 agccctgcttggccttgtatccgagacggcgtgccttgtccgggcg 248



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 250 tctttccagctgaagtgagaccacgcagctcacggtgcttatgcac 295
           |||||||||| |||||||||||||| || ||||| ||||| |||||
Sbjct: 626 tctttccagcggaagtgagaccacgaagttcacgatgcttgtgcac 581



to top

>gb|AY249425.1| Siniperca kneri ribosomal protein L15 (rpl15) mRNA, complete cds
          Length = 727

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 363 acctcaaagtacttgtaggtagaatcctcattcacccagtaggagttgagcac 415
           ||||||||| |||||||||| || ||||||  ||||||||||||||| |||||
Sbjct: 429 acctcaaagaacttgtaggtggagtcctcacccacccagtaggagttcagcac 377



to top

>gb|AY249417.1| Lateolabrax japonicus ribosomal protein L15 (rpl15) mRNA, complete
           cds
          Length = 721

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 363 acctcaaagtacttgtaggtagaatcctcattcacccagtaggag 407
           ||||||||| |||||||||| |||||||||  |||||||||||||
Sbjct: 432 acctcaaagaacttgtaggtggaatcctcacccacccagtaggag 388



to top

>gb|AE016819.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome VI,
              complete sequence
          Length = 1813164

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                          
Query: 354    acaaggatgacctcaaagtacttgtaggtagaatcctcattcacccagtaggagttgagc 413
              |||||||||||||| |||||||||||||| || ||||  || | |||||||||||| | |
Sbjct: 819630 acaaggatgacctcgaagtacttgtaggtggagtcctggttgatccagtaggagttcaac 819689

                   
Query: 414    acacg 418
              |||||
Sbjct: 819690 acacg 819694



to top

>ref|NM_211115.1| Eremothecium gossypii AFR214Cp (AFR214C), mRNA
          Length = 615

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                       
Query: 354 acaaggatgacctcaaagtacttgtaggtagaatcctcattcacccagtaggagttgagc 413
           |||||||||||||| |||||||||||||| || ||||  || | |||||||||||| | |
Sbjct: 404 acaaggatgacctcgaagtacttgtaggtggagtcctggttgatccagtaggagttcaac 345

                
Query: 414 acacg 418
           |||||
Sbjct: 344 acacg 340



to top

>gb|AY249416.1| Hypophthalmichthys molitrix ribosomal protein L15 (rpl15) mRNA,
           complete cds
          Length = 714

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 357 aggatgacctcaaagtacttgtaggtagaatcctcattcacccagtaggagttgagcaca 416
           ||||| || |||||| ||||||| || |||||||||  ||||||||||||||| ||||| 
Sbjct: 431 aggatcacttcaaagaacttgtatgtggaatcctcacccacccagtaggagtttagcacc 372

                   
Query: 417 cgaagacc 424
           || |||||
Sbjct: 371 cgcagacc 364



to top

>gb|U21746.1|BNU21746 Brassica napus ribosomal protein RL10 mRNA, partial cds
          Length = 266

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 144/180 (80%), Gaps = 2/180 (1%)
 Strand = Plus / Minus

                                                                       
Query: 447 tcctcagcaacagacctcttgttcctttggaacttgagctgggtaatacccctggtgctt 506
           |||||||||||||| |  ||| |||| ||||||||||| || ||||   |||||||   |
Sbjct: 264 tcctcagcaacagaacggttgctcctctggaacttgagttgagtaa-ctccctggtttgt 206

                                                                       
Query: 507 gggcttaccataaacaatacccttgggcacgggcctcttccggccaccacgcctgacacg 566
           ||| |||||||| |||||||| ||||| || |||||||| |  |||||||| || |||||
Sbjct: 205 gggtttaccatacacaatacctttggg-actggcctctttcttccaccacgtctcacacg 147

                                                                       
Query: 567 gatccggtagacaacatagccctgctttgccttgaatccgagacggcgtgccctgtcggg 626
            |  ||||| || ||| |||||||||| |||||| | || | |||||| ||| |||||||
Sbjct: 146 tacacggtacaccacaaagccctgcttggccttgtaacccaaacggcgagccttgtcggg 87



to top

>emb|CR717031.2|CNS0GG7K Tetraodon nigroviridis full-length cDNA
          Length = 698

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||| |||||||||||||| ||||||
Sbjct: 232 acacggatacggtagacgacatagccctgcttggccttg 194



to top

>ref|XM_341132.2| PREDICTED: Rattus norvegicus similar to chromosome 1 open reading
           frame 16 (predicted) (LOC360855), mRNA
          Length = 6649

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 435 cgcccagctctttcctcagcaacagac 461
           |||||||||||||||||||||||||||
Sbjct: 296 cgcccagctctttcctcagcaacagac 322



to top

>emb|BX052270.1|CNS09CHU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3BB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 934

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                         
Query: 584 agccctgctttgccttgaatccgagacggcgtgccctgtcggggcg 629
           ||||||||||  ||||| ||||||||||||||||| |||| |||||
Sbjct: 540 agccctgcttgaccttgtatccgagacggcgtgccttgtccgggcg 585



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                         
Query: 250 tctttccagctgaagtgagaccacgcagctcacggtgcttatgcac 295
           |||||||||| |||||||||||||| || ||||| ||||| |||||
Sbjct: 207 tctttccagcggaagtgagaccacgaagttcacgatgcttgtgcac 252



to top

>emb|BX052269.1|CNS09CHT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3BB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 948

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 250 tctttccagctgaagtgagaccacgcagctcacggtgcttatgcac 295
           |||||||||| |||||||||||||| || ||||| ||||| |||||
Sbjct: 896 tctttccagcggaagtgagaccacgaagttcacgatgcttgtgcac 851



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 584 agccctgctttgccttgaatccgagacggcgtgccctgtcggggcg 629
           ||||||||||  ||||| ||||||||||||||||| |||| |||||
Sbjct: 564 agccctgcttgaccttgtatccgagacggcgtgccttgtccgggcg 519



to top

>emb|Z69976.1|AGG5RIB6 A.gambiae mRNA for ribosomal protein RL10
          Length = 754

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 250 tctttccagctgaagtgagaccacgcagctcacggtgcttatgcac 295
           |||||||||| |||||||||||||| || ||||| ||||| |||||
Sbjct: 551 tctttccagcggaagtgagaccacgaagttcacgatgcttgtgcac 506



to top

>ref|XM_461011.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0F16258g)
           partial mRNA
          Length = 615

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 369 aagtacttgtaggtagaatcctcattcacccagtaggagtt 409
           |||||||||||||||||||| || || |||||||| |||||
Sbjct: 389 aagtacttgtaggtagaatcttcgttaacccagtaagagtt 349



to top

>gb|AF548318.1| Branchiostoma belcheri ribosomal protein L15 mRNA, complete cds
          Length = 726

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 525 acccttgggcacgggcctcttccggccaccacg 557
           |||||||||||||||| |||| |||||||||||
Sbjct: 259 acccttgggcacgggcttcttgcggccaccacg 227



to top

>gb|AY249420.1| Monopterus albus ribosomal protein L15 (rpl15) mRNA, complete cds
          Length = 715

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 363 acctcaaagtacttgtaggtagaatcctcattcacccagtaggagttgagcac 415
           ||||||||| | |||||||| || ||||||  ||||||||||||||| |||||
Sbjct: 428 acctcaaagaatttgtaggtggagtcctcacccacccagtaggagttaagcac 376



to top

>emb|CR382138.1| Debaryomyces hansenii chromosome F of strain CBS767 of Debaryomyces
               hansenii
          Length = 2336804

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                        
Query: 369     aagtacttgtaggtagaatcctcattcacccagtaggagtt 409
               |||||||||||||||||||| || || |||||||| |||||
Sbjct: 1284404 aagtacttgtaggtagaatcttcgttaacccagtaagagtt 1284444



to top

>emb|AL116499.1|CNS01D8B Botrytis cinerea strain T4 cDNA library
          Length = 650

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 70/85 (82%)
 Strand = Plus / Minus

                                                                       
Query: 547 cggccaccacgcctgacacggatccggtagacaacatagccctgctttgccttgaatccg 606
           ||||||||||| |  |||||||  ||||||| ||| || || ||||| |||||| | |||
Sbjct: 228 cggccaccacgacgaacacggacacggtagataacgtatccttgcttggccttgtaaccg 169

                                    
Query: 607 agacggcgtgccctgtcggggcggg 631
           |||||||| ||| |||| |||||||
Sbjct: 168 agacggcgggccttgtctgggcggg 144



to top

>emb|AL114521.1|CNS01BPD Botrytis cinerea strain T4 cDNA library
          Length = 660

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 70/85 (82%)
 Strand = Plus / Minus

                                                                       
Query: 547 cggccaccacgcctgacacggatccggtagacaacatagccctgctttgccttgaatccg 606
           ||||||||||| |  |||||||  ||||||| ||| || || ||||| |||||| | |||
Sbjct: 223 cggccaccacgacgaacacggacacggtagataacgtatccttgcttggccttgtaaccg 164

                                    
Query: 607 agacggcgtgccctgtcggggcggg 631
           |||||||| ||| |||| |||||||
Sbjct: 163 agacggcgggccttgtctgggcggg 139



to top

>emb|AL111401.1|CNS019AP Botrytis cinerea strain T4 cDNA library
          Length = 720

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 70/85 (82%)
 Strand = Plus / Minus

                                                                       
Query: 547 cggccaccacgcctgacacggatccggtagacaacatagccctgctttgccttgaatccg 606
           ||||||||||| |  |||||||  ||||||| ||| || || ||||| |||||| | |||
Sbjct: 223 cggccaccacgacgaacacggacacggtagataacgtatccttgcttggccttgtaaccg 164

                                    
Query: 607 agacggcgtgccctgtcggggcggg 631
           |||||||| ||| |||| |||||||
Sbjct: 163 agacggcgggccttgtctgggcggg 139



to top

>gb|AC162614.2| Mus musculus chromosome 7, clone RP23-421O10, complete sequence
          Length = 219414

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 434    gcgcccagctctttcctcagcaacagac 461
              |||||||||||| |||||||||||||||
Sbjct: 172090 gcgcccagctctctcctcagcaacagac 172117



to top

>gb|AC108840.13| Mus musculus chromosome 1, clone RP23-348P7, complete sequence
          Length = 209336

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 434    gcgcccagctctttcctcagcaacagac 461
              |||||||||||| |||||||||||||||
Sbjct: 140973 gcgcccagctctctcctcagcaacagac 140946



to top

>gb|BC081441.1| Mus musculus ribosomal protein L15, mRNA (cDNA clone MGC:102024
           IMAGE:6823341), complete cds
          Length = 709

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 434 gcgcccagctctttcctcagcaacagac 461
           |||||||||||| |||||||||||||||
Sbjct: 346 gcgcccagctctctcctcagcaacagac 319



to top

>gb|BC081442.1| Mus musculus ribosomal protein L15, mRNA (cDNA clone MGC:102025
           IMAGE:6824136), complete cds
          Length = 707

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 434 gcgcccagctctttcctcagcaacagac 461
           |||||||||||| |||||||||||||||
Sbjct: 342 gcgcccagctctctcctcagcaacagac 315



to top

>gb|BC079842.1| Mus musculus ribosomal protein L15, mRNA (cDNA clone MGC:100283
           IMAGE:5684456), complete cds
          Length = 709

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 434 gcgcccagctctttcctcagcaacagac 461
           |||||||||||| |||||||||||||||
Sbjct: 349 gcgcccagctctctcctcagcaacagac 322



to top

>ref|NM_025586.2| Mus musculus ribosomal protein L15 (Rpl15), mRNA
          Length = 996

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 434 gcgcccagctctttcctcagcaacagac 461
           |||||||||||| |||||||||||||||
Sbjct: 634 gcgcccagctctctcctcagcaacagac 607



to top

>gb|AC155314.2| Mus musculus BAC clone RP23-275G21 from chromosome 15, complete
             sequence
          Length = 205639

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 434   gcgcccagctctttcctcagcaacagac 461
             |||||||||||| |||||||||||||||
Sbjct: 79636 gcgcccagctctctcctcagcaacagac 79609



to top

>gb|AC164431.2| Mus musculus BAC clone RP23-430N15 from chromosome 17, complete sequence
          Length = 190724

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 434    gcgcccagctctttcctcagcaacagac 461
              |||||||||||| |||||||||||||||
Sbjct: 186300 gcgcccagctctctcctcagcaacagac 186327



to top

>gb|BC100335.1| Mus musculus ribosomal protein L15, mRNA (cDNA clone MGC:117637
           IMAGE:30935863), complete cds
          Length = 700

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 434 gcgcccagctctttcctcagcaacagac 461
           |||||||||||| |||||||||||||||
Sbjct: 329 gcgcccagctctctcctcagcaacagac 302



to top

>gb|AC165079.2| Mus musculus BAC clone RP24-92K17 from chromosome 16, complete sequence
          Length = 156977

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 434    gcgcccagctctttcctcagcaacagac 461
              |||||||||||| |||||||||||||||
Sbjct: 121255 gcgcccagctctctcctcagcaacagac 121282



to top

>ref|XR_002583.1| PREDICTED: Mus musculus similar to ribosomal protein L15
           (LOC669587), mRNA
          Length = 696

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 434 gcgcccagctctttcctcagcaacagac 461
           |||||||||||| |||||||||||||||
Sbjct: 334 gcgcccagctctctcctcagcaacagac 307



to top

>ref|XM_909622.2| PREDICTED: Mus musculus similar to ribosomal protein L15
           (LOC634785), mRNA
          Length = 711

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 434 gcgcccagctctttcctcagcaacagac 461
           |||||||||||| |||||||||||||||
Sbjct: 350 gcgcccagctctctcctcagcaacagac 323



to top

>ref|XM_975199.1| PREDICTED: Mus musculus similar to ribosomal protein L15
           (LOC384179), mRNA
          Length = 655

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 434 gcgcccagctctttcctcagcaacagac 461
           |||||||||||| |||||||||||||||
Sbjct: 341 gcgcccagctctctcctcagcaacagac 314



to top

>ref|XM_357471.4| PREDICTED: Mus musculus similar to ribosomal protein L15
           (LOC384179), mRNA
          Length = 655

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 434 gcgcccagctctttcctcagcaacagac 461
           |||||||||||| |||||||||||||||
Sbjct: 341 gcgcccagctctctcctcagcaacagac 314



to top

>ref|XM_912278.2| PREDICTED: Mus musculus similar to ribosomal protein L15
           (LOC384179), mRNA
          Length = 655

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 434 gcgcccagctctttcctcagcaacagac 461
           |||||||||||| |||||||||||||||
Sbjct: 341 gcgcccagctctctcctcagcaacagac 314



to top

>gb|AC130212.4| Mus musculus BAC clone RP23-461L3 from chromosome 15, complete sequence
          Length = 170741

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 434   gcgcccagctctttcctcagcaacagac 461
             |||||||||||| |||||||||||||||
Sbjct: 50050 gcgcccagctctctcctcagcaacagac 50077



to top

>gb|BC087917.1| Mus musculus ribosomal protein L15, mRNA (cDNA clone MGC:107261
           IMAGE:30299997), complete cds
          Length = 761

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 434 gcgcccagctctttcctcagcaacagac 461
           |||||||||||| |||||||||||||||
Sbjct: 389 gcgcccagctctctcctcagcaacagac 362



to top

>ref|NM_016989.1| Rattus norvegicus adenylate cyclase activating polypeptide 1
           (Adcyap1), mRNA
          Length = 2681

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                       
Query: 434 gcgcccagctctttcctcagcaacagac 461
           |||||||||||| |||||||||||||||
Sbjct: 327 gcgcccagctctctcctcagcaacagac 354



to top

>ref|XM_778953.1| PREDICTED: Strongylocentrotus purpuratus similar to ribosomal
           protein L15 (LOC578805), mRNA
          Length = 613

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 57/68 (83%)
 Strand = Plus / Minus

                                                                       
Query: 526 cccttgggcacgggcctcttccggccaccacgcctgacacggatccggtagacaacatag 585
           |||||||||||||||||||| || || ||||| |  | |||||| ||||||| ||| || 
Sbjct: 273 cccttgggcacgggcctcttgcgacctccacggcgaagacggatacggtagataacgtat 214

                   
Query: 586 ccctgctt 593
           ||||||||
Sbjct: 213 ccctgctt 206



to top

>gb|AY249421.1| Mylopharyngodon piceus ribosomal protein L15 (rpl15) mRNA, complete
           cds
          Length = 718

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 57/68 (83%)
 Strand = Plus / Minus

                                                                       
Query: 357 aggatgacctcaaagtacttgtaggtagaatcctcattcacccagtaggagttgagcaca 416
           ||||| || |||||| ||||||| || ||||| |||  ||||||||||||||| ||||| 
Sbjct: 433 aggataacttcaaagaacttgtatgtggaatcttcacccacccagtaggagtttagcacc 374

                   
Query: 417 cgaagacc 424
           || |||||
Sbjct: 373 cgcagacc 366



to top

>gb|AY249414.1| Ctenopharyngodon idella ribosomal protein L15 (rpl15) mRNA,
           complete cds
          Length = 719

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 57/68 (83%)
 Strand = Plus / Minus

                                                                       
Query: 357 aggatgacctcaaagtacttgtaggtagaatcctcattcacccagtaggagttgagcaca 416
           ||||| || |||||| ||||||| || ||||| |||  ||||||||||||||| ||||| 
Sbjct: 434 aggatcacttcaaagaacttgtatgtggaatcttcacccacccagtaggagtttagcacc 375

                   
Query: 417 cgaagacc 424
           || |||||
Sbjct: 374 cgcagacc 367



to top

>gb|AY249412.1| Aristichthys nobilis ribosomal protein L15 (rpl15) mRNA, complete
           cds
          Length = 715

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 57/68 (83%)
 Strand = Plus / Minus

                                                                       
Query: 357 aggatgacctcaaagtacttgtaggtagaatcctcattcacccagtaggagttgagcaca 416
           ||||| || |||||| ||||||| || ||||| |||  ||||||||||||||| ||||| 
Sbjct: 429 aggatcacttcaaagaacttgtatgtggaatcttcacccacccagtaggagtttagcacc 370

                   
Query: 417 cgaagacc 424
           || |||||
Sbjct: 369 cgcagacc 362



to top

>ref|XM_774933.1| PREDICTED: Strongylocentrotus purpuratus similar to ribosomal
           protein L15, transcript variant 1 (LOC574664), mRNA
          Length = 1062

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 57/68 (83%)
 Strand = Plus / Minus

                                                                       
Query: 526 cccttgggcacgggcctcttccggccaccacgcctgacacggatccggtagacaacatag 585
           |||||||||||||||||||| || || ||||| |  | |||||| ||||||| ||| || 
Sbjct: 260 cccttgggcacgggcctcttgcgacctccacggcgaagacggatacggtagataacgtat 201

                   
Query: 586 ccctgctt 593
           ||||||||
Sbjct: 200 ccctgctt 193



to top

>ref|XM_796630.1| PREDICTED: Strongylocentrotus purpuratus similar to ribosomal
           protein L15, transcript variant 2 (LOC574664), mRNA
          Length = 522

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 57/68 (83%)
 Strand = Plus / Minus

                                                                       
Query: 526 cccttgggcacgggcctcttccggccaccacgcctgacacggatccggtagacaacatag 585
           |||||||||||||||||||| || || ||||| |  | |||||| ||||||| ||| || 
Sbjct: 274 cccttgggcacgggcctcttgcgacctccacggcgaagacggatacggtagataacgtat 215

                   
Query: 586 ccctgctt 593
           ||||||||
Sbjct: 214 ccctgctt 207



to top

>gb|AC162911.2| Mus musculus BAC clone RP24-363M14 from chromosome 12, complete
             sequence
          Length = 150202

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 434   gcgcccagctctttcctcagcaacagac 461
             |||||||||||| |||||||||||||||
Sbjct: 72340 gcgcccagctctctcctcagcaacagac 72367



to top

>gb|AC164004.3| Mus musculus chromosome 5, clone RP23-58C20, complete sequence
          Length = 198872

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 434    gcgcccagctctttcctcagcaacagac 461
              |||||||||||| |||||||||||||||
Sbjct: 142858 gcgcccagctctctcctcagcaacagac 142885



to top

>gb|BC100561.1| Mus musculus ribosomal protein L15, mRNA (cDNA clone MGC:118629
           IMAGE:1361804), complete cds
          Length = 996

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 434 gcgcccagctctttcctcagcaacagac 461
           |||||||||||| |||||||||||||||
Sbjct: 634 gcgcccagctctctcctcagcaacagac 607



to top

>emb|AL663115.11| Mouse DNA sequence from clone RP23-452C23 on chromosome 11 Contains the
             gene for a novel protein simialr to cell division cycle
             associated 4 Cdca4, a ribosomal protein L15 (Rpl15)
             pseudogene, the 3' end of a novel gene and two CpG
             islands, complete sequence
          Length = 183089

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 434   gcgcccagctctttcctcagcaacagac 461
             |||||||||||| |||||||||||||||
Sbjct: 61103 gcgcccagctctctcctcagcaacagac 61130



to top

>emb|AL031798.1|SPCC576 S.pombe chromosome III cosmid c576
          Length = 35566

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 51/60 (85%)
 Strand = Plus / Minus

                                                                         
Query: 350   atcaacaaggatgacctcaaagtacttgtaggtagaatcctcattcacccagtaggagtt 409
             |||||||||||| ||||||||| ||||||| |||| ||| |  || |||||||| |||||
Sbjct: 20117 atcaacaaggataacctcaaagaacttgtaagtagcatcttggttaacccagtaagagtt 20058



to top

>emb|AL663059.5| Mouse DNA sequence from clone RP23-331C1 on chromosome 11 Contains a
             ribosomal protein L15 (Rpl15) pseudogene, complete
             sequence
          Length = 25668

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 434   gcgcccagctctttcctcagcaacagac 461
             |||||||||||| |||||||||||||||
Sbjct: 20104 gcgcccagctctctcctcagcaacagac 20077



to top

>dbj|AK152711.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830082P18 product:ribosomal
           protein L15, full insert sequence
          Length = 701

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 434 gcgcccagctctttcctcagcaacagac 461
           |||||||||||| |||||||||||||||
Sbjct: 360 gcgcccagctctctcctcagcaacagac 333



to top

>dbj|AK159183.1| Mus musculus osteoclast-like cell cDNA, RIKEN full-length enriched
           library, clone:I420007J19 product:ribosomal protein L15,
           full insert sequence
          Length = 701

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 434 gcgcccagctctttcctcagcaacagac 461
           |||||||||||| |||||||||||||||
Sbjct: 360 gcgcccagctctctcctcagcaacagac 333



to top

>dbj|AK151138.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830025L23 product:ribosomal
           protein L15, full insert sequence
          Length = 700

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 434 gcgcccagctctttcctcagcaacagac 461
           |||||||||||| |||||||||||||||
Sbjct: 359 gcgcccagctctctcctcagcaacagac 332



to top

>dbj|AK168807.1| Mus musculus 17 days embryo kidney cDNA, RIKEN full-length enriched
           library, clone:I920056F05 product:ribosomal protein L15,
           full insert sequence
          Length = 1830

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 434 gcgcccagctctttcctcagcaacagac 461
           |||||||||||| |||||||||||||||
Sbjct: 354 gcgcccagctctctcctcagcaacagac 327



to top

>dbj|AK169662.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
           full-length enriched library, clone:E430005C16
           product:ribosomal protein L15, full insert sequence
          Length = 701

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 434 gcgcccagctctttcctcagcaacagac 461
           |||||||||||| |||||||||||||||
Sbjct: 360 gcgcccagctctctcctcagcaacagac 333



to top

>dbj|AK159626.1| Mus musculus osteoclast-like cell cDNA, RIKEN full-length enriched
           library, clone:I420025P09 product:ribosomal protein L15,
           full insert sequence
          Length = 701

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 434 gcgcccagctctttcctcagcaacagac 461
           |||||||||||| |||||||||||||||
Sbjct: 360 gcgcccagctctctcctcagcaacagac 333



to top

>dbj|AK168125.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-length enriched
           library, clone:I730059H15 product:ribosomal protein L15,
           full insert sequence
          Length = 704

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 434 gcgcccagctctttcctcagcaacagac 461
           |||||||||||| |||||||||||||||
Sbjct: 363 gcgcccagctctctcctcagcaacagac 336



to top

>dbj|AK167996.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library,
           clone:I730046D23 product:ribosomal protein L15, full
           insert sequence
          Length = 702

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 434 gcgcccagctctttcctcagcaacagac 461
           |||||||||||| |||||||||||||||
Sbjct: 360 gcgcccagctctctcctcagcaacagac 333



to top

>dbj|AK010931.1| Mus musculus 13 days embryo liver cDNA, RIKEN full-length enriched
           library, clone:2510008H07 product:RIBOSOMAL PROTEIN L15
           (FRAGMENT) homolog [Mus musculus], full insert sequence
          Length = 704

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 434 gcgcccagctctttcctcagcaacagac 461
           |||||||||||| |||||||||||||||
Sbjct: 363 gcgcccagctctctcctcagcaacagac 336



to top

>dbj|AK010916.1| Mus musculus 13 days embryo liver cDNA, RIKEN full-length enriched
           library, clone:2510006H23 product:RIBOSOMAL PROTEIN L15
           (FRAGMENT) homolog [Mus musculus], full insert sequence
          Length = 702

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 434 gcgcccagctctttcctcagcaacagac 461
           |||||||||||| |||||||||||||||
Sbjct: 363 gcgcccagctctctcctcagcaacagac 336



to top

>dbj|AK010674.1| Mus musculus ES cells cDNA, RIKEN full-length enriched library,
           clone:2410045L15 product:RIBOSOMAL PROTEIN L15
           (FRAGMENT) homolog [Mus musculus], full insert sequence
          Length = 702

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 434 gcgcccagctctttcctcagcaacagac 461
           |||||||||||| |||||||||||||||
Sbjct: 361 gcgcccagctctctcctcagcaacagac 334



to top

>dbj|AK010319.1| Mus musculus ES cells cDNA, RIKEN full-length enriched library,
           clone:2410001B10 product:60S RIBOSOMAL PROTEIN L15
           homolog [Mus musculus], full insert sequence
          Length = 703

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 434 gcgcccagctctttcctcagcaacagac 461
           |||||||||||| |||||||||||||||
Sbjct: 363 gcgcccagctctctcctcagcaacagac 336



to top

>ref|NM_001023429.1| Schizosaccharomyces pombe 972h- hypothetical protein (SPCC576.11),
           partial mRNA
          Length = 606

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 51/60 (85%)
 Strand = Plus / Minus

                                                                       
Query: 350 atcaacaaggatgacctcaaagtacttgtaggtagaatcctcattcacccagtaggagtt 409
           |||||||||||| ||||||||| ||||||| |||| ||| |  || |||||||| |||||
Sbjct: 408 atcaacaaggataacctcaaagaacttgtaagtagcatcttggttaacccagtaagagtt 349



to top

>dbj|AK019386.1| Mus musculus 12 days embryo head cDNA, RIKEN full-length enriched
           library, clone:3010024H10 product:ribosomal protein L15,
           full insert sequence
          Length = 690

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 434 gcgcccagctctttcctcagcaacagac 461
           |||||||||||| |||||||||||||||
Sbjct: 350 gcgcccagctctctcctcagcaacagac 323



to top

>dbj|AK012423.1| Mus musculus 11 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2700054I09 product:ribosomal
           protein L15, full insert sequence
          Length = 694

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 434 gcgcccagctctttcctcagcaacagac 461
           |||||||||||| |||||||||||||||
Sbjct: 354 gcgcccagctctctcctcagcaacagac 327



to top

>dbj|AK002234.1| Mus musculus adult male kidney cDNA, RIKEN full-length enriched
           library, clone:0610006C19 product:RIBOSOMAL PROTEIN L15
           (FRAGMENT) homolog [Mus musculus], full insert sequence
          Length = 698

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 434 gcgcccagctctttcctcagcaacagac 461
           |||||||||||| |||||||||||||||
Sbjct: 359 gcgcccagctctctcctcagcaacagac 332



to top

>dbj|AK012025.1| Mus musculus 10 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2610313H16 product:60S RIBOSOMAL
           PROTEIN L15 homolog [Mus musculus], full insert sequence
          Length = 700

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 434 gcgcccagctctttcctcagcaacagac 461
           |||||||||||| |||||||||||||||
Sbjct: 359 gcgcccagctctctcctcagcaacagac 332



to top

>ref|NM_139114.2| Rattus norvegicus ribosomal protein L15 (Rpl15), mRNA
          Length = 1897

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 434 gcgcccagctctttcctcagcaacagac 461
           |||||||||||| |||||||||||||||
Sbjct: 342 gcgcccagctctctcctcagcaacagac 315



to top

>gb|AF401570.1| Ictalurus punctatus ribosomal protein L15 mRNA, complete cds
          Length = 691

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 396 acccagtaggagttgagcacacgaagaccacc 427
           |||||||||||||| |||||||| ||||||||
Sbjct: 384 acccagtaggagttcagcacacggagaccacc 353



to top

>ref|XM_573353.1| PREDICTED: Rattus norvegicus similar to ribosomal protein L15
           (LOC498143), mRNA
          Length = 667

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 434 gcgcccagctctttcctcagcaacagac 461
           |||||||||||| |||||||||||||||
Sbjct: 329 gcgcccagctctctcctcagcaacagac 302



to top

>ref|XM_578067.1| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L7a
           (LOC502581), mRNA
          Length = 978

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                       
Query: 434 gcgcccagctctttcctcagcaacagac 461
           |||||||||||| |||||||||||||||
Sbjct: 454 gcgcccagctctctcctcagcaacagac 481



to top

>dbj|AK186686.1| Mus musculus cDNA, clone:Y0G0138F10, strand:minus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000012549, based on BLAT search
          Length = 365

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 434 gcgcccagctctttcctcagcaacagac 461
           |||||||||||| |||||||||||||||
Sbjct: 126 gcgcccagctctctcctcagcaacagac 99



to top

>gb|BC091735.1| Mus musculus ribosomal protein L15, mRNA (cDNA clone MGC:102413
           IMAGE:3667351), complete cds
          Length = 707

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 434 gcgcccagctctttcctcagcaacagac 461
           |||||||||||| |||||||||||||||
Sbjct: 339 gcgcccagctctctcctcagcaacagac 312



to top

>gb|BC078724.1| Rattus norvegicus ribosomal protein L15, mRNA (cDNA clone MGC:93161
           IMAGE:7125608), complete cds
          Length = 1897

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 434 gcgcccagctctttcctcagcaacagac 461
           |||||||||||| |||||||||||||||
Sbjct: 342 gcgcccagctctctcctcagcaacagac 315



to top

>gb|AC102476.14| Mus musculus chromosome 5, clone RP24-396L12, complete sequence
          Length = 181047

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 434    gcgcccagctctttcctcagcaacagac 461
              |||||||||||| |||||||||||||||
Sbjct: 138446 gcgcccagctctctcctcagcaacagac 138419



to top

>emb|CT027556.11| Mouse DNA sequence from clone RP23-405M23 on chromosome 12, complete
              sequence
          Length = 209313

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 434    gcgcccagctctttcctcagcaacagac 461
              |||||||||||| |||||||||||||||
Sbjct: 134944 gcgcccagctctctcctcagcaacagac 134917



to top

>gb|AC153864.5| Mus musculus 10 BAC RP23-345N8 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 196411

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 434    gcgcccagctctttcctcagcaacagac 461
              |||||||||||| |||||||||||||||
Sbjct: 123997 gcgcccagctctctcctcagcaacagac 124024



to top

>gb|AC154579.3| Mus musculus BAC clone RP23-376B1 from chromosome 17, complete
           sequence
          Length = 193686

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                       
Query: 434 gcgcccagctctttcctcagcaacagac 461
           |||||||||||| |||||||||||||||
Sbjct: 843 gcgcccagctctctcctcagcaacagac 870



to top

>gb|AC159308.4| Mus musculus BAC clone RP23-187B11 from chromosome 9, complete sequence
          Length = 217927

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 434   gcgcccagctctttcctcagcaacagac 461
             |||||||||||| |||||||||||||||
Sbjct: 66829 gcgcccagctctctcctcagcaacagac 66856



to top

>gb|M63006.1|RATPACAP Rat pituitary adenylate cyclase activating polypeptide precursor
           protein mRNA, complete cds
          Length = 2681

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                       
Query: 434 gcgcccagctctttcctcagcaacagac 461
           |||||||||||| |||||||||||||||
Sbjct: 327 gcgcccagctctctcctcagcaacagac 354



to top

>gb|BC075894.1| Danio rerio zgc:92114, mRNA (cDNA clone MGC:92114 IMAGE:7048494),
           complete cds
          Length = 728

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 351 tcaacaaggatgacctcaaagtacttgtaggtagaatcctcattcacccagtaggagtt 409
           |||| ||||||||| |||||| ||||||| || || || |||  |||||||||||||||
Sbjct: 427 tcaataaggatgacttcaaagaacttgtatgtggagtcttcacccacccagtaggagtt 369



to top

>ref|NM_001003447.1| Danio rerio zgc:92114 (zgc:92114), mRNA
          Length = 728

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 351 tcaacaaggatgacctcaaagtacttgtaggtagaatcctcattcacccagtaggagtt 409
           |||| ||||||||| |||||| ||||||| || || || |||  |||||||||||||||
Sbjct: 427 tcaataaggatgacttcaaagaacttgtatgtggagtcttcacccacccagtaggagtt 369



to top

>emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete genome
          Length = 5178466

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 646     gcgcacgatggccggctgcttgc 668
               |||||||||||||||||||||||
Sbjct: 2578355 gcgcacgatggccggctgcttgc 2578333



to top

>ref|XM_800323.1| Trypanosoma cruzi strain CL Brener ribosomal protein L15
           (Tc00.1047053510767.10) partial mRNA
          Length = 663

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 391 cattcacccagtaggagttgagcacacgaag 421
           ||||||||||||| ||||| |||||||||||
Sbjct: 415 cattcacccagtacgagttcagcacacgaag 385



to top

>ref|XM_809599.1| Trypanosoma cruzi strain CL Brener ribosomal protein L15
           (Tc00.1047053509671.70) partial mRNA
          Length = 615

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 391 cattcacccagtaggagttgagcacacgaag 421
           ||||||||||||| ||||| |||||||||||
Sbjct: 367 cattcacccagtacgagttcagcacacgaag 337



to top

>emb|CR734570.2|CNS0GTKP Tetraodon nigroviridis full-length cDNA
          Length = 682

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 212 acacggatacggtagatgacatagccctgcttggccttg 174



to top

>emb|CR734567.2|CNS0GTKM Tetraodon nigroviridis full-length cDNA
          Length = 680

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 211 acacggatacggtagatgacatagccctgcttggccttg 173



to top

>emb|CR733808.2|CNS0GSZJ Tetraodon nigroviridis full-length cDNA
          Length = 680

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 211 acacggatacggtagatgacatagccctgcttggccttg 173



to top

>emb|CR711628.2|CNS0GC1K Tetraodon nigroviridis full-length cDNA
          Length = 707

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 238 acacggatacggtagatgacatagccctgcttggccttg 200



to top

>emb|CR728168.2|CNS0GOSU Tetraodon nigroviridis full-length cDNA
          Length = 701

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 230 acacggatacggtagatgacatagccctgcttggccttg 192



to top

>emb|CR720763.2|CNS0GJ35 Tetraodon nigroviridis full-length cDNA
          Length = 696

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 229 acacggatacggtagatgacatagccctgcttggccttg 191



to top

>emb|CR719152.2|CNS0GHUE Tetraodon nigroviridis full-length cDNA
          Length = 701

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 232 acacggatacggtagatgacatagccctgcttggccttg 194



to top

>emb|CR718902.2|CNS0GHNG Tetraodon nigroviridis full-length cDNA
          Length = 698

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 229 acacggatacggtagatgacatagccctgcttggccttg 191



to top

>emb|CR718782.2|CNS0GHK4 Tetraodon nigroviridis full-length cDNA
          Length = 696

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 229 acacggatacggtagatgacatagccctgcttggccttg 191



to top

>emb|CR718398.2|CNS0GH9G Tetraodon nigroviridis full-length cDNA
          Length = 700

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 229 acacggatacggtagatgacatagccctgcttggccttg 191



to top

>emb|CR716858.2|CNS0GG2R Tetraodon nigroviridis full-length cDNA
          Length = 697

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 230 acacggatacggtagatgacatagccctgcttggccttg 192



to top

>emb|CR714869.2|CNS0GEJL Tetraodon nigroviridis full-length cDNA
          Length = 679

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 211 acacggatacggtagatgacatagccctgcttggccttg 173



to top

>emb|CR714305.2|CNS0GE3X Tetraodon nigroviridis full-length cDNA
          Length = 712

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 243 acacggatacggtagatgacatagccctgcttggccttg 205



to top

>emb|CR713772.2|CNS0GDP4 Tetraodon nigroviridis full-length cDNA
          Length = 691

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 229 acacggatacggtagatgacatagccctgcttggccttg 191



to top

>emb|CR712144.2|CNS0GCFW Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 232 acacggatacggtagatgacatagccctgcttggccttg 194



to top

>emb|CR710759.2|CNS0GBDF Tetraodon nigroviridis full-length cDNA
          Length = 696

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 229 acacggatacggtagatgacatagccctgcttggccttg 191



to top

>emb|CR710317.2|CNS0GB15 Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 230 acacggatacggtagatgacatagccctgcttggccttg 192



to top

>emb|CR708878.2|CNS0G9X6 Tetraodon nigroviridis full-length cDNA
          Length = 471

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 308 acacggatacggtagatgacatagccctgcttggccttg 270



to top

>emb|CR709040.2|CNS0GA1O Tetraodon nigroviridis full-length cDNA
          Length = 701

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 232 acacggatacggtagatgacatagccctgcttggccttg 194



to top

>emb|CR707595.2|CNS0G8XJ Tetraodon nigroviridis full-length cDNA
          Length = 701

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 230 acacggatacggtagatgacatagccctgcttggccttg 192



to top

>emb|CR707410.2|CNS0G8SE Tetraodon nigroviridis full-length cDNA
          Length = 680

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 211 acacggatacggtagatgacatagccctgcttggccttg 173



to top

>emb|CR705983.2|CNS0G7OR Tetraodon nigroviridis full-length cDNA
          Length = 680

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 211 acacggatacggtagatgacatagccctgcttggccttg 173



to top

>emb|CR705928.2|CNS0G7N8 Tetraodon nigroviridis full-length cDNA
          Length = 697

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 230 acacggatacggtagatgacatagccctgcttggccttg 192



to top

>emb|CR705779.2|CNS0G7J3 Tetraodon nigroviridis full-length cDNA
          Length = 680

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 211 acacggatacggtagatgacatagccctgcttggccttg 173



to top

>emb|CR704933.2|CNS0G6VL Tetraodon nigroviridis full-length cDNA
          Length = 698

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 229 acacggatacggtagatgacatagccctgcttggccttg 191



to top

>emb|CR705198.2|CNS0G72Y Tetraodon nigroviridis full-length cDNA
          Length = 703

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 237 acacggatacggtagatgacatagccctgcttggccttg 199



to top

>emb|CR703639.2|CNS0G5VN Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 230 acacggatacggtagatgacatagccctgcttggccttg 192



to top

>emb|CR700763.2|CNS0G3NR Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 230 acacggatacggtagatgacatagccctgcttggccttg 192



to top

>emb|CR699990.2|CNS0G32A Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 230 acacggatacggtagatgacatagccctgcttggccttg 192



to top

>emb|CR691310.2|CNS0FWD6 Tetraodon nigroviridis full-length cDNA
          Length = 701

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 232 acacggatacggtagatgacatagccctgcttggccttg 194



to top

>emb|CR691298.2|CNS0FWCU Tetraodon nigroviridis full-length cDNA
          Length = 701

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 232 acacggatacggtagatgacatagccctgcttggccttg 194



to top

>emb|CR699239.2|CNS0G2HF Tetraodon nigroviridis full-length cDNA
          Length = 701

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 232 acacggatacggtagatgacatagccctgcttggccttg 194



to top

>emb|CR699166.2|CNS0G2FE Tetraodon nigroviridis full-length cDNA
          Length = 710

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 243 acacggatacggtagatgacatagccctgcttggccttg 205



to top

>emb|CR695796.2|CNS0FZTS Tetraodon nigroviridis full-length cDNA
          Length = 701

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 232 acacggatacggtagatgacatagccctgcttggccttg 194



to top

>emb|CR693271.2|CNS0FXVN Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 230 acacggatacggtagatgacatagccctgcttggccttg 192



to top

>emb|CR690989.2|CNS0FW49 Tetraodon nigroviridis full-length cDNA
          Length = 700

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 233 acacggatacggtagatgacatagccctgcttggccttg 195



to top

>emb|CR685900.2|CNS0FS6W Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 230 acacggatacggtagatgacatagccctgcttggccttg 192



to top

>emb|CR689623.2|CNS0FV2B Tetraodon nigroviridis full-length cDNA
          Length = 701

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 232 acacggatacggtagatgacatagccctgcttggccttg 194



to top

>emb|CR689269.2|CNS0FUSH Tetraodon nigroviridis full-length cDNA
          Length = 701

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 232 acacggatacggtagatgacatagccctgcttggccttg 194



to top

>emb|CR687161.2|CNS0FT5X Tetraodon nigroviridis full-length cDNA
          Length = 701

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 232 acacggatacggtagatgacatagccctgcttggccttg 194



to top

>emb|CR685664.2|CNS0FS0C Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 230 acacggatacggtagatgacatagccctgcttggccttg 192



to top

>emb|CR685351.2|CNS0FRRN Tetraodon nigroviridis full-length cDNA
          Length = 701

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 232 acacggatacggtagatgacatagccctgcttggccttg 194



to top

>emb|CR684589.2|CNS0FR6H Tetraodon nigroviridis full-length cDNA
          Length = 706

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 237 acacggatacggtagatgacatagccctgcttggccttg 199



to top

>emb|CR684547.2|CNS0FR5B Tetraodon nigroviridis full-length cDNA
          Length = 697

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 230 acacggatacggtagatgacatagccctgcttggccttg 192



to top

>emb|CR684350.2|CNS0FQZU Tetraodon nigroviridis full-length cDNA
          Length = 701

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 232 acacggatacggtagatgacatagccctgcttggccttg 194



to top

>emb|CR680312.2|CNS0FNVO Tetraodon nigroviridis full-length cDNA
          Length = 680

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 211 acacggatacggtagatgacatagccctgcttggccttg 173



to top

>emb|CR679130.2|CNS0FMYU Tetraodon nigroviridis full-length cDNA
          Length = 705

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 230 acacggatacggtagatgacatagccctgcttggccttg 192



to top

>emb|CR678082.2|CNS0FM5Z Tetraodon nigroviridis full-length cDNA
          Length = 647

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 211 acacggatacggtagatgacatagccctgcttggccttg 173



to top

>emb|CR677103.2|CNS0FLEZ Tetraodon nigroviridis full-length cDNA
          Length = 681

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 211 acacggatacggtagatgacatagccctgcttggccttg 173



to top

>emb|CR669366.2|CNS0FFGC Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 230 acacggatacggtagatgacatagccctgcttggccttg 192



to top

>emb|CR669127.2|CNS0FF9P Tetraodon nigroviridis full-length cDNA
          Length = 679

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 211 acacggatacggtagatgacatagccctgcttggccttg 173



to top

>emb|CR669121.2|CNS0FF9J Tetraodon nigroviridis full-length cDNA
          Length = 698

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 230 acacggatacggtagatgacatagccctgcttggccttg 192



to top

>emb|CR668410.2|CNS0FEPS Tetraodon nigroviridis full-length cDNA
          Length = 701

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 232 acacggatacggtagatgacatagccctgcttggccttg 194



to top

>emb|CR666986.2|CNS0FDM8 Tetraodon nigroviridis full-length cDNA
          Length = 681

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 211 acacggatacggtagatgacatagccctgcttggccttg 173



to top

>emb|CR667078.2|CNS0FDOS Tetraodon nigroviridis full-length cDNA
          Length = 681

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 211 acacggatacggtagatgacatagccctgcttggccttg 173



to top

>emb|CR666318.2|CNS0FD3O Tetraodon nigroviridis full-length cDNA
          Length = 680

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 211 acacggatacggtagatgacatagccctgcttggccttg 173



to top

>emb|CR662640.2|CNS0FA9I Tetraodon nigroviridis full-length cDNA
          Length = 699

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 562 acacggatccggtagacaacatagccctgctttgccttg 600
           |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 230 acacggatacggtagatgacatagccctgcttggccttg 192


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,613,908
Number of Sequences: 3902068
Number of extensions: 5613908
Number of successful extensions: 100104
Number of sequences better than 10.0: 374
Number of HSP's better than 10.0 without gapping: 372
Number of HSP's successfully gapped in prelim test: 2
Number of HSP's that attempted gapping in prelim test: 98665
Number of HSP's gapped (non-prelim): 1291
length of query: 700
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 677
effective length of database: 17,143,297,704
effective search space: 11606012545608
effective search space used: 11606012545608
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top