ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd3a13
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|X80266.1|HVGTIPP H.vulgare mRNA for gamma-TIP-like protein 835 0.0
2gb|U86762.1|TAU86762 Triticum aestivum gamma-type tonoplast intr... 476 e-131
3gb|BT016300.1| Zea mays clone Contig133 mRNA sequence 416 e-113
4gb|AY243803.1| Zea mays tonoplast water channel (TIP1-1) mRNA, c... 416 e-113
5gb|AY104464.1| Zea mays PCO114899 mRNA sequence 408 e-111
6gb|AF037061.1|AF037061 Zea mays tonoplast intrinsic protein (ZmT... 400 e-108
7gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 355 8e-95
8gb|AC090485.3|AC090485 Genomic Sequence for Oryza sativa, Nippon... 355 8e-95
9dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 355 8e-95
10dbj|D25534.1|RICYK333 Oryza sativa yk333 mRNA for gamma-Tip, com... 355 8e-95
11dbj|AK104123.1| Oryza sativa (japonica cultivar-group) cDNA clon... 355 8e-95
12dbj|AK068986.1| Oryza sativa (japonica cultivar-group) cDNA clon... 355 8e-95
13dbj|AK059438.1| Oryza sativa (japonica cultivar-group) cDNA clon... 355 8e-95
14dbj|AK058322.1| Oryza sativa (japonica cultivar-group) cDNA clon... 355 8e-95
15ref|XM_470213.1| Oryza sativa (japonica cultivar-group), predic... 337 2e-89
16emb|AJ242805.1|SST242805 Sporobolus stapfianus mRNA for putative... 232 8e-58
17dbj|AK110727.1| Oryza sativa (japonica cultivar-group) cDNA clon... 208 1e-50
18ref|NM_189497.1| Oryza sativa (japonica cultivar-group), predic... 165 1e-37
19dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 165 1e-37
20gb|AF326500.1|AF326500 Zea mays tonoplast membrane integral prot... 165 1e-37
21dbj|AP003627.3| Oryza sativa (japonica cultivar-group) genomic D... 165 1e-37
22dbj|AK111768.1| Oryza sativa (japonica cultivar-group) cDNA clon... 165 1e-37
23dbj|AK111747.1| Oryza sativa (japonica cultivar-group) cDNA clon... 165 1e-37
24dbj|AB114829.1| Oryza sativa (japonica cultivar-group) OsTIP1 mR... 165 1e-37
25dbj|AK060994.1| Oryza sativa (japonica cultivar-group) cDNA clon... 155 1e-34
26dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 147 3e-32
27dbj|AP005449.3| Oryza sativa (japonica cultivar-group) genomic D... 147 3e-32
28dbj|AP004784.3| Oryza sativa (japonica cultivar-group) genomic D... 147 3e-32
29dbj|AK104464.1| Oryza sativa (japonica cultivar-group) cDNA clon... 147 3e-32
30dbj|AK104270.1| Oryza sativa (japonica cultivar-group) cDNA clon... 147 3e-32
31dbj|AK100193.1| Oryza sativa (japonica cultivar-group) cDNA clon... 147 3e-32
32dbj|AK099616.1| Oryza sativa (japonica cultivar-group) cDNA clon... 147 3e-32
33dbj|AK099141.1| Oryza sativa (japonica cultivar-group) cDNA clon... 147 3e-32
34dbj|AK099015.1| Oryza sativa (japonica cultivar-group) cDNA clon... 147 3e-32
35dbj|AK073531.1| Oryza sativa (japonica cultivar-group) cDNA clon... 147 3e-32
36dbj|AK104377.1| Oryza sativa (japonica cultivar-group) cDNA clon... 139 8e-30
37gb|AY525641.1| Triticum aestivum delta tonoplast intrinsic prote... 137 3e-29
38gb|AY525640.1| Triticum aestivum delta tonoplast intrinsic prote... 137 3e-29
39gb|AY525639.1| Triticum aestivum delta tonoplast intrinsic prote... 137 3e-29
40gb|AY112388.1| Zea mays CL24208_1 mRNA sequence 131 2e-27
41gb|AY243804.1| Zea mays tonoplast water channel mRNA, complete cds 129 8e-27
42gb|AF326503.1|AF326503 Zea mays tonoplast membrane integral prot... 129 8e-27
43gb|AY106931.1| Zea mays PCO140073 mRNA sequence 129 8e-27
44gb|AF057183.1|AF057183 Zea mays putative tonoplast aquaporin mRN... 129 8e-27
45gb|AF326502.1|AF326502 Zea mays tonoplast membrane integral prot... 121 2e-24
46gb|AF326501.1|AF326501 Zea mays tonoplast membrane integral prot... 121 2e-24
47gb|AY105015.1| Zea mays PCO137646 mRNA sequence 121 2e-24
48gb|U86763.1|TAU86763 Triticum aestivum delta-type tonoplast intr... 121 2e-24
49ref|XM_467137.1| Oryza sativa (japonica cultivar-group), mRNA 105 1e-19
50dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 105 1e-19
51dbj|AP005006.3| Oryza sativa (japonica cultivar-group) genomic D... 105 1e-19
52dbj|AP005289.2| Oryza sativa (japonica cultivar-group) genomic D... 105 1e-19
53dbj|AB114830.1| Oryza sativa (japonica cultivar-group) OsTIP2 mR... 105 1e-19
54dbj|AK064728.1| Oryza sativa (japonica cultivar-group) cDNA clon... 105 1e-19
55emb|AJ307662.1|OSA307662 Oryza sativa genomic DNA fragment, chro... 105 1e-19
56gb|AY389618.1| Hyacinthus orientalis mitochondrial tonoplast int... 98 3e-17
57dbj|AB206104.1| Mimosa pudica tip1;1 mRNA for tonoplast intrinsi... 90 7e-15
58ref|NM_188624.1| Oryza sativa (japonica cultivar-group), Ozsa822... 86 1e-13
59gb|AF326508.1|AF326508 Zea mays tonoplast membrane integral prot... 86 1e-13
60gb|AF254799.1|AF254799 Hordeum vulgare tonoplast intrinsic prote... 86 1e-13
61dbj|AP001550.1| Oryza sativa (japonica cultivar-group) genomic D... 86 1e-13
62dbj|AK069192.1| Oryza sativa (japonica cultivar-group) cDNA clon... 86 1e-13
63gb|U43291.1|MCU43291 Mesembryanthemum crystallinum tonoplast int... 86 1e-13
64emb|AJ005078.2|PAAJ5078 Picea abies mRNA for aquaporin-like protein 82 2e-12
65gb|AF326505.1|AF326505 Zea mays tonoplast membrane integral prot... 78 3e-11
66ref|XM_473424.1| Oryza sativa (japonica cultivar-group), predic... 76 1e-10
67emb|AL663000.4|OSJN00201 Oryza sativa genomic DNA, chromosome 4,... 76 1e-10
68dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 76 1e-10
69dbj|AB012270.1| Aster tripolium mRNA for SAMIPD, partial cds 70 7e-09
70emb|X95650.1|TGTIP1GEN T.gesneriana mRNA for tonoplast intrinsic... 64 4e-07
71gb|AY821911.1| Gossypium hirsutum putative tonoplast intrinsic p... 64 4e-07
72ref|NM_197137.1| Oryza sativa (japonica cultivar-group) putative... 62 2e-06
73ref|NM_189871.1| Oryza sativa (japonica cultivar-group), mRNA 62 2e-06
74gb|AC023240.9| Oryza sativa chromosome 10 BAC OSJNBa0051D19 geno... 62 2e-06
75dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 62 2e-06
76dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 62 2e-06
77gb|AF326506.1|AF326506 Zea mays tonoplast membrane integral prot... 62 2e-06
78dbj|AP004380.2| Oryza sativa (japonica cultivar-group) genomic D... 62 2e-06
79dbj|AK111931.1| Oryza sativa (japonica cultivar-group) cDNA clon... 62 2e-06
80dbj|AB114828.1| Oryza sativa (japonica cultivar-group) OsTIP3 mR... 62 2e-06
81dbj|AK106383.1| Oryza sativa (japonica cultivar-group) cDNA clon... 62 2e-06
82gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 62 2e-06
83dbj|AB012271.1| Aster tripolium mRNA for SAMIPE, partial cds 60 6e-06
84ref|NM_188505.1| Oryza sativa (japonica cultivar-group), Ozsa817... 58 2e-05
85gb|AF521135.1| Kandelia candel tonoplast intrinsic protein (TIP)... 58 2e-05
86dbj|AP002094.1| Oryza sativa (japonica cultivar-group) genomic D... 58 2e-05
87ref|NM_188626.1| Oryza sativa (japonica cultivar-group), Ozsa822... 56 1e-04
88dbj|AK099190.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 1e-04
89dbj|AK069592.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 1e-04
90ref|NM_124117.2| Arabidopsis thaliana AtTIP2;3; water channel AT... 54 4e-04
91gb|BT016509.1| Zea mays clone Contig342 mRNA sequence 54 4e-04
92gb|DQ226889.1| Boechera divaricarpa isolate SLW-D-E07 mRNA sequence 54 4e-04
93gb|BT011663.1| Arabidopsis thaliana At5g47450 mRNA, complete cds 54 4e-04
94gb|BT011212.1| Arabidopsis thaliana At5g47450 gene, complete cds 54 4e-04
95emb|X72581.1|ATGTIPMR A.thaliana mRNA for tonoplast intrinsic pr... 54 4e-04
96emb|AJ289866.2|VVI289866 Vitis vinifera mRNA for putative aquapo... 54 4e-04
97gb|AF271661.1|AF271661 Vitis berlandieri x Vitis rupestris putat... 54 4e-04
98dbj|AB025628.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 54 4e-04
99ref|XM_473251.1| Oryza sativa (japonica cultivar-group), predic... 52 0.002
100emb|AL663019.2|OSJN00221 Oryza sativa genomic DNA, chromosome 4,... 52 0.002
101emb|AJ314583.1|POC314583 Posidonia oceanica mRNA for putative to... 52 0.002
102dbj|AK108116.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.002
103dbj|AB012272.1| Aster tripolium mRNA for SAMIPF, partial cds 52 0.002
104dbj|AB012268.1| Aster tripolium mRNA for SAMIPB, partial cds 52 0.002
105gb|AF367456.1| Prunus persica clone gTip1 gamma-tonoplast intrin... 50 0.006
106dbj|AB048248.1| Pyrus communis Py-gTIP mRNA for gamma tonoplast ... 50 0.006
107dbj|AB012269.1| Aster tripolium mRNA for SAMIPC, partial cds 50 0.006
108dbj|AB012267.1| Aster tripolium mRNA for SAMIPA, partial cds 50 0.006
109gb|U92651.2|BOU92651 Brassica oleracea var. botrytis tonoplast i... 48 0.024
110gb|AF326509.1|AF326509 Zea mays tonoplast membrane integral prot... 48 0.024
111gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete ge... 48 0.024
112emb|X53040.1|RNNIP26 R.norvegicus MIP-26 mRNA 46 0.095
113gb|AF521142.1| Kandelia candel tonoplast intrinsic protein mRNA,... 46 0.095
114emb|X53052.1|RRMIP Rat partial mRNA for main intrinsic protein 46 0.095
115emb|X12514.1|RNMIP26R Rat mRNA fragment for main intrinsic prote... 46 0.095
116gb|AY130971.1| Brassica oleracea var. botrytis tonoplast intrins... 46 0.095
117emb|AJ251652.1|MTR251652 Medicago truncatula mRNA for aquaporin ... 46 0.095
118gb|U92652.2|BOU92652 Brassica oleracea var. botrytis tonoplast i... 46 0.095
119gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome 46 0.095
120emb|BX824373.1|CNS0A6WG Arabidopsis thaliana Full-length cDNA Co... 46 0.095
121gb|AC020922.9| Homo sapiens chromosome 19 clone CTD-2105E13, com... 46 0.095
122ref|XM_343137.2| PREDICTED: Rattus norvegicus major intrinsic pr... 46 0.095
123gb|AY207429.1| Homo sapiens interleukin 11 (IL11) gene, complete... 46 0.095
124emb|AJ605573.1| Ricinus communis mRNA for aquaporin (Tip1-1 gene... 46 0.095
125gb|AY112625.1| Zea mays CL46210_1 mRNA sequence 46 0.095
126gb|AF000143.1|HSAF000143 Human putative alternative lens membran... 46 0.095
127gb|M81890.1|HUMIL11A Human interleukin 11 (IL11) gene, complete ... 46 0.095
128dbj|AB010416.1| Raphanus sativus VIP3 mRNA for delta-VM23, compl... 46 0.095
129emb|AL591787.1|SME591787 Sinorhizobium meliloti 1021 complete ch... 44 0.37
130ref|XM_851400.1| PREDICTED: Canis familiaris similar to actinin,... 44 0.37
131ref|XM_536333.2| PREDICTED: Canis familiaris similar to actinin,... 44 0.37
132ref|XM_851314.1| PREDICTED: Canis familiaris similar to actinin,... 44 0.37
133ref|XM_851274.1| PREDICTED: Canis familiaris similar to actinin,... 44 0.37
134ref|XM_851189.1| PREDICTED: Canis familiaris similar to actinin,... 44 0.37
135ref|XM_851152.1| PREDICTED: Canis familiaris similar to actinin,... 44 0.37
136ref|XM_851023.1| PREDICTED: Canis familiaris similar to actinin,... 44 0.37
137dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.37
138emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid compl... 44 0.37
139gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 44 0.37
140emb|AL928775.2|CNS08CC5 Oryza sativa chromosome 12, . BAC OSJNBa... 44 0.37
141gb|AE017351.1| Cryptococcus neoformans var. neoformans JEC21 chr... 42 1.5
142gb|AC154709.2| Mus musculus BAC clone RP24-357I4 from chromosome... 42 1.5
143gb|AE017180.1| Geobacter sulfurreducens PCA, complete genome 42 1.5
144ref|XM_593064.2| PREDICTED: Bos taurus similar to tumor protein ... 42 1.5
145gb|AY581827.1| Cynodon dactylon NOD26-like membrane integral pro... 42 1.5
146gb|AF183913.1| Azospirillum brasilense major outer membrane prot... 42 1.5
147ref|XM_856403.1| PREDICTED: Canis familiaris similar to aquapori... 42 1.5
148ref|XM_845359.1| PREDICTED: Canis familiaris similar to aquapori... 42 1.5
149emb|CT025679.5| Mouse DNA sequence from clone RP24-296K22 on chr... 42 1.5
150ref|XM_567655.1| Cryptococcus neoformans var. neoformans JEC21 h... 42 1.5
151gb|AC123532.4| Mus musculus chromosome 14 clone RP23-84B6, compl... 42 1.5
152gb|AC098877.3| Mus musculus BAC clone RP23-2C24 from 14, complet... 42 1.5
153gb|AC104099.5| Mus musculus BAC clone RP24-372J8 from 3, complet... 42 1.5
154gb|BC012214.1| Mus musculus Rab geranylgeranyl transferase, a su... 42 1.5
155gb|AY258323.1| Rubella virus strain BRD-II, complete genome 42 1.5
156ref|NM_019519.1| Mus musculus Rab geranylgeranyl transferase, a ... 42 1.5
157ref|XM_961391.1| PREDICTED: Tribolium castaneum similar to CG310... 42 1.5
158gb|CP000089.1| Dechloromonas aromatica RCB, complete genome 42 1.5
159emb|BX640442.1| Bordetella bronchiseptica strain RB50, complete ... 42 1.5
160emb|BX640430.1| Bordetella parapertussis strain 12822, complete ... 42 1.5
161emb|AL390091.1|NCB12F1 Neurospora crassa DNA linkage group II BA... 42 1.5
162emb|AJ489613.1|CAR489613 Cicer arietinum partial mRNA for tonopl... 42 1.5
163emb|AJ243309.1|PSA243309 Pisum sativum mRNA for putative tonopla... 42 1.5
164emb|BX470185.18| Zebrafish DNA sequence from clone CH211-222D3 i... 42 1.5
165dbj|AK146917.1| Mus musculus 17 days embryo kidney cDNA, RIKEN f... 42 1.5
166gb|U62778.1|GHU62778 Gossypium hirsutum delta-tonoplast intrinsi... 42 1.5
167gb|AF342810.1|AF342810 Zea mays NOD26-like membrane integral pro... 42 1.5
168gb|AF326485.1|AF326485 Zea mays NOD26-like membrane integral pro... 42 1.5
169gb|AC135495.2| Oryza sativa (japonica cultivar-group) chromosome... 42 1.5
170ref|NM_214226.1| Sus scrofa inositol(1,3,4,5)tetrakisphosphate r... 42 1.5
171gb|AE004658.1| Pseudomonas aeruginosa PAO1, section 219 of 529 o... 42 1.5
172gb|AF275315.1|AF275315 Lotus japonicus water-selective transport... 42 1.5
173gb|AF127662.1|AF127662 Mus musculus strain C57BL/6J-gm/gm RAB ge... 42 1.5
174gb|AF127661.1|AF127661 Mus musculus strain C57BL/6J-gm/gm RAB ge... 42 1.5
175gb|AF127660.1|AF127660 Mus musculus strain C57BL/6J RAB geranylg... 42 1.5
176gb|AF127659.1|AF127659 Mus musculus strain C57BL/6J-gm/gm RAB ge... 42 1.5
177gb|AF127658.1|AF127658 Mus musculus strain C57BL/6J RAB geranylg... 42 1.5
178gb|AF127657.1|AF127657 Mus musculus strain C57BL/6J-gm/gm RAB ge... 42 1.5
179gb|AF127656.1|AF127656 Mus musculus strain C57BL/6J RAB geranylg... 42 1.5
180gb|AF127655.1|AF127655 Mus musculus strain C57BL/6J-gm/gm RAB ge... 42 1.5
181gb|AF127654.1|AF127654 Mus musculus strain C57BL/6J RAB geranylg... 42 1.5
182gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, c... 42 1.5
183emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome comple... 42 1.5
184emb|AL845372.6| Zebrafish DNA sequence from clone DKEYP-113C1 in... 42 1.5
185gb|AY109651.1| Zea mays CL6730_1 mRNA sequence 42 1.5
186gb|AF009567.1|AF009567 Gossypium hirsutum delta-TIP homolog (MIP... 42 1.5
187emb|CR381567.9| Zebrafish DNA sequence from clone DKEY-115O4 in ... 42 1.5
188gb|AF026470.1|AF026470 Pseudomonas aeruginosa gluconate represso... 42 1.5
189gb|AC159324.2| Mus musculus BAC clone RP23-9D1 from chromosome 1... 42 1.5
190gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, co... 42 1.5
191emb|CR974568.14| Mouse DNA sequence from clone RP23-39N20 on chr... 42 1.5
192emb|CR388420.19| Zebrafish DNA sequence from clone DKEY-37H18 in... 42 1.5
193gb|U88368.1|SSU88368 Sus scrofa inositol(1,3,4,5)tetrakisphospha... 42 1.5
194dbj|AP004479.1| Lotus japonicus genomic DNA, chromosome 1, clone... 42 1.5
195gb|DQ202710.1| Olea europaea tonoplast intrinsic protein (tip) m... 42 1.5
196gb|L07320.1|HS5E1A Murine cytomegalovirus e1 protein gene, compl... 42 1.5
197ref|NM_129238.2| Arabidopsis thaliana GAMMA-TIP; water channel A... 40 5.8
198ref|NM_128141.3| Arabidopsis thaliana water channel AT2G25810 mR... 40 5.8
199gb|AC164878.2| Mus musculus BAC clone RP23-364G24 from chromosom... 40 5.8
200gb|AC162034.6| Mus musculus chromosome 7, clone RP23-285B12, com... 40 5.8
201gb|CP000096.1| Pelodictyon luteolum DSM 273, complete genome 40 5.8
202ref|XM_476227.1| Oryza sativa (japonica cultivar-group), predic... 40 5.8
203gb|DQ215783.1| Taeniopygia guttata clone 0058P0012B09 proteasome... 40 5.8
204gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence 40 5.8
205ref|XM_472326.1| Oryza sativa (japonica cultivar-group), predic... 40 5.8
206gb|AF474373.1| Hordeum vulgare subsp. vulgare BAC 259I16, comple... 40 5.8
207ref|NM_001025266.1| Homo sapiens hypothetical gene supported by ... 40 5.8
208gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, compl... 40 5.8
209gb|AC145321.3| Oryza sativa (japonica cultivar-group) chromosome... 40 5.8
210gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, comp... 40 5.8
211ref|XM_414866.1| PREDICTED: Gallus gallus similar to Aquaporin 8... 40 5.8
212ref|XM_426181.1| PREDICTED: Gallus gallus similar to Brix domain... 40 5.8
213gb|CP000285.1| Chromohalobacter salexigens DSM 3043, complete ge... 40 5.8
214gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, com... 40 5.8
215gb|DQ356948.1| Crocodilepox virus, complete genome 40 5.8
216gb|BT012635.1| Arabidopsis thaliana At2g25810 mRNA, complete cds 40 5.8
217gb|AC145396.3| Oryza sativa (japonica cultivar-group) chromosome... 40 5.8
218gb|AY502065.1| Streptomyces mobaraensis transglutaminase gene, c... 40 5.8
219gb|AF531437.1| Streptomyces mobaraensis IFO13819 transglutaminas... 40 5.8
220emb|AL591789.1|SME591789 Sinorhizobium meliloti 1021 complete ch... 40 5.8
221emb|CR847515.10| Zebrafish DNA sequence from clone DKEYP-60A7 in... 40 5.8
222gb|AC012596.4| Homo sapiens BAC clone CTD-2523K17 from 7, comple... 40 5.8
223gb|AY225468.1| Mus musculus interleukin 11 gene, promoter region... 40 5.8
224emb|AL161740.16| Human DNA sequence from clone RP6-239D12 on chr... 40 5.8
225gb|AC123518.2| Oryza sativa (japonica cultivar-group) chromosome... 40 5.8
226emb|X63552.1|ATGTIPARA A.thaliana gene for tonoplast intrinsic p... 40 5.8
227gb|AY059134.1| Arabidopsis thaliana putative aquaporin (At2g3683... 40 5.8
228gb|AF370172.1| Arabidopsis thaliana putative tonoplast intrinsic... 40 5.8
229gb|AF486513.1| Hordeum vulgare cultivar Yon M Kei GBSSI gene, pr... 40 5.8
230gb|AF486512.1| Hordeum vulgare cultivar CDC Alamo GBSSI gene, pr... 40 5.8
231gb|AF486508.1| Hordeum vulgare cultivar Oderbrucker GBSSI gene, ... 40 5.8
232emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromos... 40 5.8
233emb|AJ289696.1|POC289696 Posidonia oceanica partial mRNA for put... 40 5.8
234emb|BX897736.7| Zebrafish DNA sequence from clone CH211-181B15 i... 40 5.8
235gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome 40 5.8
236gb|AE005901.1| Caulobacter crescentus CB15 section 227 of 359 of... 40 5.8
237gb|AC023310.4| Homo sapiens chromosome 15, clone RP11-336L20, co... 40 5.8
238dbj|AK091454.1| Homo sapiens cDNA FLJ34135 fis, clone FCBBF3010695 40 5.8
239tpg|BK001890.1| TPA: TPA_inf: Drosophila melanogaster HDC08154 (... 40 5.8
240gb|CP000133.1| Rhizobium etli CFN 42, complete genome 40 5.8
241gb|CP000136.1| Rhizobium etli CFN 42 plasmid p42c, complete sequ... 40 5.8
242dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ... 40 5.8
243gb|AC006922.7| Arabidopsis thaliana chromosome 2 clone T1J8 map ... 40 5.8
244gb|AC005395.3| Arabidopsis thaliana chromosome 2 clone F17H15 ma... 40 5.8
245dbj|AB118808.1| Hordeum vulgare subsp. spontaneum GBSSI gene for... 40 5.8
246dbj|AB089162.1| Hordeum vulgare subsp. vulgare GBSSI gene for gr... 40 5.8
247dbj|AB088761.1| Hordeum vulgare subsp. vulgare GBSSI gene for gr... 40 5.8
248gb|AC100757.2| Homo sapiens chromosome 15, clone RP11-566K19, co... 40 5.8
249gb|AC107487.1| Drosophila melanogaster 3L BAC RP98-10D20 (Roswel... 40 5.8
250gb|DQ317109.1| Drosophila pseudoobscura Dscam gene, exons 3 thro... 40 5.8
251emb|BX548249.13| Zebrafish DNA sequence from clone CH211-93A2 in... 40 5.8
252emb|BX119977.10| Zebrafish DNA sequence from clone CH211-198A3 i... 40 5.8
253dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.8
254dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.8
255dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.8
256emb|AL662997.3|OSJN00205 Oryza sativa genomic DNA, chromosome 4,... 40 5.8
257emb|BX819301.1|CNS0AA93 Arabidopsis thaliana Full-length cDNA Co... 40 5.8
258emb|BX819122.1|CNS0AA8S Arabidopsis thaliana Full-length cDNA Co... 40 5.8
259emb|BX819066.1|CNS0AA99 Arabidopsis thaliana Full-length cDNA Co... 40 5.8
260emb|BX818765.1|CNS0AA8G Arabidopsis thaliana Full-length cDNA Co... 40 5.8
261emb|BX819619.1|CNS0A8TV Arabidopsis thaliana Full-length cDNA Co... 40 5.8
262emb|BX819585.1|CNS0A8ZS Arabidopsis thaliana Full-length cDNA Co... 40 5.8
263emb|BX819242.1|CNS0A8YI Arabidopsis thaliana Full-length cDNA Co... 40 5.8
264emb|BX818836.1|CNS0A8V6 Arabidopsis thaliana Full-length cDNA Co... 40 5.8
265emb|BX818785.1|CNS0A8WQ Arabidopsis thaliana Full-length cDNA Co... 40 5.8
266emb|BX820166.1|CNS0A8IR Arabidopsis thaliana Full-length cDNA Co... 40 5.8
267gb|AE004695.1| Pseudomonas aeruginosa PAO1, section 256 of 529 o... 40 5.8
268gb|AY087558.1| Arabidopsis thaliana clone 36633 mRNA, complete s... 40 5.8
269gb|CP000157.1| Erythrobacter litoralis HTCC2594, complete genome 40 5.8
270gb|AC136687.6| Homo sapiens chromosome 15, clone RP11-439M15, co... 40 5.8
271gb|AC134393.6| Homo sapiens chromosome 15, clone CTC-803A3, comp... 40 5.8
272gb|AC131280.9| Homo sapiens chromosome 15, clone RP11-467L19, co... 40 5.8
273dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ... 40 5.8
274dbj|AP006149.2| Oryza sativa (japonica cultivar-group) genomic D... 40 5.8
275dbj|AP003712.4| Oryza sativa (japonica cultivar-group) genomic D... 40 5.8
276dbj|AB154356.1| Hordeum vulgare subsp. spontaneum GBSSI gene for... 40 5.8
277dbj|AB118809.1| Hordeum vulgare subsp. spontaneum GBSSI gene for... 40 5.8
278dbj|AK112006.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.8
279dbj|AK111927.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.8
280emb|X07932.1|HVWAXYR Barley mRNA pcwx27 for waxy locus 40 5.8
281emb|X07931.1|HVWAXYG Barley DNA for waxy locus encoding starch s... 40 5.8
282dbj|AK109762.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.8
283gb|AC007934.7|AC007934 Homo sapiens, clone RP11-29A1, complete s... 40 5.8
284dbj|AK100873.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.8
285dbj|AK072531.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.8
286dbj|AK069688.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.8
287gb|AF466200.2| Sorghum bicolor putative protein kinase gene, par... 40 5.8
288dbj|AK060193.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.8
289emb|AL929340.4| Zebrafish DNA sequence from clone CH211-248N16 i... 40 5.8
290gb|AC006947.2|AC006947 Homo sapiens chromosome 17, clone hRPK.11... 40 5.8
291gb|AE003476.3| Drosophila melanogaster chromosome 3L, section 10... 40 5.8
292gb|U68299.1|MCU68299 Mouse cytomegalovirus 1 complete genomic se... 40 5.8
293emb|CR388150.14| Zebrafish DNA sequence from clone DKEY-115A2 in... 40 5.8
294gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 40 5.8
295gb|AF317103.1| Dumontia alaskana specimen-voucher GWS000917 (UNB... 40 5.8
296gb|AF317102.1| Dumontia alaskana specimen-voucher GWS000916 (UNB... 40 5.8
297gb|AF317101.1| Dumontia alaskana specimen-voucher G0221 (UNB) sm... 40 5.8
298gb|M84344.1|ATHGTIP Arabidopsis thaliana tonoplast intrinsic pro... 40 5.8
299dbj|AB054056.1| Hordeum vulgare waxy gene, partial sequence, cul... 40 5.8
300dbj|AB054055.2| Hordeum vulgare waxy gene, partial sequence, cul... 40 5.8
301emb|AL772162.4| Mouse DNA sequence from clone RP23-175J8 on chro... 40 5.8

>emb|X80266.1|HVGTIPP H.vulgare mRNA for gamma-TIP-like protein
          Length = 1020

 Score =  835 bits (421), Expect = 0.0
 Identities = 430/434 (99%)
 Strand = Plus / Minus

                                                                       
Query: 1   aaattgncagggtcgatcgtcacaggtttgncagcaccacaaactgatggaccgatcgac 60
           |||||| ||||||||||||||||||||||  |||||||||||||||||||||||||||||
Sbjct: 997 aaattgacagggtcgatcgtcacaggtttcacagcaccacaaactgatggaccgatcgac 938

                                                                       
Query: 61  cctgggaatgggatggattcattcattcaaagcaaacttaaacgactcatgactggaagc 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 937 cctgggaatgggatggattcattcattcaaagcaaacttaaacgactcatgactggaagc 878

                                                                       
Query: 121 aaggggagacgcgatcgaccacacggacggacgggcgggcggggggcaggcggcggtgag 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 877 aaggggagacgcgatcgaccacacggacggacgggcgggcggggggcaggcggcggtgag 818

                                                                       
Query: 181 cttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtaga 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 817 cttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtaga 758

                                                                       
Query: 241 tgacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtaccccc 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 757 tgacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtaccccc 698

                                                                       
Query: 301 actcccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggaga 360
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 697 actcccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggaga 638

                                                                       
Query: 361 aggcgccgccgacnaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatgg 420
           ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 637 aggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatgg 578

                         
Query: 421 tgcccaggctgccc 434
           ||||||||||||||
Sbjct: 577 tgcccaggctgccc 564



to top

>gb|U86762.1|TAU86762 Triticum aestivum gamma-type tonoplast intrinsic protein mRNA,
           complete cds
          Length = 1133

 Score =  476 bits (240), Expect = e-131
 Identities = 248/251 (98%)
 Strand = Plus / Minus

                                                                       
Query: 184 agtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagatga 243
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 845 agtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagatga 786

                                                                       
Query: 244 cgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccact 303
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 785 cgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccact 726

                                                                       
Query: 304 cccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaagg 363
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 725 cccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaagg 666

                                                                       
Query: 364 cgccgccgacnaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgc 423
           ||||||| || |||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 665 cgccgcccaccaggatgttggcgcccacgatgaagccgatggcgatgggcgcgatggtgc 606

                      
Query: 424 ccaggctgccc 434
           |||||||||||
Sbjct: 605 ccaggctgccc 595



 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 90  aagcaaacttaaacgactcatg 111
           ||||||||||||||||||||||
Sbjct: 977 aagcaaacttaaacgactcatg 956



to top

>gb|BT016300.1| Zea mays clone Contig133 mRNA sequence
          Length = 1112

 Score =  416 bits (210), Expect = e-113
 Identities = 242/253 (95%)
 Strand = Plus / Minus

                                                                       
Query: 182 ttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagat 241
           |||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 850 ttagtagtcggtggaggggagctgctcgtgggtgtgggagatgaagagcagctcgtagat 791

                                                                       
Query: 242 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtaccccca 301
           |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||
Sbjct: 790 gacgccggcgaggccgccgccgatgaggggcccgacccagtacacccactggtagcccca 731

                                                                       
Query: 302 ctcccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaa 361
           |||||||||||||||||||||||||||||| ||||||||||||||||||||||||  |||
Sbjct: 730 ctcccagctgacgagggcggggccgaaggacacggcggggttcatggacgcgccgtcgaa 671

                                                                       
Query: 362 ggcgccgccgacnaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 421
           ||||||||| || |||||||||||||| ||||||||||||||||||||||| ||||||||
Sbjct: 670 ggcgccgcccaccaggatgttggcgcccacgatgaagccgatggcgatgggggcgatggt 611

                        
Query: 422 gcccaggctgccc 434
           |||||||||||||
Sbjct: 610 gcccaggctgccc 598



to top

>gb|AY243803.1| Zea mays tonoplast water channel (TIP1-1) mRNA, complete cds
          Length = 1039

 Score =  416 bits (210), Expect = e-113
 Identities = 242/253 (95%)
 Strand = Plus / Minus

                                                                       
Query: 182 ttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagat 241
           |||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 754 ttagtagtcggtggaggggagctgctcgtgggtgtgggagatgaagagcagctcgtagat 695

                                                                       
Query: 242 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtaccccca 301
           |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 694 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtagcccca 635

                                                                       
Query: 302 ctcccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaa 361
           |||||||||||||||||||||||||||||| ||||||||||||||||||||||||  |||
Sbjct: 634 ctcccagctgacgagggcggggccgaaggacacggcggggttcatggacgcgccgtcgaa 575

                                                                       
Query: 362 ggcgccgccgacnaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 421
           ||||||||| || ||||||||||| || ||||||||||||||||||||||| ||||||||
Sbjct: 574 ggcgccgcccaccaggatgttggcccccacgatgaagccgatggcgatgggggcgatggt 515

                        
Query: 422 gcccaggctgccc 434
           |||||||||||||
Sbjct: 514 gcccaggctgccc 502



to top

>gb|AY104464.1| Zea mays PCO114899 mRNA sequence
          Length = 1167

 Score =  408 bits (206), Expect = e-111
 Identities = 241/253 (95%)
 Strand = Plus / Minus

                                                                       
Query: 182 ttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagat 241
           |||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 849 ttagtagtcggtggaggggagctgctcgtgggtgtgggagatgaagagcagctcgtagat 790

                                                                       
Query: 242 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtaccccca 301
           |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 789 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtagcccca 730

                                                                       
Query: 302 ctcccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaa 361
           |||||||||||||||||||||||||||||| ||||||||||||||||||||||||  |||
Sbjct: 729 ctcccagctgacgagggcggggccgaaggacacggcggggttcatggacgcgccgtcgaa 670

                                                                       
Query: 362 ggcgccgccgacnaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 421
           ||||||||| || ||||||||||| || ||||||||||||||||| ||||| ||||||||
Sbjct: 669 ggcgccgcccaccaggatgttggcccccacgatgaagccgatggcaatgggggcgatggt 610

                        
Query: 422 gcccaggctgccc 434
           |||||||||||||
Sbjct: 609 gcccaggctgccc 597



to top

>gb|AF037061.1|AF037061 Zea mays tonoplast intrinsic protein (ZmTIP1) mRNA, complete cds
          Length = 1097

 Score =  400 bits (202), Expect = e-108
 Identities = 240/253 (94%)
 Strand = Plus / Minus

                                                                       
Query: 182 ttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagat 241
           |||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 846 ttagtagtcggtggaggggagctgctcgtgggtgtgggagatgaagagcagctcgtagat 787

                                                                       
Query: 242 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtaccccca 301
           |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||
Sbjct: 786 gacgccggcgaggccgccgccgatgaggggcccgacccagtacacccactggtagcccca 727

                                                                       
Query: 302 ctcccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaa 361
           |||||||||||||||||||||||||||||| ||||||||||||||||||||||||  |||
Sbjct: 726 ctcccagctgacgagggcggggccgaaggacacggcggggttcatggacgcgccgtcgaa 667

                                                                       
Query: 362 ggcgccgccgacnaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 421
           ||||||||| || ||||||||||| || ||||||||||||||||| ||||| ||||||||
Sbjct: 666 ggcgccgcccaccaggatgttggcccccacgatgaagccgatggcaatgggggcgatggt 607

                        
Query: 422 gcccaggctgccc 434
           |||||||||||||
Sbjct: 606 gcccaggctgccc 594



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  355 bits (179), Expect = 8e-95
 Identities = 244/266 (91%)
 Strand = Plus / Plus

                                                                           
Query: 169     ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 228
               ||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 2544716 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 2544775

                                                                           
Query: 229     gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 288
               | | |||||||||||||||||||||||| ||||||||||| ||||| |||||||||||||
Sbjct: 2544776 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 2544835

                                                                           
Query: 289     actggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatgg 348
               ||||| || ||||   ||||||||||||||| ||||||||||||||||| ||||||||||
Sbjct: 2544836 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 2544895

                                                                           
Query: 349     acgcgccggagaaggcgccgccgacnaggatgttggcgccgacgatgaagccgatggcga 408
               | ||||||  ||| ||||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 2544896 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 2544955

                                         
Query: 409     tgggcgcgatggtgcccaggctgccc 434
               |||| ||||||||||| |||||||||
Sbjct: 2544956 tgggggcgatggtgccgaggctgccc 2544981



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 143     acggacggacgggcgggcggg 163
               |||||||||||||||||||||
Sbjct: 8319519 acggacggacgggcgggcggg 8319499



to top

>gb|AC090485.3|AC090485 Genomic Sequence for Oryza sativa, Nipponbare strain, clone
              OSJNBa0067N01, from chromosome 3, complete sequence
          Length = 159636

 Score =  355 bits (179), Expect = 8e-95
 Identities = 244/266 (91%)
 Strand = Plus / Minus

                                                                          
Query: 169    ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 228
              ||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 125378 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 125319

                                                                          
Query: 229    gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 288
              | | |||||||||||||||||||||||| ||||||||||| ||||| |||||||||||||
Sbjct: 125318 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 125259

                                                                          
Query: 289    actggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatgg 348
              ||||| || ||||   ||||||||||||||| ||||||||||||||||| ||||||||||
Sbjct: 125258 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 125199

                                                                          
Query: 349    acgcgccggagaaggcgccgccgacnaggatgttggcgccgacgatgaagccgatggcga 408
              | ||||||  ||| ||||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 125198 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 125139

                                        
Query: 409    tgggcgcgatggtgcccaggctgccc 434
              |||| ||||||||||| |||||||||
Sbjct: 125138 tgggggcgatggtgccgaggctgccc 125113



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  355 bits (179), Expect = 8e-95
 Identities = 244/266 (91%)
 Strand = Plus / Plus

                                                                           
Query: 169     ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 228
               ||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 2544826 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 2544885

                                                                           
Query: 229     gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 288
               | | |||||||||||||||||||||||| ||||||||||| ||||| |||||||||||||
Sbjct: 2544886 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 2544945

                                                                           
Query: 289     actggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatgg 348
               ||||| || ||||   ||||||||||||||| ||||||||||||||||| ||||||||||
Sbjct: 2544946 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 2545005

                                                                           
Query: 349     acgcgccggagaaggcgccgccgacnaggatgttggcgccgacgatgaagccgatggcga 408
               | ||||||  ||| ||||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 2545006 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 2545065

                                         
Query: 409     tgggcgcgatggtgcccaggctgccc 434
               |||| ||||||||||| |||||||||
Sbjct: 2545066 tgggggcgatggtgccgaggctgccc 2545091



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 143     acggacggacgggcgggcggg 163
               |||||||||||||||||||||
Sbjct: 8317354 acggacggacgggcgggcggg 8317334



to top

>dbj|D25534.1|RICYK333 Oryza sativa yk333 mRNA for gamma-Tip, complete cds
          Length = 1080

 Score =  355 bits (179), Expect = 8e-95
 Identities = 244/266 (91%)
 Strand = Plus / Minus

                                                                       
Query: 169 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 228
           ||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 844 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 785

                                                                       
Query: 229 gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 288
           | | |||||||||||||||||||||||| ||||||||||| ||||| |||||||||||||
Sbjct: 784 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 725

                                                                       
Query: 289 actggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatgg 348
           ||||| || ||||   ||||||||||||||| ||||||||||||||||| ||||||||||
Sbjct: 724 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 665

                                                                       
Query: 349 acgcgccggagaaggcgccgccgacnaggatgttggcgccgacgatgaagccgatggcga 408
           | ||||||  ||| ||||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 664 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 605

                                     
Query: 409 tgggcgcgatggtgcccaggctgccc 434
           |||| ||||||||||| |||||||||
Sbjct: 604 tgggggcgatggtgccgaggctgccc 579



to top

>dbj|AK104123.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-C12, full
           insert sequence
          Length = 1034

 Score =  355 bits (179), Expect = 8e-95
 Identities = 244/266 (91%)
 Strand = Plus / Minus

                                                                       
Query: 169 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 228
           ||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 853 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 794

                                                                       
Query: 229 gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 288
           | | |||||||||||||||||||||||| ||||||||||| ||||| |||||||||||||
Sbjct: 793 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 734

                                                                       
Query: 289 actggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatgg 348
           ||||| || ||||   ||||||||||||||| ||||||||||||||||| ||||||||||
Sbjct: 733 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 674

                                                                       
Query: 349 acgcgccggagaaggcgccgccgacnaggatgttggcgccgacgatgaagccgatggcga 408
           | ||||||  ||| ||||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 673 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 614

                                     
Query: 409 tgggcgcgatggtgcccaggctgccc 434
           |||| ||||||||||| |||||||||
Sbjct: 613 tgggggcgatggtgccgaggctgccc 588



to top

>dbj|AK068986.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023003E16, full
           insert sequence
          Length = 1082

 Score =  355 bits (179), Expect = 8e-95
 Identities = 244/266 (91%)
 Strand = Plus / Minus

                                                                       
Query: 169 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 228
           ||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 855 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 796

                                                                       
Query: 229 gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 288
           | | |||||||||||||||||||||||| ||||||||||| ||||| |||||||||||||
Sbjct: 795 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 736

                                                                       
Query: 289 actggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatgg 348
           ||||| || ||||   ||||||||||||||| ||||||||||||||||| ||||||||||
Sbjct: 735 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 676

                                                                       
Query: 349 acgcgccggagaaggcgccgccgacnaggatgttggcgccgacgatgaagccgatggcga 408
           | ||||||  ||| ||||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 675 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 616

                                     
Query: 409 tgggcgcgatggtgcccaggctgccc 434
           |||| ||||||||||| |||||||||
Sbjct: 615 tgggggcgatggtgccgaggctgccc 590



to top

>dbj|AK059438.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-027-G11, full
           insert sequence
          Length = 551

 Score =  355 bits (179), Expect = 8e-95
 Identities = 244/266 (91%)
 Strand = Plus / Minus

                                                                       
Query: 169 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 228
           ||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 379 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 320

                                                                       
Query: 229 gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 288
           | | |||||||||||||||||||||||| ||||||||||| ||||| |||||||||||||
Sbjct: 319 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 260

                                                                       
Query: 289 actggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatgg 348
           ||||| || ||||   ||||||||||||||| ||||||||||||||||| ||||||||||
Sbjct: 259 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 200

                                                                       
Query: 349 acgcgccggagaaggcgccgccgacnaggatgttggcgccgacgatgaagccgatggcga 408
           | ||||||  ||| ||||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 199 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 140

                                     
Query: 409 tgggcgcgatggtgcccaggctgccc 434
           |||| ||||||||||| |||||||||
Sbjct: 139 tgggggcgatggtgccgaggctgccc 114



to top

>dbj|AK058322.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B06, full
           insert sequence
          Length = 1055

 Score =  355 bits (179), Expect = 8e-95
 Identities = 244/266 (91%)
 Strand = Plus / Minus

                                                                       
Query: 169 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 228
           ||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 851 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 792

                                                                       
Query: 229 gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 288
           | | |||||||||||||||||||||||| ||||||||||| ||||| |||||||||||||
Sbjct: 791 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 732

                                                                       
Query: 289 actggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatgg 348
           ||||| || ||||   ||||||||||||||| ||||||||||||||||| ||||||||||
Sbjct: 731 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 672

                                                                       
Query: 349 acgcgccggagaaggcgccgccgacnaggatgttggcgccgacgatgaagccgatggcga 408
           | ||||||  ||| ||||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 671 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 612

                                     
Query: 409 tgggcgcgatggtgcccaggctgccc 434
           |||| ||||||||||| |||||||||
Sbjct: 611 tgggggcgatggtgccgaggctgccc 586



to top

>ref|XM_470213.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 753

 Score =  337 bits (170), Expect = 2e-89
 Identities = 232/253 (91%)
 Strand = Plus / Minus

                                                                       
Query: 182 ttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagat 241
           |||||||||||||||||||||||||||||||||| ||||||||||||| | |||||||||
Sbjct: 753 ttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaagaggacctcgtagat 694

                                                                       
Query: 242 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtaccccca 301
           ||||||||||||||| ||||||||||| ||||| |||||||||||||||||| || ||||
Sbjct: 693 gacgccggcgaggccaccgccgatgagtgggccaacccagtacacccactgggactccca 634

                                                                       
Query: 302 ctcccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaa 361
              ||||||||||||||| ||||||||||||||||| ||||||||||| ||||||  |||
Sbjct: 633 ggaccagctgacgagggccgggccgaaggagacggccgggttcatggaggcgccgtcgaa 574

                                                                       
Query: 362 ggcgccgccgacnaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 421
            ||||||||||| |||||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 573 cgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcgatgggggcgatggt 514

                        
Query: 422 gcccaggctgccc 434
           ||| |||||||||
Sbjct: 513 gccgaggctgccc 501



to top

>emb|AJ242805.1|SST242805 Sporobolus stapfianus mRNA for putative gamma tonoplast intrinsic
           protein (TIP)
          Length = 1146

 Score =  232 bits (117), Expect = 8e-58
 Identities = 223/258 (86%), Gaps = 3/258 (1%)
 Strand = Plus / Minus

                                                                       
Query: 180 gcttagtagtcggtggtggggagctgctcgtgggtgcgggag---atgaagagcagctcg 236
           |||||||||||||||||||||||||||||||||||| |||||   ||||||||||  |||
Sbjct: 837 gcttagtagtcggtggtggggagctgctcgtgggtgtgggaggagatgaagagcatgtcg 778

                                                                       
Query: 237 tagatgacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtac 296
           || || |   | |||||  |  | |||||||  |||||||||||||||||||| ||||  
Sbjct: 777 tatataagtgcagcgagtgcagcaccgatgaacgggccgacccagtacacccagtggttg 718

                                                                       
Query: 297 ccccactcccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccg 356
             |||   |||||||||||| | |||||||||||| ||||||||||||||||||||||||
Sbjct: 717 ttccaggaccagctgacgagcgaggggccgaaggacacggcggggttcatggacgcgccg 658

                                                                       
Query: 357 gagaaggcgccgccgacnaggatgttggcgccgacgatgaagccgatggcgatgggcgcg 416
             ||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |||
Sbjct: 657 tcgaaggcgccgccgacgaggatgttggcgcccacgatgaagccgatggcgatgggggcg 598

                             
Query: 417 atggtgcccaggctgccc 434
           ||||||||||||||||||
Sbjct: 597 atggtgcccaggctgccc 580



to top

>dbj|AK110727.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-170-E06, full
           insert sequence
          Length = 1024

 Score =  208 bits (105), Expect = 1e-50
 Identities = 155/172 (90%)
 Strand = Plus / Plus

                                                                       
Query: 263 gatgagggggccgacccagtacacccactggtacccccactcccagctgacgagggcggg 322
           |||||| ||||| |||||||||||||||||| || ||||   ||||||||||||||| ||
Sbjct: 219 gatgagtgggccaacccagtacacccactgggactcccaggaccagctgacgagggccgg 278

                                                                       
Query: 323 gccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacnaggatgtt 382
           ||||||||||||||| ||||||||||| ||||||  ||| ||||||||||| ||||||||
Sbjct: 279 gccgaaggagacggccgggttcatggaggcgccgtcgaacgcgccgccgacgaggatgtt 338

                                                               
Query: 383 ggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccc 434
            ||||||||||||||||||||||||||||| ||||||||||| |||||||||
Sbjct: 339 cgcgccgacgatgaagccgatggcgatgggggcgatggtgccgaggctgccc 390



 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 55/57 (96%)
 Strand = Plus / Plus

                                                                    
Query: 169 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatga 225
           ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 167 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatga 223



to top

>ref|NM_189497.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 759

 Score =  165 bits (83), Expect = 1e-37
 Identities = 103/110 (93%)
 Strand = Plus / Minus

                                                                       
Query: 310 tgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgc 369
           |||||| ||||||||||||||||||||||||||||||||| ||||||  |||||||||||
Sbjct: 628 tgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgc 569

                                                             
Query: 370 cgacnaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatg 419
           || | |||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 568 cggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatg 519



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  165 bits (83), Expect = 1e-37
 Identities = 103/110 (93%)
 Strand = Plus / Plus

                                                                            
Query: 310      tgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgc 369
                |||||| ||||||||||||||||||||||||||||||||| ||||||  |||||||||||
Sbjct: 43108799 tgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgc 43108858

                                                                  
Query: 370      cgacnaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatg 419
                || | |||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 43108859 cggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatg 43108908



 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 78/90 (86%)
 Strand = Plus / Minus

                                                                           
Query: 313     cgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccga 372
               ||||||| ||||||||||||  ||| ||||||||||| ||||||||| |||  |||||| 
Sbjct: 7297479 cgagggccgggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccgg 7297420

                                             
Query: 373     cnaggatgttggcgccgacgatgaagccga 402
               | ||||||||||||||||||| || |||||
Sbjct: 7297419 cgaggatgttggcgccgacgacgaggccga 7297390



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                                
Query: 246     ccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 294
               |||||||||||| ||||||||| ||| |||| |||||||||||| ||||
Sbjct: 6644922 ccggcgaggccggcgccgatgaagggaccgagccagtacacccagtggt 6644970



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                      
Query: 339     gggttcatggacgcgccggagaaggcgccgccgacnaggatgttggcgccgacga 393
               ||||||||||||||||||| ||  ||||||||| | | | |||||||||||||||
Sbjct: 7302352 gggttcatggacgcgccggtgagcgcgccgccggcgacggtgttggcgccgacga 7302298



to top

>gb|AF326500.1|AF326500 Zea mays tonoplast membrane integral protein ZmTIP1-2 mRNA,
           complete cds
          Length = 1021

 Score =  165 bits (83), Expect = 1e-37
 Identities = 133/150 (88%)
 Strand = Plus / Minus

                                                                       
Query: 270 gggccgacccagtacacccactggtacccccactcccagctgacgagggcggggccgaag 329
           |||||||||||||||||||| |||| | ||||  | | | |||||| ||| |||||||||
Sbjct: 682 gggccgacccagtacacccagtggttctcccagacgccggtgacgacggccgggccgaag 623

                                                                       
Query: 330 gagacggcggggttcatggacgcgccggagaaggcgccgccgacnaggatgttggcgccg 389
           |||||||||||||||||||| ||||||  ||||||||| ||  | |||||||||||||||
Sbjct: 622 gagacggcggggttcatggaggcgccgtcgaaggcgccccccgccaggatgttggcgccg 563

                                         
Query: 390 acgatgaagccgatggcgatgggcgcgatg 419
           ||||||||||||||||||||||||||||||
Sbjct: 562 acgatgaagccgatggcgatgggcgcgatg 533



to top

>dbj|AP003627.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0459B04
          Length = 142475

 Score =  165 bits (83), Expect = 1e-37
 Identities = 103/110 (93%)
 Strand = Plus / Plus

                                                                          
Query: 310    tgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgc 369
              |||||| ||||||||||||||||||||||||||||||||| ||||||  |||||||||||
Sbjct: 105828 tgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgc 105887

                                                                
Query: 370    cgacnaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatg 419
              || | |||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 105888 cggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatg 105937



to top

>dbj|AK111768.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023066H10, full
           insert sequence
          Length = 1346

 Score =  165 bits (83), Expect = 1e-37
 Identities = 103/110 (93%)
 Strand = Plus / Minus

                                                                       
Query: 310 tgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgc 369
           |||||| ||||||||||||||||||||||||||||||||| ||||||  |||||||||||
Sbjct: 652 tgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgc 593

                                                             
Query: 370 cgacnaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatg 419
           || | |||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 592 cggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatg 543



to top

>dbj|AK111747.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023050B20, full
           insert sequence
          Length = 1149

 Score =  165 bits (83), Expect = 1e-37
 Identities = 103/110 (93%)
 Strand = Plus / Minus

                                                                       
Query: 310 tgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgc 369
           |||||| ||||||||||||||||||||||||||||||||| ||||||  |||||||||||
Sbjct: 701 tgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgc 642

                                                             
Query: 370 cgacnaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatg 419
           || | |||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 641 cggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatg 592



to top

>dbj|AB114829.1| Oryza sativa (japonica cultivar-group) OsTIP1 mRNA for tonoplast
           intrinsic protein, complete cds
          Length = 970

 Score =  165 bits (83), Expect = 1e-37
 Identities = 103/110 (93%)
 Strand = Plus / Minus

                                                                       
Query: 310 tgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgc 369
           |||||| ||||||||||||||||||||||||||||||||| ||||||  |||||||||||
Sbjct: 638 tgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgc 579

                                                             
Query: 370 cgacnaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatg 419
           || | |||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 578 cggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatg 529



to top

>dbj|AK060994.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-E02, full
           insert sequence
          Length = 870

 Score =  155 bits (78), Expect = 1e-34
 Identities = 93/98 (94%)
 Strand = Plus / Minus

                                                                       
Query: 169 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 228
           ||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 689 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 630

                                                 
Query: 229 gcagctcgtagatgacgccggcgaggccgccgccgatg 266
           | | |||||||||||||||||||||||| |||||||||
Sbjct: 629 ggacctcgtagatgacgccggcgaggccaccgccgatg 592



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score =  147 bits (74), Expect = 3e-32
 Identities = 106/117 (90%)
 Strand = Plus / Minus

                                                                            
Query: 308      gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 367
                |||| ||| ||||||||||||||||   || |||||||||||  |||||||||||| |||
Sbjct: 13251010 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 13250951

                                                                         
Query: 368      gccgacnaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 424
                | |||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 13250950 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 13250894



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                                
Query: 236      gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 283
                ||||| || |||||||||||||||||||| ||||||||||||||||||
Sbjct: 13251082 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 13251035



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 386      gccgacgatgaagccgatggcgat 409
                ||||| ||||||||||||||||||
Sbjct: 26574317 gccgaggatgaagccgatggcgat 26574294



to top

>dbj|AP005449.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0427E01
          Length = 146395

 Score =  147 bits (74), Expect = 3e-32
 Identities = 106/117 (90%)
 Strand = Plus / Minus

                                                                         
Query: 308   gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 367
             |||| ||| ||||||||||||||||   || |||||||||||  |||||||||||| |||
Sbjct: 12820 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 12761

                                                                      
Query: 368   gccgacnaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 424
             | |||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 12760 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 12704



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                             
Query: 236   gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 283
             ||||| || |||||||||||||||||||| ||||||||||||||||||
Sbjct: 12892 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 12845



to top

>dbj|AP004784.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
              clone:OSJNBa0012F14
          Length = 168629

 Score =  147 bits (74), Expect = 3e-32
 Identities = 106/117 (90%)
 Strand = Plus / Minus

                                                                          
Query: 308    gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 367
              |||| ||| ||||||||||||||||   || |||||||||||  |||||||||||| |||
Sbjct: 168198 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 168139

                                                                       
Query: 368    gccgacnaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 424
              | |||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 168138 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 168082



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                              
Query: 236    gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 283
              ||||| || |||||||||||||||||||| ||||||||||||||||||
Sbjct: 168270 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 168223



to top

>dbj|AK104464.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C06, full
           insert sequence
          Length = 1194

 Score =  147 bits (74), Expect = 3e-32
 Identities = 106/117 (90%)
 Strand = Plus / Minus

                                                                       
Query: 308 gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 367
           |||| ||| ||||||||||||||||   || |||||||||||  |||||||||||| |||
Sbjct: 710 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 651

                                                                    
Query: 368 gccgacnaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 424
           | |||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 650 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 594



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 236 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 283
           ||||| || |||||||||||||||||||| ||||||||||||||||||
Sbjct: 782 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 735



to top

>dbj|AK104270.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-F03, full
           insert sequence
          Length = 1214

 Score =  147 bits (74), Expect = 3e-32
 Identities = 106/117 (90%)
 Strand = Plus / Minus

                                                                       
Query: 308 gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 367
           |||| ||| ||||||||||||||||   || |||||||||||  |||||||||||| |||
Sbjct: 712 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 653

                                                                    
Query: 368 gccgacnaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 424
           | |||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 652 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 596



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 236 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 283
           ||||| || |||||||||||||||||||| ||||||||||||||||||
Sbjct: 784 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 737



to top

>dbj|AK100193.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023036J06, full
           insert sequence
          Length = 1074

 Score =  147 bits (74), Expect = 3e-32
 Identities = 106/117 (90%)
 Strand = Plus / Minus

                                                                       
Query: 308 gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 367
           |||| ||| ||||||||||||||||   || |||||||||||  |||||||||||| |||
Sbjct: 590 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 531

                                                                    
Query: 368 gccgacnaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 424
           | |||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 530 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 474



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 236 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 283
           ||||| || |||||||||||||||||||| ||||||||||||||||||
Sbjct: 662 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 615



to top

>dbj|AK099616.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013050J20, full
           insert sequence
          Length = 1197

 Score =  147 bits (74), Expect = 3e-32
 Identities = 106/117 (90%)
 Strand = Plus / Minus

                                                                       
Query: 308 gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 367
           |||| ||| ||||||||||||||||   || |||||||||||  |||||||||||| |||
Sbjct: 713 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 654

                                                                    
Query: 368 gccgacnaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 424
           | |||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 653 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 597



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 236 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 283
           ||||| || |||||||||||||||||||| ||||||||||||||||||
Sbjct: 785 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 738



to top

>dbj|AK099141.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023055A02, full
           insert sequence
          Length = 1195

 Score =  147 bits (74), Expect = 3e-32
 Identities = 106/117 (90%)
 Strand = Plus / Minus

                                                                       
Query: 308 gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 367
           |||| ||| ||||||||||||||||   || |||||||||||  |||||||||||| |||
Sbjct: 711 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 652

                                                                    
Query: 368 gccgacnaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 424
           | |||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 651 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 595



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 236 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 283
           ||||| || |||||||||||||||||||| ||||||||||||||||||
Sbjct: 783 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 736



to top

>dbj|AK099015.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013116H02, full
           insert sequence
          Length = 1202

 Score =  147 bits (74), Expect = 3e-32
 Identities = 106/117 (90%)
 Strand = Plus / Minus

                                                                       
Query: 308 gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 367
           |||| ||| ||||||||||||||||   || |||||||||||  |||||||||||| |||
Sbjct: 713 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 654

                                                                    
Query: 368 gccgacnaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 424
           | |||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 653 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 597



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 236 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 283
           ||||| || |||||||||||||||||||| ||||||||||||||||||
Sbjct: 785 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 738



to top

>dbj|AK073531.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033044F19, full
           insert sequence
          Length = 1220

 Score =  147 bits (74), Expect = 3e-32
 Identities = 106/117 (90%)
 Strand = Plus / Minus

                                                                       
Query: 308 gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 367
           |||| ||| ||||||||||||||||   || |||||||||||  |||||||||||| |||
Sbjct: 711 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 652

                                                                    
Query: 368 gccgacnaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 424
           | |||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 651 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 595



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 236 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 283
           ||||| || |||||||||||||||||||| ||||||||||||||||||
Sbjct: 783 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 736



to top

>dbj|AK104377.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-035-G09, full
           insert sequence
          Length = 1196

 Score =  139 bits (70), Expect = 8e-30
 Identities = 105/117 (89%)
 Strand = Plus / Minus

                                                                       
Query: 308 gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 367
           |||| ||| |||||| |||||||||   || |||||||||||  |||||||||||| |||
Sbjct: 712 gctggcgacggcgggaccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 653

                                                                    
Query: 368 gccgacnaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 424
           | |||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 652 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 596



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 236 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 283
           ||||| || |||||||||||||||||||| ||||||||||||||||||
Sbjct: 784 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 737



to top

>gb|AY525641.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;3 mRNA,
           complete cds
          Length = 829

 Score =  137 bits (69), Expect = 3e-29
 Identities = 98/108 (90%)
 Strand = Plus / Minus

                                                                       
Query: 317 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacnag 376
           ||||||||||||||||   || |||||||||||| |||||||||||| |||| |||| ||
Sbjct: 663 ggcggggccgaaggagcgtgcagggttcatggacccgccggagaaggggccggcgacgag 604

                                                           
Query: 377 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 424
           ||||||||||||||||||||||||||||||||| || |||||||||||
Sbjct: 603 gatgttggcgccgacgatgaagccgatggcgattggagcgatggtgcc 556



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 236 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 283
           ||||| ||||||||||||||| ||||||||||| |||||| |||||||
Sbjct: 744 gtagacgacgccggcgaggccaccgccgatgagcgggccggcccagta 697



to top

>gb|AY525640.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;2 mRNA,
           complete cds
          Length = 853

 Score =  137 bits (69), Expect = 3e-29
 Identities = 98/108 (90%)
 Strand = Plus / Minus

                                                                       
Query: 317 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacnag 376
           ||||||||||||||||   || |||||||||||| |||||||||||| |||| | || ||
Sbjct: 666 ggcggggccgaaggagcgtgcagggttcatggacccgccggagaaggggccggcaacgag 607

                                                           
Query: 377 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 424
           |||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 606 gatgttggcgccgacgatgaagccgatggcgatgggggcgatggtgcc 559



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 236 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 283
           ||||| ||||||||||||||| ||||||||||| |||||| |||||||
Sbjct: 747 gtagacgacgccggcgaggccaccgccgatgagcgggccggcccagta 700



to top

>gb|AY525639.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;1 mRNA,
           complete cds
          Length = 817

 Score =  137 bits (69), Expect = 3e-29
 Identities = 98/108 (90%)
 Strand = Plus / Minus

                                                                       
Query: 317 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacnag 376
           ||||||||||||||||   || |||||||||||| |||||||||||| |||| | || ||
Sbjct: 667 ggcggggccgaaggagcgtgcagggttcatggacccgccggagaaggggccggccacgag 608

                                                           
Query: 377 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 424
           |||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 607 gatgttggcgccgacgatgaagccgatggcgatgggggcgatggtgcc 560



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 49/54 (90%)
 Strand = Plus / Minus

                                                                 
Query: 236 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccca 289
           ||||| ||||||||||||||| ||||||||||| |||||| ||||||| |||||
Sbjct: 748 gtagacgacgccggcgaggccaccgccgatgagcgggccggcccagtagaccca 695



to top

>gb|AY112388.1| Zea mays CL24208_1 mRNA sequence
          Length = 833

 Score =  131 bits (66), Expect = 2e-27
 Identities = 127/150 (84%)
 Strand = Plus / Plus

                                                                       
Query: 270 gggccgacccagtacacccactggtacccccactcccagctgacgagggcggggccgaag 329
           |||||||||||||||||||| |||| | ||||  | | | ||||||  || |||||||||
Sbjct: 329 gggccgacccagtacacccagtggttctcccagacgccggtgacgacagccgggccgaag 388

                                                                       
Query: 330 gagacggcggggttcatggacgcgccggagaaggcgccgccgacnaggatgttggcgccg 389
           |||||||||| ||||||||| ||||||  |||||||       | |||||||||||||||
Sbjct: 389 gagacggcggngttcatggaggcgccgtcgaaggcgnnnnnngccaggatgttggcgccg 448

                                         
Query: 390 acgatgaagccgatggcgatgggcgcgatg 419
           ||||||||||||||||||||||||||||||
Sbjct: 449 acgatgaagccgatggcgatgggcgcgatg 478



to top

>gb|AY243804.1| Zea mays tonoplast water channel mRNA, complete cds
          Length = 968

 Score =  129 bits (65), Expect = 8e-27
 Identities = 100/112 (89%)
 Strand = Plus / Minus

                                                                       
Query: 317 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacnag 376
           ||||||||||||||||  ||| |||||||||||  |||||  ||||| |||| || | ||
Sbjct: 615 ggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcggccag 556

                                                               
Query: 377 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccagg 428
           |||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 555 gatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagg 504



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 252 aggccgccgccgatgagggggccgacccagtacaccca 289
           ||||| ||||||| ||||||||||||||||||||||||
Sbjct: 680 aggccaccgccgacgagggggccgacccagtacaccca 643



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 317 ggcggggccgaaggagacggcggggttca 345
           |||| ||||||||| ||||||||||||||
Sbjct: 276 ggcgaggccgaaggtgacggcggggttca 248



to top

>gb|AF326503.1|AF326503 Zea mays tonoplast membrane integral protein ZmTIP2-3 mRNA,
           complete cds
          Length = 1042

 Score =  129 bits (65), Expect = 8e-27
 Identities = 100/112 (89%)
 Strand = Plus / Minus

                                                                       
Query: 317 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacnag 376
           ||||||||||||||||  ||| |||||||||||  |||||  ||||| |||| || | ||
Sbjct: 683 ggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcggccag 624

                                                               
Query: 377 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccagg 428
           |||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 623 gatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagg 572



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 252 aggccgccgccgatgagggggccgacccagtacaccca 289
           ||||| ||||||| ||||||||||||||||||||||||
Sbjct: 748 aggccaccgccgacgagggggccgacccagtacaccca 711



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 317 ggcggggccgaaggagacggcggggttca 345
           |||| ||||||||| ||||||||||||||
Sbjct: 344 ggcgaggccgaaggtgacggcggggttca 316



to top

>gb|AY106931.1| Zea mays PCO140073 mRNA sequence
          Length = 1069

 Score =  129 bits (65), Expect = 8e-27
 Identities = 100/112 (89%)
 Strand = Plus / Minus

                                                                       
Query: 317 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacnag 376
           ||||||||||||||||  ||| |||||||||||  |||||  ||||| |||| || | ||
Sbjct: 692 ggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcggccag 633

                                                               
Query: 377 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccagg 428
           |||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 632 gatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagg 581



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 252 aggccgccgccgatgagggggccgacccagtacaccca 289
           ||||| ||||||| ||||||||||||||||||||||||
Sbjct: 757 aggccaccgccgacgagggggccgacccagtacaccca 720



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 317 ggcggggccgaaggagacggcggggttca 345
           |||| ||||||||| ||||||||||||||
Sbjct: 353 ggcgaggccgaaggtgacggcggggttca 325



to top

>gb|AF057183.1|AF057183 Zea mays putative tonoplast aquaporin mRNA, complete cds
          Length = 1060

 Score =  129 bits (65), Expect = 8e-27
 Identities = 100/112 (89%)
 Strand = Plus / Minus

                                                                       
Query: 317 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacnag 376
           ||||||||||||||||  ||| |||||||||||  |||||  ||||| |||| || | ||
Sbjct: 674 ggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcggccag 615

                                                               
Query: 377 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccagg 428
           |||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 614 gatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagg 563



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 252 aggccgccgccgatgagggggccgacccagtacaccca 289
           ||||| ||||||| ||||||||||||||||||||||||
Sbjct: 739 aggccaccgccgacgagggggccgacccagtacaccca 702



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 317 ggcggggccgaaggagacggcggggttca 345
           |||| ||||||||| ||||||||||||||
Sbjct: 335 ggcgaggccgaaggtgacggcggggttca 307



to top

>gb|AF326502.1|AF326502 Zea mays tonoplast membrane integral protein ZmTIP2-2 mRNA,
           complete cds
          Length = 1073

 Score =  121 bits (61), Expect = 2e-24
 Identities = 96/108 (88%)
 Strand = Plus / Minus

                                                                       
Query: 317 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacnag 376
           ||||||||||||||||  |||||||||||||||  |||||  |||||  ||  || | ||
Sbjct: 682 ggcggggccgaaggagcgggcggggttcatggagccgccgctgaagggccccgcggcgag 623

                                                           
Query: 377 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 424
           ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 622 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 575



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 235 cgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccca 289
           |||||| || ||| ||||| |||||||||||||| |||||||||||||| |||||
Sbjct: 764 cgtagacgaggccagcgagtccgccgccgatgagcgggccgacccagtagaccca 710



to top

>gb|AF326501.1|AF326501 Zea mays tonoplast membrane integral protein ZmTIP2-1 mRNA,
           complete cds
          Length = 1110

 Score =  121 bits (61), Expect = 2e-24
 Identities = 96/108 (88%)
 Strand = Plus / Minus

                                                                       
Query: 317 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacnag 376
           ||||||||||||||||  |||||||||||||||  |||||  |||||  ||  || | ||
Sbjct: 839 ggcggggccgaaggagcgggcggggttcatggagccgccgctgaagggccccgcggcgag 780

                                                           
Query: 377 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 424
           ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 779 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 732



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 235 cgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccca 289
           |||||| || ||| |||||||||||||||| ||| |||||||||||||| |||||
Sbjct: 921 cgtagacgaggccagcgaggccgccgccgacgagcgggccgacccagtagaccca 867



to top

>gb|AY105015.1| Zea mays PCO137646 mRNA sequence
          Length = 1238

 Score =  121 bits (61), Expect = 2e-24
 Identities = 96/108 (88%)
 Strand = Plus / Minus

                                                                       
Query: 317 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacnag 376
           ||||||||||||||||  |||||||||||||||  |||||  |||||  ||  || | ||
Sbjct: 838 ggcggggccgaaggagcgggcggggttcatggagccgccgctgaagggccccgcggcgag 779

                                                           
Query: 377 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 424
           ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 778 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 731



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 235 cgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccca 289
           |||||| || ||| |||||||||||||||| ||| |||||||||||||| |||||
Sbjct: 920 cgtagacgaggccagcgaggccgccgccgacgagcgggccgacccagtagaccca 866



to top

>gb|U86763.1|TAU86763 Triticum aestivum delta-type tonoplast intrinsic protein mRNA,
           complete cds
          Length = 1067

 Score =  121 bits (61), Expect = 2e-24
 Identities = 96/108 (88%)
 Strand = Plus / Minus

                                                                       
Query: 317 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacnag 376
           ||||||||||||||||   || |||||||||||| ||||||| |||| |||| | || ||
Sbjct: 669 ggcggggccgaaggagcgtgcagggttcatggacccgccggaaaaggggccggccacgag 610

                                                           
Query: 377 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 424
           ||||||||||||||| |||||||||||||||||||| |||||||||||
Sbjct: 609 gatgttggcgccgacaatgaagccgatggcgatgggggcgatggtgcc 562



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 242 gacgccggcgaggccgccgccgatgagggggccgacccagtacaccca 289
           ||||||||||||||| ||||||||||| |||||| ||||||| |||||
Sbjct: 744 gacgccggcgaggccaccgccgatgagcgggccggcccagtaaaccca 697



to top

>ref|XM_467137.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 747

 Score =  105 bits (53), Expect = 1e-19
 Identities = 94/108 (87%)
 Strand = Plus / Minus

                                                                       
Query: 317 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacnag 376
           ||||||||||||||||   || |||||||||||  |||||  ||| | |||| || | ||
Sbjct: 612 ggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcgag 553

                                                           
Query: 377 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 424
           ||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 552 gatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgcc 505



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 246 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 289
           |||||||||||||||||||| || |||||||||||||| |||||
Sbjct: 683 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 640



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  105 bits (53), Expect = 1e-19
 Identities = 94/108 (87%)
 Strand = Plus / Plus

                                                                            
Query: 317      ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacnag 376
                ||||||||||||||||   || |||||||||||  |||||  ||| | |||| || | ||
Sbjct: 26627254 ggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcgag 26627313

                                                                
Query: 377      gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 424
                ||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 26627314 gatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgcc 26627361



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                            
Query: 246      ccggcgaggccgccgccgatgagggggccgacccagtacaccca 289
                |||||||||||||||||||| || |||||||||||||| |||||
Sbjct: 26627183 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 26627226



to top

>dbj|AP005006.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0519E06
          Length = 170634

 Score =  105 bits (53), Expect = 1e-19
 Identities = 94/108 (87%)
 Strand = Plus / Plus

                                                                          
Query: 317    ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacnag 376
              ||||||||||||||||   || |||||||||||  |||||  ||| | |||| || | ||
Sbjct: 169635 ggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcgag 169694

                                                              
Query: 377    gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 424
              ||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 169695 gatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgcc 169742



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                          
Query: 246    ccggcgaggccgccgccgatgagggggccgacccagtacaccca 289
              |||||||||||||||||||| || |||||||||||||| |||||
Sbjct: 169564 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 169607



to top

>dbj|AP005289.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1112_F09
          Length = 139371

 Score =  105 bits (53), Expect = 1e-19
 Identities = 94/108 (87%)
 Strand = Plus / Plus

                                                                         
Query: 317   ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacnag 376
             ||||||||||||||||   || |||||||||||  |||||  ||| | |||| || | ||
Sbjct: 61415 ggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcgag 61474

                                                             
Query: 377   gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 424
             ||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 61475 gatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgcc 61522



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                         
Query: 246   ccggcgaggccgccgccgatgagggggccgacccagtacaccca 289
             |||||||||||||||||||| || |||||||||||||| |||||
Sbjct: 61344 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 61387



to top

>dbj|AB114830.1| Oryza sativa (japonica cultivar-group) OsTIP2 mRNA for tonoplast
           intrinsic protein, complete cds
          Length = 1013

 Score =  105 bits (53), Expect = 1e-19
 Identities = 94/108 (87%)
 Strand = Plus / Minus

                                                                       
Query: 317 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacnag 376
           ||||||||||||||||   || |||||||||||  |||||  ||| | |||| || | ||
Sbjct: 685 ggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcgag 626

                                                           
Query: 377 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 424
           ||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 625 gatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgcc 578



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 246 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 289
           |||||||||||||||||||| || |||||||||||||| |||||
Sbjct: 756 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 713



to top

>dbj|AK064728.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-120-A10, full
           insert sequence
          Length = 873

 Score =  105 bits (53), Expect = 1e-19
 Identities = 94/108 (87%)
 Strand = Plus / Minus

                                                                       
Query: 317 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacnag 376
           ||||||||||||||||   || |||||||||||  |||||  ||| | |||| || | ||
Sbjct: 487 ggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcgag 428

                                                           
Query: 377 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 424
           ||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 427 gatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgcc 380



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 246 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 289
           |||||||||||||||||||| || |||||||||||||| |||||
Sbjct: 558 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 515



to top

>emb|AJ307662.1|OSA307662 Oryza sativa genomic DNA fragment, chromosome 2
          Length = 339972

 Score =  105 bits (53), Expect = 1e-19
 Identities = 94/108 (87%)
 Strand = Plus / Minus

                                                                          
Query: 317    ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacnag 376
              ||||||||||||||||   || |||||||||||  |||||  ||| | |||| || | ||
Sbjct: 250580 ggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcgag 250521

                                                              
Query: 377    gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 424
              ||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 250520 gatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgcc 250473



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 49/50 (98%)
 Strand = Plus / Plus

                                                                
Query: 375    aggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 424
              ||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 332126 aggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgcc 332175



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                          
Query: 246    ccggcgaggccgccgccgatgagggggccgacccagtacaccca 289
              |||||||||||||||||||| || |||||||||||||| |||||
Sbjct: 250651 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 250608



to top

>gb|AY389618.1| Hyacinthus orientalis mitochondrial tonoplast intrinsic protein
           (TIP1) mRNA, partial cds
          Length = 662

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 111/132 (84%)
 Strand = Plus / Minus

                                                                       
Query: 299 ccactcccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccgga 358
           |||||||||||| || || |  || |||||||| || || |||||||| ||||| |||  
Sbjct: 632 ccactcccagctcaccagcggcggcccgaaggacaccgccgggttcatcgacgccccgtc 573

                                                                       
Query: 359 gaaggcgccgccgacnaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 418
           |||||| |||||| | ||||||||||| || |||||||||||||| ||||||||||||||
Sbjct: 572 gaaggccccgccggccaggatgttggcccccacgatgaagccgatcgcgatgggcgcgat 513

                       
Query: 419 ggtgcccaggct 430
            || ||||||||
Sbjct: 512 cgtccccaggct 501



to top

>dbj|AB206104.1| Mimosa pudica tip1;1 mRNA for tonoplast intrinsic protein 1;1,
           complete cds
          Length = 1067

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 96/113 (84%)
 Strand = Plus / Minus

                                                                       
Query: 182 ttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagat 241
           |||||| ||||||||||||||||||||||||||| ||||||||||||  |  || |||||
Sbjct: 826 ttagtaatcggtggtggggagctgctcgtgggtgtgggagatgaagataacttcatagat 767

                                                                
Query: 242 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 294
           ||| || || ||||| || || || || |||||||||||||| ||||| ||||
Sbjct: 766 gaccccagcaaggccacctccaataagtgggccgacccagtagacccagtggt 714



to top

>ref|NM_188624.1| Oryza sativa (japonica cultivar-group), Ozsa8227 predicted mRNA
          Length = 756

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 78/90 (86%)
 Strand = Plus / Minus

                                                                       
Query: 313 cgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccga 372
           ||||||| ||||||||||||  ||| ||||||||||| ||||||||| |||  |||||| 
Sbjct: 616 cgagggccgggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccgg 557

                                         
Query: 373 cnaggatgttggcgccgacgatgaagccga 402
           | ||||||||||||||||||| || |||||
Sbjct: 556 cgaggatgttggcgccgacgacgaggccga 527



to top

>gb|AF326508.1|AF326508 Zea mays tonoplast membrane integral protein ZmTIP4-4 mRNA,
           complete cds
          Length = 955

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 72/82 (87%)
 Strand = Plus / Minus

                                                                       
Query: 312 acgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccg 371
           ||||| |||||||||||||||   ||||||||||||||||||||||||||||  ||||||
Sbjct: 714 acgagcgcggggccgaaggagcgcgcggggttcatggacgcgccggagaagggcccgccg 655

                                 
Query: 372 acnaggatgttggcgccgacga 393
            | || | ||||||||||||||
Sbjct: 654 gcgagcacgttggcgccgacga 633



to top

>gb|AF254799.1|AF254799 Hordeum vulgare tonoplast intrinsic protein 1 (TIP1), tonoplast
             intrinsic protein 2 (TIP2), and Rar1 (Rar1) genes,
             complete cds
          Length = 65979

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 75/86 (87%)
 Strand = Plus / Minus

                                                                         
Query: 339   gggttcatggacgcgccggagaaggcgccgccgacnaggatgttggcgccgacgatgaag 398
             |||||||||||  |||||  |||||  ||| || | ||||||||||||||||||||||||
Sbjct: 44819 gggttcatggagccgccgctgaagggcccggcggcgaggatgttggcgccgacgatgaag 44760

                                       
Query: 399   ccgatggcgatgggcgcgatggtgcc 424
             ||||| || |||||||||||||||||
Sbjct: 44759 ccgatcgccatgggcgcgatggtgcc 44734



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                         
Query: 246   ccggcgaggccgccgccgatgagggggccgacccagtacaccca 289
             |||||||||||||| || ||||| || |||||||||||||||||
Sbjct: 44912 ccggcgaggccgccaccaatgagtggcccgacccagtacaccca 44869



to top

>dbj|AP001550.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0431F01
          Length = 143209

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 78/90 (86%)
 Strand = Plus / Minus

                                                                         
Query: 313   cgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccga 372
             ||||||| ||||||||||||  ||| ||||||||||| ||||||||| |||  |||||| 
Sbjct: 98909 cgagggccgggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccgg 98850

                                           
Query: 373   cnaggatgttggcgccgacgatgaagccga 402
             | ||||||||||||||||||| || |||||
Sbjct: 98849 cgaggatgttggcgccgacgacgaggccga 98820



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                     
Query: 339    gggttcatggacgcgccggagaaggcgccgccgacnaggatgttggcgccgacga 393
              ||||||||||||||||||| ||  ||||||||| | | | |||||||||||||||
Sbjct: 103782 gggttcatggacgcgccggtgagcgcgccgccggcgacggtgttggcgccgacga 103728



to top

>dbj|AK069192.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023007E01, full
           insert sequence
          Length = 1112

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 78/90 (86%)
 Strand = Plus / Minus

                                                                       
Query: 313 cgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccga 372
           ||||||| ||||||||||||  ||| ||||||||||| ||||||||| |||  |||||| 
Sbjct: 619 cgagggccgggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccgg 560

                                         
Query: 373 cnaggatgttggcgccgacgatgaagccga 402
           | ||||||||||||||||||| || |||||
Sbjct: 559 cgaggatgttggcgccgacgacgaggccga 530



to top

>gb|U43291.1|MCU43291 Mesembryanthemum crystallinum tonoplast intrinsic protein (TIP)
           mRNA, complete cds
          Length = 1235

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 138/170 (81%)
 Strand = Plus / Minus

                                                                       
Query: 237 tagatgacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtac 296
           |||||||| |||||||| || || |||||||| |||||||||||||| ||||| ||||  
Sbjct: 752 tagatgactccggcgagccctcctccgatgagtgggccgacccagtagacccagtggttg 693

                                                                       
Query: 297 ccccactcccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccg 356
             |||   ||| ||||| ||||| || ||||| || ||||| ||||||||||| || |||
Sbjct: 692 ttccaggtccaactgactagggctggaccgaatgacacggccgggttcatggatgcaccg 633

                                                             
Query: 357 gagaaggcgccgccgacnaggatgttggcgccgacgatgaagccgatggc 406
           | |||||| || ||||| | ||||||||| || |||||||| || |||||
Sbjct: 632 gtgaaggctcctccgaccaagatgttggctccaacgatgaaaccaatggc 583



to top

>emb|AJ005078.2|PAAJ5078 Picea abies mRNA for aquaporin-like protein
          Length = 1007

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 88/104 (84%)
 Strand = Plus / Minus

                                                                       
Query: 325 cgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacnaggatgttgg 384
           ||||||||  |||||||||||||||  |||| ||||||| |||  || | | ||||||||
Sbjct: 684 cgaaggagcgggcggggttcatggagccgccagagaaggggcccgcggccaagatgttgg 625

                                                       
Query: 385 cgccgacgatgaagccgatggcgatgggcgcgatggtgcccagg 428
           |||| ||||||||||| || || ||||| |||||||||||||||
Sbjct: 624 cgcccacgatgaagccaatagcaatgggagcgatggtgcccagg 581



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 42/44 (95%)
 Strand = Plus / Minus

                                                       
Query: 246 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 289
           ||||| |||||||| |||||||||||||||||||||||||||||
Sbjct: 763 ccggcaaggccgcctccgatgagggggccgacccagtacaccca 720



to top

>gb|AF326505.1|AF326505 Zea mays tonoplast membrane integral protein ZmTIP4-1 mRNA,
           complete cds
          Length = 1125

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 71/82 (86%)
 Strand = Plus / Minus

                                                                       
Query: 315 agggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacn 374
           ||||| ||||||||||||   || ||||||||||||||||||| ||||  ||||||| | 
Sbjct: 768 agggccgggccgaaggagcgtgccgggttcatggacgcgccggtgaagttgccgccggcg 709

                                 
Query: 375 aggatgttggcgccgacgatga 396
           ||| ||||||||||||||||||
Sbjct: 708 aggctgttggcgccgacgatga 687



to top

>ref|XM_473424.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 2307

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 47/50 (94%)
 Strand = Plus / Minus

                                                             
Query: 375 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 424
           ||||||||||| |||||||||||||||||||| |||||||||| ||||||
Sbjct: 557 aggatgttggcaccgacgatgaagccgatggccatgggcgcgacggtgcc 508



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 246 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 289
           ||||| ||||| || ||||| || ||||||||||||||||||||
Sbjct: 686 ccggccaggccaccaccgatcagtgggccgacccagtacaccca 643



to top

>emb|AL663000.4|OSJN00201 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0034G17,
             complete sequence
          Length = 127259

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 47/50 (94%)
 Strand = Plus / Plus

                                                               
Query: 375   aggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 424
             ||||||||||| |||||||||||||||||||| |||||||||| ||||||
Sbjct: 92622 aggatgttggcaccgacgatgaagccgatggccatgggcgcgacggtgcc 92671



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                         
Query: 246   ccggcgaggccgccgccgatgagggggccgacccagtacaccca 289
             ||||| ||||| || ||||| || ||||||||||||||||||||
Sbjct: 92493 ccggccaggccaccaccgatcagtgggccgacccagtacaccca 92536



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 47/50 (94%)
 Strand = Plus / Plus

                                                                  
Query: 375      aggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcc 424
                ||||||||||| |||||||||||||||||||| |||||||||| ||||||
Sbjct: 27568646 aggatgttggcaccgacgatgaagccgatggccatgggcgcgacggtgcc 27568695



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 124/157 (78%)
 Strand = Plus / Minus

                                                                            
Query: 259      cgccgatgagggggccgacccagtacacccactggtacccccactcccagctgacgaggg 318
                |||||||||| || |||| |||||| ||||| ||||  | ||| | ||||| |||||| |
Sbjct: 26354830 cgccgatgagcggcccgagccagtaaacccagtggtggcgccagttccagccgacgagcg 26354771

                                                                            
Query: 319      cggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacnagga 378
                | |||||||| | |   || |||||||||| |||||||  ||| | ||| ||| | ||||
Sbjct: 26354770 ccgggccgaacgcgcgcgccgggttcatggccgcgccgtcgaacgggcccccggcgagga 26354711

                                                     
Query: 379      tgttggcgccgacgatgaagccgatggcgatgggcgc 415
                |||| |||||  |||  ||||||||||||| ||||||
Sbjct: 26354710 tgttcgcgcccgcgaccaagccgatggcgaggggcgc 26354674



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                            
Query: 246      ccggcgaggccgccgccgatgagggggccgacccagtacaccca 289
                ||||| ||||| || ||||| || ||||||||||||||||||||
Sbjct: 27568517 ccggccaggccaccaccgatcagtgggccgacccagtacaccca 27568560



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                            
Query: 242      gacgccggcgaggccgccgccgatgagg 269
                ||||||| ||||||||||||||| ||||
Sbjct: 19492802 gacgccgacgaggccgccgccgaggagg 19492775



to top

>dbj|AB012270.1| Aster tripolium mRNA for SAMIPD, partial cds
          Length = 321

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 38/39 (97%)
 Strand = Plus / Minus

                                                  
Query: 377 gatgttggcgccgacgatgaagccgatggcgatgggcgc 415
           |||||||||||||||||||||||||||||| ||||||||
Sbjct: 321 gatgttggcgccgacgatgaagccgatggcaatgggcgc 283



to top

>emb|X95650.1|TGTIP1GEN T.gesneriana mRNA for tonoplast intrinsic protein
          Length = 992

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 73/87 (83%)
 Strand = Plus / Minus

                                                                       
Query: 335 ggcggggttcatggacgcgccggagaaggcgccgccgacnaggatgttggcgccgacgat 394
           |||||||||||| ||||| |||| ||| || || || || || |||||||| ||||||||
Sbjct: 623 ggcggggttcatcgacgcaccggtgaacgccccaccaaccagaatgttggcaccgacgat 564

                                      
Query: 395 gaagccgatggcgatgggcgcgatggt 421
           ||| ||||| || ||||| ||||||||
Sbjct: 563 gaatccgatcgcaatgggagcgatggt 537



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 258 ccgccgatgagggggccgacccagtacaccca 289
           ||||||||||| ||||| ||||||||||||||
Sbjct: 703 ccgccgatgagcgggccaacccagtacaccca 672



to top

>gb|AY821911.1| Gossypium hirsutum putative tonoplast intrinsic protein mRNA,
           partial cds
          Length = 529

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 86/104 (82%)
 Strand = Plus / Minus

                                                                       
Query: 180 gcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtag 239
           ||||| || |||||||| ||||||||||||||||||  |  ||||||||  | |||||||
Sbjct: 417 gcttaataatcggtggttgggagctgctcgtgggtgttgctgatgaagatgaactcgtag 358

                                                       
Query: 240 atgacgccggcgaggccgccgccgatgagggggccgacccagta 283
           ||||  || ||||| || || ||||| ||||| |||||||||||
Sbjct: 357 atgagaccagcgagcccaccaccgataaggggtccgacccagta 314



to top

>ref|NM_197137.1| Oryza sativa (japonica cultivar-group) putative beta-tonoplast
           intrinsic protein (OSJNBa0051D19.19), mRNA
          Length = 1186

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                       
Query: 246 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 305
           |||||||||||| |||||| || |||||||| |||||||||||| |||| || |||   |
Sbjct: 855 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggtgcctccagcgc 796

                                  
Query: 306 cagctgacgagggcggggccgaa 328
           |||| |||||| || ||||||||
Sbjct: 795 cagccgacgagcgccgggccgaa 773



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 378 atgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 421
           ||||||||||||| || |||||||| |||||  |||||||||||
Sbjct: 723 atgttggcgccgaggaggaagccgacggcgagcggcgcgatggt 680



to top

>ref|NM_189871.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 576

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 246 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 305
           |||||||||||| | ||||||| |||||||| |||||||||||| |||| || ||| | |
Sbjct: 512 ccggcgaggccggcaccgatgaaggggccgagccagtacacccagtggtgcctccagtgc 453

                      
Query: 306 cagctgacgag 316
           |||| ||||||
Sbjct: 452 cagccgacgag 442



to top

>gb|AC023240.9| Oryza sativa chromosome 10 BAC OSJNBa0051D19 genomic sequence, complete
             sequence
          Length = 131984

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                         
Query: 246   ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 305
             |||||||||||| |||||| || |||||||| |||||||||||| |||| || |||   |
Sbjct: 26108 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggtgcctccagcgc 26167

                                    
Query: 306   cagctgacgagggcggggccgaa 328
             |||| |||||| || ||||||||
Sbjct: 26168 cagccgacgagcgccgggccgaa 26190



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                         
Query: 378   atgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 421
             ||||||||||||| || |||||||| |||||  |||||||||||
Sbjct: 26240 atgttggcgccgaggaggaagccgacggcgagcggcgcgatggt 26283



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                            
Query: 246      ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 305
                |||||||||||| |||||| || |||||||| |||||||||||| |||| || |||   |
Sbjct: 18187020 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggtgcctccagcgc 18186961

                                       
Query: 306      cagctgacgagggcggggccgaa 328
                |||| |||||| || ||||||||
Sbjct: 18186960 cagccgacgagcgccgggccgaa 18186938



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                            
Query: 378      atgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 421
                ||||||||||||| || |||||||| |||||  |||||||||||
Sbjct: 18186888 atgttggcgccgaggaggaagccgacggcgagcggcgcgatggt 18186845



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                            
Query: 246      ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 305
                |||||||||||| | ||||||| |||||||| |||||||||||| |||| || ||| | |
Sbjct: 25641777 ccggcgaggccggcaccgatgaaggggccgagccagtacacccagtggtgcctccagtgc 25641836

                           
Query: 306      cagctgacgag 316
                |||| ||||||
Sbjct: 25641837 cagccgacgag 25641847



to top

>gb|AF326506.1|AF326506 Zea mays tonoplast membrane integral protein ZmTIP4-2 mRNA,
           complete cds
          Length = 1255

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 51/58 (87%)
 Strand = Plus / Minus

                                                                     
Query: 339 gggttcatggacgcgccggagaaggcgccgccgacnaggatgttggcgccgacgatga 396
           ||||||||||||||||||| ||||  ||||||| | ||| ||||||||||||| ||||
Sbjct: 743 gggttcatggacgcgccggtgaagttgccgccggcgaggctgttggcgccgactatga 686



to top

>dbj|AP004380.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0594D10
          Length = 143200

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                         
Query: 246   ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 305
             |||||||||||| | ||||||| |||||||| |||||||||||| |||| || ||| | |
Sbjct: 95750 ccggcgaggccggcaccgatgaaggggccgagccagtacacccagtggtgcctccagtgc 95809

                        
Query: 306   cagctgacgag 316
             |||| ||||||
Sbjct: 95810 cagccgacgag 95820



to top

>dbj|AK111931.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-016-C03, full
           insert sequence
          Length = 1200

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                       
Query: 246 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 305
           |||||||||||| |||||| || |||||||| |||||||||||| |||| || |||   |
Sbjct: 864 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggtgcctccagcgc 805

                                  
Query: 306 cagctgacgagggcggggccgaa 328
           |||| |||||| || ||||||||
Sbjct: 804 cagccgacgagcgccgggccgaa 782



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 378 atgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 421
           ||||||||||||| || |||||||| |||||  |||||||||||
Sbjct: 732 atgttggcgccgaggaggaagccgacggcgagcggcgcgatggt 689



to top

>dbj|AB114828.1| Oryza sativa (japonica cultivar-group) OsTIP3 mRNA for tonoplast
           intrinsic protein, complete cds
          Length = 1178

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                       
Query: 246 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 305
           |||||||||||| |||||| || |||||||| |||||||||||| |||| || |||   |
Sbjct: 847 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggtgcctccagcgc 788

                                  
Query: 306 cagctgacgagggcggggccgaa 328
           |||| |||||| || ||||||||
Sbjct: 787 cagccgacgagcgccgggccgaa 765



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 378 atgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 421
           ||||||||||||| || |||||||| |||||  |||||||||||
Sbjct: 715 atgttggcgccgaggaggaagccgacggcgagcggcgcgatggt 672



to top

>dbj|AK106383.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-102-E03, full
           insert sequence
          Length = 1787

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                       
Query: 246 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 305
           |||||||||||| |||||| || |||||||| |||||||||||| |||| || |||   |
Sbjct: 139 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggtgcctccagcgc 198

                                  
Query: 306 cagctgacgagggcggggccgaa 328
           |||| |||||| || ||||||||
Sbjct: 199 cagccgacgagcgccgggccgaa 221



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 378 atgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 421
           ||||||||||||| || |||||||| |||||  |||||||||||
Sbjct: 271 atgttggcgccgaggaggaagccgacggcgagcggcgcgatggt 314



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                            
Query: 246      ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 305
                |||||||||||| |||||| || |||||||| |||||||||||| |||| || |||   |
Sbjct: 18196273 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggtgcctccagcgc 18196214

                                       
Query: 306      cagctgacgagggcggggccgaa 328
                |||| |||||| || ||||||||
Sbjct: 18196213 cagccgacgagcgccgggccgaa 18196191



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                            
Query: 378      atgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 421
                ||||||||||||| || |||||||| |||||  |||||||||||
Sbjct: 18196141 atgttggcgccgaggaggaagccgacggcgagcggcgcgatggt 18196098



to top

>dbj|AB012271.1| Aster tripolium mRNA for SAMIPE, partial cds
          Length = 321

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 377 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccca 426
           |||||||||||||||||| |||||||||||||| || || || |||||||
Sbjct: 321 gatgttggcgccgacgataaagccgatggcgatcggtgcaattgtgccca 272



to top

>ref|NM_188505.1| Oryza sativa (japonica cultivar-group), Ozsa8174 predicted mRNA
          Length = 969

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 246 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 294
           |||||||||||| ||||||||| ||| |||| |||||||||||| ||||
Sbjct: 881 ccggcgaggccggcgccgatgaagggaccgagccagtacacccagtggt 833



to top

>gb|AF521135.1| Kandelia candel tonoplast intrinsic protein (TIP) mRNA, complete
           cds
          Length = 1099

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                
Query: 180 gcttagtagtcggtggtggggagctgctcgtgggtgc 216
           ||||||||||| | |||||||||||||||||||||||
Sbjct: 859 gcttagtagtcagcggtggggagctgctcgtgggtgc 823



to top

>dbj|AP002094.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0483F08
          Length = 148985

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                               
Query: 246    ccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 294
              |||||||||||| ||||||||| ||| |||| |||||||||||| ||||
Sbjct: 125093 ccggcgaggccggcgccgatgaagggaccgagccagtacacccagtggt 125141



to top

>ref|NM_188626.1| Oryza sativa (japonica cultivar-group), Ozsa8229 predicted mRNA
          Length = 756

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 339 gggttcatggacgcgccggagaaggcgccgccgacnaggatgttggcgccgacga 393
           ||||||||||||||||||| ||  ||||||||| | | | |||||||||||||||
Sbjct: 590 gggttcatggacgcgccggtgagcgcgccgccggcgacggtgttggcgccgacga 536



to top

>dbj|AK099190.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023108H12, full
           insert sequence
          Length = 1055

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 339 gggttcatggacgcgccggagaaggcgccgccgacnaggatgttggcgccgacga 393
           ||||||||||||||||||| ||  ||||||||| | | | |||||||||||||||
Sbjct: 636 gggttcatggacgcgccggtgagcgcgccgccggcgacggtgttggcgccgacga 582



to top

>dbj|AK069592.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023019I12, full
           insert sequence
          Length = 1059

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 339 gggttcatggacgcgccggagaaggcgccgccgacnaggatgttggcgccgacga 393
           ||||||||||||||||||| ||  ||||||||| | | | |||||||||||||||
Sbjct: 639 gggttcatggacgcgccggtgagcgcgccgccggcgacggtgttggcgccgacga 585



to top

>ref|NM_124117.2| Arabidopsis thaliana AtTIP2;3; water channel AT5G47450 (AtTIP2;3)
           mRNA, complete cds
          Length = 1051

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 375 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 421
           ||||||||||| || || ||||||||||||||||| || ||||||||
Sbjct: 595 aggatgttggcaccaactatgaagccgatggcgattggagcgatggt 549



to top

>gb|BT016509.1| Zea mays clone Contig342 mRNA sequence
          Length = 1237

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 54/63 (85%)
 Strand = Plus / Minus

                                                                       
Query: 232 gctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacacccact 291
           ||||||||| |||||||| ||||||| ||||||  | ||| || |||||||||||||| |
Sbjct: 880 gctcgtagacgacgccggagaggccggcgccgaccatgggccccacccagtacacccatt 821

              
Query: 292 ggt 294
           |||
Sbjct: 820 ggt 818



to top

>gb|DQ226889.1| Boechera divaricarpa isolate SLW-D-E07 mRNA sequence
          Length = 980

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 184 agtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagatga 243
           ||||||||||||| |||||||| |||||||||  |   |||||||  | |||||||||||
Sbjct: 767 agtagtcggtggttgggagctgttcgtgggtggtgttaatgaagaaaacctcgtagatga 708

                                                              
Query: 244 cgccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 294
             |||||||  || ||||||| ||| || ||| ||||||| ||||| ||||
Sbjct: 707 gtccggcgattccaccgccgacgagaggtccggcccagtagacccagtggt 657



to top

>gb|BT011663.1| Arabidopsis thaliana At5g47450 mRNA, complete cds
          Length = 753

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 375 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 421
           ||||||||||| || || ||||||||||||||||| || ||||||||
Sbjct: 557 aggatgttggcaccaactatgaagccgatggcgattggagcgatggt 511



to top

>gb|BT011212.1| Arabidopsis thaliana At5g47450 gene, complete cds
          Length = 853

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 375 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 421
           ||||||||||| || || ||||||||||||||||| || ||||||||
Sbjct: 585 aggatgttggcaccaactatgaagccgatggcgattggagcgatggt 539



to top

>emb|X72581.1|ATGTIPMR A.thaliana mRNA for tonoplast intrinsic protein gamma (gamma-TIP)
          Length = 933

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 184 agtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagatga 243
           ||||||||||||| |||||||||||||| |||  |  ||||||||  |  ||||||||||
Sbjct: 787 agtagtcggtggttgggagctgctcgtgtgtggtgttgatgaagaaaacttcgtagatga 728

                                                              
Query: 244 cgccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 294
             || ||||  || ||||||| ||| || ||| ||||||||||||| ||||
Sbjct: 727 gtccagcgattccaccgccgacgagaggtccggcccagtacacccagtggt 677



to top

>emb|AJ289866.2|VVI289866 Vitis vinifera mRNA for putative aquaporin (delta-TIP gene)
          Length = 1017

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 308 gctgacgagggcggggccgaaggagacggcggggttcat 346
           |||||||| ||||||||||||||||  ||||||||||||
Sbjct: 624 gctgacgacggcggggccgaaggagcgggcggggttcat 586



to top

>gb|AF271661.1|AF271661 Vitis berlandieri x Vitis rupestris putative aquaporin TIP1 (TIP1)
           mRNA, complete cds
          Length = 1057

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 308 gctgacgagggcggggccgaaggagacggcggggttcat 346
           |||||||| ||||||||||||||||  ||||||||||||
Sbjct: 666 gctgacgacggcggggccgaaggagcgggcggggttcat 628



to top

>dbj|AB025628.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNJ7
          Length = 80117

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                           
Query: 375  aggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 421
            ||||||||||| || || ||||||||||||||||| || ||||||||
Sbjct: 8649 aggatgttggcaccaactatgaagccgatggcgattggagcgatggt 8695



to top

>ref|XM_473251.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 798

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 124/157 (78%)
 Strand = Plus / Minus

                                                                       
Query: 259 cgccgatgagggggccgacccagtacacccactggtacccccactcccagctgacgaggg 318
           |||||||||| || |||| |||||| ||||| ||||  | ||| | ||||| |||||| |
Sbjct: 697 cgccgatgagcggcccgagccagtaaacccagtggtggcgccagttccagccgacgagcg 638

                                                                       
Query: 319 cggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacnagga 378
           | |||||||| | |   || |||||||||| |||||||  ||| | ||| ||| | ||||
Sbjct: 637 ccgggccgaacgcgcgcgccgggttcatggccgcgccgtcgaacgggcccccggcgagga 578

                                                
Query: 379 tgttggcgccgacgatgaagccgatggcgatgggcgc 415
           |||| |||||  |||  ||||||||||||| ||||||
Sbjct: 577 tgttcgcgcccgcgaccaagccgatggcgaggggcgc 541



to top

>emb|AL663019.2|OSJN00221 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0038O10,
              complete sequence
          Length = 141545

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 124/157 (78%)
 Strand = Plus / Minus

                                                                          
Query: 259    cgccgatgagggggccgacccagtacacccactggtacccccactcccagctgacgaggg 318
              |||||||||| || |||| |||||| ||||| ||||  | ||| | ||||| |||||| |
Sbjct: 131407 cgccgatgagcggcccgagccagtaaacccagtggtggcgccagttccagccgacgagcg 131348

                                                                          
Query: 319    cggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacnagga 378
              | |||||||| | |   || |||||||||| |||||||  ||| | ||| ||| | ||||
Sbjct: 131347 ccgggccgaacgcgcgcgccgggttcatggccgcgccgtcgaacgggcccccggcgagga 131288

                                                   
Query: 379    tgttggcgccgacgatgaagccgatggcgatgggcgc 415
              |||| |||||  |||  ||||||||||||| ||||||
Sbjct: 131287 tgttcgcgcccgcgaccaagccgatggcgaggggcgc 131251



to top

>emb|AJ314583.1|POC314583 Posidonia oceanica mRNA for putative tonoplast intrinsic protein
           (tip1 gene)
          Length = 1112

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 187/241 (77%)
 Strand = Plus / Minus

                                                                       
Query: 184 agtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagatga 243
           ||||||| ||||| |||||||| || |||||| ||  |||||| | ||||| ||||| ||
Sbjct: 830 agtagtcagtggttgggagctgttcatgggtgtggttgatgaataacagctggtagacga 771

                                                                       
Query: 244 cgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccact 303
            |||||||| | |  | ||||  || |||||||||||||| | ||| ||||   |||| |
Sbjct: 770 tgccggcgatggctgcaccgactagtgggccgacccagtagatccagtggttaacccagt 711

                                                                       
Query: 304 cccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaagg 363
            |||||| || | ||| || || ||||  ||||| ||||||||||| || |||| |||| 
Sbjct: 710 tccagctcaccaaggcaggtccaaaggccacggcagggttcatggatgcaccggtgaaga 651

                                                                       
Query: 364 cgccgccgacnaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgc 423
           | || ||||| | |||||||||  | || || | ||||||||||| ||| ||||| ||||
Sbjct: 650 ctcctccgacgaagatgttggcagcaacaataaggccgatggcgaggggagcgatagtgc 591

            
Query: 424 c 424
           |
Sbjct: 590 c 590



to top

>dbj|AK108116.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-139-C05, full
           insert sequence
          Length = 912

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 124/157 (78%)
 Strand = Plus / Minus

                                                                       
Query: 259 cgccgatgagggggccgacccagtacacccactggtacccccactcccagctgacgaggg 318
           |||||||||| || |||| |||||| ||||| ||||  | ||| | ||||| |||||| |
Sbjct: 763 cgccgatgagcggcccgagccagtaaacccagtggtggcgccagttccagccgacgagcg 704

                                                                       
Query: 319 cggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacnagga 378
           | |||||||| | |   || |||||||||| |||||||  ||| | ||| ||| | ||||
Sbjct: 703 ccgggccgaacgcgcgcgccgggttcatggccgcgccgtcgaacgggcccccggcgagga 644

                                                
Query: 379 tgttggcgccgacgatgaagccgatggcgatgggcgc 415
           |||| |||||  |||  ||||||||||||| ||||||
Sbjct: 643 tgttcgcgcccgcgaccaagccgatggcgaggggcgc 607



to top

>dbj|AB012272.1| Aster tripolium mRNA for SAMIPF, partial cds
          Length = 321

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 377 gatgttggcgccgacgatgaagccgatggc 406
           |||||||||||||||||| |||||||||||
Sbjct: 321 gatgttggcgccgacgataaagccgatggc 292



to top

>dbj|AB012268.1| Aster tripolium mRNA for SAMIPB, partial cds
          Length = 321

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 377 gatgttggcgccgacgatgaagccgatggc 406
           |||||||||||||||||| |||||||||||
Sbjct: 321 gatgttggcgccgacgataaagccgatggc 292



to top

>gb|AF367456.1| Prunus persica clone gTip1 gamma-tonoplast intrinsic protein mRNA,
           partial cds
          Length = 408

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 305 ccagctgacgagggcggggccgaaggagacggcggggttcatgga 349
           |||||||||||  ||||| ||||||||||| || |||||||||||
Sbjct: 393 ccagctgacgacagcgggtccgaaggagactgccgggttcatgga 349



to top

>dbj|AB048248.1| Pyrus communis Py-gTIP mRNA for gamma tonoplast intrinsic protein,
           complete cds
          Length = 1122

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 378 atgttggcgccgacgatgaagccgatggcgatgggcgcgat 418
           ||||||||||| |||||||| || || ||||||||||||||
Sbjct: 631 atgttggcgccaacgatgaaaccaatcgcgatgggcgcgat 591



to top

>dbj|AB012269.1| Aster tripolium mRNA for SAMIPC, partial cds
          Length = 321

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 384 gcgccgacgatgaagccgatggcga 408
           |||||||||||||||||||||||||
Sbjct: 314 gcgccgacgatgaagccgatggcga 290



to top

>dbj|AB012267.1| Aster tripolium mRNA for SAMIPA, partial cds
          Length = 321

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 381 ttggcgccgacgatgaagccgatggcgat 409
           |||||||||||||| ||||||||||||||
Sbjct: 317 ttggcgccgacgataaagccgatggcgat 289



to top

>gb|U92651.2|BOU92651 Brassica oleracea var. botrytis tonoplast intrinsic protein
           bobTIP26-1 mRNA, complete cds
          Length = 942

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 184 agtagtcggtggtggggagctgctcgtgggtg 215
           ||||||||| |||||||||||| |||||||||
Sbjct: 790 agtagtcggcggtggggagctgttcgtgggtg 759



to top

>gb|AF326509.1|AF326509 Zea mays tonoplast membrane integral protein ZmTIP5-1 mRNA,
           complete cds
          Length = 1021

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 308 gctgacgagggcggggccgaaggagacggcggggttcatggacgcgcc 355
           |||||||| ||| |||||||| |||  ||| |||||||||||||||||
Sbjct: 709 gctgacgacggccgggccgaacgagcgggccgggttcatggacgcgcc 662



to top

>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome
          Length = 4751080

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                   
Query: 382     tggcgccgacgatgaagccgatggcgatgggcgcga 417
               |||||||||||||||||||| || ||||||| ||||
Sbjct: 3239016 tggcgccgacgatgaagccggtgacgatgggggcga 3238981



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 384     gcgccgacgatgaagccgatg 404
               |||||||||||||||||||||
Sbjct: 3655270 gcgccgacgatgaagccgatg 3655250



to top

>emb|X53040.1|RNNIP26 R.norvegicus MIP-26 mRNA
          Length = 336

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 252 aggccgccgccgatgagggggccgacccagtacacccactggt 294
           ||||| ||||||||||  ||||| |||||||||||||| ||||
Sbjct: 301 aggcccccgccgatgattgggcccacccagtacacccagtggt 259



to top

>gb|AF521142.1| Kandelia candel tonoplast intrinsic protein mRNA, partial cds
          Length = 175

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 380 gttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccca 426
           |||||| || || ||||| ||||||||||| |||||||| |||||||
Sbjct: 62  gttggcacccacaatgaaaccgatggcgattggcgcgattgtgccca 16



to top

>emb|X53052.1|RRMIP Rat partial mRNA for main intrinsic protein
          Length = 936

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 252 aggccgccgccgatgagggggccgacccagtacacccactggt 294
           ||||| ||||||||||  ||||| |||||||||||||| ||||
Sbjct: 635 aggcccccgccgatgattgggcccacccagtacacccagtggt 593



to top

>emb|X12514.1|RNMIP26R Rat mRNA fragment for main intrinsic protein 26 (MIP26)
          Length = 543

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 252 aggccgccgccgatgagggggccgacccagtacacccactggt 294
           ||||| ||||||||||  ||||| |||||||||||||| ||||
Sbjct: 242 aggcccccgccgatgattgggcccacccagtacacccagtggt 200



to top

>gb|AY130971.1| Brassica oleracea var. botrytis tonoplast intrinsic protein
            bobTIP26-2 gene, complete cds
          Length = 1442

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 89/111 (80%)
 Strand = Plus / Minus

                                                                        
Query: 184  agtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagatga 243
            |||||||||||||||||||||| || || |||  |  ||||||||  | |||||||||||
Sbjct: 1247 agtagtcggtggtggggagctgttcatgtgtggtgttgatgaagaaaacctcgtagatga 1188

                                                               
Query: 244  cgccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 294
              |||||||  || |||||||| || || ||  ||||||| ||||| ||||
Sbjct: 1187 gtccggcgactccaccgccgataagaggtccagcccagtagacccagtggt 1137



to top

>emb|AJ251652.1|MTR251652 Medicago truncatula mRNA for aquaporin (aqp1 gene)
          Length = 1120

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 183 tagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagag 229
           |||||||| || || ||||||||||||||||||| |  |||||||||
Sbjct: 837 tagtagtcagtagttgggagctgctcgtgggtgctgttgatgaagag 791



to top

>gb|U92652.2|BOU92652 Brassica oleracea var. botrytis tonoplast intrinsic protein
           bobTIP26-2 mRNA, partial cds
          Length = 599

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 89/111 (80%)
 Strand = Plus / Minus

                                                                       
Query: 184 agtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagatga 243
           |||||||||||||||||||||| || || |||  |  ||||||||  | |||||||||||
Sbjct: 526 agtagtcggtggtggggagctgttcatgtgtggtgttgatgaagaaaacctcgtagatga 467

                                                              
Query: 244 cgccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 294
             |||||||  || |||||||| || || ||  ||||||| ||||| ||||
Sbjct: 466 gtccggcgactccaccgccgataagaggtccagcccagtagacccagtggt 416



to top

>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome
          Length = 5331656

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 245     gccggcgaggccgccgccgatga 267
               |||||||||||||||||||||||
Sbjct: 3111631 gccggcgaggccgccgccgatga 3111609



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 244    cgccggcgaggccgccgccgatga 267
              ||||||||||||| ||||||||||
Sbjct: 505314 cgccggcgaggccaccgccgatga 505291



to top

>emb|BX824373.1|CNS0A6WG Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH44ZA10 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 887

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 70/86 (81%)
 Strand = Plus / Minus

                                                                       
Query: 333 acggcggggttcatggacgcgccggagaaggcgccgccgacnaggatgttggcgccgacg 392
           ||||| ||||||||||| ||||||  ||| || || ||| | |||||||| || || |||
Sbjct: 488 acggctgggttcatggaagcgccgctgaaagctccaccggcgaggatgttcgctccaacg 429

                                     
Query: 393 atgaagccgatggcgatgggcgcgat 418
           ||||| || |||||||| || |||||
Sbjct: 428 atgaaacctatggcgattggtgcgat 403



to top

>gb|AC020922.9| Homo sapiens chromosome 19 clone CTD-2105E13, complete sequence
          Length = 134793

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 152   cgggcgggcggggggcaggcggc 174
             |||||||||||||||||||||||
Sbjct: 78789 cgggcgggcggggggcaggcggc 78811



to top

>ref|XM_343137.2| PREDICTED: Rattus norvegicus major intrinsic protein of eye lens
           fiber (Mip), mRNA
          Length = 2075

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 252 aggccgccgccgatgagggggccgacccagtacacccactggt 294
           ||||| ||||||||||  ||||| |||||||||||||| ||||
Sbjct: 685 aggcccccgccgatgattgggcccacccagtacacccagtggt 643



to top

>gb|AY207429.1| Homo sapiens interleukin 11 (IL11) gene, complete cds
          Length = 9803

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 152  cgggcgggcggggggcaggcggc 174
            |||||||||||||||||||||||
Sbjct: 1449 cgggcgggcggggggcaggcggc 1427



to top

>emb|AJ605573.1| Ricinus communis mRNA for aquaporin (Tip1-1 gene), clone pT4L
          Length = 1057

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 182 ttagtagtcggtggtggggagctgctcgtgggtgc 216
           ||||||||| ||||| ||||||||||| |||||||
Sbjct: 804 ttagtagtcagtggtagggagctgctcatgggtgc 770



to top

>gb|AY112625.1| Zea mays CL46210_1 mRNA sequence
          Length = 479

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 232 gctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacacccact 291
           ||||| ||| |||||||| ||||||| ||||||  | ||| || |||||||||||||| |
Sbjct: 279 gctcgaagacgacgccggagaggccggcgccgaccatgggccccacccagtacacccatt 338

              
Query: 292 ggt 294
           |||
Sbjct: 339 ggt 341



to top

>gb|AF000143.1|HSAF000143 Human putative alternative lens membrane intrinsic protein (PALM)
           mRNA, partial cds
          Length = 789

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 252 aggccgccgccgatgagggggccgacccagtacacccactggt 294
           ||||| ||||||||||  ||||| |||||||||||||| ||||
Sbjct: 641 aggcccccgccgatgattgggcccacccagtacacccagtggt 599



to top

>gb|M81890.1|HUMIL11A Human interleukin 11 (IL11) gene, complete mRNA
          Length = 6870

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 152 cgggcgggcggggggcaggcggc 174
           |||||||||||||||||||||||
Sbjct: 688 cgggcgggcggggggcaggcggc 666



to top

>dbj|AB010416.1| Raphanus sativus VIP3 mRNA for delta-VM23, complete cds
          Length = 911

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 375 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 421
           ||||||||||| ||||||||||  || ||||||| ||| ||||||||
Sbjct: 598 aggatgttggcaccgacgatgagaccaatggcgaggggagcgatggt 552



to top

>emb|AL591787.1|SME591787 Sinorhizobium meliloti 1021 complete chromosome; segment 6/12
          Length = 329100

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 246    ccggcgaggccgccgccgatga 267
              ||||||||||||||||||||||
Sbjct: 213784 ccggcgaggccgccgccgatga 213805



to top

>ref|XM_851400.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript
           variant 11 (LOC479191), mRNA
          Length = 4681

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 143 acggacggacgggcgggcggggggcaggcggcgg 176
           |||||||||||||| ||||||| || ||||||||
Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91



to top

>ref|XM_536333.2| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript
           variant 1 (LOC479191), mRNA
          Length = 4681

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 143 acggacggacgggcgggcggggggcaggcggcgg 176
           |||||||||||||| ||||||| || ||||||||
Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91



to top

>ref|XM_851314.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript
           variant 10 (LOC479191), mRNA
          Length = 4663

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 143 acggacggacgggcgggcggggggcaggcggcgg 176
           |||||||||||||| ||||||| || ||||||||
Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91



to top

>ref|XM_851274.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript
           variant 9 (LOC479191), mRNA
          Length = 4438

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 143 acggacggacgggcgggcggggggcaggcggcgg 176
           |||||||||||||| ||||||| || ||||||||
Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91



to top

>ref|XM_851189.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript
           variant 7 (LOC479191), mRNA
          Length = 4777

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 143 acggacggacgggcgggcggggggcaggcggcgg 176
           |||||||||||||| ||||||| || ||||||||
Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91



to top

>ref|XM_851152.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript
           variant 6 (LOC479191), mRNA
          Length = 4696

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 143 acggacggacgggcgggcggggggcaggcggcgg 176
           |||||||||||||| ||||||| || ||||||||
Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91



to top

>ref|XM_851023.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript
           variant 3 (LOC479191), mRNA
          Length = 4681

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 143 acggacggacgggcgggcggggggcaggcggcgg 176
           |||||||||||||| ||||||| || ||||||||
Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
               sequence
          Length = 27566993

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 317     ggcggggccgaaggagacggcg 338
               ||||||||||||||||||||||
Sbjct: 8473737 ggcggggccgaaggagacggcg 8473716



 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 317     ggcggggccgaaggagacggcg 338
               ||||||||||||||||||||||
Sbjct: 8461221 ggcggggccgaaggagacggcg 8461200



to top

>emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid complete sequence
          Length = 2094509

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                         
Query: 389     gacgatgaagccgatggcgatgggcg 414
               ||||||| ||||||||||||||||||
Sbjct: 1047164 gacgatgtagccgatggcgatgggcg 1047139



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 317     ggcggggccgaaggagacggcg 338
               ||||||||||||||||||||||
Sbjct: 8473620 ggcggggccgaaggagacggcg 8473599



 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 317     ggcggggccgaaggagacggcg 338
               ||||||||||||||||||||||
Sbjct: 8461104 ggcggggccgaaggagacggcg 8461083



to top

>emb|AL928775.2|CNS08CC5 Oryza sativa chromosome 12, . BAC OSJNBa0030N06 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 146444

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 317   ggcggggccgaaggagacggcg 338
             ||||||||||||||||||||||
Sbjct: 80400 ggcggggccgaaggagacggcg 80379



 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 317   ggcggggccgaaggagacggcg 338
             ||||||||||||||||||||||
Sbjct: 67884 ggcggggccgaaggagacggcg 67863



to top

>gb|AE017351.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 11, complete
              sequence
          Length = 1019846

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 289    actggtacccccactcccagc 309
              |||||||||||||||||||||
Sbjct: 290624 actggtacccccactcccagc 290604



to top

>gb|AC154709.2| Mus musculus BAC clone RP24-357I4 from chromosome 12, complete sequence
          Length = 136354

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 143   acggacggacgggcgggcggg 163
             |||||||||||||||||||||
Sbjct: 94084 acggacggacgggcgggcggg 94104



to top

>gb|AE017180.1| Geobacter sulfurreducens PCA, complete genome
          Length = 3814139

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 377     gatgttggcgccgacgatgaagccg 401
               ||||||| |||||||||||||||||
Sbjct: 2949085 gatgttgtcgccgacgatgaagccg 2949061



to top

>ref|XM_593064.2| PREDICTED: Bos taurus similar to tumor protein p73 (LOC515105),
           mRNA
          Length = 2606

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 254 gccgccgccgatgagggggcc 274
           |||||||||||||||||||||
Sbjct: 22  gccgccgccgatgagggggcc 42



to top

>gb|AY581827.1| Cynodon dactylon NOD26-like membrane integral protein-like mRNA,
           partial sequence
          Length = 555

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 332 gacggcggggttcatggacgcgccggaga 360
           ||||||||||||||||  |||||||||||
Sbjct: 425 gacggcggggttcatgtgcgcgccggaga 397



to top

>gb|AF183913.1| Azospirillum brasilense major outer membrane protein OmaA precursor
           (omaA) gene, complete cds
          Length = 1435

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 246 ccggcgaggccgccgccgatg 266
           |||||||||||||||||||||
Sbjct: 698 ccggcgaggccgccgccgatg 678



to top

>ref|XM_856403.1| PREDICTED: Canis familiaris similar to aquaporin 6, transcript
           variant 2 (LOC607978), mRNA
          Length = 1082

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 317 ggcggggccgaaggagacggcggggttcatgga 349
           ||||||||||||||||  ||| |||||||||||
Sbjct: 588 ggcggggccgaaggagcgggccgggttcatgga 556



to top

>ref|XM_845359.1| PREDICTED: Canis familiaris similar to aquaporin 6, transcript
           variant 1 (LOC607978), mRNA
          Length = 1067

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 317 ggcggggccgaaggagacggcggggttcatgga 349
           ||||||||||||||||  ||| |||||||||||
Sbjct: 573 ggcggggccgaaggagcgggccgggttcatgga 541



to top

>emb|CT025679.5| Mouse DNA sequence from clone RP24-296K22 on chromosome 14, complete
              sequence
          Length = 160805

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 143    acggacggacgggcgggcggg 163
              |||||||||||||||||||||
Sbjct: 155955 acggacggacgggcgggcggg 155935



to top

>ref|XM_567655.1| Cryptococcus neoformans var. neoformans JEC21 hypothetical protein
            (CNK00920) partial mRNA
          Length = 2340

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 289  actggtacccccactcccagc 309
            |||||||||||||||||||||
Sbjct: 2133 actggtacccccactcccagc 2113



to top

>gb|AC123532.4| Mus musculus chromosome 14 clone RP23-84B6, complete sequence
          Length = 166421

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 143  acggacggacgggcgggcggg 163
            |||||||||||||||||||||
Sbjct: 7846 acggacggacgggcgggcggg 7826



to top

>gb|AC098877.3| Mus musculus BAC clone RP23-2C24 from 14, complete sequence
          Length = 240151

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 143   acggacggacgggcgggcggg 163
             |||||||||||||||||||||
Sbjct: 37973 acggacggacgggcgggcggg 37953



to top

>gb|AC104099.5| Mus musculus BAC clone RP24-372J8 from 3, complete sequence
          Length = 148259

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 143   acggacggacgggcgggcggg 163
             |||||||||||||||||||||
Sbjct: 37509 acggacggacgggcgggcggg 37489



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 140   cacacggacggacgggcgggcggg 163
             ||||||||||||||| ||||||||
Sbjct: 37516 cacacggacggacggacgggcggg 37493



to top

>gb|BC012214.1| Mus musculus Rab geranylgeranyl transferase, a subunit, mRNA (cDNA
           clone MGC:19255 IMAGE:3967218), complete cds
          Length = 2176

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 143 acggacggacgggcgggcggg 163
           |||||||||||||||||||||
Sbjct: 23  acggacggacgggcgggcggg 43



to top

>gb|AY258323.1| Rubella virus strain BRD-II, complete genome
          Length = 9778

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 152  cgggcgggcggggggcaggcggcgg 176
            ||||||||| |||||||||||||||
Sbjct: 2327 cgggcgggctgggggcaggcggcgg 2303



to top

>ref|NM_019519.1| Mus musculus Rab geranylgeranyl transferase, a subunit (Rabggta),
           mRNA
          Length = 2547

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 143 acggacggacgggcgggcggg 163
           |||||||||||||||||||||
Sbjct: 18  acggacggacgggcgggcggg 38



to top

>ref|XM_961391.1| PREDICTED: Tribolium castaneum similar to CG31000-PC, isoform C
            (LOC654951), mRNA
          Length = 3244

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 244  cgccggcgaggccgccgccga 264
            |||||||||||||||||||||
Sbjct: 1642 cgccggcgaggccgccgccga 1622



to top

>gb|CP000089.1| Dechloromonas aromatica RCB, complete genome
          Length = 4501104

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 248     ggcgaggccgccgccgatgag 268
               |||||||||||||||||||||
Sbjct: 1201038 ggcgaggccgccgccgatgag 1201058



to top

>emb|BX640442.1| Bordetella bronchiseptica strain RB50, complete genome; segment 6/16
          Length = 349876

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 377    gatgttggcgccgacgatgaagccg 401
              ||||| |||||||||||||||||||
Sbjct: 151437 gatgtcggcgccgacgatgaagccg 151461



to top

>emb|BX640430.1| Bordetella parapertussis strain 12822, complete genome; segment 8/14
          Length = 348014

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 377   gatgttggcgccgacgatgaagccg 401
             ||||| |||||||||||||||||||
Sbjct: 62418 gatgtcggcgccgacgatgaagccg 62442



to top

>emb|AL390091.1|NCB12F1 Neurospora crassa DNA linkage group II BAC clone B12F1
          Length = 68478

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 143   acggacggacgggcgggcggg 163
             |||||||||||||||||||||
Sbjct: 42894 acggacggacgggcgggcggg 42914



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 140   cacacggacggacgggcgggcggg 163
             ||||||||||||||| ||||||||
Sbjct: 42887 cacacggacggacggacgggcggg 42910



to top

>emb|AJ489613.1|CAR489613 Cicer arietinum partial mRNA for tonoplast intrinsic protein (tip
           gene)
          Length = 716

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 183 tagtagtcggtggtggggagctgctcgtgggtg 215
           |||||||| ||||| ||||| ||||||||||||
Sbjct: 428 tagtagtcagtggtagggagttgctcgtgggtg 396



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 321 gggccgaaggagacggcggggttcatggacgcgccggagaaggc 364
           |||||||| || ||||| ||||||||||| || |||| ||||||
Sbjct: 290 gggccgaatgacacggctgggttcatggatgctccggtgaaggc 247



to top

>emb|AJ243309.1|PSA243309 Pisum sativum mRNA for putative tonoplast intrinsic protein (gene
           tip1-1)
          Length = 1104

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 324 ccgaaggagacggcggggttcatggacgcgccggagaaggc 364
           ||||| || ||||||||||||||||| || |||| ||||||
Sbjct: 686 ccgaatgacacggcggggttcatggatgctccggtgaaggc 646



to top

>emb|BX470185.18| Zebrafish DNA sequence from clone CH211-222D3 in linkage group 3,
             complete sequence
          Length = 198900

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 143   acggacggacgggcgggcggg 163
             |||||||||||||||||||||
Sbjct: 27616 acggacggacgggcgggcggg 27596



to top

>dbj|AK146917.1| Mus musculus 17 days embryo kidney cDNA, RIKEN full-length enriched
           library, clone:I920074L06 product:Rab geranylgeranyl
           transferase, a subunit, full insert sequence
          Length = 2422

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 143 acggacggacgggcgggcggg 163
           |||||||||||||||||||||
Sbjct: 41  acggacggacgggcgggcggg 61



to top

>gb|U62778.1|GHU62778 Gossypium hirsutum delta-tonoplast intrinsic protein mRNA, complete
           cds
          Length = 997

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 377 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 421
           ||||||||| || || |||||||||||||| ||||| || |||||
Sbjct: 592 gatgttggcaccaacaatgaagccgatggcaatgggtgcaatggt 548



to top

>gb|AF342810.1|AF342810 Zea mays NOD26-like membrane integral protein ZmNIP2-3 mRNA,
           complete cds
          Length = 1300

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 332 gacggcggggttcatggacgcgccggaga 360
           ||||||||||||||||  |||||||||||
Sbjct: 442 gacggcggggttcatgtgcgcgccggaga 414



to top

>gb|AF326485.1|AF326485 Zea mays NOD26-like membrane integral protein ZmNIP2-2 mRNA,
           complete cds
          Length = 1387

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 332 gacggcggggttcatggacgcgccggaga 360
           ||||||||||||||||  |||||||||||
Sbjct: 452 gacggcggggttcatgtgcgcgccggaga 424



to top

>gb|AC135495.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1664B11,
             complete sequence
          Length = 126040

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 143   acggacggacgggcgggcggg 163
             |||||||||||||||||||||
Sbjct: 56775 acggacggacgggcgggcggg 56755



to top

>ref|NM_214226.1| Sus scrofa inositol(1,3,4,5)tetrakisphosphate receptor (CENTA1),
           mRNA
          Length = 1544

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 144 cggacggacgggcgggcggggggca 168
           |||||||||||||||||||| ||||
Sbjct: 56  cggacggacgggcgggcgggcggca 80



to top

>gb|AE004658.1| Pseudomonas aeruginosa PAO1, section 219 of 529 of the complete
            genome
          Length = 11864

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 244  cgccggcgaggccgccgccga 264
            |||||||||||||||||||||
Sbjct: 2650 cgccggcgaggccgccgccga 2630



to top

>gb|AF275315.1|AF275315 Lotus japonicus water-selective transport intrinsic membrane
           protein 1 mRNA, complete cds
          Length = 1162

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 305 ccagctgacgagggcggggccgaaggagacggcggggttcatgga 349
           |||||| |||| ||| || ||||| || |||||||||||||||||
Sbjct: 689 ccagctcacgacggctggtccgaatgacacggcggggttcatgga 645



to top

>gb|AF127662.1|AF127662 Mus musculus strain C57BL/6J-gm/gm RAB geranylgeranyl transferase
           alpha subunit (Rabggta) mRNA, complete cds,
           alternatively spliced
          Length = 2466

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 143 acggacggacgggcgggcggg 163
           |||||||||||||||||||||
Sbjct: 18  acggacggacgggcgggcggg 38



to top

>gb|AF127661.1|AF127661 Mus musculus strain C57BL/6J-gm/gm RAB geranylgeranyl transferase
           alpha subunit (Rabggta) pseudogene, complete sequence
          Length = 2435

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 143 acggacggacgggcgggcggg 163
           |||||||||||||||||||||
Sbjct: 18  acggacggacgggcgggcggg 38



to top

>gb|AF127660.1|AF127660 Mus musculus strain C57BL/6J RAB geranylgeranyl transferase alpha
           subunit (Rabggta) mRNA, complete cds, alternatively
           spliced
          Length = 2492

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 143 acggacggacgggcgggcggg 163
           |||||||||||||||||||||
Sbjct: 18  acggacggacgggcgggcggg 38



to top

>gb|AF127659.1|AF127659 Mus musculus strain C57BL/6J-gm/gm RAB geranylgeranyl transferase
           alpha subunit (Rabggta) mRNA, complete cds,
           alternatively spliced
          Length = 2547

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 143 acggacggacgggcgggcggg 163
           |||||||||||||||||||||
Sbjct: 18  acggacggacgggcgggcggg 38



to top

>gb|AF127658.1|AF127658 Mus musculus strain C57BL/6J RAB geranylgeranyl transferase alpha
           subunit (Rabggta) mRNA, complete cds, alternatively
           spliced
          Length = 2547

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 143 acggacggacgggcgggcggg 163
           |||||||||||||||||||||
Sbjct: 18  acggacggacgggcgggcggg 38



to top

>gb|AF127657.1|AF127657 Mus musculus strain C57BL/6J-gm/gm RAB geranylgeranyl transferase
           alpha subunit (Rabggta) pseudogene, complete sequence
          Length = 2338

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 143 acggacggacgggcgggcggg 163
           |||||||||||||||||||||
Sbjct: 18  acggacggacgggcgggcggg 38



to top

>gb|AF127656.1|AF127656 Mus musculus strain C57BL/6J RAB geranylgeranyl transferase alpha
           subunit (Rabggta) mRNA, complete cds, alternatively
           spliced
          Length = 2395

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 143 acggacggacgggcgggcggg 163
           |||||||||||||||||||||
Sbjct: 18  acggacggacgggcgggcggg 38



to top

>gb|AF127655.1|AF127655 Mus musculus strain C57BL/6J-gm/gm RAB geranylgeranyl transferase
           alpha subunit (Rabggta) gene, complete cds,
           alternatively spliced
          Length = 2685

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 143 acggacggacgggcgggcggg 163
           |||||||||||||||||||||
Sbjct: 18  acggacggacgggcgggcggg 38



to top

>gb|AF127654.1|AF127654 Mus musculus strain C57BL/6J RAB geranylgeranyl transferase alpha
           subunit (Rabggta) gene, complete cds, alternatively
           spliced
          Length = 2685

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 143 acggacggacgggcgggcggg 163
           |||||||||||||||||||||
Sbjct: 18  acggacggacgggcgggcggg 38



to top

>gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, complete sequence
          Length = 3131724

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 244     cgccggcgaggccgccgccga 264
               |||||||||||||||||||||
Sbjct: 2570348 cgccggcgaggccgccgccga 2570368



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 244     cgccggcgaggccgccgccgatga 267
               ||||||| ||||||||||||||||
Sbjct: 2369100 cgccggccaggccgccgccgatga 2369077



to top

>emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome complete sequence
          Length = 3716413

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 244     cgccggcgaggccgccgccga 264
               |||||||||||||||||||||
Sbjct: 1841115 cgccggcgaggccgccgccga 1841095



to top

>emb|AL845372.6| Zebrafish DNA sequence from clone DKEYP-113C1 in linkage group 20,
             complete sequence
          Length = 80017

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 143   acggacggacgggcgggcggg 163
             |||||||||||||||||||||
Sbjct: 44968 acggacggacgggcgggcggg 44988



to top

>gb|AY109651.1| Zea mays CL6730_1 mRNA sequence
          Length = 899

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 332 gacggcggggttcatggacgcgccggaga 360
           ||||||||||||||||  |||||||||||
Sbjct: 430 gacggcggggttcatgtgcgcgccggaga 402



to top

>gb|AF009567.1|AF009567 Gossypium hirsutum delta-TIP homolog (MIP) mRNA, partial cds
          Length = 316

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 377 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 421
           ||||||||| || || |||||||||||||| ||||| || |||||
Sbjct: 289 gatgttggcaccaacaatgaagccgatggcaatgggtgcaatggt 245



to top

>emb|CR381567.9| Zebrafish DNA sequence from clone DKEY-115O4 in linkage group 23,
             complete sequence
          Length = 142417

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 143   acggacggacgggcgggcggg 163
             |||||||||||||||||||||
Sbjct: 45131 acggacggacgggcgggcggg 45151



to top

>gb|AF026470.1|AF026470 Pseudomonas aeruginosa gluconate repressor (gnuR), gluconate kinase
           (gnuK), and gluconate permease (gnuT) genes, complete
           cds
          Length = 3554

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 244 cgccggcgaggccgccgccga 264
           |||||||||||||||||||||
Sbjct: 427 cgccggcgaggccgccgccga 407



to top

>gb|AC159324.2| Mus musculus BAC clone RP23-9D1 from chromosome 12, complete sequence
          Length = 207280

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 143   acggacggacgggcgggcggg 163
             |||||||||||||||||||||
Sbjct: 13760 acggacggacgggcgggcggg 13780



to top

>gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, complete sequence
          Length = 2914771

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 154     ggcgggcggggggcaggcggcggtg 178
               ||||||||||||||| |||||||||
Sbjct: 2074504 ggcgggcggggggcatgcggcggtg 2074480



to top

>emb|CR974568.14| Mouse DNA sequence from clone RP23-39N20 on chromosome 12, complete
              sequence
          Length = 251037

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 143    acggacggacgggcgggcggg 163
              |||||||||||||||||||||
Sbjct: 108741 acggacggacgggcgggcggg 108721



to top

>emb|CR388420.19| Zebrafish DNA sequence from clone DKEY-37H18 in linkage group 13,
             complete sequence
          Length = 121689

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 143   acggacggacgggcgggcggg 163
             |||||||||||||||||||||
Sbjct: 73151 acggacggacgggcgggcggg 73131



to top

>gb|U88368.1|SSU88368 Sus scrofa inositol(1,3,4,5)tetrakisphosphate receptor mRNA,
           complete cds
          Length = 1544

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 144 cggacggacgggcgggcggggggca 168
           |||||||||||||||||||| ||||
Sbjct: 56  cggacggacgggcgggcgggcggca 80



to top

>dbj|AP004479.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT03H13, TM0012b,
             complete sequence
          Length = 41820

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                          
Query: 305   ccagctgacgagggcggggccgaaggagacggcggggttcatgga 349
             |||||| |||| ||| || ||||| || |||||||||||||||||
Sbjct: 10107 ccagctcacgacggctggtccgaatgacacggcggggttcatgga 10151



to top

>gb|DQ202710.1| Olea europaea tonoplast intrinsic protein (tip) mRNA, complete cds
          Length = 1064

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 86/108 (79%)
 Strand = Plus / Minus

                                                                       
Query: 305 ccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggc 364
           |||||||||||  || ||||| || || ||||| ||||||||||| || ||   ||| ||
Sbjct: 728 ccagctgacgacagcagggccaaaagacacggctgggttcatggatgcaccatcgaatgc 669

                                                           
Query: 365 gccgccgacnaggatgttggcgccgacgatgaagccgatggcgatggg 412
           ||| ||| | | ||||||||| || || |||||||| ||||| |||||
Sbjct: 668 gccaccggctaagatgttggcaccaacaatgaagccaatggcaatggg 621



to top

>gb|L07320.1|HS5E1A Murine cytomegalovirus e1 protein gene, complete cds
          Length = 4536

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 143 acggacggacgggcgggcggg 163
           |||||||||||||||||||||
Sbjct: 745 acggacggacgggcgggcggg 765



to top

>ref|NM_129238.2| Arabidopsis thaliana GAMMA-TIP; water channel AT2G36830 (GAMMA-TIP)
           mRNA, complete cds
          Length = 1058

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 184 agtagtcggtggtggggagctgctcgtg 211
           ||||||| ||||| ||||||||||||||
Sbjct: 818 agtagtctgtggttgggagctgctcgtg 791



to top

>ref|NM_128141.3| Arabidopsis thaliana water channel AT2G25810 mRNA, complete cds
          Length = 894

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 43/51 (84%)
 Strand = Plus / Minus

                                                              
Query: 335 ggcggggttcatggacgcgccggagaaggcgccgccgacnaggatgttggc 385
           ||||||||||||||| ||||| || ||||| || ||  | |||||||||||
Sbjct: 642 ggcggggttcatggaggcgccagaaaaggcacctcctgcaaggatgttggc 592



to top

>gb|AC164878.2| Mus musculus BAC clone RP23-364G24 from chromosome 13, complete
             sequence
          Length = 181893

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 143   acggacggacgggcgggcgg 162
             ||||||||||||||||||||
Sbjct: 94623 acggacggacgggcgggcgg 94642



to top

>gb|AC162034.6| Mus musculus chromosome 7, clone RP23-285B12, complete sequence
          Length = 197907

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 152    cgggcgggcggggggcaggc 171
              ||||||||||||||||||||
Sbjct: 122681 cgggcgggcggggggcaggc 122700



to top

>gb|CP000096.1| Pelodictyon luteolum DSM 273, complete genome
          Length = 2364842

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 257     gccgccgatgagggggccga 276
               ||||||||||||||||||||
Sbjct: 1305526 gccgccgatgagggggccga 1305507



to top

>ref|XM_476227.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 756

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 339 gggttcatggacgcgccggagaag 362
           |||||||| |||||||||||||||
Sbjct: 596 gggttcattgacgcgccggagaag 573



to top

>gb|DQ215783.1| Taeniopygia guttata clone 0058P0012B09 proteasome alpha 1 subunit
           variant 1-like mRNA, complete sequence
          Length = 1190

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 152 cgggcgggcggggggcaggcggcg 175
           ||||||||||| ||||||||||||
Sbjct: 38  cgggcgggcggcgggcaggcggcg 15



to top

>gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence
          Length = 3587082

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 245    gccggcgaggccgccgccga 264
              ||||||||||||||||||||
Sbjct: 412353 gccggcgaggccgccgccga 412372



to top

>ref|XM_472326.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 618

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 242 gacgccggcgaggccgccgccgatgagg 269
           ||||||| ||||||||||||||| ||||
Sbjct: 133 gacgccgacgaggccgccgccgaggagg 160



to top

>gb|AF474373.1| Hordeum vulgare subsp. vulgare BAC 259I16, complete sequence
          Length = 124050

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 143   acggacggacgggcgggcgg 162
             ||||||||||||||||||||
Sbjct: 72221 acggacggacgggcgggcgg 72202



to top

>ref|NM_001025266.1| Homo sapiens hypothetical gene supported by AK091454 (LOC285382),
           mRNA
          Length = 5901

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 242 gacgccggcgaggccgccgc 261
           ||||||||||||||||||||
Sbjct: 217 gacgccggcgaggccgccgc 198



to top

>gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, complete genome
          Length = 3188609

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 247    cggcgaggccgccgccgatg 266
              ||||||||||||||||||||
Sbjct: 622954 cggcgaggccgccgccgatg 622973



to top

>gb|AC145321.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0094P07, complete sequence
          Length = 162311

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 244   cgccggcgaggccgccgccg 263
             ||||||||||||||||||||
Sbjct: 15954 cgccggcgaggccgccgccg 15935



to top

>gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, complete sequence
          Length = 3510148

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 245     gccggcgaggccgccgccga 264
               ||||||||||||||||||||
Sbjct: 1776040 gccggcgaggccgccgccga 1776021



to top

>ref|XM_414866.1| PREDICTED: Gallus gallus similar to Aquaporin 8 (LOC416566), mRNA
          Length = 1761

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 260  gccgatgagggggccgacccagtacacccactggta 295
            |||||| || || ||||||||||||||||| |||||
Sbjct: 1371 gccgatcagaggcccgacccagtacacccagtggta 1336



to top

>ref|XM_426181.1| PREDICTED: Gallus gallus similar to Brix domain containing protein 1
            (LOC428624), mRNA
          Length = 1530

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 244  cgccggcgaggccgccgccg 263
            ||||||||||||||||||||
Sbjct: 1364 cgccggcgaggccgccgccg 1345



to top

>gb|CP000285.1| Chromohalobacter salexigens DSM 3043, complete genome
          Length = 3696649

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 378     atgttggcgccgacgatgaagccgatgg 405
               |||| |||||||| ||||||||||||||
Sbjct: 3114875 atgtaggcgccgaagatgaagccgatgg 3114848



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 247   cggcgaggccgccgccgatg 266
             ||||||||||||||||||||
Sbjct: 49687 cggcgaggccgccgccgatg 49668



to top

>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence
          Length = 4126292

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 245     gccggcgaggccgccgccga 264
               ||||||||||||||||||||
Sbjct: 3021559 gccggcgaggccgccgccga 3021540



to top

>gb|DQ356948.1| Crocodilepox virus, complete genome
          Length = 190054

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 244    cgccggcgaggccgccgccg 263
              ||||||||||||||||||||
Sbjct: 101116 cgccggcgaggccgccgccg 101135



to top

>gb|BT012635.1| Arabidopsis thaliana At2g25810 mRNA, complete cds
          Length = 750

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 43/51 (84%)
 Strand = Plus / Minus

                                                              
Query: 335 ggcggggttcatggacgcgccggagaaggcgccgccgacnaggatgttggc 385
           ||||||||||||||| ||||| || ||||| || ||  | |||||||||||
Sbjct: 585 ggcggggttcatggaggcgccagaaaaggcacctcctgcaaggatgttggc 535



to top

>gb|AC145396.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBa0042F15, complete sequence
          Length = 162959

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 339   gggttcatggacgcgccggagaag 362
             |||||||| |||||||||||||||
Sbjct: 86935 gggttcattgacgcgccggagaag 86912



to top

>gb|AY502065.1| Streptomyces mobaraensis transglutaminase gene, complete cds
          Length = 1224

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 245 gccggcgaggccgccgccga 264
           ||||||||||||||||||||
Sbjct: 76  gccggcgaggccgccgccga 95



to top

>gb|AF531437.1| Streptomyces mobaraensis IFO13819 transglutaminase precursor, gene,
           complete cds
          Length = 1809

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 245 gccggcgaggccgccgccga 264
           ||||||||||||||||||||
Sbjct: 653 gccggcgaggccgccgccga 672



to top

>emb|AL591789.1|SME591789 Sinorhizobium meliloti 1021 complete chromosome; segment 8/12
          Length = 294800

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 398    gccgatggcgatgggcgcga 417
              ||||||||||||||||||||
Sbjct: 252331 gccgatggcgatgggcgcga 252350



to top

>emb|CR847515.10| Zebrafish DNA sequence from clone DKEYP-60A7 in linkage group 9, complete
              sequence
          Length = 153947

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 77     attcattcattcaaagcaaa 96
              ||||||||||||||||||||
Sbjct: 143356 attcattcattcaaagcaaa 143337



to top

>gb|AC012596.4| Homo sapiens BAC clone CTD-2523K17 from 7, complete sequence
          Length = 154859

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 72    gatggattcattcattcaaa 91
             ||||||||||||||||||||
Sbjct: 68036 gatggattcattcattcaaa 68017



to top

>gb|AY225468.1| Mus musculus interleukin 11 gene, promoter region and partial 5'UTR
          Length = 3811

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 152  cgggcgggcggggggcaggc 171
            ||||||||||||||||||||
Sbjct: 3619 cgggcgggcggggggcaggc 3600



to top

>emb|AL161740.16| Human DNA sequence from clone RP6-239D12 on chromosome 1p32.1-33
             Contains 3' end of the DAB1 gene for disabled homolog 1
             (Drosophila), a novel gene and the 5' end of a novel gene,
             complete sequence
          Length = 60856

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 72    gatggattcattcattcaaa 91
             ||||||||||||||||||||
Sbjct: 53885 gatggattcattcattcaaa 53904



to top

>gb|AC123518.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBb0088N01, complete sequence
          Length = 123954

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 244   cgccggcgaggccgccgccg 263
             ||||||||||||||||||||
Sbjct: 68770 cgccggcgaggccgccgccg 68751



to top

>emb|X63552.1|ATGTIPARA A.thaliana gene for tonoplast intrinsic protein gamma-TIP(Ara)
          Length = 1398

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 184  agtagtcggtggtggggagctgctcgtg 211
            ||||||| ||||| ||||||||||||||
Sbjct: 1203 agtagtctgtggttgggagctgctcgtg 1176



to top

>gb|AY059134.1| Arabidopsis thaliana putative aquaporin (At2g36830) mRNA, complete
           cds
          Length = 787

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 184 agtagtcggtggtggggagctgctcgtg 211
           ||||||| ||||| ||||||||||||||
Sbjct: 754 agtagtctgtggttgggagctgctcgtg 727



to top

>gb|AF370172.1| Arabidopsis thaliana putative tonoplast intrinsic protein gamma,
           aquaporin (At2g36830) mRNA, complete cds
          Length = 1030

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 184 agtagtcggtggtggggagctgctcgtg 211
           ||||||| ||||| ||||||||||||||
Sbjct: 812 agtagtctgtggttgggagctgctcgtg 785



to top

>gb|AF486513.1| Hordeum vulgare cultivar Yon M Kei GBSSI gene, promoter and 5'
           untranslated region
          Length = 1201

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 143 acggacggacgggcgggcgg 162
           ||||||||||||||||||||
Sbjct: 883 acggacggacgggcgggcgg 864



to top

>gb|AF486512.1| Hordeum vulgare cultivar CDC Alamo GBSSI gene, promoter and 5'
           untranslated region
          Length = 1197

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 143 acggacggacgggcgggcgg 162
           ||||||||||||||||||||
Sbjct: 884 acggacggacgggcgggcgg 865



to top

>gb|AF486508.1| Hordeum vulgare cultivar Oderbrucker GBSSI gene, promoter and 5'
           untranslated region
          Length = 1195

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 143 acggacggacgggcgggcgg 162
           ||||||||||||||||||||
Sbjct: 882 acggacggacgggcgggcgg 863



to top

>emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromosome 1, complete sequence
          Length = 4074542

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 245     gccggcgaggccgccgccga 264
               ||||||||||||||||||||
Sbjct: 2751481 gccggcgaggccgccgccga 2751462



to top

>emb|AJ289696.1|POC289696 Posidonia oceanica partial mRNA for putative aquaporin (aq1 gene)
          Length = 428

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 118/151 (78%)
 Strand = Plus / Minus

                                                                       
Query: 274 cgacccagtacacccactggtacccccactcccagctgacgagggcggggccgaaggaga 333
           |||||||||| ||||||||||   |||| | |||||| || | ||| || || ||||  |
Sbjct: 428 cgacccagtaaacccactggttaacccagttccagctcaccaaggcaggtccaaaggcca 369

                                                                       
Query: 334 cggcggggttcatggacgcgccggagaaggcgccgccgacnaggatgttggcgccgacga 393
           |||| ||||||||||| || |||| |||| | || ||| | | |||||||||  | || |
Sbjct: 368 cggcagggttcatggatgcaccggtgaagactcctccgtcgaagatgttggcagcaacaa 309

                                          
Query: 394 tgaagccgatggcgatgggcgcgatggtgcc 424
           | | ||||||||||| ||| ||||| |||||
Sbjct: 308 taaggccgatggcgaggggagcgatagtgcc 278



to top

>emb|BX897736.7| Zebrafish DNA sequence from clone CH211-181B15 in linkage group 17,
             complete sequence
          Length = 141987

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 70    gggatggattcattcattca 89
             ||||||||||||||||||||
Sbjct: 10001 gggatggattcattcattca 10020



to top

>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome
          Length = 5513844

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 245     gccggcgaggccgccgccga 264
               ||||||||||||||||||||
Sbjct: 3009661 gccggcgaggccgccgccga 3009642



to top

>gb|AE005901.1| Caulobacter crescentus CB15 section 227 of 359 of the complete genome
          Length = 11136

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 385  cgccgacgatgaagccgatg 404
            ||||||||||||||||||||
Sbjct: 8892 cgccgacgatgaagccgatg 8873



to top

>gb|AC023310.4| Homo sapiens chromosome 15, clone RP11-336L20, complete sequence
          Length = 177355

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 67    aatgggatggattcattcattcaa 90
             |||||||| |||||||||||||||
Sbjct: 47407 aatgggattgattcattcattcaa 47384



to top

>dbj|AK091454.1| Homo sapiens cDNA FLJ34135 fis, clone FCBBF3010695
          Length = 2613

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 242 gacgccggcgaggccgccgc 261
           ||||||||||||||||||||
Sbjct: 217 gacgccggcgaggccgccgc 198



to top

>tpg|BK001890.1| TPA: TPA_inf: Drosophila melanogaster HDC08154 (HDC08154) gene,
            complete cds
          Length = 1399

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 143  acggacggacgggcgggcgg 162
            ||||||||||||||||||||
Sbjct: 1381 acggacggacgggcgggcgg 1362



to top

>gb|CP000133.1| Rhizobium etli CFN 42, complete genome
          Length = 4381608

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 244   cgccggcgaggccgccgccg 263
             ||||||||||||||||||||
Sbjct: 76092 cgccggcgaggccgccgccg 76111



to top

>gb|CP000136.1| Rhizobium etli CFN 42 plasmid p42c, complete sequence
          Length = 250948

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 247    cggcgaggccgccgccgatg 266
              ||||||||||||||||||||
Sbjct: 121334 cggcgaggccgccgccgatg 121315



to top

>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome
          Length = 4967148

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 244     cgccggcgaggccgccgccg 263
               ||||||||||||||||||||
Sbjct: 3338605 cgccggcgaggccgccgccg 3338586



to top

>gb|AC006922.7| Arabidopsis thaliana chromosome 2 clone T1J8 map g6825, complete
            sequence
          Length = 134151

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 184  agtagtcggtggtggggagctgctcgtg 211
            ||||||| ||||| ||||||||||||||
Sbjct: 7513 agtagtctgtggttgggagctgctcgtg 7486



to top

>gb|AC005395.3| Arabidopsis thaliana chromosome 2 clone F17H15 map B68, complete
             sequence
          Length = 102004

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 43/51 (84%)
 Strand = Plus / Plus

                                                                
Query: 335   ggcggggttcatggacgcgccggagaaggcgccgccgacnaggatgttggc 385
             ||||||||||||||| ||||| || ||||| || ||  | |||||||||||
Sbjct: 62231 ggcggggttcatggaggcgccagaaaaggcacctcctgcaaggatgttggc 62281



to top

>dbj|AB118808.1| Hordeum vulgare subsp. spontaneum GBSSI gene for granule bound
           starch synthase I, complete cds, strain:OUH643
          Length = 5119

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 143 acggacggacgggcgggcgg 162
           ||||||||||||||||||||
Sbjct: 797 acggacggacgggcgggcgg 778



to top

>dbj|AB089162.1| Hordeum vulgare subsp. vulgare GBSSI gene for granule bound starch
           synthase I
          Length = 5190

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 143 acggacggacgggcgggcgg 162
           ||||||||||||||||||||
Sbjct: 822 acggacggacgggcgggcgg 803



to top

>dbj|AB088761.1| Hordeum vulgare subsp. vulgare GBSSI gene for granule bound starch
           synthase I, complete cds
          Length = 5190

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 143 acggacggacgggcgggcgg 162
           ||||||||||||||||||||
Sbjct: 822 acggacggacgggcgggcgg 803



to top

>gb|AC100757.2| Homo sapiens chromosome 15, clone RP11-566K19, complete sequence
          Length = 171987

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 67    aatgggatggattcattcattcaa 90
             |||||||| |||||||||||||||
Sbjct: 31404 aatgggattgattcattcattcaa 31381



to top

>gb|AC107487.1| Drosophila melanogaster 3L BAC RP98-10D20 (Roswell Park Cancer
             Institute Drosophila BAC Library) complete sequence
          Length = 170900

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 143   acggacggacgggcgggcgg 162
             ||||||||||||||||||||
Sbjct: 32025 acggacggacgggcgggcgg 32006



to top

>gb|DQ317109.1| Drosophila pseudoobscura Dscam gene, exons 3 through 24
          Length = 53864

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 247   cggcgaggccgccgccgatg 266
             ||||||||||||||||||||
Sbjct: 28501 cggcgaggccgccgccgatg 28520


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,760,963
Number of Sequences: 3902068
Number of extensions: 3760963
Number of successful extensions: 92613
Number of sequences better than 10.0: 301
Number of HSP's better than 10.0 without gapping: 303
Number of HSP's successfully gapped in prelim test: 3
Number of HSP's that attempted gapping in prelim test: 88986
Number of HSP's gapped (non-prelim): 3617
length of query: 434
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 412
effective length of database: 17,147,199,772
effective search space: 7064646306064
effective search space used: 7064646306064
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top