Clone Name | rbasd2k11 |
---|---|
Clone Library Name | barley_pub |
>gb|AC155651.4| Mus musculus 6 BAC RP24-111E13 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 175599 Score = 44.1 bits (22), Expect = 0.54 Identities = 22/22 (100%) Strand = Plus / Minus Query: 248 tgcgaacaagacagagccatgc 269 |||||||||||||||||||||| Sbjct: 50287 tgcgaacaagacagagccatgc 50266
>gb|AC158664.5| Mus musculus 6 BAC RP23-24F17 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 232894 Score = 44.1 bits (22), Expect = 0.54 Identities = 22/22 (100%) Strand = Plus / Plus Query: 248 tgcgaacaagacagagccatgc 269 |||||||||||||||||||||| Sbjct: 216736 tgcgaacaagacagagccatgc 216757
>emb|AL513443.1|NC93G11 Neurospora crassa DNA linkage group V Cosmid contig 93G11 Length = 86075 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Plus Query: 170 accgaaccatcattcatatcagtgc 194 ||||||||| ||||||||||||||| Sbjct: 15697 accgaaccaacattcatatcagtgc 15721
>gb|AY664414.1| Zea mays cultivar B73 locus 9008, complete sequence Length = 339089 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 306 ggaggcggggtctgcgggcgc 326 ||||||||||||||||||||| Sbjct: 89435 ggaggcggggtctgcgggcgc 89455
>gb|M95500.1|WHTWIR1APR Wheat WIR1A gene, complete cds Length = 842 Score = 42.1 bits (21), Expect = 2.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 507 gacgaanagagcgatctggaggagcacc 534 |||||| ||||||||||| ||||||||| Sbjct: 227 gacgaagagagcgatctgcaggagcacc 200
>ref|XM_547974.2| PREDICTED: Canis familiaris similar to CG32732-PA (LOC490852), mRNA Length = 2695 Score = 40.1 bits (20), Expect = 8.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 437 ccagagcaccaccaccgagtcctg 460 |||||||||||||||| ||||||| Sbjct: 2187 ccagagcaccaccacccagtcctg 2164
>gb|AC003988.1| Homo sapiens PAC clone RP5-1171L6 from 7, complete sequence Length = 58725 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 124 attttggcaaatactagatg 143 |||||||||||||||||||| Sbjct: 12357 attttggcaaatactagatg 12338
>emb|BX572600.1| Rhodopseudomonas palustris CGA009 complete genome; segment 8/16 Length = 349640 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 442 gcaccaccaccgagtcctgg 461 |||||||||||||||||||| Sbjct: 236096 gcaccaccaccgagtcctgg 236077
>gb|AF192304.6| Homo sapiens chromosome 8 clone CTC-458A3 map 8q24.3, complete sequence Length = 177028 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 117 catctttattttggcaaata 136 |||||||||||||||||||| Sbjct: 50205 catctttattttggcaaata 50186
>emb|AJ431203.1|NTO431203 Nicotiana tomentosiformis endogenous pararetrovirus partial proviral ORF3 & ORF4 pseudogenes Length = 1928 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 215 ggttcagtataagatcctga 234 |||||||||||||||||||| Sbjct: 620 ggttcagtataagatcctga 601 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,841,828 Number of Sequences: 3902068 Number of extensions: 3841828 Number of successful extensions: 80108 Number of sequences better than 10.0: 10 Number of HSP's better than 10.0 without gapping: 10 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 80090 Number of HSP's gapped (non-prelim): 18 length of query: 620 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 597 effective length of database: 17,143,297,704 effective search space: 10234548729288 effective search space used: 10234548729288 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)